Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


PLOD1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 [Homo sapiens (human)]

Gene Symbol PLOD1
Entrez Gene ID 5351
Full Name procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Synonyms EDS6, LH, LH1, LLH, PLOD
General protein information
Preferred Names
procollagen-lysine,2-oxoglutarate 5-dioxygenase 1
Names
procollagen-lysine,2-oxoglutarate 5-dioxygenase 1
lysine hydroxylase
lysyl hydroxlase 1
procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1
NP_000293.2
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

1

1p36.22

Summary Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

153454

Disorder Html: Ehlers-Danlos syndrome, type VI, 225400 (3); Nevo syndrome, 601451
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu59781 XM_011541593 PREDICTED: Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu59782 XM_011541594 PREDICTED: Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu18408 NM_000302 Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu59781D
Sequence Information ORF Nucleotide Sequence (Length: 2325bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
ATGCGGCCCC TGCTGCTACT GGCCCTGCTG GGCTGGCTGC TGCTGGCCGA AGCGAAGGGC 
GACGCCAAGC CGGAGGCCCC CTGTTGCCAA GAGGGCCTCA GAGCTGGTGG CTCTGGTTCT
CTTCACCTGG GGAGAGACTT CACCGTCCTG GCAGGAGCTC GGGGGAGCCC TTCCCCAAGT
GTGAGCAGCA TCCCTCGTTT CTGGATCCCA GGTTCAGACA ACCTTTTAGT CCTCACGGTG
GCCACTAAGG AGACCGAGGG ATTCCGTCGC TTCAAGCGCT CAGCTCAGTT CTTCAACTAC
AAGATCCAGG CGCTTGGCCT AGGGGAGGAC TGGAATGTGG AGAAGGGGAC GTCGGCAGGT
GGAGGGCAGA AGGTCCGGCT GCTGAAGAAA GCTCTGGAGA AGCACGCAGA CAAGGAGGAT
CTGGTCATTC TCTTCGCAGA CAGCTATGAC GTGCTGTTTG CATCGGGGCC CCGGGAGCTC
CTGAAGAAGT TCCGGCAGGC CAGGAGCCAG GTGGTCTTCT CTGCTGAGGA GCTCATCTAC
CCAGACCGCA GGCTGGAGAC CAAGTATCCG GTGGTGTCCG ATGGCAAGAG GTTCCTGGGC
TCTGGAGGCT TCATCGGTTA TGCCCCCAAC CTCAGCAAAC TGGTGGCCGA GTGGGAGGGC
CAGGACAGCG ACAGCGATCA GCTGTTTTAC ACCAAGATCT TCTTGGACCC GGAGAAGAGG
GAGCAGATCA ATATCACCCT GGACCACCGC TGCCGTATCT TCCAGAACCT GGATGGAGCC
TTGGATGAGG TCGTGCTCAA GTTTGAAATG GGCCATGTGA GAGCGAGGAA CCTGGCCTAT
GACACCCTCC CGGTCCTGAT CCATGGCAAC GGGCCAACCA AGCTGCAGTT GAACTACCTG
GGCAACTACA TCCCGCGCTT CTGGACCTTC GAAACAGGCT GCACCGTGTG TGACGAAGGC
TTGCGCAGCC TCAAGGGCAT TGGGGATGAA GCTCTGCCCA CGGTCCTGGT CGGCGTGTTC
ATCGAACAGC CCACGCCGTT TGTGTCCCTG TTCTTCCAGC GGCTCCTGCG GCTCCACTAC
CCCCAGAAAC ACATGCGACT TTTCATCCAC AACCACGAGC AGCACCACAA GGCTCAGGTG
GAAGAGTTCC TGGCACAGCA TGGCAGCGAG TACCAGTCTG TGAAGCTGGT GGGCCCTGAG
GTGCGGATGG CGAATGCAGA TGCCAGGAAC ATGGGCGCAG ACCTGTGCCG GCAGGACCGC
AGCTGCACCT ACTACTTCAG CGTGGATGCT GACGTGGCCC TGACCGAGCC CAACAGCCTG
CGGCTGCTGA TCCAACAGAA CAAGAACGTC ATTGCCCCGC TGATGACCCG GCATGGGAGG
CTGTGGTCGA ACTTCTGGGG GGCTCTCAGT GCAGATGGCT ACTATGCCCG TTCCGAGGAC
TACGTGGACA TTGTGCAGGG GCGGCGTGTT GGTGTCTGGA ATGTGCCCTA TATTTCAAAC
ATCTACTTGA TCAAGGGCAG TGCCCTGCGG GGTGAGCTGC AGTCCTCAGA TCTCTTCCAC
CACAGCAAGC TGGACCCCGA CATGGCCTTC TGTGCCAACA TCCGGCAGCA GGATGTGTTC
ATGTTCCTGA CCAACCGGCA CACCCTTGGC CATCTGCTCT CCCTAGACAG CTACCGCACC
ACCCACCTGC ACAACGACCT CTGGGAGGTG TTCAGCAACC CCGAGGACTG GAAGGAGAAG
TACATCCACC AGAACTACAC CAAAGCCCTG GCAGGGAAGC TGGTGGAGAC GCCCTGCCCG
GATGTCTATT GGTTCCCCAT CTTCACGGAG GTGGCCTGTG ATGAGCTGGT GGAGGAGATG
GAGCACTTTG GCCAGTGGTC TCTGGGCAAC AACAAGGACA ACCGCATCCA GGGTGGCTAC
GAGAACGTGC CGACTATTGA CATCCACATG AACCAGATCG GCTTTGAGCG GGAGTGGCAC
AAATTCCTGC TGGAGTACAT TGCGCCCATG ACGGAGAAGC TCTACCCCGG CTACTACACC
AGGGCCCAGT TTGACCTGGC CTTTGTCGTC CGCTACAAGC CTGATGAGCA GCCCTCACTG
ATGCCACACC ATGATGCCTC CACCTTCACC ATCAACATCG CCCTGAACCG AGTCGGGGTG
GATTACGAGG GCGGGGGCTG TCGGTTCCTG CGCTACAACT GTTCCATCCG AGCCCCAAGG
AAGGGCTGGA CCCTCATGCA CCCTGGACGA CTCACGCATT ACCATGAGGG GCTCCCCACC
ACCAGGGGCA CCCGCTACAT CGCAGTCTCC TTCGTCGATC CCTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_011539895.1
CDS50..2374
Misc Feature(1)1874..2365(+)
Translation
Position Chain Variation Link
5 5 c, t dbSNP:745989868
8 8 c, g dbSNP:751377124
11 11 g, t dbSNP:769995450
24 24 a, g dbSNP:567346111
49 49 c, g dbSNP:749523957
75 75 c, t dbSNP:754752318
101 101 a, g dbSNP:373165011
123 123 a, c dbSNP:774044489
130 130 -, ct dbSNP:755023329
143 143 a, g dbSNP:750942127
145 145 c, t dbSNP:756127228
146 146 c, t dbSNP:780128462
156 156 a, g dbSNP:749471041
158 158 a, g dbSNP:768905930
167 167 c, t dbSNP:778747566
173 173 c, t dbSNP:75220940
178 178 a, g dbSNP:772043000
179 179 a, g dbSNP:772958427
183 183 c, g dbSNP:760704322
184 184 a, g dbSNP:770520341
185 185 g, t dbSNP:776315809
193 193 c, t dbSNP:552200340
194 194 a, g dbSNP:764851668
196 196 c, t dbSNP:751944884
202 202 a, g dbSNP:373030736
209 209 c, t dbSNP:376231018
210 210 a, g dbSNP:112799470
211 211 a, g dbSNP:756644283
218 218 a, c dbSNP:576264625
222 222 -, c dbSNP:778889842
222 222 c, t dbSNP:534978828
223 223 c, g dbSNP:755180775
224 224 c, g dbSNP:779072214
227 227 a, c dbSNP:748408983
241 241 c, t dbSNP:78727544
245 245 c, g, t dbSNP:777648958
246 246 a, c, g dbSNP:568319180
258 258 a, c, t dbSNP:745434130
259 259 a, c dbSNP:774944869
264 264 c, t dbSNP:762687408
272 272 a, c dbSNP:776894307
276 276 c, t dbSNP:766724096
279 279 c, t dbSNP:777178486
285 285 c, t dbSNP:374597380
286 286 a, g dbSNP:765270896
289 289 a, g, t dbSNP:752778368
293 293 a, g dbSNP:148997434
295 295 -, t dbSNP:748066312
298 298 a, g dbSNP:751831236
299 299 a, g dbSNP:369263247
304 304 a, c, g, t dbSNP:11553679
305 305 a, c, g dbSNP:538407894
307 307 a, g dbSNP:779453447
308 308 a, g dbSNP:556718115
314 314 c, t dbSNP:202003686
315 315 a, g dbSNP:202116614
317 317 c, t dbSNP:778603432
318 318 a, g dbSNP:141704997
319 319 a, c dbSNP:771332500
322 322 c, t dbSNP:776947403
325 325 a, g dbSNP:765354146
326 326 c, t dbSNP:138698098
327 327 a, g dbSNP:142710681
328 328 c, t dbSNP:763163866
330 330 c, t dbSNP:764260254
343 343 c, g dbSNP:371961536
354 354 c, t dbSNP:762098276
360 360 c, g dbSNP:753862253
363 363 c, t dbSNP:754877185
366 366 c, g dbSNP:138106022
367 367 c, t dbSNP:34032489
369 369 c, t dbSNP:373927410
374 374 a, g dbSNP:146092290
383 383 a, t dbSNP:143604754
390 390 a, g dbSNP:756553633
391 391 c, g dbSNP:7551068
399 399 c, t dbSNP:780253192
400 400 a, g dbSNP:749845776
403 403 a, g dbSNP:769238622
406 406 a, t dbSNP:774587722
407 407 g, t dbSNP:748173461
409 409 g, t dbSNP:772274349
410 410 a, g dbSNP:773540306
412 412 a, g dbSNP:760785117
418 418 a, g dbSNP:766236123
427 427 g, t dbSNP:201579526
433 433 a, g dbSNP:371574381
440 440 a, c, g dbSNP:34878020
442 442 c, t dbSNP:765098815
457 457 a, g dbSNP:7541079
461 461 -, aag dbSNP:777435127
462 462 a, g dbSNP:752204392
466 466 a, g dbSNP:768169776
476 476 a, g dbSNP:763494719
484 484 c, t dbSNP:7529452
485 485 a, g dbSNP:7551175
491 491 a, g dbSNP:780490883
493 493 c, t dbSNP:147980436
497 497 a, g dbSNP:774590964
499 499 c, t dbSNP:750096749
500 500 a, g dbSNP:141809154
504 504 -, tgt dbSNP:770511543
505 505 a, g dbSNP:779398093
513 513 c, t dbSNP:549517196
516 516 a, g dbSNP:753296406
518 518 -, c dbSNP:776398739
518 518 c, t dbSNP:758789186
521 521 a, c dbSNP:772221158
522 522 a, g dbSNP:141767454
526 526 a, g dbSNP:746999816
542 542 c, t dbSNP:771186398
543 543 a, g dbSNP:781455578
544 544 a, g dbSNP:746072884
545 545 a, c dbSNP:769620321
548 548 g, t dbSNP:2273285
550 550 c, t dbSNP:762972277
553 553 c, g dbSNP:768422539
566 566 g, t dbSNP:144702307
596 596 c, t dbSNP:761296670
597 597 a, g dbSNP:148510973
601 601 a, g dbSNP:151122664
607 607 a, g dbSNP:750148215
618 618 c, t dbSNP:760372600
628 628 c, t dbSNP:765725567
639 639 a, c, g dbSNP:753061220
640 640 g, t dbSNP:778072657
641 641 a, t dbSNP:372628401
648 648 g, t dbSNP:757335356
649 649 c, t dbSNP:781221516
650 650 a, t dbSNP:746124510
651 651 c, t dbSNP:769958284
662 662 a, g dbSNP:147924545
665 665 a, g dbSNP:772861343
698 698 a, g dbSNP:780519821
699 699 a, t dbSNP:554232128
711 711 a, g dbSNP:770557607
718 718 c, t dbSNP:776200742
724 724 a, c, t dbSNP:113384442
725 725 a, c, g, t dbSNP:188165334
730 730 a, g dbSNP:35958757
732 732 c, t dbSNP:756245932
733 733 a, g dbSNP:766424893
740 740 a, c dbSNP:754048128
741 741 c, t dbSNP:755186588
745 745 g, t dbSNP:142978362
750 750 c, t dbSNP:747917838
754 754 -, ggaccc dbSNP:775053632
754 754 c, g dbSNP:201888323
757 757 c, t dbSNP:375364215
759 759 c, g, t dbSNP:375416784
760 760 a, g dbSNP:776173072
767 767 a, c dbSNP:569590633
772 772 c, g dbSNP:767195501
780 780 a, g dbSNP:750416079
791 791 a, g dbSNP:367575725
793 793 c, t dbSNP:201291374
797 797 c, t dbSNP:534314930
798 798 a, g dbSNP:145482271
803 803 c, g, t dbSNP:199990859
804 804 a, g, t dbSNP:536503346
807 807 c, t dbSNP:781376270
815 815 a, g dbSNP:746416126
827 827 a, g dbSNP:770147701
828 828 -, c dbSNP:36005914
828 828 c, t dbSNP:775720354
834 834 a, c dbSNP:760452720
838 838 a, g, t dbSNP:150852515
840 840 c, t dbSNP:776599201
841 841 c, t dbSNP:759435283
842 842 a, g, t dbSNP:372534520
858 858 c, t dbSNP:377072582
860 860 a, g dbSNP:763724588
867 867 c, t dbSNP:376643174
868 868 a, g dbSNP:371007185
873 873 c, t dbSNP:756600025
874 874 a, g dbSNP:183225496
892 892 c, g dbSNP:566018612
893 893 a, g dbSNP:535012522
896 896 a, c dbSNP:779066341
900 900 c, t dbSNP:748111731
901 901 a, g dbSNP:149566879
902 902 g, t dbSNP:777914756
905 905 c, t dbSNP:747209460
910 910 a, c dbSNP:770749842
916 916 c, t dbSNP:776366598
919 919 c, t dbSNP:567164584
920 920 a, g dbSNP:769659116
926 926 a, t dbSNP:775496572
930 930 a, g dbSNP:762431149
932 932 c, t dbSNP:763439166
937 937 g, t dbSNP:768989396
945 945 a, g dbSNP:774882355
949 949 a, g dbSNP:762271097
951 951 a, g dbSNP:767610828
953 953 a, g dbSNP:750459442
954 954 a, g dbSNP:538763801
963 963 c, t dbSNP:766692124
964 964 a, g dbSNP:753994916
966 966 a, g dbSNP:144226170
975 975 c, t dbSNP:147940796
978 978 g, t dbSNP:752711810
980 980 c, g dbSNP:758361490
984 984 c, g dbSNP:777431366
987 987 a, g dbSNP:558752942
989 989 c, t dbSNP:368132656
990 990 c, g, t dbSNP:780952856
992 992 a, g dbSNP:74354225
994 994 c, t dbSNP:140758113
995 995 a, g dbSNP:145447578
1003 1003 c, t dbSNP:373471550
1013 1013 c, t dbSNP:775565324
1014 1014 g, t dbSNP:184999645
1016 1016 a, g dbSNP:760869815
1020 1020 c, t dbSNP:766349712
1022 1022 a, c dbSNP:776949094
1023 1023 a, c, g dbSNP:543437537
1024 1024 a, g dbSNP:557353959
1026 1026 a, g dbSNP:758414759
1028 1028 a, g dbSNP:764158476
1029 1029 c, t dbSNP:199669594
1036 1036 c, t dbSNP:755620088
1043 1043 c, t dbSNP:370663808
1046 1046 c, t dbSNP:748920493
1048 1048 c, t dbSNP:145574708
1050 1050 c, t dbSNP:777957649
1051 1051 a, g dbSNP:747570972
1060 1060 c, t dbSNP:373082170
1061 1061 a, g dbSNP:776772692
1064 1064 a, g dbSNP:143114026
1072 1072 c, t dbSNP:747668784
1073 1073 a, g dbSNP:775902328
1084 1084 a, g dbSNP:763229200
1086 1086 c, t dbSNP:532145123
1087 1087 a, g dbSNP:199946373
1091 1091 a, g dbSNP:761815159
1093 1093 a, g dbSNP:767424651
1095 1095 a, c dbSNP:565765056
1100 1100 c, t dbSNP:760230526
1109 1109 c, g, t dbSNP:370736543
1111 1111 a, g dbSNP:754534604
1118 1118 c, t dbSNP:11553674
1120 1120 a, g dbSNP:751800110
1126 1126 c, t dbSNP:374787907
1137 1137 a, c dbSNP:141881216
1138 1138 a, g dbSNP:746354303
1141 1141 c, t dbSNP:770032875
1145 1145 c, t dbSNP:121913550
1146 1146 a, g, t dbSNP:749535965
1161 1161 a, g dbSNP:200524993
1165 1165 c, t dbSNP:761576315
1168 1168 a, g dbSNP:150627428
1175 1175 c, t dbSNP:147536755
1183 1183 c, t dbSNP:767051420
1187 1187 a, g dbSNP:754351882
1213 1213 c, t dbSNP:755056846
1216 1216 c, t dbSNP:140159343
1217 1217 a, g dbSNP:748344499
1221 1221 a, g, t dbSNP:200166434
1225 1225 a, g dbSNP:777545904
1227 1227 c, g dbSNP:746868590
1239 1239 c, t dbSNP:770695057
1245 1245 c, g dbSNP:776480771
1249 1249 a, c, g dbSNP:35656581
1252 1252 a, g dbSNP:769217332
1253 1253 c, t dbSNP:775007891
1254 1254 a, g dbSNP:370305686
1260 1260 c, t dbSNP:763906693
1261 1261 a, g dbSNP:374036329
1264 1264 a, t dbSNP:761174430
1280 1280 a, g dbSNP:766824430
1286 1286 a, g dbSNP:367592901
1286 1286 -, g dbSNP:758298439
1287 1287 c, t dbSNP:377080927
1293 1293 c, t dbSNP:753127125
1298 1298 c, g dbSNP:763065699
1299 1299 a, g, t dbSNP:574781992
1300 1300 a, g dbSNP:148644646
1305 1305 a, g dbSNP:377497101
1307 1307 a, c, t dbSNP:750301725
1320 1320 a, c dbSNP:754748178
1323 1323 a, g dbSNP:749210400
1324 1324 c, t dbSNP:768317167
1330 1330 c, t dbSNP:200131516
1331 1331 a, g dbSNP:2230896
1342 1342 c, t dbSNP:771685198
1343 1343 a, g dbSNP:371223839
1354 1354 c, t dbSNP:74949176
1355 1355 a, g dbSNP:373520363
1361 1361 a, g dbSNP:376235626
1362 1362 a, g dbSNP:763409574
1363 1363 c, g, t dbSNP:764179880
1366 1366 c, t dbSNP:761878111
1371 1371 a, g dbSNP:767839550
1372 1372 c, g dbSNP:144439284
1384 1384 a, g dbSNP:755978483
1385 1385 c, t dbSNP:779676937
1387 1387 a, g dbSNP:753853335
1396 1396 c, t dbSNP:1130529
1397 1397 a, g dbSNP:773517731
1400 1400 a, g dbSNP:755416195
1406 1406 c, g, t dbSNP:760764359
1407 1407 c, t dbSNP:753623016
1408 1408 a, g dbSNP:754812888
1418 1418 c, g, t dbSNP:559232378
1419 1419 a, g dbSNP:371001571
1424 1424 a, g dbSNP:777107202
1428 1428 a, g dbSNP:746696317
1433 1433 c, t dbSNP:756800628
1437 1437 c, t dbSNP:138586136
1445 1445 c, t dbSNP:373446893
1451 1451 g, t dbSNP:768987788
1454 1454 c, g dbSNP:774878639
1463 1463 c, g dbSNP:748565316
1471 1471 c, t dbSNP:143294623
1472 1472 g, t dbSNP:773110071
1478 1478 c, t dbSNP:370790682
1479 1479 a, g dbSNP:766778400
1482 1482 -, c dbSNP:761014653
1483 1483 c, t dbSNP:776976856
1492 1492 a, c, t dbSNP:759448456
1493 1493 a, g dbSNP:752708558
1511 1511 c, t dbSNP:11553676
1514 1514 c, t dbSNP:763672034
1515 1515 a, g dbSNP:199567720
1527 1527 -, g dbSNP:752741064
1541 1541 a, g dbSNP:759788811
1550 1550 a, g dbSNP:769732677
1554 1554 a, c dbSNP:373893146
1555 1555 c, t dbSNP:184406592
1556 1556 g, t dbSNP:764003497
1570 1570 c, t dbSNP:751492695
1573 1573 c, t dbSNP:761352973
1577 1577 c, t dbSNP:745946511
1578 1578 a, g dbSNP:750100311
1603 1603 c, t dbSNP:375032262
1610 1610 c, t dbSNP:755707958
1617 1617 a, g dbSNP:576907642
1618 1618 a, g dbSNP:139869965
1625 1625 c, t dbSNP:758780380
1627 1627 c, g, t dbSNP:367929166
1630 1630 c, t dbSNP:771162666
1646 1646 a, t dbSNP:781368673
1651 1651 c, t dbSNP:746099980
1652 1652 c, t dbSNP:770072937
1653 1653 a, g dbSNP:775776634
1663 1663 c, t dbSNP:139165192
1667 1667 c, t dbSNP:750942824
1670 1670 a, g dbSNP:144007935
1672 1672 c, g dbSNP:780133138
1685 1685 c, t dbSNP:149124387
1686 1686 a, g dbSNP:755162218
1692 1692 c, t dbSNP:779104605
1701 1701 a, g dbSNP:555034048
1723 1723 c, g dbSNP:121913552
1724 1724 c, t dbSNP:138490756
1725 1725 a, g dbSNP:773170096
1733 1733 c, t dbSNP:746905101
1735 1735 c, t dbSNP:146975823
1736 1736 c, t dbSNP:770368112
1739 1739 c, t dbSNP:776146504
1740 1740 a, c, g dbSNP:759113604
1742 1742 a, g dbSNP:775268631
1744 1744 c, g, t dbSNP:759491848
1745 1745 a, g dbSNP:750991056
1748 1748 c, t dbSNP:761187766
1750 1750 c, g, t dbSNP:543980683
1751 1751 -, g dbSNP:35625768
1756 1756 a, g dbSNP:755001757
1758 1758 c, t dbSNP:779159824
1759 1759 a, g dbSNP:752889171
1768 1768 a, c dbSNP:758701213
1771 1771 c, t dbSNP:142934642
1772 1772 a, g dbSNP:112250644
1775 1775 g, t dbSNP:779655041
1782 1782 -, agg dbSNP:757173694
1787 1787 a, c dbSNP:748954428
1792 1792 c, t dbSNP:768491146
1793 1793 a, c, g dbSNP:376017234
1795 1795 c, t dbSNP:771171842
1798 1798 c, t dbSNP:138289419
1801 1801 c, g dbSNP:759983190
1805 1805 c, t dbSNP:765311232
1806 1806 a, g dbSNP:775477980
1813 1813 a, c dbSNP:763014294
1819 1819 c, g dbSNP:764355890
1822 1822 a, c, t dbSNP:2230898
1824 1824 a, g dbSNP:767176963
1835 1835 g, t dbSNP:750387880
1839 1839 c, t dbSNP:748526375
1840 1840 a, g dbSNP:201999965
1848 1848 c, t dbSNP:754569828
1849 1849 a, g dbSNP:778242162
1855 1855 c, t dbSNP:747846409
1857 1857 a, g dbSNP:146360295
1862 1862 c, t dbSNP:552518372
1865 1865 c, t dbSNP:576500420
1868 1868 a, g dbSNP:369696269
1875 1875 c, t dbSNP:770120389
1876 1876 a, g dbSNP:565216977
1879 1879 a, g dbSNP:139230801
1882 1882 a, g dbSNP:768803999
1887 1887 a, g dbSNP:377325169
1892 1892 c, g dbSNP:761949919
1893 1893 a, t dbSNP:772242667
1896 1896 a, t dbSNP:773547480
1897 1897 a, g dbSNP:139468110
1898 1898 a, g dbSNP:370250187
1928 1928 c, t dbSNP:753853201
1931 1931 c, t dbSNP:759328881
1938 1938 a, g dbSNP:764804887
1950 1950 a, c dbSNP:756846064
1951 1951 c, g dbSNP:780818096
1952 1952 c, g, t dbSNP:367844314
1953 1953 a, g dbSNP:755346019
1960 1960 g, t dbSNP:779326156
1962 1962 a, g dbSNP:748646169
1969 1969 c, t dbSNP:758425988
1970 1970 a, g, t dbSNP:777937910
1975 1975 c, t dbSNP:771350321
1976 1976 a, g dbSNP:149654030
1978 1978 c, g, t dbSNP:35460537
1979 1979 c, t dbSNP:141692280
1980 1980 c, t dbSNP:775321665
1981 1981 a, c, g dbSNP:151051718
1984 1984 g, t dbSNP:773916889
1992 1992 c, t dbSNP:761299438
1996 1996 c, g, t dbSNP:546775471
1998 1998 c, t dbSNP:755326697
2000 2000 a, g dbSNP:765586163
2005 2005 a, g dbSNP:753155562
2006 2006 a, t dbSNP:758904956
2008 2008 a, c, t dbSNP:372579008
2009 2009 a, g, t dbSNP:757393804
2012 2012 a, t dbSNP:746064243
2018 2018 c, t dbSNP:769499769
2019 2019 a, g dbSNP:150184664
2023 2023 a, g dbSNP:749187050
2026 2026 c, g dbSNP:121913553
2029 2029 a, c dbSNP:768638113
2052 2052 c, t dbSNP:774249367
2054 2054 c, t dbSNP:761352524
2055 2055 c, t dbSNP:766973023
2056 2056 c, t dbSNP:772758944
2061 2061 c, g, t dbSNP:760314787
2068 2068 a, g dbSNP:201112464
2074 2074 a, c dbSNP:758826887
2078 2078 a, g dbSNP:764750668
2082 2082 a, g dbSNP:752084194
2085 2085 a, g dbSNP:757445322
2095 2095 c, g dbSNP:779912763
2116 2116 c, t dbSNP:763454814
2117 2117 a, g dbSNP:149425237
2119 2119 a, c dbSNP:752137195
2120 2120 c, t dbSNP:576416937
2121 2121 c, g dbSNP:767500051
2122 2122 c, t dbSNP:11553677
2128 2128 c, g dbSNP:11553672
2131 2131 a, t dbSNP:750583085
2135 2135 a, g dbSNP:756124891
2148 2148 g, t dbSNP:780363756
2152 2152 g, t dbSNP:3177759
2158 2158 c, t dbSNP:545485217
2169 2169 c, t dbSNP:754787633
2176 2176 c, t dbSNP:778619786
2188 2188 c, t dbSNP:748080300
2189 2189 a, g dbSNP:199730384
2191 2191 c, t dbSNP:777554498
2194 2194 g, t dbSNP:746583661
2198 2198 c, t dbSNP:121913554
2203 2203 c, t dbSNP:541261242
2204 2204 a, g dbSNP:759217354
2209 2209 c, g dbSNP:769156857
2221 2221 c, t dbSNP:757078518
2222 2222 a, g dbSNP:121913551
2224 2224 a, g dbSNP:183218776
2226 2226 g, t dbSNP:201625707
2232 2232 a, g dbSNP:755654001
2234 2234 a, t dbSNP:779884038
2240 2240 c, t dbSNP:748841458
2241 2241 a, g dbSNP:772498138
2243 2243 c, t dbSNP:529774961
2247 2247 a, g dbSNP:747393648
2258 2258 c, t dbSNP:373094220
2262 2262 c, t dbSNP:777096767
2265 2265 c, t dbSNP:557317492
2280 2280 -, ca dbSNP:778205353
2285 2285 a, g dbSNP:142916043
2289 2289 a, g dbSNP:773756799
2298 2298 a, g dbSNP:775807168
2302 2302 c, t dbSNP:763030551
2304 2304 c, t dbSNP:377406897
2305 2305 a, g dbSNP:751380359
2314 2314 c, t dbSNP:879690
2321 2321 c, t dbSNP:767613444
2323 2323 c, g dbSNP:879691
2324 2324 c, g dbSNP:762440021
2326 2326 a, c dbSNP:755707390
2329 2329 a, c dbSNP:779651224
2331 2331 c, t dbSNP:370498584
2342 2342 c, t dbSNP:754650948
2343 2343 a, g dbSNP:187909486
2347 2347 c, t dbSNP:145293802
2348 2348 a, g dbSNP:747378023
2350 2350 c, t dbSNP:140513387
2351 2351 g, t dbSNP:781689639
2352 2352 c, t dbSNP:149161535
2363 2363 a, c, g, t dbSNP:151247380
2365 2365 c, t dbSNP:768818916
2366 2366 a, g dbSNP:774611185
2371 2371 c, t dbSNP:140741046
2374 2374 a, g dbSNP:767372151
2378 2378 a, g dbSNP:750397415
2381 2381 a, c dbSNP:760621897
2383 2383 a, g dbSNP:369501908
2388 2388 a, g dbSNP:201169472
2391 2391 c, g dbSNP:753343984
2393 2393 c, t dbSNP:754484912
2413 2413 c, t dbSNP:778467079
2414 2414 a, g dbSNP:145873083
2423 2423 c, t dbSNP:757645346
2424 2424 -, cc dbSNP:747566822
2425 2425 c, t dbSNP:781480166
2445 2445 c, g dbSNP:2230899
2509 2509 a, g dbSNP:548198470
2548 2548 a, g dbSNP:138612687
2577 2577 a, g dbSNP:765780712
2609 2609 a, g dbSNP:750820355
2617 2617 c, t dbSNP:758794193
2637 2637 a, g dbSNP:373050647
2640 2640 c, t dbSNP:754702690
2699 2699 a, g dbSNP:537155991
2730 2730 c, t dbSNP:767162156
2744 2744 a, t dbSNP:766727378
2759 2759 c, t dbSNP:752156481
2782 2782 c, g dbSNP:551103869
2798 2798 -, gggacttctgcttcaagttttg dbSNP:202209753
2805 2805 c, t dbSNP:11553673
2814 2814 c, g dbSNP:11553681
2916 2916 a, g dbSNP:577834357
2921 2921 c, g dbSNP:1063393
2940 2940 c, g dbSNP:540068101
2957 2957 c, g dbSNP:191227335
2973 2973 c, t dbSNP:1049519
2988 2988 g, t dbSNP:15431
2995 2995 a, g dbSNP:534573017
3012 3012 c, t dbSNP:554620655
3044 3044 a, c dbSNP:1804187
3053 3053 g, t dbSNP:574433935
3063 3063 a, g dbSNP:184470121
3095 3095 g, t dbSNP:142707437
3104 3104 a, c dbSNP:112280868
3105 3105 a, t dbSNP:112041336

Target ORF information:

RefSeq Version XM_011541593
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
XM_011541593

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
ATGCGGCCCC TGCTGCTACT GGCCCTGCTG GGCTGGCTGC TGCTGGCCGA AGCGAAGGGC 
GACGCCAAGC CGGAGGCCCC CTGTTGCCAA GAGGGCCTCA GAGCTGGTGG CTCTGGTTCT
CTTCACCTGG GGAGAGACTT CACCGTCCTG GCAGGAGCTC GGGGGAGCCC TTCCCCAAGT
GTGAGCAGCA TCCCTCGTTT CTGGATCCCA GGTTCAGACA ACCTTTTAGT CCTCACGGTG
GCCACTAAGG AGACCGAGGG ATTCCGTCGC TTCAAGCGCT CAGCTCAGTT CTTCAACTAC
AAGATCCAGG CGCTTGGCCT AGGGGAGGAC TGGAATGTGG AGAAGGGGAC GTCGGCAGGT
GGAGGGCAGA AGGTCCGGCT GCTGAAGAAA GCTCTGGAGA AGCACGCAGA CAAGGAGGAT
CTGGTCATTC TCTTCGCAGA CAGCTATGAC GTGCTGTTTG CATCGGGGCC CCGGGAGCTC
CTGAAGAAGT TCCGGCAGGC CAGGAGCCAG GTGGTCTTCT CTGCTGAGGA GCTCATCTAC
CCAGACCGCA GGCTGGAGAC CAAGTATCCG GTGGTGTCCG ATGGCAAGAG GTTCCTGGGC
TCTGGAGGCT TCATCGGTTA TGCCCCCAAC CTCAGCAAAC TGGTGGCCGA GTGGGAGGGC
CAGGACAGCG ACAGCGATCA GCTGTTTTAC ACCAAGATCT TCTTGGACCC GGAGAAGAGG
GAGCAGATCA ATATCACCCT GGACCACCGC TGCCGTATCT TCCAGAACCT GGATGGAGCC
TTGGATGAGG TCGTGCTCAA GTTTGAAATG GGCCATGTGA GAGCGAGGAA CCTGGCCTAT
GACACCCTCC CGGTCCTGAT CCATGGCAAC GGGCCAACCA AGCTGCAGTT GAACTACCTG
GGCAACTACA TCCCGCGCTT CTGGACCTTC GAAACAGGCT GCACCGTGTG TGACGAAGGC
TTGCGCAGCC TCAAGGGCAT TGGGGATGAA GCTCTGCCCA CGGTCCTGGT CGGCGTGTTC
ATCGAACAGC CCACGCCGTT TGTGTCCCTG TTCTTCCAGC GGCTCCTGCG GCTCCACTAC
CCCCAGAAAC ACATGCGACT TTTCATCCAC AACCACGAGC AGCACCACAA GGCTCAGGTG
GAAGAGTTCC TGGCACAGCA TGGCAGCGAG TACCAGTCTG TGAAGCTGGT GGGCCCTGAG
GTGCGGATGG CGAATGCAGA TGCCAGGAAC ATGGGCGCAG ACCTGTGCCG GCAGGACCGC
AGCTGCACCT ACTACTTCAG CGTGGATGCT GACGTGGCCC TGACCGAGCC CAACAGCCTG
CGGCTGCTGA TCCAACAGAA CAAGAACGTC ATTGCCCCGC TGATGACCCG GCATGGGAGG
CTGTGGTCGA ACTTCTGGGG GGCTCTCAGT GCAGATGGCT ACTATGCCCG TTCCGAGGAC
TACGTGGACA TTGTGCAGGG GCGGCGTGTT GGTGTCTGGA ATGTGCCCTA TATTTCAAAC
ATCTACTTGA TCAAGGGCAG TGCCCTGCGG GGTGAGCTGC AGTCCTCAGA TCTCTTCCAC
CACAGCAAGC TGGACCCCGA CATGGCCTTC TGTGCCAACA TCCGGCAGCA GGATGTGTTC
ATGTTCCTGA CCAACCGGCA CACCCTTGGC CATCTGCTCT CCCTAGACAG CTACCGCACC
ACCCACCTGC ACAACGACCT CTGGGAGGTG TTCAGCAACC CCGAGGACTG GAAGGAGAAG
TACATCCACC AGAACTACAC CAAAGCCCTG GCAGGGAAGC TGGTGGAGAC GCCCTGCCCG
GATGTCTATT GGTTCCCCAT CTTCACGGAG GTGGCCTGTG ATGAGCTGGT GGAGGAGATG
GAGCACTTTG GCCAGTGGTC TCTGGGCAAC AACAAGGACA ACCGCATCCA GGGTGGCTAC
GAGAACGTGC CGACTATTGA CATCCACATG AACCAGATCG GCTTTGAGCG GGAGTGGCAC
AAATTCCTGC TGGAGTACAT TGCGCCCATG ACGGAGAAGC TCTACCCCGG CTACTACACC
AGGGCCCAGT TTGACCTGGC CTTTGTCGTC CGCTACAAGC CTGATGAGCA GCCCTCACTG
ATGCCACACC ATGATGCCTC CACCTTCACC ATCAACATCG CCCTGAACCG AGTCGGGGTG
GATTACGAGG GCGGGGGCTG TCGGTTCCTG CGCTACAACT GTTCCATCCG AGCCCCAAGG
AAGGGCTGGA CCCTCATGCA CCCTGGACGA CTCACGCATT ACCATGAGGG GCTCCCCACC
ACCAGGGGCA CCCGCTACAT CGCAGTCTCC TTCGTCGATC CCTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu59782D
Sequence Information ORF Nucleotide Sequence (Length: 2265bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
ATGATGAAGC CCGCAGCCCC CTGTTGCCAA GAGGGCCTCA GAGCTGGTGG CTCTGGTTCT 
CTTCACCTGG GGAGAGACTT CACCGTCCTG GCAGGAGCTC GGGGGAGCCC TTCCCCAAGT
GTGAGCAGCA TCCCTCGTTT CTGGATCCCA GGTTCAGACA ACCTTTTAGT CCTCACGGTG
GCCACTAAGG AGACCGAGGG ATTCCGTCGC TTCAAGCGCT CAGCTCAGTT CTTCAACTAC
AAGATCCAGG CGCTTGGCCT AGGGGAGGAC TGGAATGTGG AGAAGGGGAC GTCGGCAGGT
GGAGGGCAGA AGGTCCGGCT GCTGAAGAAA GCTCTGGAGA AGCACGCAGA CAAGGAGGAT
CTGGTCATTC TCTTCGCAGA CAGCTATGAC GTGCTGTTTG CATCGGGGCC CCGGGAGCTC
CTGAAGAAGT TCCGGCAGGC CAGGAGCCAG GTGGTCTTCT CTGCTGAGGA GCTCATCTAC
CCAGACCGCA GGCTGGAGAC CAAGTATCCG GTGGTGTCCG ATGGCAAGAG GTTCCTGGGC
TCTGGAGGCT TCATCGGTTA TGCCCCCAAC CTCAGCAAAC TGGTGGCCGA GTGGGAGGGC
CAGGACAGCG ACAGCGATCA GCTGTTTTAC ACCAAGATCT TCTTGGACCC GGAGAAGAGG
GAGCAGATCA ATATCACCCT GGACCACCGC TGCCGTATCT TCCAGAACCT GGATGGAGCC
TTGGATGAGG TCGTGCTCAA GTTTGAAATG GGCCATGTGA GAGCGAGGAA CCTGGCCTAT
GACACCCTCC CGGTCCTGAT CCATGGCAAC GGGCCAACCA AGCTGCAGTT GAACTACCTG
GGCAACTACA TCCCGCGCTT CTGGACCTTC GAAACAGGCT GCACCGTGTG TGACGAAGGC
TTGCGCAGCC TCAAGGGCAT TGGGGATGAA GCTCTGCCCA CGGTCCTGGT CGGCGTGTTC
ATCGAACAGC CCACGCCGTT TGTGTCCCTG TTCTTCCAGC GGCTCCTGCG GCTCCACTAC
CCCCAGAAAC ACATGCGACT TTTCATCCAC AACCACGAGC AGCACCACAA GGCTCAGGTG
GAAGAGTTCC TGGCACAGCA TGGCAGCGAG TACCAGTCTG TGAAGCTGGT GGGCCCTGAG
GTGCGGATGG CGAATGCAGA TGCCAGGAAC ATGGGCGCAG ACCTGTGCCG GCAGGACCGC
AGCTGCACCT ACTACTTCAG CGTGGATGCT GACGTGGCCC TGACCGAGCC CAACAGCCTG
CGGCTGCTGA TCCAACAGAA CAAGAACGTC ATTGCCCCGC TGATGACCCG GCATGGGAGG
CTGTGGTCGA ACTTCTGGGG GGCTCTCAGT GCAGATGGCT ACTATGCCCG TTCCGAGGAC
TACGTGGACA TTGTGCAGGG GCGGCGTGTT GGTGTCTGGA ATGTGCCCTA TATTTCAAAC
ATCTACTTGA TCAAGGGCAG TGCCCTGCGG GGTGAGCTGC AGTCCTCAGA TCTCTTCCAC
CACAGCAAGC TGGACCCCGA CATGGCCTTC TGTGCCAACA TCCGGCAGCA GGATGTGTTC
ATGTTCCTGA CCAACCGGCA CACCCTTGGC CATCTGCTCT CCCTAGACAG CTACCGCACC
ACCCACCTGC ACAACGACCT CTGGGAGGTG TTCAGCAACC CCGAGGACTG GAAGGAGAAG
TACATCCACC AGAACTACAC CAAAGCCCTG GCAGGGAAGC TGGTGGAGAC GCCCTGCCCG
GATGTCTATT GGTTCCCCAT CTTCACGGAG GTGGCCTGTG ATGAGCTGGT GGAGGAGATG
GAGCACTTTG GCCAGTGGTC TCTGGGCAAC AACAAGGACA ACCGCATCCA GGGTGGCTAC
GAGAACGTGC CGACTATTGA CATCCACATG AACCAGATCG GCTTTGAGCG GGAGTGGCAC
AAATTCCTGC TGGAGTACAT TGCGCCCATG ACGGAGAAGC TCTACCCCGG CTACTACACC
AGGGCCCAGT TTGACCTGGC CTTTGTCGTC CGCTACAAGC CTGATGAGCA GCCCTCACTG
ATGCCACACC ATGATGCCTC CACCTTCACC ATCAACATCG CCCTGAACCG AGTCGGGGTG
GATTACGAGG GCGGGGGCTG TCGGTTCCTG CGCTACAACT GTTCCATCCG AGCCCCAAGG
AAGGGCTGGA CCCTCATGCA CCCTGGACGA CTCACGCATT ACCATGAGGG GCTCCCCACC
ACCAGGGGCA CCCGCTACAT CGCAGTCTCC TTCGTCGATC CCTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_011539896.1
CDS13..2277
Misc Feature(1)1777..2268(+)
Translation
Position Chain Variation Link
24 24 c, t dbSNP:564066509
28 28 g, t dbSNP:781613275
33 33 -, ct dbSNP:755023329
46 46 a, g dbSNP:750942127
48 48 c, t dbSNP:756127228
49 49 c, t dbSNP:780128462
59 59 a, g dbSNP:749471041
61 61 a, g dbSNP:768905930
70 70 c, t dbSNP:778747566
76 76 c, t dbSNP:75220940
81 81 a, g dbSNP:772043000
82 82 a, g dbSNP:772958427
86 86 c, g dbSNP:760704322
87 87 a, g dbSNP:770520341
88 88 g, t dbSNP:776315809
96 96 c, t dbSNP:552200340
97 97 a, g dbSNP:764851668
99 99 c, t dbSNP:751944884
105 105 a, g dbSNP:373030736
112 112 c, t dbSNP:376231018
113 113 a, g dbSNP:112799470
114 114 a, g dbSNP:756644283
121 121 a, c dbSNP:576264625
125 125 -, c dbSNP:778889842
125 125 c, t dbSNP:534978828
126 126 c, g dbSNP:755180775
127 127 c, g dbSNP:779072214
130 130 a, c dbSNP:748408983
144 144 c, t dbSNP:78727544
148 148 c, g, t dbSNP:777648958
149 149 a, c, g dbSNP:568319180
161 161 a, c, t dbSNP:745434130
162 162 a, c dbSNP:774944869
167 167 c, t dbSNP:762687408
175 175 a, c dbSNP:776894307
179 179 c, t dbSNP:766724096
182 182 c, t dbSNP:777178486
188 188 c, t dbSNP:374597380
189 189 a, g dbSNP:765270896
192 192 a, g, t dbSNP:752778368
196 196 a, g dbSNP:148997434
198 198 -, t dbSNP:748066312
201 201 a, g dbSNP:751831236
202 202 a, g dbSNP:369263247
207 207 a, c, g, t dbSNP:11553679
208 208 a, c, g dbSNP:538407894
210 210 a, g dbSNP:779453447
211 211 a, g dbSNP:556718115
217 217 c, t dbSNP:202003686
218 218 a, g dbSNP:202116614
220 220 c, t dbSNP:778603432
221 221 a, g dbSNP:141704997
222 222 a, c dbSNP:771332500
225 225 c, t dbSNP:776947403
228 228 a, g dbSNP:765354146
229 229 c, t dbSNP:138698098
230 230 a, g dbSNP:142710681
231 231 c, t dbSNP:763163866
233 233 c, t dbSNP:764260254
246 246 c, g dbSNP:371961536
257 257 c, t dbSNP:762098276
263 263 c, g dbSNP:753862253
266 266 c, t dbSNP:754877185
269 269 c, g dbSNP:138106022
270 270 c, t dbSNP:34032489
272 272 c, t dbSNP:373927410
277 277 a, g dbSNP:146092290
286 286 a, t dbSNP:143604754
293 293 a, g dbSNP:756553633
294 294 c, g dbSNP:7551068
302 302 c, t dbSNP:780253192
303 303 a, g dbSNP:749845776
306 306 a, g dbSNP:769238622
309 309 a, t dbSNP:774587722
310 310 g, t dbSNP:748173461
312 312 g, t dbSNP:772274349
313 313 a, g dbSNP:773540306
315 315 a, g dbSNP:760785117
321 321 a, g dbSNP:766236123
330 330 g, t dbSNP:201579526
336 336 a, g dbSNP:371574381
343 343 a, c, g dbSNP:34878020
345 345 c, t dbSNP:765098815
360 360 a, g dbSNP:7541079
364 364 -, aag dbSNP:777435127
365 365 a, g dbSNP:752204392
369 369 a, g dbSNP:768169776
379 379 a, g dbSNP:763494719
387 387 c, t dbSNP:7529452
388 388 a, g dbSNP:7551175
394 394 a, g dbSNP:780490883
396 396 c, t dbSNP:147980436
400 400 a, g dbSNP:774590964
402 402 c, t dbSNP:750096749
403 403 a, g dbSNP:141809154
407 407 -, tgt dbSNP:770511543
408 408 a, g dbSNP:779398093
416 416 c, t dbSNP:549517196
419 419 a, g dbSNP:753296406
421 421 -, c dbSNP:776398739
421 421 c, t dbSNP:758789186
424 424 a, c dbSNP:772221158
425 425 a, g dbSNP:141767454
429 429 a, g dbSNP:746999816
445 445 c, t dbSNP:771186398
446 446 a, g dbSNP:781455578
447 447 a, g dbSNP:746072884
448 448 a, c dbSNP:769620321
451 451 g, t dbSNP:2273285
453 453 c, t dbSNP:762972277
456 456 c, g dbSNP:768422539
469 469 g, t dbSNP:144702307
499 499 c, t dbSNP:761296670
500 500 a, g dbSNP:148510973
504 504 a, g dbSNP:151122664
510 510 a, g dbSNP:750148215
521 521 c, t dbSNP:760372600
531 531 c, t dbSNP:765725567
542 542 a, c, g dbSNP:753061220
543 543 g, t dbSNP:778072657
544 544 a, t dbSNP:372628401
551 551 g, t dbSNP:757335356
552 552 c, t dbSNP:781221516
553 553 a, t dbSNP:746124510
554 554 c, t dbSNP:769958284
565 565 a, g dbSNP:147924545
568 568 a, g dbSNP:772861343
601 601 a, g dbSNP:780519821
602 602 a, t dbSNP:554232128
614 614 a, g dbSNP:770557607
621 621 c, t dbSNP:776200742
627 627 a, c, t dbSNP:113384442
628 628 a, c, g, t dbSNP:188165334
633 633 a, g dbSNP:35958757
635 635 c, t dbSNP:756245932
636 636 a, g dbSNP:766424893
643 643 a, c dbSNP:754048128
644 644 c, t dbSNP:755186588
648 648 g, t dbSNP:142978362
653 653 c, t dbSNP:747917838
657 657 -, ggaccc dbSNP:775053632
657 657 c, g dbSNP:201888323
660 660 c, t dbSNP:375364215
662 662 c, g, t dbSNP:375416784
663 663 a, g dbSNP:776173072
670 670 a, c dbSNP:569590633
675 675 c, g dbSNP:767195501
683 683 a, g dbSNP:750416079
694 694 a, g dbSNP:367575725
696 696 c, t dbSNP:201291374
700 700 c, t dbSNP:534314930
701 701 a, g dbSNP:145482271
706 706 c, g, t dbSNP:199990859
707 707 a, g, t dbSNP:536503346
710 710 c, t dbSNP:781376270
718 718 a, g dbSNP:746416126
730 730 a, g dbSNP:770147701
731 731 -, c dbSNP:36005914
731 731 c, t dbSNP:775720354
737 737 a, c dbSNP:760452720
741 741 a, g, t dbSNP:150852515
743 743 c, t dbSNP:776599201
744 744 c, t dbSNP:759435283
745 745 a, g, t dbSNP:372534520
761 761 c, t dbSNP:377072582
763 763 a, g dbSNP:763724588
770 770 c, t dbSNP:376643174
771 771 a, g dbSNP:371007185
776 776 c, t dbSNP:756600025
777 777 a, g dbSNP:183225496
795 795 c, g dbSNP:566018612
796 796 a, g dbSNP:535012522
799 799 a, c dbSNP:779066341
803 803 c, t dbSNP:748111731
804 804 a, g dbSNP:149566879
805 805 g, t dbSNP:777914756
808 808 c, t dbSNP:747209460
813 813 a, c dbSNP:770749842
819 819 c, t dbSNP:776366598
822 822 c, t dbSNP:567164584
823 823 a, g dbSNP:769659116
829 829 a, t dbSNP:775496572
833 833 a, g dbSNP:762431149
835 835 c, t dbSNP:763439166
840 840 g, t dbSNP:768989396
848 848 a, g dbSNP:774882355
852 852 a, g dbSNP:762271097
854 854 a, g dbSNP:767610828
856 856 a, g dbSNP:750459442
857 857 a, g dbSNP:538763801
866 866 c, t dbSNP:766692124
867 867 a, g dbSNP:753994916
869 869 a, g dbSNP:144226170
878 878 c, t dbSNP:147940796
881 881 g, t dbSNP:752711810
883 883 c, g dbSNP:758361490
887 887 c, g dbSNP:777431366
890 890 a, g dbSNP:558752942
892 892 c, t dbSNP:368132656
893 893 c, g, t dbSNP:780952856
895 895 a, g dbSNP:74354225
897 897 c, t dbSNP:140758113
898 898 a, g dbSNP:145447578
906 906 c, t dbSNP:373471550
916 916 c, t dbSNP:775565324
917 917 g, t dbSNP:184999645
919 919 a, g dbSNP:760869815
923 923 c, t dbSNP:766349712
925 925 a, c dbSNP:776949094
926 926 a, c, g dbSNP:543437537
927 927 a, g dbSNP:557353959
929 929 a, g dbSNP:758414759
931 931 a, g dbSNP:764158476
932 932 c, t dbSNP:199669594
939 939 c, t dbSNP:755620088
946 946 c, t dbSNP:370663808
949 949 c, t dbSNP:748920493
951 951 c, t dbSNP:145574708
953 953 c, t dbSNP:777957649
954 954 a, g dbSNP:747570972
963 963 c, t dbSNP:373082170
964 964 a, g dbSNP:776772692
967 967 a, g dbSNP:143114026
975 975 c, t dbSNP:747668784
976 976 a, g dbSNP:775902328
987 987 a, g dbSNP:763229200
989 989 c, t dbSNP:532145123
990 990 a, g dbSNP:199946373
994 994 a, g dbSNP:761815159
996 996 a, g dbSNP:767424651
998 998 a, c dbSNP:565765056
1003 1003 c, t dbSNP:760230526
1012 1012 c, g, t dbSNP:370736543
1014 1014 a, g dbSNP:754534604
1021 1021 c, t dbSNP:11553674
1023 1023 a, g dbSNP:751800110
1029 1029 c, t dbSNP:374787907
1040 1040 a, c dbSNP:141881216
1041 1041 a, g dbSNP:746354303
1044 1044 c, t dbSNP:770032875
1048 1048 c, t dbSNP:121913550
1049 1049 a, g, t dbSNP:749535965
1064 1064 a, g dbSNP:200524993
1068 1068 c, t dbSNP:761576315
1071 1071 a, g dbSNP:150627428
1078 1078 c, t dbSNP:147536755
1086 1086 c, t dbSNP:767051420
1090 1090 a, g dbSNP:754351882
1116 1116 c, t dbSNP:755056846
1119 1119 c, t dbSNP:140159343
1120 1120 a, g dbSNP:748344499
1124 1124 a, g, t dbSNP:200166434
1128 1128 a, g dbSNP:777545904
1130 1130 c, g dbSNP:746868590
1142 1142 c, t dbSNP:770695057
1148 1148 c, g dbSNP:776480771
1152 1152 a, c, g dbSNP:35656581
1155 1155 a, g dbSNP:769217332
1156 1156 c, t dbSNP:775007891
1157 1157 a, g dbSNP:370305686
1163 1163 c, t dbSNP:763906693
1164 1164 a, g dbSNP:374036329
1167 1167 a, t dbSNP:761174430
1183 1183 a, g dbSNP:766824430
1189 1189 a, g dbSNP:367592901
1189 1189 -, g dbSNP:758298439
1190 1190 c, t dbSNP:377080927
1196 1196 c, t dbSNP:753127125
1201 1201 c, g dbSNP:763065699
1202 1202 a, g, t dbSNP:574781992
1203 1203 a, g dbSNP:148644646
1208 1208 a, g dbSNP:377497101
1210 1210 a, c, t dbSNP:750301725
1223 1223 a, c dbSNP:754748178
1226 1226 a, g dbSNP:749210400
1227 1227 c, t dbSNP:768317167
1233 1233 c, t dbSNP:200131516
1234 1234 a, g dbSNP:2230896
1245 1245 c, t dbSNP:771685198
1246 1246 a, g dbSNP:371223839
1257 1257 c, t dbSNP:74949176
1258 1258 a, g dbSNP:373520363
1264 1264 a, g dbSNP:376235626
1265 1265 a, g dbSNP:763409574
1266 1266 c, g, t dbSNP:764179880
1269 1269 c, t dbSNP:761878111
1274 1274 a, g dbSNP:767839550
1275 1275 c, g dbSNP:144439284
1287 1287 a, g dbSNP:755978483
1288 1288 c, t dbSNP:779676937
1290 1290 a, g dbSNP:753853335
1299 1299 c, t dbSNP:1130529
1300 1300 a, g dbSNP:773517731
1303 1303 a, g dbSNP:755416195
1309 1309 c, g, t dbSNP:760764359
1310 1310 c, t dbSNP:753623016
1311 1311 a, g dbSNP:754812888
1321 1321 c, g, t dbSNP:559232378
1322 1322 a, g dbSNP:371001571
1327 1327 a, g dbSNP:777107202
1331 1331 a, g dbSNP:746696317
1336 1336 c, t dbSNP:756800628
1340 1340 c, t dbSNP:138586136
1348 1348 c, t dbSNP:373446893
1354 1354 g, t dbSNP:768987788
1357 1357 c, g dbSNP:774878639
1366 1366 c, g dbSNP:748565316
1374 1374 c, t dbSNP:143294623
1375 1375 g, t dbSNP:773110071
1381 1381 c, t dbSNP:370790682
1382 1382 a, g dbSNP:766778400
1385 1385 -, c dbSNP:761014653
1386 1386 c, t dbSNP:776976856
1395 1395 a, c, t dbSNP:759448456
1396 1396 a, g dbSNP:752708558
1414 1414 c, t dbSNP:11553676
1417 1417 c, t dbSNP:763672034
1418 1418 a, g dbSNP:199567720
1430 1430 -, g dbSNP:752741064
1444 1444 a, g dbSNP:759788811
1453 1453 a, g dbSNP:769732677
1457 1457 a, c dbSNP:373893146
1458 1458 c, t dbSNP:184406592
1459 1459 g, t dbSNP:764003497
1473 1473 c, t dbSNP:751492695
1476 1476 c, t dbSNP:761352973
1480 1480 c, t dbSNP:745946511
1481 1481 a, g dbSNP:750100311
1506 1506 c, t dbSNP:375032262
1513 1513 c, t dbSNP:755707958
1520 1520 a, g dbSNP:576907642
1521 1521 a, g dbSNP:139869965
1528 1528 c, t dbSNP:758780380
1530 1530 c, g, t dbSNP:367929166
1533 1533 c, t dbSNP:771162666
1549 1549 a, t dbSNP:781368673
1554 1554 c, t dbSNP:746099980
1555 1555 c, t dbSNP:770072937
1556 1556 a, g dbSNP:775776634
1566 1566 c, t dbSNP:139165192
1570 1570 c, t dbSNP:750942824
1573 1573 a, g dbSNP:144007935
1575 1575 c, g dbSNP:780133138
1588 1588 c, t dbSNP:149124387
1589 1589 a, g dbSNP:755162218
1595 1595 c, t dbSNP:779104605
1604 1604 a, g dbSNP:555034048
1626 1626 c, g dbSNP:121913552
1627 1627 c, t dbSNP:138490756
1628 1628 a, g dbSNP:773170096
1636 1636 c, t dbSNP:746905101
1638 1638 c, t dbSNP:146975823
1639 1639 c, t dbSNP:770368112
1642 1642 c, t dbSNP:776146504
1643 1643 a, c, g dbSNP:759113604
1645 1645 a, g dbSNP:775268631
1647 1647 c, g, t dbSNP:759491848
1648 1648 a, g dbSNP:750991056
1651 1651 c, t dbSNP:761187766
1653 1653 c, g, t dbSNP:543980683
1654 1654 -, g dbSNP:35625768
1659 1659 a, g dbSNP:755001757
1661 1661 c, t dbSNP:779159824
1662 1662 a, g dbSNP:752889171
1671 1671 a, c dbSNP:758701213
1674 1674 c, t dbSNP:142934642
1675 1675 a, g dbSNP:112250644
1678 1678 g, t dbSNP:779655041
1685 1685 -, agg dbSNP:757173694
1690 1690 a, c dbSNP:748954428
1695 1695 c, t dbSNP:768491146
1696 1696 a, c, g dbSNP:376017234
1698 1698 c, t dbSNP:771171842
1701 1701 c, t dbSNP:138289419
1704 1704 c, g dbSNP:759983190
1708 1708 c, t dbSNP:765311232
1709 1709 a, g dbSNP:775477980
1716 1716 a, c dbSNP:763014294
1722 1722 c, g dbSNP:764355890
1725 1725 a, c, t dbSNP:2230898
1727 1727 a, g dbSNP:767176963
1738 1738 g, t dbSNP:750387880
1742 1742 c, t dbSNP:748526375
1743 1743 a, g dbSNP:201999965
1751 1751 c, t dbSNP:754569828
1752 1752 a, g dbSNP:778242162
1758 1758 c, t dbSNP:747846409
1760 1760 a, g dbSNP:146360295
1765 1765 c, t dbSNP:552518372
1768 1768 c, t dbSNP:576500420
1771 1771 a, g dbSNP:369696269
1778 1778 c, t dbSNP:770120389
1779 1779 a, g dbSNP:565216977
1782 1782 a, g dbSNP:139230801
1785 1785 a, g dbSNP:768803999
1790 1790 a, g dbSNP:377325169
1795 1795 c, g dbSNP:761949919
1796 1796 a, t dbSNP:772242667
1799 1799 a, t dbSNP:773547480
1800 1800 a, g dbSNP:139468110
1801 1801 a, g dbSNP:370250187
1831 1831 c, t dbSNP:753853201
1834 1834 c, t dbSNP:759328881
1841 1841 a, g dbSNP:764804887
1853 1853 a, c dbSNP:756846064
1854 1854 c, g dbSNP:780818096
1855 1855 c, g, t dbSNP:367844314
1856 1856 a, g dbSNP:755346019
1863 1863 g, t dbSNP:779326156
1865 1865 a, g dbSNP:748646169
1872 1872 c, t dbSNP:758425988
1873 1873 a, g, t dbSNP:777937910
1878 1878 c, t dbSNP:771350321
1879 1879 a, g dbSNP:149654030
1881 1881 c, g, t dbSNP:35460537
1882 1882 c, t dbSNP:141692280
1883 1883 c, t dbSNP:775321665
1884 1884 a, c, g dbSNP:151051718
1887 1887 g, t dbSNP:773916889
1895 1895 c, t dbSNP:761299438
1899 1899 c, g, t dbSNP:546775471
1901 1901 c, t dbSNP:755326697
1903 1903 a, g dbSNP:765586163
1908 1908 a, g dbSNP:753155562
1909 1909 a, t dbSNP:758904956
1911 1911 a, c, t dbSNP:372579008
1912 1912 a, g, t dbSNP:757393804
1915 1915 a, t dbSNP:746064243
1921 1921 c, t dbSNP:769499769
1922 1922 a, g dbSNP:150184664
1926 1926 a, g dbSNP:749187050
1929 1929 c, g dbSNP:121913553
1932 1932 a, c dbSNP:768638113
1955 1955 c, t dbSNP:774249367
1957 1957 c, t dbSNP:761352524
1958 1958 c, t dbSNP:766973023
1959 1959 c, t dbSNP:772758944
1964 1964 c, g, t dbSNP:760314787
1971 1971 a, g dbSNP:201112464
1977 1977 a, c dbSNP:758826887
1981 1981 a, g dbSNP:764750668
1985 1985 a, g dbSNP:752084194
1988 1988 a, g dbSNP:757445322
1998 1998 c, g dbSNP:779912763
2019 2019 c, t dbSNP:763454814
2020 2020 a, g dbSNP:149425237
2022 2022 a, c dbSNP:752137195
2023 2023 c, t dbSNP:576416937
2024 2024 c, g dbSNP:767500051
2025 2025 c, t dbSNP:11553677
2031 2031 c, g dbSNP:11553672
2034 2034 a, t dbSNP:750583085
2038 2038 a, g dbSNP:756124891
2051 2051 g, t dbSNP:780363756
2055 2055 g, t dbSNP:3177759
2061 2061 c, t dbSNP:545485217
2072 2072 c, t dbSNP:754787633
2079 2079 c, t dbSNP:778619786
2091 2091 c, t dbSNP:748080300
2092 2092 a, g dbSNP:199730384
2094 2094 c, t dbSNP:777554498
2097 2097 g, t dbSNP:746583661
2101 2101 c, t dbSNP:121913554
2106 2106 c, t dbSNP:541261242
2107 2107 a, g dbSNP:759217354
2112 2112 c, g dbSNP:769156857
2124 2124 c, t dbSNP:757078518
2125 2125 a, g dbSNP:121913551
2127 2127 a, g dbSNP:183218776
2129 2129 g, t dbSNP:201625707
2135 2135 a, g dbSNP:755654001
2137 2137 a, t dbSNP:779884038
2143 2143 c, t dbSNP:748841458
2144 2144 a, g dbSNP:772498138
2146 2146 c, t dbSNP:529774961
2150 2150 a, g dbSNP:747393648
2161 2161 c, t dbSNP:373094220
2165 2165 c, t dbSNP:777096767
2168 2168 c, t dbSNP:557317492
2183 2183 -, ca dbSNP:778205353
2188 2188 a, g dbSNP:142916043
2192 2192 a, g dbSNP:773756799
2201 2201 a, g dbSNP:775807168
2205 2205 c, t dbSNP:763030551
2207 2207 c, t dbSNP:377406897
2208 2208 a, g dbSNP:751380359
2217 2217 c, t dbSNP:879690
2224 2224 c, t dbSNP:767613444
2226 2226 c, g dbSNP:879691
2227 2227 c, g dbSNP:762440021
2229 2229 a, c dbSNP:755707390
2232 2232 a, c dbSNP:779651224
2234 2234 c, t dbSNP:370498584
2245 2245 c, t dbSNP:754650948
2246 2246 a, g dbSNP:187909486
2250 2250 c, t dbSNP:145293802
2251 2251 a, g dbSNP:747378023
2253 2253 c, t dbSNP:140513387
2254 2254 g, t dbSNP:781689639
2255 2255 c, t dbSNP:149161535
2266 2266 a, c, g, t dbSNP:151247380
2268 2268 c, t dbSNP:768818916
2269 2269 a, g dbSNP:774611185
2274 2274 c, t dbSNP:140741046
2277 2277 a, g dbSNP:767372151
2281 2281 a, g dbSNP:750397415
2284 2284 a, c dbSNP:760621897
2286 2286 a, g dbSNP:369501908
2291 2291 a, g dbSNP:201169472
2294 2294 c, g dbSNP:753343984
2296 2296 c, t dbSNP:754484912
2316 2316 c, t dbSNP:778467079
2317 2317 a, g dbSNP:145873083
2326 2326 c, t dbSNP:757645346
2327 2327 -, cc dbSNP:747566822
2328 2328 c, t dbSNP:781480166
2348 2348 c, g dbSNP:2230899
2412 2412 a, g dbSNP:548198470
2451 2451 a, g dbSNP:138612687
2480 2480 a, g dbSNP:765780712
2512 2512 a, g dbSNP:750820355
2520 2520 c, t dbSNP:758794193
2540 2540 a, g dbSNP:373050647
2543 2543 c, t dbSNP:754702690
2602 2602 a, g dbSNP:537155991
2633 2633 c, t dbSNP:767162156
2647 2647 a, t dbSNP:766727378
2662 2662 c, t dbSNP:752156481
2685 2685 c, g dbSNP:551103869
2701 2701 -, gggacttctgcttcaagttttg dbSNP:202209753
2708 2708 c, t dbSNP:11553673
2717 2717 c, g dbSNP:11553681
2819 2819 a, g dbSNP:577834357
2824 2824 c, g dbSNP:1063393
2843 2843 c, g dbSNP:540068101
2860 2860 c, g dbSNP:191227335
2876 2876 c, t dbSNP:1049519
2891 2891 g, t dbSNP:15431
2898 2898 a, g dbSNP:534573017
2915 2915 c, t dbSNP:554620655
2947 2947 a, c dbSNP:1804187
2956 2956 g, t dbSNP:574433935
2966 2966 a, g dbSNP:184470121
2998 2998 g, t dbSNP:142707437
3007 3007 a, c dbSNP:112280868
3008 3008 a, t dbSNP:112041336

Target ORF information:

RefSeq Version XM_011541594
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), transcript variant X2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
XM_011541594

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
ATGATGAAGC CCGCAGCCCC CTGTTGCCAA GAGGGCCTCA GAGCTGGTGG CTCTGGTTCT 
CTTCACCTGG GGAGAGACTT CACCGTCCTG GCAGGAGCTC GGGGGAGCCC TTCCCCAAGT
GTGAGCAGCA TCCCTCGTTT CTGGATCCCA GGTTCAGACA ACCTTTTAGT CCTCACGGTG
GCCACTAAGG AGACCGAGGG ATTCCGTCGC TTCAAGCGCT CAGCTCAGTT CTTCAACTAC
AAGATCCAGG CGCTTGGCCT AGGGGAGGAC TGGAATGTGG AGAAGGGGAC GTCGGCAGGT
GGAGGGCAGA AGGTCCGGCT GCTGAAGAAA GCTCTGGAGA AGCACGCAGA CAAGGAGGAT
CTGGTCATTC TCTTCGCAGA CAGCTATGAC GTGCTGTTTG CATCGGGGCC CCGGGAGCTC
CTGAAGAAGT TCCGGCAGGC CAGGAGCCAG GTGGTCTTCT CTGCTGAGGA GCTCATCTAC
CCAGACCGCA GGCTGGAGAC CAAGTATCCG GTGGTGTCCG ATGGCAAGAG GTTCCTGGGC
TCTGGAGGCT TCATCGGTTA TGCCCCCAAC CTCAGCAAAC TGGTGGCCGA GTGGGAGGGC
CAGGACAGCG ACAGCGATCA GCTGTTTTAC ACCAAGATCT TCTTGGACCC GGAGAAGAGG
GAGCAGATCA ATATCACCCT GGACCACCGC TGCCGTATCT TCCAGAACCT GGATGGAGCC
TTGGATGAGG TCGTGCTCAA GTTTGAAATG GGCCATGTGA GAGCGAGGAA CCTGGCCTAT
GACACCCTCC CGGTCCTGAT CCATGGCAAC GGGCCAACCA AGCTGCAGTT GAACTACCTG
GGCAACTACA TCCCGCGCTT CTGGACCTTC GAAACAGGCT GCACCGTGTG TGACGAAGGC
TTGCGCAGCC TCAAGGGCAT TGGGGATGAA GCTCTGCCCA CGGTCCTGGT CGGCGTGTTC
ATCGAACAGC CCACGCCGTT TGTGTCCCTG TTCTTCCAGC GGCTCCTGCG GCTCCACTAC
CCCCAGAAAC ACATGCGACT TTTCATCCAC AACCACGAGC AGCACCACAA GGCTCAGGTG
GAAGAGTTCC TGGCACAGCA TGGCAGCGAG TACCAGTCTG TGAAGCTGGT GGGCCCTGAG
GTGCGGATGG CGAATGCAGA TGCCAGGAAC ATGGGCGCAG ACCTGTGCCG GCAGGACCGC
AGCTGCACCT ACTACTTCAG CGTGGATGCT GACGTGGCCC TGACCGAGCC CAACAGCCTG
CGGCTGCTGA TCCAACAGAA CAAGAACGTC ATTGCCCCGC TGATGACCCG GCATGGGAGG
CTGTGGTCGA ACTTCTGGGG GGCTCTCAGT GCAGATGGCT ACTATGCCCG TTCCGAGGAC
TACGTGGACA TTGTGCAGGG GCGGCGTGTT GGTGTCTGGA ATGTGCCCTA TATTTCAAAC
ATCTACTTGA TCAAGGGCAG TGCCCTGCGG GGTGAGCTGC AGTCCTCAGA TCTCTTCCAC
CACAGCAAGC TGGACCCCGA CATGGCCTTC TGTGCCAACA TCCGGCAGCA GGATGTGTTC
ATGTTCCTGA CCAACCGGCA CACCCTTGGC CATCTGCTCT CCCTAGACAG CTACCGCACC
ACCCACCTGC ACAACGACCT CTGGGAGGTG TTCAGCAACC CCGAGGACTG GAAGGAGAAG
TACATCCACC AGAACTACAC CAAAGCCCTG GCAGGGAAGC TGGTGGAGAC GCCCTGCCCG
GATGTCTATT GGTTCCCCAT CTTCACGGAG GTGGCCTGTG ATGAGCTGGT GGAGGAGATG
GAGCACTTTG GCCAGTGGTC TCTGGGCAAC AACAAGGACA ACCGCATCCA GGGTGGCTAC
GAGAACGTGC CGACTATTGA CATCCACATG AACCAGATCG GCTTTGAGCG GGAGTGGCAC
AAATTCCTGC TGGAGTACAT TGCGCCCATG ACGGAGAAGC TCTACCCCGG CTACTACACC
AGGGCCCAGT TTGACCTGGC CTTTGTCGTC CGCTACAAGC CTGATGAGCA GCCCTCACTG
ATGCCACACC ATGATGCCTC CACCTTCACC ATCAACATCG CCCTGAACCG AGTCGGGGTG
GATTACGAGG GCGGGGGCTG TCGGTTCCTG CGCTACAACT GTTCCATCCG AGCCCCAAGG
AAGGGCTGGA CCCTCATGCA CCCTGGACGA CTCACGCATT ACCATGAGGG GCTCCCCACC
ACCAGGGGCA CCCGCTACAT CGCAGTCTCC TTCGTCGATC CCTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu18408D
Sequence Information ORF Nucleotide Sequence (Length: 2184bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC334246.1, M98252.1 and BQ447373.1. This sequence is a reference standard in the RefSeqGene project. On Mar 1, 2011 this sequence version replaced gi:32307143. Summary: Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: M98252.1, BC016657.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
ATGCGGCCCC TGCTGCTACT GGCCCTGCTG GGCTGGCTGC TGCTGGCCGA AGCGAAGGGC 
GACGCCAAGC CGGAGGACAA CCTTTTAGTC CTCACGGTGG CCACTAAGGA GACCGAGGGA
TTCCGTCGCT TCAAGCGCTC AGCTCAGTTC TTCAACTACA AGATCCAGGC GCTTGGCCTA
GGGGAGGACT GGAATGTGGA GAAGGGGACG TCGGCAGGTG GAGGGCAGAA GGTCCGGCTG
CTGAAGAAAG CTCTGGAGAA GCACGCAGAC AAGGAGGATC TGGTCATTCT CTTCGCAGAC
AGCTATGACG TGCTGTTTGC ATCGGGGCCC CGGGAGCTCC TGAAGAAGTT CCGGCAGGCC
AGGAGCCAGG TGGTCTTCTC TGCTGAGGAG CTCATCTACC CAGACCGCAG GCTGGAGACC
AAGTATCCGG TGGTGTCCGA TGGCAAGAGG TTCCTGGGCT CTGGAGGCTT CATCGGTTAT
GCCCCCAACC TCAGCAAACT GGTGGCCGAG TGGGAGGGCC AGGACAGCGA CAGCGATCAG
CTGTTTTACA CCAAGATCTT CTTGGACCCG GAGAAGAGGG AGCAGATCAA TATCACCCTG
GACCACCGCT GCCGTATCTT CCAGAACCTG GATGGAGCCT TGGATGAGGT CGTGCTCAAG
TTTGAAATGG GCCATGTGAG AGCGAGGAAC CTGGCCTATG ACACCCTCCC GGTCCTGATC
CATGGCAACG GGCCAACCAA GCTGCAGTTG AACTACCTGG GCAACTACAT CCCGCGCTTC
TGGACCTTCG AAACAGGCTG CACCGTGTGT GACGAAGGCT TGCGCAGCCT CAAGGGCATT
GGGGATGAAG CTCTGCCCAC GGTCCTGGTC GGCGTGTTCA TCGAACAGCC CACGCCGTTT
GTGTCCCTGT TCTTCCAGCG GCTCCTGCGG CTCCACTACC CCCAGAAACA CATGCGACTT
TTCATCCACA ACCACGAGCA GCACCACAAG GCTCAGGTGG AAGAGTTCCT GGCACAGCAT
GGCAGCGAGT ACCAGTCTGT GAAGCTGGTG GGCCCTGAGG TGCGGATGGC GAATGCAGAT
GCCAGGAACA TGGGCGCAGA CCTGTGCCGG CAGGACCGCA GCTGCACCTA CTACTTCAGC
GTGGATGCTG ACGTGGCCCT GACCGAGCCC AACAGCCTGC GGCTGCTGAT CCAACAGAAC
AAGAACGTCA TTGCCCCGCT GATGACCCGG CATGGGAGGC TGTGGTCGAA CTTCTGGGGG
GCTCTCAGTG CAGATGGCTA CTATGCCCGT TCCGAGGACT ACGTGGACAT TGTGCAGGGG
CGGCGTGTTG GTGTCTGGAA TGTGCCCTAT ATTTCAAACA TCTACTTGAT CAAGGGCAGT
GCCCTGCGGG GTGAGCTGCA GTCCTCAGAT CTCTTCCACC ACAGCAAGCT GGACCCCGAC
ATGGCCTTCT GTGCCAACAT CCGGCAGCAG GATGTGTTCA TGTTCCTGAC CAACCGGCAC
ACCCTTGGCC ATCTGCTCTC CCTAGACAGC TACCGCACCA CCCACCTGCA CAACGACCTC
TGGGAGGTGT TCAGCAACCC CGAGGACTGG AAGGAGAAGT ACATCCACCA GAACTACACC
AAAGCCCTGG CAGGGAAGCT GGTGGAGACG CCCTGCCCGG ATGTCTATTG GTTCCCCATC
TTCACGGAGG TGGCCTGTGA TGAGCTGGTG GAGGAGATGG AGCACTTTGG CCAGTGGTCT
CTGGGCAACA ACAAGGACAA CCGCATCCAG GGTGGCTACG AGAACGTGCC GACTATTGAC
ATCCACATGA ACCAGATCGG CTTTGAGCGG GAGTGGCACA AATTCCTGCT GGAGTACATT
GCGCCCATGA CGGAGAAGCT CTACCCCGGC TACTACACCA GGGCCCAGTT TGACCTGGCC
TTTGTCGTCC GCTACAAGCC TGATGAGCAG CCCTCACTGA TGCCACACCA TGATGCCTCC
ACCTTCACCA TCAACATCGC CCTGAACCGA GTCGGGGTGG ATTACGAGGG CGGGGGCTGT
CGGTTCCTGC GCTACAACTG TTCCATCCGA GCCCCAAGGA AGGGCTGGAC CCTCATGCAC
CCTGGACGAC TCACGCATTA CCATGAGGGG CTCCCCACCA CCAGGGGCAC CCGCTACATC
GCAGTCTCCT TCGTCGATCC CTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_000293.2
CDS114..2297
Misc Feature(1)1797..2288(+)
Exon (1)1..189
Gene:PLOD1
Gene Synonym:
Exon (2)190..281
Gene:PLOD1
Gene Synonym:
Exon (3)282..415
Gene:PLOD1
Gene Synonym:
Exon (4)416..579
Gene:PLOD1
Gene Synonym:
Exon (5)580..692
Gene:PLOD1
Gene Synonym:
Exon (6)693..756
Gene:PLOD1
Gene Synonym:
Exon (7)757..854
Gene:PLOD1
Gene Synonym:
Exon (8)855..956
Gene:PLOD1
Gene Synonym:
Exon (9)957..1088
Gene:PLOD1
Gene Synonym:
Exon (10)1089..1210
Gene:PLOD1
Gene Synonym:
Exon (11)1211..1315
Gene:PLOD1
Gene Synonym:
Exon (12)1316..1441
Gene:PLOD1
Gene Synonym:
Exon (13)1442..1583
Gene:PLOD1
Gene Synonym:
Exon (14)1584..1697
Gene:PLOD1
Gene Synonym:
Exon (15)1698..1763
Gene:PLOD1
Gene Synonym:
Exon (16)1764..1868
Gene:PLOD1
Gene Synonym:
Exon (17)1869..2015
Gene:PLOD1
Gene Synonym:
Exon (18)2016..2141
Gene:PLOD1
Gene Synonym:
Exon (19)2142..3031
Gene:PLOD1
Gene Synonym:
Translation
Position Chain Variation Link
27 27 c, t dbSNP:550797643
29 29 a, t dbSNP:368661925
36 36 a, g dbSNP:569290347
37 37 a, g dbSNP:144465849
38 38 a, g dbSNP:551773846
53 53 c, g dbSNP:566803699
56 56 a, g dbSNP:552712043
64 64 c, g dbSNP:555643065
69 69 c, t dbSNP:745989868
72 72 c, g dbSNP:751377124
75 75 g, t dbSNP:769995450
88 88 a, g dbSNP:567346111
113 113 c, g dbSNP:749523957
139 139 c, t dbSNP:754752318
165 165 a, g dbSNP:373165011
187 187 a, c dbSNP:774044489
195 195 a, c dbSNP:776894307
199 199 c, t dbSNP:766724096
202 202 c, t dbSNP:777178486
208 208 c, t dbSNP:374597380
209 209 a, g dbSNP:765270896
212 212 a, g, t dbSNP:752778368
216 216 a, g dbSNP:148997434
218 218 -, t dbSNP:748066312
221 221 a, g dbSNP:751831236
222 222 a, g dbSNP:369263247
227 227 a, c, g, t dbSNP:11553679
228 228 a, c, g dbSNP:538407894
230 230 a, g dbSNP:779453447
231 231 a, g dbSNP:556718115
237 237 c, t dbSNP:202003686
238 238 a, g dbSNP:202116614
240 240 c, t dbSNP:778603432
241 241 a, g dbSNP:141704997
242 242 a, c dbSNP:771332500
245 245 c, t dbSNP:776947403
248 248 a, g dbSNP:765354146
249 249 c, t dbSNP:138698098
250 250 a, g dbSNP:142710681
251 251 c, t dbSNP:763163866
253 253 c, t dbSNP:764260254
266 266 c, g dbSNP:371961536
277 277 c, t dbSNP:762098276
283 283 c, g dbSNP:753862253
286 286 c, t dbSNP:754877185
289 289 c, g dbSNP:138106022
290 290 c, t dbSNP:34032489
292 292 c, t dbSNP:373927410
297 297 a, g dbSNP:146092290
306 306 a, t dbSNP:143604754
313 313 a, g dbSNP:756553633
314 314 c, g dbSNP:7551068
322 322 c, t dbSNP:780253192
323 323 a, g dbSNP:749845776
326 326 a, g dbSNP:769238622
329 329 a, t dbSNP:774587722
330 330 g, t dbSNP:748173461
332 332 g, t dbSNP:772274349
333 333 a, g dbSNP:773540306
335 335 a, g dbSNP:760785117
341 341 a, g dbSNP:766236123
350 350 g, t dbSNP:201579526
356 356 a, g dbSNP:371574381
363 363 a, c, g dbSNP:34878020
365 365 c, t dbSNP:765098815
380 380 a, g dbSNP:7541079
384 384 -, aag dbSNP:777435127
385 385 a, g dbSNP:752204392
389 389 a, g dbSNP:768169776
399 399 a, g dbSNP:763494719
407 407 c, t dbSNP:7529452
408 408 a, g dbSNP:7551175
414 414 a, g dbSNP:780490883
416 416 c, t dbSNP:147980436
420 420 a, g dbSNP:774590964
422 422 c, t dbSNP:750096749
423 423 a, g dbSNP:141809154
427 427 -, tgt dbSNP:770511543
428 428 a, g dbSNP:779398093
436 436 c, t dbSNP:549517196
439 439 a, g dbSNP:753296406
441 441 -, c dbSNP:776398739
441 441 c, t dbSNP:758789186
444 444 a, c dbSNP:772221158
445 445 a, g dbSNP:141767454
449 449 a, g dbSNP:746999816
465 465 c, t dbSNP:771186398
466 466 a, g dbSNP:781455578
467 467 a, g dbSNP:746072884
468 468 a, c dbSNP:769620321
471 471 g, t dbSNP:2273285
473 473 c, t dbSNP:762972277
476 476 c, g dbSNP:768422539
489 489 g, t dbSNP:144702307
519 519 c, t dbSNP:761296670
520 520 a, g dbSNP:148510973
524 524 a, g dbSNP:151122664
530 530 a, g dbSNP:750148215
541 541 c, t dbSNP:760372600
551 551 c, t dbSNP:765725567
562 562 a, c, g dbSNP:753061220
563 563 g, t dbSNP:778072657
564 564 a, t dbSNP:372628401
571 571 g, t dbSNP:757335356
572 572 c, t dbSNP:781221516
573 573 a, t dbSNP:746124510
574 574 c, t dbSNP:769958284
585 585 a, g dbSNP:147924545
588 588 a, g dbSNP:772861343
621 621 a, g dbSNP:780519821
622 622 a, t dbSNP:554232128
634 634 a, g dbSNP:770557607
641 641 c, t dbSNP:776200742
647 647 a, c, t dbSNP:113384442
648 648 a, c, g, t dbSNP:188165334
653 653 a, g dbSNP:35958757
655 655 c, t dbSNP:756245932
656 656 a, g dbSNP:766424893
663 663 a, c dbSNP:754048128
664 664 c, t dbSNP:755186588
668 668 g, t dbSNP:142978362
673 673 c, t dbSNP:747917838
677 677 -, ggaccc dbSNP:775053632
677 677 c, g dbSNP:201888323
680 680 c, t dbSNP:375364215
682 682 c, g, t dbSNP:375416784
683 683 a, g dbSNP:776173072
690 690 a, c dbSNP:569590633
695 695 c, g dbSNP:767195501
703 703 a, g dbSNP:750416079
714 714 a, g dbSNP:367575725
716 716 c, t dbSNP:201291374
720 720 c, t dbSNP:534314930
721 721 a, g dbSNP:145482271
726 726 c, g, t dbSNP:199990859
727 727 a, g, t dbSNP:536503346
730 730 c, t dbSNP:781376270
738 738 a, g dbSNP:746416126
750 750 a, g dbSNP:770147701
751 751 -, c dbSNP:36005914
751 751 c, t dbSNP:775720354
757 757 a, c dbSNP:760452720
761 761 a, g, t dbSNP:150852515
763 763 c, t dbSNP:776599201
764 764 c, t dbSNP:759435283
765 765 a, g, t dbSNP:372534520
781 781 c, t dbSNP:377072582
783 783 a, g dbSNP:763724588
790 790 c, t dbSNP:376643174
791 791 a, g dbSNP:371007185
796 796 c, t dbSNP:756600025
797 797 a, g dbSNP:183225496
815 815 c, g dbSNP:566018612
816 816 a, g dbSNP:535012522
819 819 a, c dbSNP:779066341
823 823 c, t dbSNP:748111731
824 824 a, g dbSNP:149566879
825 825 g, t dbSNP:777914756
828 828 c, t dbSNP:747209460
833 833 a, c dbSNP:770749842
839 839 c, t dbSNP:776366598
842 842 c, t dbSNP:567164584
843 843 a, g dbSNP:769659116
849 849 a, t dbSNP:775496572
853 853 a, g dbSNP:762431149
855 855 c, t dbSNP:763439166
860 860 g, t dbSNP:768989396
868 868 a, g dbSNP:774882355
872 872 a, g dbSNP:762271097
874 874 a, g dbSNP:767610828
876 876 a, g dbSNP:750459442
877 877 a, g dbSNP:538763801
886 886 c, t dbSNP:766692124
887 887 a, g dbSNP:753994916
889 889 a, g dbSNP:144226170
898 898 c, t dbSNP:147940796
901 901 g, t dbSNP:752711810
903 903 c, g dbSNP:758361490
907 907 c, g dbSNP:777431366
910 910 a, g dbSNP:558752942
912 912 c, t dbSNP:368132656
913 913 c, g, t dbSNP:780952856
915 915 a, g dbSNP:74354225
917 917 c, t dbSNP:140758113
918 918 a, g dbSNP:145447578
926 926 c, t dbSNP:373471550
936 936 c, t dbSNP:775565324
937 937 g, t dbSNP:184999645
939 939 a, g dbSNP:760869815
943 943 c, t dbSNP:766349712
945 945 a, c dbSNP:776949094
946 946 a, c, g dbSNP:543437537
947 947 a, g dbSNP:557353959
949 949 a, g dbSNP:758414759
951 951 a, g dbSNP:764158476
952 952 c, t dbSNP:199669594
959 959 c, t dbSNP:755620088
966 966 c, t dbSNP:370663808
969 969 c, t dbSNP:748920493
971 971 c, t dbSNP:145574708
973 973 c, t dbSNP:777957649
974 974 a, g dbSNP:747570972
983 983 c, t dbSNP:373082170
984 984 a, g dbSNP:776772692
987 987 a, g dbSNP:143114026
995 995 c, t dbSNP:747668784
996 996 a, g dbSNP:775902328
1007 1007 a, g dbSNP:763229200
1009 1009 c, t dbSNP:532145123
1010 1010 a, g dbSNP:199946373
1014 1014 a, g dbSNP:761815159
1016 1016 a, g dbSNP:767424651
1018 1018 a, c dbSNP:565765056
1023 1023 c, t dbSNP:760230526
1032 1032 c, g, t dbSNP:370736543
1034 1034 a, g dbSNP:754534604
1041 1041 c, t dbSNP:11553674
1043 1043 a, g dbSNP:751800110
1049 1049 c, t dbSNP:374787907
1060 1060 a, c dbSNP:141881216
1061 1061 a, g dbSNP:746354303
1064 1064 c, t dbSNP:770032875
1068 1068 c, t dbSNP:121913550
1069 1069 a, g, t dbSNP:749535965
1084 1084 a, g dbSNP:200524993
1088 1088 c, t dbSNP:761576315
1091 1091 a, g dbSNP:150627428
1098 1098 c, t dbSNP:147536755
1106 1106 c, t dbSNP:767051420
1110 1110 a, g dbSNP:754351882
1136 1136 c, t dbSNP:755056846
1139 1139 c, t dbSNP:140159343
1140 1140 a, g dbSNP:748344499
1144 1144 a, g, t dbSNP:200166434
1148 1148 a, g dbSNP:777545904
1150 1150 c, g dbSNP:746868590
1162 1162 c, t dbSNP:770695057
1168 1168 c, g dbSNP:776480771
1172 1172 a, c, g dbSNP:35656581
1175 1175 a, g dbSNP:769217332
1176 1176 c, t dbSNP:775007891
1177 1177 a, g dbSNP:370305686
1183 1183 c, t dbSNP:763906693
1184 1184 a, g dbSNP:374036329
1187 1187 a, t dbSNP:761174430
1203 1203 a, g dbSNP:766824430
1209 1209 a, g dbSNP:367592901
1209 1209 -, g dbSNP:758298439
1210 1210 c, t dbSNP:377080927
1216 1216 c, t dbSNP:753127125
1221 1221 c, g dbSNP:763065699
1222 1222 a, g, t dbSNP:574781992
1223 1223 a, g dbSNP:148644646
1228 1228 a, g dbSNP:377497101
1230 1230 a, c, t dbSNP:750301725
1243 1243 a, c dbSNP:754748178
1246 1246 a, g dbSNP:749210400
1247 1247 c, t dbSNP:768317167
1253 1253 c, t dbSNP:200131516
1254 1254 a, g dbSNP:2230896
1265 1265 c, t dbSNP:771685198
1266 1266 a, g dbSNP:371223839
1277 1277 c, t dbSNP:74949176
1278 1278 a, g dbSNP:373520363
1284 1284 a, g dbSNP:376235626
1285 1285 a, g dbSNP:763409574
1286 1286 c, g, t dbSNP:764179880
1289 1289 c, t dbSNP:761878111
1294 1294 a, g dbSNP:767839550
1295 1295 c, g dbSNP:144439284
1307 1307 a, g dbSNP:755978483
1308 1308 c, t dbSNP:779676937
1310 1310 a, g dbSNP:753853335
1319 1319 c, t dbSNP:1130529
1320 1320 a, g dbSNP:773517731
1323 1323 a, g dbSNP:755416195
1329 1329 c, g, t dbSNP:760764359
1330 1330 c, t dbSNP:753623016
1331 1331 a, g dbSNP:754812888
1341 1341 c, g, t dbSNP:559232378
1342 1342 a, g dbSNP:371001571
1347 1347 a, g dbSNP:777107202
1351 1351 a, g dbSNP:746696317
1356 1356 c, t dbSNP:756800628
1360 1360 c, t dbSNP:138586136
1368 1368 c, t dbSNP:373446893
1374 1374 g, t dbSNP:768987788
1377 1377 c, g dbSNP:774878639
1386 1386 c, g dbSNP:748565316
1394 1394 c, t dbSNP:143294623
1395 1395 g, t dbSNP:773110071
1401 1401 c, t dbSNP:370790682
1402 1402 a, g dbSNP:766778400
1405 1405 -, c dbSNP:761014653
1406 1406 c, t dbSNP:776976856
1415 1415 a, c, t dbSNP:759448456
1416 1416 a, g dbSNP:752708558
1434 1434 c, t dbSNP:11553676
1437 1437 c, t dbSNP:763672034
1438 1438 a, g dbSNP:199567720
1450 1450 -, g dbSNP:752741064
1464 1464 a, g dbSNP:759788811
1473 1473 a, g dbSNP:769732677
1477 1477 a, c dbSNP:373893146
1478 1478 c, t dbSNP:184406592
1479 1479 g, t dbSNP:764003497
1493 1493 c, t dbSNP:751492695
1496 1496 c, t dbSNP:761352973
1500 1500 c, t dbSNP:745946511
1501 1501 a, g dbSNP:750100311
1526 1526 c, t dbSNP:375032262
1533 1533 c, t dbSNP:755707958
1540 1540 a, g dbSNP:576907642
1541 1541 a, g dbSNP:139869965
1548 1548 c, t dbSNP:758780380
1550 1550 c, g, t dbSNP:367929166
1553 1553 c, t dbSNP:771162666
1569 1569 a, t dbSNP:781368673
1574 1574 c, t dbSNP:746099980
1575 1575 c, t dbSNP:770072937
1576 1576 a, g dbSNP:775776634
1586 1586 c, t dbSNP:139165192
1590 1590 c, t dbSNP:750942824
1593 1593 a, g dbSNP:144007935
1595 1595 c, g dbSNP:780133138
1608 1608 c, t dbSNP:149124387
1609 1609 a, g dbSNP:755162218
1615 1615 c, t dbSNP:779104605
1624 1624 a, g dbSNP:555034048
1646 1646 c, g dbSNP:121913552
1647 1647 c, t dbSNP:138490756
1648 1648 a, g dbSNP:773170096
1656 1656 c, t dbSNP:746905101
1658 1658 c, t dbSNP:146975823
1659 1659 c, t dbSNP:770368112
1662 1662 c, t dbSNP:776146504
1663 1663 a, c, g dbSNP:759113604
1665 1665 a, g dbSNP:775268631
1667 1667 c, g, t dbSNP:759491848
1668 1668 a, g dbSNP:750991056
1671 1671 c, t dbSNP:761187766
1673 1673 c, g, t dbSNP:543980683
1674 1674 -, g dbSNP:35625768
1679 1679 a, g dbSNP:755001757
1681 1681 c, t dbSNP:779159824
1682 1682 a, g dbSNP:752889171
1691 1691 a, c dbSNP:758701213
1694 1694 c, t dbSNP:142934642
1695 1695 a, g dbSNP:112250644
1698 1698 g, t dbSNP:779655041
1705 1705 -, agg dbSNP:757173694
1710 1710 a, c dbSNP:748954428
1715 1715 c, t dbSNP:768491146
1716 1716 a, c, g dbSNP:376017234
1718 1718 c, t dbSNP:771171842
1721 1721 c, t dbSNP:138289419
1724 1724 c, g dbSNP:759983190
1728 1728 c, t dbSNP:765311232
1729 1729 a, g dbSNP:775477980
1736 1736 a, c dbSNP:763014294
1742 1742 c, g dbSNP:764355890
1745 1745 a, c, t dbSNP:2230898
1747 1747 a, g dbSNP:767176963
1758 1758 g, t dbSNP:750387880
1762 1762 c, t dbSNP:748526375
1763 1763 a, g dbSNP:201999965
1771 1771 c, t dbSNP:754569828
1772 1772 a, g dbSNP:778242162
1778 1778 c, t dbSNP:747846409
1780 1780 a, g dbSNP:146360295
1785 1785 c, t dbSNP:552518372
1788 1788 c, t dbSNP:576500420
1791 1791 a, g dbSNP:369696269
1798 1798 c, t dbSNP:770120389
1799 1799 a, g dbSNP:565216977
1802 1802 a, g dbSNP:139230801
1805 1805 a, g dbSNP:768803999
1810 1810 a, g dbSNP:377325169
1815 1815 c, g dbSNP:761949919
1816 1816 a, t dbSNP:772242667
1819 1819 a, t dbSNP:773547480
1820 1820 a, g dbSNP:139468110
1821 1821 a, g dbSNP:370250187
1851 1851 c, t dbSNP:753853201
1854 1854 c, t dbSNP:759328881
1861 1861 a, g dbSNP:764804887
1873 1873 a, c dbSNP:756846064
1874 1874 c, g dbSNP:780818096
1875 1875 c, g, t dbSNP:367844314
1876 1876 a, g dbSNP:755346019
1883 1883 g, t dbSNP:779326156
1885 1885 a, g dbSNP:748646169
1892 1892 c, t dbSNP:758425988
1893 1893 a, g, t dbSNP:777937910
1898 1898 c, t dbSNP:771350321
1899 1899 a, g dbSNP:149654030
1901 1901 c, g, t dbSNP:35460537
1902 1902 c, t dbSNP:141692280
1903 1903 c, t dbSNP:775321665
1904 1904 a, c, g dbSNP:151051718
1907 1907 g, t dbSNP:773916889
1915 1915 c, t dbSNP:761299438
1919 1919 c, g, t dbSNP:546775471
1921 1921 c, t dbSNP:755326697
1923 1923 a, g dbSNP:765586163
1928 1928 a, g dbSNP:753155562
1929 1929 a, t dbSNP:758904956
1931 1931 a, c, t dbSNP:372579008
1932 1932 a, g, t dbSNP:757393804
1935 1935 a, t dbSNP:746064243
1941 1941 c, t dbSNP:769499769
1942 1942 a, g dbSNP:150184664
1946 1946 a, g dbSNP:749187050
1949 1949 c, g dbSNP:121913553
1952 1952 a, c dbSNP:768638113
1975 1975 c, t dbSNP:774249367
1977 1977 c, t dbSNP:761352524
1978 1978 c, t dbSNP:766973023
1979 1979 c, t dbSNP:772758944
1984 1984 c, g, t dbSNP:760314787
1991 1991 a, g dbSNP:201112464
1997 1997 a, c dbSNP:758826887
2001 2001 a, g dbSNP:764750668
2005 2005 a, g dbSNP:752084194
2008 2008 a, g dbSNP:757445322
2018 2018 c, g dbSNP:779912763
2039 2039 c, t dbSNP:763454814
2040 2040 a, g dbSNP:149425237
2042 2042 a, c dbSNP:752137195
2043 2043 c, t dbSNP:576416937
2044 2044 c, g dbSNP:767500051
2045 2045 c, t dbSNP:11553677
2051 2051 c, g dbSNP:11553672
2054 2054 a, t dbSNP:750583085
2058 2058 a, g dbSNP:756124891
2071 2071 g, t dbSNP:780363756
2075 2075 g, t dbSNP:3177759
2081 2081 c, t dbSNP:545485217
2092 2092 c, t dbSNP:754787633
2099 2099 c, t dbSNP:778619786
2111 2111 c, t dbSNP:748080300
2112 2112 a, g dbSNP:199730384
2114 2114 c, t dbSNP:777554498
2117 2117 g, t dbSNP:746583661
2121 2121 c, t dbSNP:121913554
2126 2126 c, t dbSNP:541261242
2127 2127 a, g dbSNP:759217354
2132 2132 c, g dbSNP:769156857
2144 2144 c, t dbSNP:757078518
2145 2145 a, g dbSNP:121913551
2147 2147 a, g dbSNP:183218776
2149 2149 g, t dbSNP:201625707
2155 2155 a, g dbSNP:755654001
2157 2157 a, t dbSNP:779884038
2163 2163 c, t dbSNP:748841458
2164 2164 a, g dbSNP:772498138
2166 2166 c, t dbSNP:529774961
2170 2170 a, g dbSNP:747393648
2181 2181 c, t dbSNP:373094220
2185 2185 c, t dbSNP:777096767
2188 2188 c, t dbSNP:557317492
2203 2203 -, ca dbSNP:778205353
2208 2208 a, g dbSNP:142916043
2212 2212 a, g dbSNP:773756799
2221 2221 a, g dbSNP:775807168
2225 2225 c, t dbSNP:763030551
2227 2227 c, t dbSNP:377406897
2228 2228 a, g dbSNP:751380359
2237 2237 c, t dbSNP:879690
2244 2244 c, t dbSNP:767613444
2246 2246 c, g dbSNP:879691
2247 2247 c, g dbSNP:762440021
2249 2249 a, c dbSNP:755707390
2252 2252 a, c dbSNP:779651224
2254 2254 c, t dbSNP:370498584
2265 2265 c, t dbSNP:754650948
2266 2266 a, g dbSNP:187909486
2270 2270 c, t dbSNP:145293802
2271 2271 a, g dbSNP:747378023
2273 2273 c, t dbSNP:140513387
2274 2274 g, t dbSNP:781689639
2275 2275 c, t dbSNP:149161535
2286 2286 a, c, g, t dbSNP:151247380
2288 2288 c, t dbSNP:768818916
2289 2289 a, g dbSNP:774611185
2294 2294 c, t dbSNP:140741046
2297 2297 a, g dbSNP:767372151
2301 2301 a, g dbSNP:750397415
2304 2304 a, c dbSNP:760621897
2306 2306 a, g dbSNP:369501908
2311 2311 a, g dbSNP:201169472
2314 2314 c, g dbSNP:753343984
2316 2316 c, t dbSNP:754484912
2336 2336 c, t dbSNP:778467079
2337 2337 a, g dbSNP:145873083
2346 2346 c, t dbSNP:757645346
2347 2347 -, cc dbSNP:747566822
2348 2348 c, t dbSNP:781480166
2368 2368 c, g dbSNP:2230899
2432 2432 a, g dbSNP:548198470
2471 2471 a, g dbSNP:138612687
2500 2500 a, g dbSNP:765780712
2532 2532 a, g dbSNP:750820355
2540 2540 c, t dbSNP:758794193
2560 2560 a, g dbSNP:373050647
2563 2563 c, t dbSNP:754702690
2622 2622 a, g dbSNP:537155991
2653 2653 c, t dbSNP:767162156
2667 2667 a, t dbSNP:766727378
2682 2682 c, t dbSNP:752156481
2705 2705 c, g dbSNP:551103869
2721 2721 -, gggacttctgcttcaagttttg dbSNP:202209753
2728 2728 c, t dbSNP:11553673
2737 2737 c, g dbSNP:11553681
2839 2839 a, g dbSNP:577834357
2844 2844 c, g dbSNP:1063393
2863 2863 c, g dbSNP:540068101
2880 2880 c, g dbSNP:191227335
2896 2896 c, t dbSNP:1049519
2911 2911 g, t dbSNP:15431
2918 2918 a, g dbSNP:534573017
2935 2935 c, t dbSNP:554620655
2967 2967 a, c dbSNP:1804187
2976 2976 g, t dbSNP:574433935
2986 2986 a, g dbSNP:184470121
3018 3018 g, t dbSNP:142707437
3027 3027 a, c dbSNP:112280868
3028 3028 a, t dbSNP:112041336

Target ORF information:

RefSeq Version NM_000302
Organism Homo sapiens (human)
Definition Homo sapiens procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_000302

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
ATGCGGCCCC TGCTGCTACT GGCCCTGCTG GGCTGGCTGC TGCTGGCCGA AGCGAAGGGC 
GACGCCAAGC CGGAGGACAA CCTTTTAGTC CTCACGGTGG CCACTAAGGA GACCGAGGGA
TTCCGTCGCT TCAAGCGCTC AGCTCAGTTC TTCAACTACA AGATCCAGGC GCTTGGCCTA
GGGGAGGACT GGAATGTGGA GAAGGGGACG TCGGCAGGTG GAGGGCAGAA GGTCCGGCTG
CTGAAGAAAG CTCTGGAGAA GCACGCAGAC AAGGAGGATC TGGTCATTCT CTTCGCAGAC
AGCTATGACG TGCTGTTTGC ATCGGGGCCC CGGGAGCTCC TGAAGAAGTT CCGGCAGGCC
AGGAGCCAGG TGGTCTTCTC TGCTGAGGAG CTCATCTACC CAGACCGCAG GCTGGAGACC
AAGTATCCGG TGGTGTCCGA TGGCAAGAGG TTCCTGGGCT CTGGAGGCTT CATCGGTTAT
GCCCCCAACC TCAGCAAACT GGTGGCCGAG TGGGAGGGCC AGGACAGCGA CAGCGATCAG
CTGTTTTACA CCAAGATCTT CTTGGACCCG GAGAAGAGGG AGCAGATCAA TATCACCCTG
GACCACCGCT GCCGTATCTT CCAGAACCTG GATGGAGCCT TGGATGAGGT CGTGCTCAAG
TTTGAAATGG GCCATGTGAG AGCGAGGAAC CTGGCCTATG ACACCCTCCC GGTCCTGATC
CATGGCAACG GGCCAACCAA GCTGCAGTTG AACTACCTGG GCAACTACAT CCCGCGCTTC
TGGACCTTCG AAACAGGCTG CACCGTGTGT GACGAAGGCT TGCGCAGCCT CAAGGGCATT
GGGGATGAAG CTCTGCCCAC GGTCCTGGTC GGCGTGTTCA TCGAACAGCC CACGCCGTTT
GTGTCCCTGT TCTTCCAGCG GCTCCTGCGG CTCCACTACC CCCAGAAACA CATGCGACTT
TTCATCCACA ACCACGAGCA GCACCACAAG GCTCAGGTGG AAGAGTTCCT GGCACAGCAT
GGCAGCGAGT ACCAGTCTGT GAAGCTGGTG GGCCCTGAGG TGCGGATGGC GAATGCAGAT
GCCAGGAACA TGGGCGCAGA CCTGTGCCGG CAGGACCGCA GCTGCACCTA CTACTTCAGC
GTGGATGCTG ACGTGGCCCT GACCGAGCCC AACAGCCTGC GGCTGCTGAT CCAACAGAAC
AAGAACGTCA TTGCCCCGCT GATGACCCGG CATGGGAGGC TGTGGTCGAA CTTCTGGGGG
GCTCTCAGTG CAGATGGCTA CTATGCCCGT TCCGAGGACT ACGTGGACAT TGTGCAGGGG
CGGCGTGTTG GTGTCTGGAA TGTGCCCTAT ATTTCAAACA TCTACTTGAT CAAGGGCAGT
GCCCTGCGGG GTGAGCTGCA GTCCTCAGAT CTCTTCCACC ACAGCAAGCT GGACCCCGAC
ATGGCCTTCT GTGCCAACAT CCGGCAGCAG GATGTGTTCA TGTTCCTGAC CAACCGGCAC
ACCCTTGGCC ATCTGCTCTC CCTAGACAGC TACCGCACCA CCCACCTGCA CAACGACCTC
TGGGAGGTGT TCAGCAACCC CGAGGACTGG AAGGAGAAGT ACATCCACCA GAACTACACC
AAAGCCCTGG CAGGGAAGCT GGTGGAGACG CCCTGCCCGG ATGTCTATTG GTTCCCCATC
TTCACGGAGG TGGCCTGTGA TGAGCTGGTG GAGGAGATGG AGCACTTTGG CCAGTGGTCT
CTGGGCAACA ACAAGGACAA CCGCATCCAG GGTGGCTACG AGAACGTGCC GACTATTGAC
ATCCACATGA ACCAGATCGG CTTTGAGCGG GAGTGGCACA AATTCCTGCT GGAGTACATT
GCGCCCATGA CGGAGAAGCT CTACCCCGGC TACTACACCA GGGCCCAGTT TGACCTGGCC
TTTGTCGTCC GCTACAAGCC TGATGAGCAG CCCTCACTGA TGCCACACCA TGATGCCTCC
ACCTTCACCA TCAACATCGC CCTGAACCGA GTCGGGGTGG ATTACGAGGG CGGGGGCTGT
CGGTTCCTGC GCTACAACTG TTCCATCCGA GCCCCAAGGA AGGGCTGGAC CCTCATGCAC
CCTGGACGAC TCACGCATTA CCATGAGGGG CTCCCCACCA CCAGGGGCAC CCGCTACATC
GCAGTCTCCT TCGTCGATCC CTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.