Email to GenScript

FGFRL1 fibroblast growth factor receptor-like 1 [Homo sapiens (human)]

Gene Symbol FGFRL1
Entrez Gene ID 53834
Full Name fibroblast growth factor receptor-like 1
Synonyms FGFR5, FHFR
General protein information
Preferred Names
fibroblast growth factor receptor-like 1
fibroblast growth factor receptor-like 1
FGFR-like protein
FGF receptor-like protein 1
FGF homologous factor receptor
fibroblast growth factor receptor 5
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:

The following FGFRL1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the FGFRL1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu03560 XM_011513486 PREDICTED: Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu03560 XM_011513487 PREDICTED: Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu03560 NM_021923 Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu03560 NM_001004358 Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu03560 NM_001004356 Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu03560
Accession Version XM_011513486.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1515bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu03560D_COA.pdf (pdf)
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor-like 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)250..501(+)
Misc Feature(2)292..501(+)
Misc Feature(3)622..867(+)
Misc Feature(4)628..642(+)
Misc Feature(5)631..666(+)
Misc Feature(6)646..837(+)
Misc Feature(7)910..1218(+)
Misc Feature(8)934..1221(+)
Position Chain Variation Link
61 61 c, t dbSNP:552923576
67 67 a, g dbSNP:577755625
98 98 c, t dbSNP:545021273
104 104 a, g dbSNP:768448638
117 117 a, g dbSNP:563577326
122 122 g, t dbSNP:530783925
126 126 c, t dbSNP:542659364
138 138 a, g dbSNP:749047276
140 140 c, g dbSNP:770787708
141 141 a, c, g, t dbSNP:778383576
143 143 c, g, t dbSNP:368027099
146 146 a, g dbSNP:557157256
147 147 a, c, g dbSNP:372270864
149 149 c, t dbSNP:763187872
150 150 a, c dbSNP:766779845
151 151 a, g dbSNP:774369555
153 153 c, g dbSNP:759797809
161 161 c, t dbSNP:767784488
163 163 -, agcccc dbSNP:747194253
166 166 c, t dbSNP:575630622
168 168 c, t dbSNP:756223516
171 171 a, c, g dbSNP:376206035
175 175 c, t dbSNP:753833720
191 191 -, gct dbSNP:769021838
204 204 a, g dbSNP:756947825
205 205 a, g dbSNP:778776233
212 212 c, t dbSNP:745720792
213 213 a, g dbSNP:4647942
217 217 -, gcc dbSNP:776508642
220 220 g, t dbSNP:779902508
222 222 a, c dbSNP:746487161
229 229 c, g dbSNP:768315040
232 232 a, g dbSNP:773807067
234 234 c, t dbSNP:760894803
235 235 a, c dbSNP:547113709
237 237 c, g dbSNP:776762633
241 241 a, g dbSNP:761850703
246 246 a, g dbSNP:765191650
248 248 c, t dbSNP:78299800
252 252 c, g dbSNP:762788863
255 255 g, t dbSNP:766291232
259 259 a, g dbSNP:751465034
265 265 c, t dbSNP:754661810
266 266 a, g dbSNP:557619683
267 267 a, g dbSNP:201988101
270 270 c, g dbSNP:755606953
272 272 g, t dbSNP:199787006
277 277 c, t dbSNP:746384176
278 278 a, g dbSNP:772358818
286 286 c, t dbSNP:780395159
287 287 a, g dbSNP:747436071
291 291 c, t dbSNP:768846760
292 292 c, g dbSNP:776759278
293 293 c, t dbSNP:761913241
294 294 g, t dbSNP:373335067
295 295 c, t dbSNP:769788707
296 296 a, g dbSNP:375489366
310 310 a, g, t dbSNP:550722940
313 313 a, g dbSNP:766480123
315 315 g, t dbSNP:751377059
323 323 c, t dbSNP:759444080
324 324 a, g dbSNP:767154264
326 326 c, t dbSNP:752311377
327 327 a, g dbSNP:569083517
328 328 c, t dbSNP:777150201
330 330 a, g dbSNP:753416769
334 334 a, c dbSNP:758895914
337 337 a, g dbSNP:780591496
342 342 a, g dbSNP:747346476
351 351 c, t dbSNP:201067344
355 355 c, g, t dbSNP:191062034
356 356 a, g dbSNP:769847502
358 358 a, t dbSNP:773150815
360 360 c, t dbSNP:749427340
366 366 c, t dbSNP:770960248
369 369 a, c, t dbSNP:372553975
376 376 a, g dbSNP:759352019
379 379 c, t dbSNP:767226381
380 380 a, g dbSNP:775138464
385 385 c, t dbSNP:760242543
386 386 a, g dbSNP:763867368
387 387 a, c, t dbSNP:61733101
388 388 a, g dbSNP:766832234
394 394 c, t dbSNP:533496126
395 395 c, t dbSNP:776843445
402 402 a, g dbSNP:781415322
405 405 g, t dbSNP:748603105
414 414 c, g dbSNP:756265844
418 418 a, c, g dbSNP:377619943
424 424 c, t dbSNP:369657280
425 425 a, g dbSNP:774368943
430 430 a, g dbSNP:71604335
435 435 c, t dbSNP:558236459
438 438 c, t dbSNP:576840405
439 439 a, g dbSNP:200736918
440 440 c, t dbSNP:142763226
444 444 c, g, t dbSNP:113418020
445 445 c, g dbSNP:776300560
451 451 a, g dbSNP:371631827
453 453 a, g dbSNP:147343114
455 455 c, t dbSNP:757572064
456 456 a, c, t dbSNP:751997519
459 459 c, t dbSNP:768117149
462 462 c, t dbSNP:752971788
468 468 c, t dbSNP:756531169
469 469 a, g dbSNP:778092068
471 471 c, t dbSNP:754122283
473 473 a, g dbSNP:757336835
476 476 g, t dbSNP:779128594
479 479 a, g dbSNP:746021134
480 480 c, t dbSNP:771885034
481 481 a, g dbSNP:372607043
487 487 -, ta dbSNP:762347391
488 488 a, g dbSNP:746746134
489 489 c, t dbSNP:139057147
491 491 c, t dbSNP:377060032
492 492 a, c, t dbSNP:200350712
495 495 c, t dbSNP:781572073
496 496 a, g dbSNP:772572830
498 498 c, t dbSNP:762562937
499 499 a, g dbSNP:767870668
505 505 c, g dbSNP:753268976
506 506 a, g dbSNP:781145411
510 510 c, t dbSNP:747896165
511 511 a, g dbSNP:758696948
517 517 c, t dbSNP:755924836
521 521 a, g dbSNP:777232211
527 527 a, t dbSNP:748971007
531 531 c, t dbSNP:371664807
537 537 g, t dbSNP:770552349
538 538 c, t dbSNP:773895801
540 540 c, t dbSNP:745417758
541 541 a, g dbSNP:769257115
542 542 a, g dbSNP:556264405
549 549 c, t dbSNP:762223132
557 557 a, g, t dbSNP:765652265
565 565 a, g dbSNP:763233631
566 566 a, c dbSNP:766569185
568 568 a, c dbSNP:751619106
570 570 c, t dbSNP:376193356
578 578 a, c dbSNP:767392280
583 583 g, t dbSNP:752643862
586 586 a, g dbSNP:755840443
590 590 a, g dbSNP:749613570
593 593 c, g dbSNP:771210370
594 594 a, g dbSNP:774485968
595 595 c, t dbSNP:201696860
599 599 c, t dbSNP:772338165
623 623 a, g dbSNP:775524754
625 625 c, t dbSNP:760707374
630 630 c, g dbSNP:764055305
637 637 c, t dbSNP:753743806
638 638 a, g dbSNP:761612724
642 642 a, c, g, t dbSNP:113814624
643 643 a, g dbSNP:779904701
652 652 a, t dbSNP:751051234
654 654 c, t dbSNP:140852364
655 655 a, g dbSNP:778281827
658 658 c, t dbSNP:749760188
659 659 a, g dbSNP:771531742
669 669 c, t dbSNP:779235733
670 670 a, g dbSNP:377175884
675 675 c, g dbSNP:772250235
688 688 c, t dbSNP:775719058
689 689 a, g dbSNP:760761457
690 690 g, t dbSNP:768632874
693 693 a, c, t dbSNP:776565730
694 694 a, g dbSNP:201262483
700 700 a, t dbSNP:773123389
701 701 c, t dbSNP:762884996
702 702 a, g dbSNP:766091807
714 714 c, t dbSNP:200618237
728 728 a, c, t dbSNP:369436907
729 729 a, g dbSNP:199798050
730 730 c, t dbSNP:757739388
731 731 a, g, t dbSNP:4647937
732 732 c, t dbSNP:374115931
739 739 a, g, t dbSNP:758783277
741 741 c, t dbSNP:144863877
742 742 a, g, t dbSNP:768990087
753 753 -, gaa dbSNP:773886054
762 762 a, g dbSNP:547516754
763 763 g, t dbSNP:769826602
767 767 c, t dbSNP:773316252
768 768 a, g dbSNP:762776382
771 771 a, g dbSNP:766278654
787 787 c, t dbSNP:774266040
788 788 a, g dbSNP:759093103
791 791 c, t dbSNP:767248157
792 792 a, g dbSNP:752117207
795 795 a, g dbSNP:755650629
801 801 c, t dbSNP:765681967
802 802 g, t dbSNP:752653233
811 811 a, c dbSNP:565792759
817 817 c, t dbSNP:148556821
818 818 a, g dbSNP:780279438
819 819 c, t dbSNP:747464840
825 825 a, c, g dbSNP:144361678
829 829 c, t dbSNP:201667493
830 830 a, g dbSNP:146608674
833 833 c, t dbSNP:773213801
834 834 a, g dbSNP:749230766
837 837 c, t dbSNP:771046121
846 846 c, t dbSNP:773991255
849 849 c, t dbSNP:759415964
855 855 c, t dbSNP:771584275
874 874 c, t dbSNP:768269824
875 875 a, g dbSNP:776300610
876 876 a, g dbSNP:116837147
880 880 c, g, t dbSNP:143714694
884 884 c, t dbSNP:543347696
890 890 c, t dbSNP:768184121
891 891 c, t dbSNP:114935241
892 892 a, g dbSNP:368039756
896 896 g, t dbSNP:764362615
902 902 a, g dbSNP:754124213
905 905 c, t dbSNP:757215836
906 906 a, g dbSNP:765357209
908 908 a, g dbSNP:750528701
912 912 a, c, t dbSNP:140460823
913 913 a, g dbSNP:746770205
920 920 c, t dbSNP:754793602
921 921 a, g dbSNP:780767290
924 924 a, g dbSNP:747844379
925 925 a, g dbSNP:769387185
927 927 a, g dbSNP:772753740
932 932 c, t dbSNP:748784356
933 933 c, t dbSNP:371754554
934 934 g, t dbSNP:776162191
936 936 c, g dbSNP:758196459
938 938 a, g dbSNP:764556581
944 944 c, t dbSNP:776925588
945 945 a, g dbSNP:540991862
964 964 c, g dbSNP:765429291
965 965 a, g dbSNP:370772573
969 969 c, t dbSNP:758442194
970 970 a, g dbSNP:766259424
972 972 c, t dbSNP:751514315
973 973 a, g dbSNP:754703776
981 981 a, g dbSNP:58679007
985 985 a, c dbSNP:747940022
987 987 c, t dbSNP:532862696
995 995 -, gaa dbSNP:757673940
1000 1000 c, t dbSNP:777318066
1001 1001 a, g dbSNP:372119720
1002 1002 c, g, t dbSNP:770577862
1003 1003 g, t dbSNP:376072293
1011 1011 c, t dbSNP:769346621
1012 1012 a, g dbSNP:777032994
1014 1014 c, t dbSNP:762124519
1015 1015 a, g dbSNP:770019120
1017 1017 c, t dbSNP:138109269
1018 1018 a, g dbSNP:200852436
1020 1020 g, t dbSNP:564517711
1021 1021 a, g dbSNP:149112646
1025 1025 a, g dbSNP:759443799
1026 1026 c, t dbSNP:767391975
1029 1029 c, t dbSNP:370405185
1030 1030 a, g dbSNP:752493793
1031 1031 a, g dbSNP:755880461
1032 1032 c, t dbSNP:777425704
1039 1039 a, g dbSNP:753437773
1041 1041 c, g dbSNP:757035366
1042 1042 a, g, t dbSNP:532080560
1043 1043 a, g dbSNP:372708838
1044 1044 c, t dbSNP:4647946
1047 1047 a, g dbSNP:781580876
1050 1050 c, g, t dbSNP:138843839
1051 1051 a, g dbSNP:773419444
1072 1072 c, t dbSNP:763160215
1073 1073 c, t dbSNP:568375042
1076 1076 c, t dbSNP:774380288
1077 1077 a, g dbSNP:375942692
1083 1083 c, t dbSNP:142743042
1084 1084 a, c, g dbSNP:529265854
1091 1091 c, t dbSNP:200863947
1094 1094 a, g dbSNP:370584141
1097 1097 a, c dbSNP:756949305
1098 1098 c, t dbSNP:778748309
1099 1099 a, g dbSNP:749914986
1101 1101 c, t dbSNP:147385493
1110 1110 c, t dbSNP:781684420
1113 1113 c, t dbSNP:748610298
1122 1122 g, t dbSNP:756715366
1125 1125 c, g, t dbSNP:202228086
1127 1127 g, t dbSNP:771097582
1128 1128 c, t dbSNP:774575940
1132 1132 c, t dbSNP:745887685
1133 1133 a, g dbSNP:147980100
1135 1135 a, g dbSNP:200153294
1138 1138 c, t dbSNP:760516188
1139 1139 a, g dbSNP:374222149
1140 1140 c, t dbSNP:368634271
1142 1142 a, g dbSNP:761732244
1143 1143 a, g dbSNP:141649779
1145 1145 a, g dbSNP:750115262
1146 1146 c, t dbSNP:757861533
1149 1149 c, t dbSNP:765806312
1150 1150 g, t dbSNP:751142885
1151 1151 c, t dbSNP:756543798
1152 1152 a, g dbSNP:778280412
1161 1161 c, t dbSNP:749603726
1162 1162 a, g dbSNP:757629043
1173 1173 c, t dbSNP:138509526
1180 1180 a, t dbSNP:746084833
1183 1183 a, g dbSNP:139387602
1194 1194 a, c dbSNP:775409417
1197 1197 a, c dbSNP:747154466
1198 1198 c, t dbSNP:768438794
1203 1203 c, t dbSNP:776735135
1204 1204 a, g dbSNP:374309032
1215 1215 c, t dbSNP:765131320
1233 1233 -, c dbSNP:369065988
1235 1235 c, t dbSNP:771759616
1236 1236 a, c, g dbSNP:537262686
1238 1238 a, c dbSNP:4647930
1240 1240 g, t dbSNP:773783296
1247 1247 c, t dbSNP:763163157
1251 1251 a, g dbSNP:745740200
1259 1259 c, t dbSNP:368961378
1260 1260 a, g dbSNP:755231134
1265 1265 c, t dbSNP:767896163
1266 1266 a, g dbSNP:752771234
1267 1267 a, g dbSNP:756272863
1268 1268 c, g dbSNP:567597911
1279 1279 c, t dbSNP:749241683
1280 1280 c, t dbSNP:371943795
1282 1282 a, c, t dbSNP:778745736
1283 1283 a, g dbSNP:376903367
1286 1286 c, t dbSNP:775146211
1287 1287 c, t dbSNP:111246053
1288 1288 a, g dbSNP:201440347
1296 1296 c, g, t dbSNP:146112374
1297 1297 a, g dbSNP:766847951
1300 1300 a, c dbSNP:774750247
1303 1303 c, t dbSNP:373660136
1308 1308 a, c, t dbSNP:140148549
1311 1311 c, t dbSNP:375677549
1312 1312 a, g dbSNP:202037959
1313 1313 c, g dbSNP:753912109
1317 1317 c, g dbSNP:757186468
1321 1321 a, c dbSNP:778746987
1336 1336 c, t dbSNP:745613727
1338 1338 c, g dbSNP:758203364
1350 1350 c, t dbSNP:779615534
1354 1354 c, g dbSNP:746661915
1367 1367 c, t dbSNP:768252857
1368 1368 a, g dbSNP:776185476
1373 1373 a, c dbSNP:747654089
1374 1374 a, c dbSNP:577572432
1377 1377 c, t dbSNP:201062727
1378 1378 a, g dbSNP:373506035
1379 1379 c, t dbSNP:759910460
1380 1380 a, g dbSNP:61734883
1386 1386 c, g dbSNP:776053533
1387 1387 c, t dbSNP:760955260
1398 1398 a, t dbSNP:764261493
1402 1402 a, c, g dbSNP:201377348
1404 1404 c, t dbSNP:370211317
1405 1405 c, t dbSNP:750366202
1407 1407 c, g dbSNP:758398284
1409 1409 a, c, t dbSNP:200338999
1410 1410 a, g dbSNP:754631527
1412 1412 a, c, t dbSNP:375985073
1413 1413 a, g dbSNP:201785648
1417 1417 a, t dbSNP:777488330
1418 1418 a, c, t dbSNP:746360727
1419 1419 a, g dbSNP:375150331
1420 1420 a, g dbSNP:760976677
1423 1423 c, t dbSNP:368437012
1424 1424 a, g, t dbSNP:4647931
1425 1425 c, t dbSNP:765297271
1426 1426 a, g dbSNP:750561767
1427 1427 a, g dbSNP:374653229
1429 1429 c, t dbSNP:766347101
1430 1430 a, c, g, t dbSNP:751318362
1431 1431 c, t dbSNP:752283163
1434 1434 c, t dbSNP:367617448
1435 1435 a, g dbSNP:200822222
1438 1438 a, g dbSNP:376736117
1442 1442 a, g dbSNP:367966622
1446 1446 c, t dbSNP:772665357
1453 1453 c, t dbSNP:780728675
1454 1454 c, t dbSNP:747340530
1455 1455 a, c, g dbSNP:145786390
1461 1461 c, t dbSNP:748306032
1462 1462 a, g dbSNP:770052916
1470 1470 c, t dbSNP:371849695
1471 1471 a, g dbSNP:376400181
1472 1472 c, t dbSNP:766259286
1476 1476 a, c dbSNP:774173217
1481 1481 c, g dbSNP:759581394
1487 1487 a, g dbSNP:767199588
1491 1491 a, g dbSNP:551721504
1498 1498 a, g dbSNP:755794980
1500 1500 a, c, g dbSNP:200350207
1501 1501 c, t dbSNP:756840934
1502 1502 a, g dbSNP:182915641
1506 1506 a, g dbSNP:747467662
1511 1511 c, t dbSNP:755567722
1512 1512 a, g dbSNP:373825808
1517 1517 -, ccc dbSNP:765638279
1517 1517 c, t dbSNP:748588827
1519 1519 c, t dbSNP:549237929
1520 1520 c, t dbSNP:773448649
1526 1526 a, c, g dbSNP:567468058
1530 1530 a, g dbSNP:774561854
1531 1531 c, t dbSNP:769491696
1535 1535 a, g, t dbSNP:767542507
1536 1536 c, t dbSNP:148505744
1543 1543 c, g dbSNP:80019124
1544 1544 a, c, t dbSNP:4647932
1553 1553 a, g dbSNP:764647868
1555 1555 c, t dbSNP:749989018
1571 1571 a, c, g dbSNP:755416353
1576 1576 c, t dbSNP:375421159
1582 1582 -, gacatc dbSNP:750976145
1586 1586 -, tc dbSNP:758856602
1586 1586 c, t dbSNP:756472488
1587 1587 -, ca, caca, cacaca dbSNP:751700498
1588 1588 -, cacaca dbSNP:769679151
1588 1588 -, caca dbSNP:781628478
1588 1588 -, ca dbSNP:145808953
1588 1588 c, g dbSNP:571486674
1589 1589 -, caca dbSNP:747154781
1589 1589 a, c dbSNP:749511854
1590 1590 c, t dbSNP:771187237
1591 1591 a, g dbSNP:778839265
1595 1595 -, cacacacacacactct dbSNP:777542278
1598 1598 c, t dbSNP:745984551
1599 1599 -, cacacacactct dbSNP:770799450
1600 1600 -, cacacacactct dbSNP:749212877
1606 1606 -, cact dbSNP:773797947
1608 1608 -, ct dbSNP:759055320
1608 1608 c, t dbSNP:771866499
1609 1609 a, t dbSNP:775503014
1610 1610 c, g dbSNP:199548478
1612 1612 -, cacacacactca dbSNP:771696328
1612 1612 -, caca dbSNP:775168543
1615 1615 a, t dbSNP:768557913
1617 1617 a, g dbSNP:776633899
1623 1623 a, g dbSNP:761525836
1625 1625 a, g dbSNP:372496076
1626 1626 c, t dbSNP:749851372
1627 1627 a, g dbSNP:138327840
1634 1634 a, g dbSNP:149625647
1642 1642 c, t dbSNP:753212127
1658 1658 a, g dbSNP:111608568
1659 1659 g, t dbSNP:144318134
1670 1670 c, t dbSNP:370665283
1671 1671 a, g dbSNP:554196152
1675 1675 c, t dbSNP:779229022
1676 1676 c, t dbSNP:748164211
1677 1677 a, g dbSNP:372960046
1692 1692 -, c dbSNP:762050692
1694 1694 -, g dbSNP:765594414
1695 1695 c, g dbSNP:541578778
1696 1696 c, g, t dbSNP:377284409
1699 1699 a, g dbSNP:768753902
1700 1700 a, g dbSNP:370871387
1702 1702 c, g, t dbSNP:761720392
1703 1703 a, g dbSNP:777973033
1705 1705 c, t dbSNP:578178286
1727 1727 c, t dbSNP:545104718
1734 1734 c, t dbSNP:749451713
1746 1746 c, t dbSNP:563689502
1747 1747 c, g dbSNP:531075308
1774 1774 a, g dbSNP:61007088
1776 1776 c, t dbSNP:552234059
1785 1785 c, t dbSNP:561328425
1791 1791 g, t dbSNP:528313149
1810 1810 c, t dbSNP:771227332
1820 1820 -, ac dbSNP:147695405
1834 1834 -, acac dbSNP:113926759
1842 1842 a, g dbSNP:546746341
1845 1845 a, g dbSNP:4647939
1849 1849 a, g dbSNP:746826540
1854 1854 c, t dbSNP:532423431
1857 1857 a, g dbSNP:768657932
1859 1859 a, g dbSNP:534686121
1868 1868 c, t dbSNP:568514652
1873 1873 a, g dbSNP:371059354
1874 1874 c, t dbSNP:546391446
1875 1875 a, g dbSNP:554259719
1880 1880 c, t dbSNP:761910406
1894 1894 c, g dbSNP:566202202
1901 1901 c, t dbSNP:568598861
1903 1903 -, cg dbSNP:201031675
1905 1905 -, cacaca dbSNP:761442334
1905 1905 -, ca dbSNP:4647945
1906 1906 a, g dbSNP:772827102
1910 1910 -, ac dbSNP:372298935
1911 1911 c, t dbSNP:534932929
1929 1929 c, t dbSNP:553513239
1930 1930 c, t dbSNP:147461484
1931 1931 a, g dbSNP:545679240
1940 1940 c, t dbSNP:557228247
1954 1954 c, g dbSNP:573619022
1963 1963 a, c dbSNP:73070424
1964 1964 a, g dbSNP:115824203
1966 1966 a, g dbSNP:561393016
1967 1967 c, g dbSNP:187595155
1969 1969 c, t dbSNP:751872526
1978 1978 a, g dbSNP:562604726
1991 1991 c, t dbSNP:755346435
1996 1996 a, g dbSNP:540089482
2014 2014 g, t dbSNP:565082475
2015 2015 -, acac dbSNP:575306605
2017 2017 a, g dbSNP:767940786
2020 2020 a, c, t dbSNP:753195481
2021 2021 a, g dbSNP:575572545
2029 2029 a, g dbSNP:372948683
2032 2032 c, t dbSNP:139909269
2033 2033 a, g dbSNP:116173564
2050 2050 -, acac dbSNP:751956500
2050 2050 -, ac dbSNP:376462828
2052 2052 -, ac dbSNP:748391991
2063 2063 c, t dbSNP:529661387
2066 2066 a, g dbSNP:779210431
2082 2082 c, t dbSNP:746734756
2083 2083 a, g dbSNP:768568238
2084 2084 -, cacacacgtgcagatatggtatccgga dbSNP:533634308
2090 2090 a, c, t dbSNP:11538025
2091 2091 a, g dbSNP:201858459
2092 2092 -, tgca dbSNP:369182316
2096 2096 -, gatatggtatccggacacacacgtgca dbSNP:35896028
2102 2102 ctg, gta dbSNP:386670451
2104 2104 a, g dbSNP:533874850
2107 2107 c, t dbSNP:377108343
2111 2111 -, gc dbSNP:376865502
2114 2114 a, g dbSNP:772556487
2120 2120 a, g dbSNP:762546540
2125 2125 g, t dbSNP:571817420
2126 2126 a, t dbSNP:765885844
2133 2133 g, t dbSNP:538817789
2135 2135 c, t dbSNP:192541751
2137 2137 g, t dbSNP:575982814
2146 2146 c, g dbSNP:773993761
2159 2159 g, t dbSNP:28602600
2160 2160 -, ac dbSNP:762493335
2161 2161 a, t dbSNP:759248664
2174 2174 c, t dbSNP:756451035
2175 2175 a, g dbSNP:543072483
2187 2187 -, ac dbSNP:56398186
2188 2188 -, ac dbSNP:781533771
2189 2189 -, ac dbSNP:771747710
2191 2191 c, g dbSNP:554987351
2202 2202 acgt, gc dbSNP:386670452
2203 2203 -, ac dbSNP:397935892
2203 2203 c, t dbSNP:560739572
2204 2204 a, g dbSNP:199852820
2205 2205 c, t dbSNP:1064838
2215 2215 c, t dbSNP:576981416
2221 2221 a, g dbSNP:573172534
2222 2222 c, t dbSNP:28668809
2228 2228 c, t dbSNP:543974698
2230 2230 c, g, t dbSNP:1064839
2236 2236 c, t dbSNP:529919727
2260 2260 a, t dbSNP:547820432
2278 2278 c, g dbSNP:764687219
2308 2308 c, t dbSNP:559712155
2311 2311 a, g dbSNP:527237566
2326 2326 a, g dbSNP:184928800
2329 2329 -, caca dbSNP:570296680
2329 2329 -, ca dbSNP:751002701
2330 2330 -, ca dbSNP:760257693
2332 2332 -, ca dbSNP:529106784
2335 2335 c, t dbSNP:142792896
2338 2338 a, g dbSNP:539246283
2339 2339 -, ac dbSNP:35640602
2339 2339 c, t dbSNP:551177228
2346 2346 a, g dbSNP:569605885
2354 2354 c, t dbSNP:536936448
2355 2355 a, g dbSNP:151232580
2366 2366 c, t dbSNP:573197554
2367 2367 a, g dbSNP:115679552
2377 2377 a, g dbSNP:559031465
2380 2380 c, t dbSNP:758744980
2383 2383 c, t dbSNP:781101014
2387 2387 c, t dbSNP:577245313
2390 2390 -, acac dbSNP:369250502
2392 2392 -, ac dbSNP:776639287
2399 2399 c, t dbSNP:544033211
2404 2404 a, g dbSNP:562331083
2412 2412 a, g dbSNP:574437474
2414 2414 c, t dbSNP:574683299
2421 2421 -, ac dbSNP:538923386
2429 2429 a, g dbSNP:560149049
2430 2430 -, ca dbSNP:57445348
2442 2442 c, g dbSNP:187572457
2459 2459 a, g dbSNP:551862508
2468 2468 c, t dbSNP:564238440
2476 2476 -, ac dbSNP:542089125
2484 2484 -, at dbSNP:34428342
2518 2518 c, t dbSNP:531419076
2519 2519 a, g dbSNP:370714398
2531 2531 c, t dbSNP:569472053
2535 2535 c, t dbSNP:192813350
2540 2540 -, acac dbSNP:528378155
2545 2545 c, t dbSNP:4647936
2546 2546 a, g dbSNP:4647943
2549 2549 c, t dbSNP:748675670
2550 2550 a, g dbSNP:567024820
2562 2562 a, g dbSNP:140919592
2585 2585 a, c dbSNP:534225926
2586 2586 c, t dbSNP:770466875
2587 2587 a, g dbSNP:558664418
2595 2595 a, g dbSNP:577305280
2598 2598 -, ca dbSNP:748899241
2610 2610 c, t dbSNP:530852681
2615 2615 a, t dbSNP:537942579
2625 2625 -, ac dbSNP:201331455
2631 2631 c, t dbSNP:545798369
2636 2636 a, g dbSNP:556189339
2641 2641 a, c, t dbSNP:189183107
2650 2650 -, g dbSNP:778748230
2662 2662 c, t dbSNP:3733350
2685 2685 c, t dbSNP:573362339
2686 2686 a, g dbSNP:775786632
2725 2725 c, t dbSNP:572227834
2745 2745 c, t dbSNP:545820664
2746 2746 c, t dbSNP:370896791
2752 2752 -, tgtccccgcctc dbSNP:376088822
2752 2752 a, t dbSNP:148837233
2758 2758 c, t dbSNP:543546237
2759 2759 g, t dbSNP:143441743
2770 2770 c, t dbSNP:561727372
2776 2776 -, catccccgcctc dbSNP:4647941
2777 2777 a, g dbSNP:370377465
2782 2782 c, t dbSNP:530339594
2804 2804 c, t dbSNP:192584184
2816 2816 c, t dbSNP:548473385
2823 2823 c, g dbSNP:567188360
2842 2842 c, g dbSNP:527966255
2847 2847 c, t dbSNP:748302174
2869 2869 a, g dbSNP:4647938
2883 2883 a, g dbSNP:778080073
2891 2891 a, g dbSNP:570513184
2924 2924 c, g dbSNP:4647940
2933 2933 -, c dbSNP:544137988
2945 2945 c, g dbSNP:568107933
2987 2987 a, g dbSNP:762285982
2988 2988 a, t dbSNP:765388428
3004 3004 a, g dbSNP:556256579
3043 3043 c, t dbSNP:568189259
3050 3050 c, t dbSNP:113502766
3051 3051 a, g dbSNP:758652958
3082 3082 c, t dbSNP:377102874
3085 3085 c, t dbSNP:780444862
3086 3086 a, g dbSNP:114230525
3088 3088 c, t dbSNP:762308289
3094 3094 c, t dbSNP:765895558
3102 3102 -, c dbSNP:59896854
3108 3108 -, c dbSNP:397941425
3108 3108 c, t dbSNP:375839578
3119 3119 c, g, t dbSNP:545776199
3133 3133 a, t dbSNP:764609587
3135 3135 a, c dbSNP:777493059
3138 3138 g, t dbSNP:557985553
3160 3160 g, t dbSNP:754163645
3161 3161 a, c, g dbSNP:148169986
3165 3165 a, g dbSNP:749233111
3170 3170 c, t dbSNP:770901335
3171 3171 a, g dbSNP:750645767
3173 3173 a, g dbSNP:778356397
3177 3177 c, t dbSNP:118095428
3213 3213 c, t dbSNP:141073382
3214 3214 c, t dbSNP:745408023

Target ORF information:

RefSeq Version XM_011513486
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu03560
Accession Version XM_011513487.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1515bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu03560D_COA.pdf (pdf)
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor-like 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)677..928(+)
Misc Feature(2)719..928(+)
Misc Feature(3)1049..1294(+)
Misc Feature(4)1055..1069(+)
Misc Feature(5)1058..1093(+)
Misc Feature(6)1073..1264(+)
Misc Feature(7)1337..1645(+)
Misc Feature(8)1361..1648(+)
Position Chain Variation Link
20 20 a, g dbSNP:536191465
22 22 c, g dbSNP:4569707
68 68 a, c dbSNP:572650158
107 107 a, g dbSNP:545886231
108 108 a, g dbSNP:564479687
112 112 c, g dbSNP:768576649
130 130 a, g dbSNP:188533594
144 144 c, g dbSNP:543497662
175 175 a, g dbSNP:776484647
195 195 a, g dbSNP:368561405
239 239 a, g dbSNP:114228690
253 253 c, t dbSNP:745555001
258 258 c, t dbSNP:185122491
288 288 c, t dbSNP:375527194
292 292 c, g dbSNP:113326586
293 293 -, c dbSNP:576457343
294 294 -, c dbSNP:151274002
295 295 g, t dbSNP:533102802
302 302 c, g, t dbSNP:545272567
306 306 c, t dbSNP:112866759
343 343 g, t dbSNP:79664023
344 344 c, t dbSNP:78520297
387 387 a, c dbSNP:528153554
397 397 a, c dbSNP:138648196
402 402 g, t dbSNP:566249629
403 403 c, t dbSNP:539786097
415 415 c, t dbSNP:114874465
427 427 a, g dbSNP:188321235
456 456 a, c dbSNP:537059018
522 522 a, g dbSNP:555309362
523 523 c, t dbSNP:181897613
565 565 a, g dbSNP:749047276
567 567 c, g dbSNP:770787708
568 568 a, c, g, t dbSNP:778383576
570 570 c, g, t dbSNP:368027099
573 573 a, g dbSNP:557157256
574 574 a, c, g dbSNP:372270864
576 576 c, t dbSNP:763187872
577 577 a, c dbSNP:766779845
578 578 a, g dbSNP:774369555
580 580 c, g dbSNP:759797809
588 588 c, t dbSNP:767784488
590 590 -, agcccc dbSNP:747194253
593 593 c, t dbSNP:575630622
595 595 c, t dbSNP:756223516
598 598 a, c, g dbSNP:376206035
602 602 c, t dbSNP:753833720
618 618 -, gct dbSNP:769021838
631 631 a, g dbSNP:756947825
632 632 a, g dbSNP:778776233
639 639 c, t dbSNP:745720792
640 640 a, g dbSNP:4647942
644 644 -, gcc dbSNP:776508642
647 647 g, t dbSNP:779902508
649 649 a, c dbSNP:746487161
656 656 c, g dbSNP:768315040
659 659 a, g dbSNP:773807067
661 661 c, t dbSNP:760894803
662 662 a, c dbSNP:547113709
664 664 c, g dbSNP:776762633
668 668 a, g dbSNP:761850703
673 673 a, g dbSNP:765191650
675 675 c, t dbSNP:78299800
679 679 c, g dbSNP:762788863
682 682 g, t dbSNP:766291232
686 686 a, g dbSNP:751465034
692 692 c, t dbSNP:754661810
693 693 a, g dbSNP:557619683
694 694 a, g dbSNP:201988101
697 697 c, g dbSNP:755606953
699 699 g, t dbSNP:199787006
704 704 c, t dbSNP:746384176
705 705 a, g dbSNP:772358818
713 713 c, t dbSNP:780395159
714 714 a, g dbSNP:747436071
718 718 c, t dbSNP:768846760
719 719 c, g dbSNP:776759278
720 720 c, t dbSNP:761913241
721 721 g, t dbSNP:373335067
722 722 c, t dbSNP:769788707
723 723 a, g dbSNP:375489366
737 737 a, g, t dbSNP:550722940
740 740 a, g dbSNP:766480123
742 742 g, t dbSNP:751377059
750 750 c, t dbSNP:759444080
751 751 a, g dbSNP:767154264
753 753 c, t dbSNP:752311377
754 754 a, g dbSNP:569083517
755 755 c, t dbSNP:777150201
757 757 a, g dbSNP:753416769
761 761 a, c dbSNP:758895914
764 764 a, g dbSNP:780591496
769 769 a, g dbSNP:747346476
778 778 c, t dbSNP:201067344
782 782 c, g, t dbSNP:191062034
783 783 a, g dbSNP:769847502
785 785 a, t dbSNP:773150815
787 787 c, t dbSNP:749427340
793 793 c, t dbSNP:770960248
796 796 a, c, t dbSNP:372553975
803 803 a, g dbSNP:759352019
806 806 c, t dbSNP:767226381
807 807 a, g dbSNP:775138464
812 812 c, t dbSNP:760242543
813 813 a, g dbSNP:763867368
814 814 a, c, t dbSNP:61733101
815 815 a, g dbSNP:766832234
821 821 c, t dbSNP:533496126
822 822 c, t dbSNP:776843445
829 829 a, g dbSNP:781415322
832 832 g, t dbSNP:748603105
841 841 c, g dbSNP:756265844
845 845 a, c, g dbSNP:377619943
851 851 c, t dbSNP:369657280
852 852 a, g dbSNP:774368943
857 857 a, g dbSNP:71604335
862 862 c, t dbSNP:558236459
865 865 c, t dbSNP:576840405
866 866 a, g dbSNP:200736918
867 867 c, t dbSNP:142763226
871 871 c, g, t dbSNP:113418020
872 872 c, g dbSNP:776300560
878 878 a, g dbSNP:371631827
880 880 a, g dbSNP:147343114
882 882 c, t dbSNP:757572064
883 883 a, c, t dbSNP:751997519
886 886 c, t dbSNP:768117149
889 889 c, t dbSNP:752971788
895 895 c, t dbSNP:756531169
896 896 a, g dbSNP:778092068
898 898 c, t dbSNP:754122283
900 900 a, g dbSNP:757336835
903 903 g, t dbSNP:779128594
906 906 a, g dbSNP:746021134
907 907 c, t dbSNP:771885034
908 908 a, g dbSNP:372607043
914 914 -, ta dbSNP:762347391
915 915 a, g dbSNP:746746134
916 916 c, t dbSNP:139057147
918 918 c, t dbSNP:377060032
919 919 a, c, t dbSNP:200350712
922 922 c, t dbSNP:781572073
923 923 a, g dbSNP:772572830
925 925 c, t dbSNP:762562937
926 926 a, g dbSNP:767870668
932 932 c, g dbSNP:753268976
933 933 a, g dbSNP:781145411
937 937 c, t dbSNP:747896165
938 938 a, g dbSNP:758696948
944 944 c, t dbSNP:755924836
948 948 a, g dbSNP:777232211
954 954 a, t dbSNP:748971007
958 958 c, t dbSNP:371664807
964 964 g, t dbSNP:770552349
965 965 c, t dbSNP:773895801
967 967 c, t dbSNP:745417758
968 968 a, g dbSNP:769257115
969 969 a, g dbSNP:556264405
976 976 c, t dbSNP:762223132
984 984 a, g, t dbSNP:765652265
992 992 a, g dbSNP:763233631
993 993 a, c dbSNP:766569185
995 995 a, c dbSNP:751619106
997 997 c, t dbSNP:376193356
1005 1005 a, c dbSNP:767392280
1010 1010 g, t dbSNP:752643862
1013 1013 a, g dbSNP:755840443
1017 1017 a, g dbSNP:749613570
1020 1020 c, g dbSNP:771210370
1021 1021 a, g dbSNP:774485968
1022 1022 c, t dbSNP:201696860
1026 1026 c, t dbSNP:772338165
1050 1050 a, g dbSNP:775524754
1052 1052 c, t dbSNP:760707374
1057 1057 c, g dbSNP:764055305
1064 1064 c, t dbSNP:753743806
1065 1065 a, g dbSNP:761612724
1069 1069 a, c, g, t dbSNP:113814624
1070 1070 a, g dbSNP:779904701
1079 1079 a, t dbSNP:751051234
1081 1081 c, t dbSNP:140852364
1082 1082 a, g dbSNP:778281827
1085 1085 c, t dbSNP:749760188
1086 1086 a, g dbSNP:771531742
1096 1096 c, t dbSNP:779235733
1097 1097 a, g dbSNP:377175884
1102 1102 c, g dbSNP:772250235
1115 1115 c, t dbSNP:775719058
1116 1116 a, g dbSNP:760761457
1117 1117 g, t dbSNP:768632874
1120 1120 a, c, t dbSNP:776565730
1121 1121 a, g dbSNP:201262483
1127 1127 a, t dbSNP:773123389
1128 1128 c, t dbSNP:762884996
1129 1129 a, g dbSNP:766091807
1141 1141 c, t dbSNP:200618237
1155 1155 a, c, t dbSNP:369436907
1156 1156 a, g dbSNP:199798050
1157 1157 c, t dbSNP:757739388
1158 1158 a, g, t dbSNP:4647937
1159 1159 c, t dbSNP:374115931
1166 1166 a, g, t dbSNP:758783277
1168 1168 c, t dbSNP:144863877
1169 1169 a, g, t dbSNP:768990087
1180 1180 -, gaa dbSNP:773886054
1189 1189 a, g dbSNP:547516754
1190 1190 g, t dbSNP:769826602
1194 1194 c, t dbSNP:773316252
1195 1195 a, g dbSNP:762776382
1198 1198 a, g dbSNP:766278654
1214 1214 c, t dbSNP:774266040
1215 1215 a, g dbSNP:759093103
1218 1218 c, t dbSNP:767248157
1219 1219 a, g dbSNP:752117207
1222 1222 a, g dbSNP:755650629
1228 1228 c, t dbSNP:765681967
1229 1229 g, t dbSNP:752653233
1238 1238 a, c dbSNP:565792759
1244 1244 c, t dbSNP:148556821
1245 1245 a, g dbSNP:780279438
1246 1246 c, t dbSNP:747464840
1252 1252 a, c, g dbSNP:144361678
1256 1256 c, t dbSNP:201667493
1257 1257 a, g dbSNP:146608674
1260 1260 c, t dbSNP:773213801
1261 1261 a, g dbSNP:749230766
1264 1264 c, t dbSNP:771046121
1273 1273 c, t dbSNP:773991255
1276 1276 c, t dbSNP:759415964
1282 1282 c, t dbSNP:771584275
1301 1301 c, t dbSNP:768269824
1302 1302 a, g dbSNP:776300610
1303 1303 a, g dbSNP:116837147
1307 1307 c, g, t dbSNP:143714694
1311 1311 c, t dbSNP:543347696
1317 1317 c, t dbSNP:768184121
1318 1318 c, t dbSNP:114935241
1319 1319 a, g dbSNP:368039756
1323 1323 g, t dbSNP:764362615
1329 1329 a, g dbSNP:754124213
1332 1332 c, t dbSNP:757215836
1333 1333 a, g dbSNP:765357209
1335 1335 a, g dbSNP:750528701
1339 1339 a, c, t dbSNP:140460823
1340 1340 a, g dbSNP:746770205
1347 1347 c, t dbSNP:754793602
1348 1348 a, g dbSNP:780767290
1351 1351 a, g dbSNP:747844379
1352 1352 a, g dbSNP:769387185
1354 1354 a, g dbSNP:772753740
1359 1359 c, t dbSNP:748784356
1360 1360 c, t dbSNP:371754554
1361 1361 g, t dbSNP:776162191
1363 1363 c, g dbSNP:758196459
1365 1365 a, g dbSNP:764556581
1371 1371 c, t dbSNP:776925588
1372 1372 a, g dbSNP:540991862
1391 1391 c, g dbSNP:765429291
1392 1392 a, g dbSNP:370772573
1396 1396 c, t dbSNP:758442194
1397 1397 a, g dbSNP:766259424
1399 1399 c, t dbSNP:751514315
1400 1400 a, g dbSNP:754703776
1408 1408 a, g dbSNP:58679007
1412 1412 a, c dbSNP:747940022
1414 1414 c, t dbSNP:532862696
1422 1422 -, gaa dbSNP:757673940
1427 1427 c, t dbSNP:777318066
1428 1428 a, g dbSNP:372119720
1429 1429 c, g, t dbSNP:770577862
1430 1430 g, t dbSNP:376072293
1438 1438 c, t dbSNP:769346621
1439 1439 a, g dbSNP:777032994
1441 1441 c, t dbSNP:762124519
1442 1442 a, g dbSNP:770019120
1444 1444 c, t dbSNP:138109269
1445 1445 a, g dbSNP:200852436
1447 1447 g, t dbSNP:564517711
1448 1448 a, g dbSNP:149112646
1452 1452 a, g dbSNP:759443799
1453 1453 c, t dbSNP:767391975
1456 1456 c, t dbSNP:370405185
1457 1457 a, g dbSNP:752493793
1458 1458 a, g dbSNP:755880461
1459 1459 c, t dbSNP:777425704
1466 1466 a, g dbSNP:753437773
1468 1468 c, g dbSNP:757035366
1469 1469 a, g, t dbSNP:532080560
1470 1470 a, g dbSNP:372708838
1471 1471 c, t dbSNP:4647946
1474 1474 a, g dbSNP:781580876
1477 1477 c, g, t dbSNP:138843839
1478 1478 a, g dbSNP:773419444
1499 1499 c, t dbSNP:763160215
1500 1500 c, t dbSNP:568375042
1503 1503 c, t dbSNP:774380288
1504 1504 a, g dbSNP:375942692
1510 1510 c, t dbSNP:142743042
1511 1511 a, c, g dbSNP:529265854
1518 1518 c, t dbSNP:200863947
1521 1521 a, g dbSNP:370584141
1524 1524 a, c dbSNP:756949305
1525 1525 c, t dbSNP:778748309
1526 1526 a, g dbSNP:749914986
1528 1528 c, t dbSNP:147385493
1537 1537 c, t dbSNP:781684420
1540 1540 c, t dbSNP:748610298
1549 1549 g, t dbSNP:756715366
1552 1552 c, g, t dbSNP:202228086
1554 1554 g, t dbSNP:771097582
1555 1555 c, t dbSNP:774575940
1559 1559 c, t dbSNP:745887685
1560 1560 a, g dbSNP:147980100
1562 1562 a, g dbSNP:200153294
1565 1565 c, t dbSNP:760516188
1566 1566 a, g dbSNP:374222149
1567 1567 c, t dbSNP:368634271
1569 1569 a, g dbSNP:761732244
1570 1570 a, g dbSNP:141649779
1572 1572 a, g dbSNP:750115262
1573 1573 c, t dbSNP:757861533
1576 1576 c, t dbSNP:765806312
1577 1577 g, t dbSNP:751142885
1578 1578 c, t dbSNP:756543798
1579 1579 a, g dbSNP:778280412
1588 1588 c, t dbSNP:749603726
1589 1589 a, g dbSNP:757629043
1600 1600 c, t dbSNP:138509526
1607 1607 a, t dbSNP:746084833
1610 1610 a, g dbSNP:139387602
1621 1621 a, c dbSNP:775409417
1624 1624 a, c dbSNP:747154466
1625 1625 c, t dbSNP:768438794
1630 1630 c, t dbSNP:776735135
1631 1631 a, g dbSNP:374309032
1642 1642 c, t dbSNP:765131320
1660 1660 -, c dbSNP:369065988
1662 1662 c, t dbSNP:771759616
1663 1663 a, c, g dbSNP:537262686
1665 1665 a, c dbSNP:4647930
1667 1667 g, t dbSNP:773783296
1674 1674 c, t dbSNP:763163157
1678 1678 a, g dbSNP:745740200
1686 1686 c, t dbSNP:368961378
1687 1687 a, g dbSNP:755231134
1692 1692 c, t dbSNP:767896163
1693 1693 a, g dbSNP:752771234
1694 1694 a, g dbSNP:756272863
1695 1695 c, g dbSNP:567597911
1706 1706 c, t dbSNP:749241683
1707 1707 c, t dbSNP:371943795
1709 1709 a, c, t dbSNP:778745736
1710 1710 a, g dbSNP:376903367
1713 1713 c, t dbSNP:775146211
1714 1714 c, t dbSNP:111246053
1715 1715 a, g dbSNP:201440347
1723 1723 c, g, t dbSNP:146112374
1724 1724 a, g dbSNP:766847951
1727 1727 a, c dbSNP:774750247
1730 1730 c, t dbSNP:373660136
1735 1735 a, c, t dbSNP:140148549
1738 1738 c, t dbSNP:375677549
1739 1739 a, g dbSNP:202037959
1740 1740 c, g dbSNP:753912109
1744 1744 c, g dbSNP:757186468
1748 1748 a, c dbSNP:778746987
1763 1763 c, t dbSNP:745613727
1765 1765 c, g dbSNP:758203364
1777 1777 c, t dbSNP:779615534
1781 1781 c, g dbSNP:746661915
1794 1794 c, t dbSNP:768252857
1795 1795 a, g dbSNP:776185476
1800 1800 a, c dbSNP:747654089
1801 1801 a, c dbSNP:577572432
1804 1804 c, t dbSNP:201062727
1805 1805 a, g dbSNP:373506035
1806 1806 c, t dbSNP:759910460
1807 1807 a, g dbSNP:61734883
1813 1813 c, g dbSNP:776053533
1814 1814 c, t dbSNP:760955260
1825 1825 a, t dbSNP:764261493
1829 1829 a, c, g dbSNP:201377348
1831 1831 c, t dbSNP:370211317
1832 1832 c, t dbSNP:750366202
1834 1834 c, g dbSNP:758398284
1836 1836 a, c, t dbSNP:200338999
1837 1837 a, g dbSNP:754631527
1839 1839 a, c, t dbSNP:375985073
1840 1840 a, g dbSNP:201785648
1844 1844 a, t dbSNP:777488330
1845 1845 a, c, t dbSNP:746360727
1846 1846 a, g dbSNP:375150331
1847 1847 a, g dbSNP:760976677
1850 1850 c, t dbSNP:368437012
1851 1851 a, g, t dbSNP:4647931
1852 1852 c, t dbSNP:765297271
1853 1853 a, g dbSNP:750561767
1854 1854 a, g dbSNP:374653229
1856 1856 c, t dbSNP:766347101
1857 1857 a, c, g, t dbSNP:751318362
1858 1858 c, t dbSNP:752283163
1861 1861 c, t dbSNP:367617448
1862 1862 a, g dbSNP:200822222
1865 1865 a, g dbSNP:376736117
1869 1869 a, g dbSNP:367966622
1873 1873 c, t dbSNP:772665357
1880 1880 c, t dbSNP:780728675
1881 1881 c, t dbSNP:747340530
1882 1882 a, c, g dbSNP:145786390
1888 1888 c, t dbSNP:748306032
1889 1889 a, g dbSNP:770052916
1897 1897 c, t dbSNP:371849695
1898 1898 a, g dbSNP:376400181
1899 1899 c, t dbSNP:766259286
1903 1903 a, c dbSNP:774173217
1908 1908 c, g dbSNP:759581394
1914 1914 a, g dbSNP:767199588
1918 1918 a, g dbSNP:551721504
1925 1925 a, g dbSNP:755794980
1927 1927 a, c, g dbSNP:200350207
1928 1928 c, t dbSNP:756840934
1929 1929 a, g dbSNP:182915641
1933 1933 a, g dbSNP:747467662
1938 1938 c, t dbSNP:755567722
1939 1939 a, g dbSNP:373825808
1944 1944 -, ccc dbSNP:765638279
1944 1944 c, t dbSNP:748588827
1946 1946 c, t dbSNP:549237929
1947 1947 c, t dbSNP:773448649
1953 1953 a, c, g dbSNP:567468058
1957 1957 a, g dbSNP:774561854
1958 1958 c, t dbSNP:769491696
1962 1962 a, g, t dbSNP:767542507
1963 1963 c, t dbSNP:148505744
1970 1970 c, g dbSNP:80019124
1971 1971 a, c, t dbSNP:4647932
1980 1980 a, g dbSNP:764647868
1982 1982 c, t dbSNP:749989018
1998 1998 a, c, g dbSNP:755416353
2003 2003 c, t dbSNP:375421159
2009 2009 -, gacatc dbSNP:750976145
2013 2013 -, tc dbSNP:758856602
2013 2013 c, t dbSNP:756472488
2014 2014 -, ca, caca, cacaca dbSNP:751700498
2015 2015 -, cacaca dbSNP:769679151
2015 2015 -, caca dbSNP:781628478
2015 2015 -, ca dbSNP:145808953
2015 2015 c, g dbSNP:571486674
2016 2016 -, caca dbSNP:747154781
2016 2016 a, c dbSNP:749511854
2017 2017 c, t dbSNP:771187237
2018 2018 a, g dbSNP:778839265
2022 2022 -, cacacacacacactct dbSNP:777542278
2025 2025 c, t dbSNP:745984551
2026 2026 -, cacacacactct dbSNP:770799450
2027 2027 -, cacacacactct dbSNP:749212877
2033 2033 -, cact dbSNP:773797947
2035 2035 -, ct dbSNP:759055320
2035 2035 c, t dbSNP:771866499
2036 2036 a, t dbSNP:775503014
2037 2037 c, g dbSNP:199548478
2039 2039 -, cacacacactca dbSNP:771696328
2039 2039 -, caca dbSNP:775168543
2042 2042 a, t dbSNP:768557913
2044 2044 a, g dbSNP:776633899
2050 2050 a, g dbSNP:761525836
2052 2052 a, g dbSNP:372496076
2053 2053 c, t dbSNP:749851372
2054 2054 a, g dbSNP:138327840
2061 2061 a, g dbSNP:149625647
2069 2069 c, t dbSNP:753212127
2085 2085 a, g dbSNP:111608568
2086 2086 g, t dbSNP:144318134
2097 2097 c, t dbSNP:370665283
2098 2098 a, g dbSNP:554196152
2102 2102 c, t dbSNP:779229022
2103 2103 c, t dbSNP:748164211
2104 2104 a, g dbSNP:372960046
2119 2119 -, c dbSNP:762050692
2121 2121 -, g dbSNP:765594414
2122 2122 c, g dbSNP:541578778
2123 2123 c, g, t dbSNP:377284409
2126 2126 a, g dbSNP:768753902
2127 2127 a, g dbSNP:370871387
2129 2129 c, g, t dbSNP:761720392
2130 2130 a, g dbSNP:777973033
2132 2132 c, t dbSNP:578178286
2154 2154 c, t dbSNP:545104718
2161 2161 c, t dbSNP:749451713
2173 2173 c, t dbSNP:563689502
2174 2174 c, g dbSNP:531075308
2201 2201 a, g dbSNP:61007088
2203 2203 c, t dbSNP:552234059
2212 2212 c, t dbSNP:561328425
2218 2218 g, t dbSNP:528313149
2237 2237 c, t dbSNP:771227332
2247 2247 -, ac dbSNP:147695405
2261 2261 -, acac dbSNP:113926759
2269 2269 a, g dbSNP:546746341
2272 2272 a, g dbSNP:4647939
2276 2276 a, g dbSNP:746826540
2281 2281 c, t dbSNP:532423431
2284 2284 a, g dbSNP:768657932
2286 2286 a, g dbSNP:534686121
2295 2295 c, t dbSNP:568514652
2300 2300 a, g dbSNP:371059354
2301 2301 c, t dbSNP:546391446
2302 2302 a, g dbSNP:554259719
2307 2307 c, t dbSNP:761910406
2321 2321 c, g dbSNP:566202202
2328 2328 c, t dbSNP:568598861
2330 2330 -, cg dbSNP:201031675
2332 2332 -, cacaca dbSNP:761442334
2332 2332 -, ca dbSNP:4647945
2333 2333 a, g dbSNP:772827102
2337 2337 -, ac dbSNP:372298935
2338 2338 c, t dbSNP:534932929
2356 2356 c, t dbSNP:553513239
2357 2357 c, t dbSNP:147461484
2358 2358 a, g dbSNP:545679240
2367 2367 c, t dbSNP:557228247
2381 2381 c, g dbSNP:573619022
2390 2390 a, c dbSNP:73070424
2391 2391 a, g dbSNP:115824203
2393 2393 a, g dbSNP:561393016
2394 2394 c, g dbSNP:187595155
2396 2396 c, t dbSNP:751872526
2405 2405 a, g dbSNP:562604726
2418 2418 c, t dbSNP:755346435
2423 2423 a, g dbSNP:540089482
2441 2441 g, t dbSNP:565082475
2442 2442 -, acac dbSNP:575306605
2444 2444 a, g dbSNP:767940786
2447 2447 a, c, t dbSNP:753195481
2448 2448 a, g dbSNP:575572545
2456 2456 a, g dbSNP:372948683
2459 2459 c, t dbSNP:139909269
2460 2460 a, g dbSNP:116173564
2477 2477 -, acac dbSNP:751956500
2477 2477 -, ac dbSNP:376462828
2479 2479 -, ac dbSNP:748391991
2490 2490 c, t dbSNP:529661387
2493 2493 a, g dbSNP:779210431
2509 2509 c, t dbSNP:746734756
2510 2510 a, g dbSNP:768568238
2511 2511 -, cacacacgtgcagatatggtatccgga dbSNP:533634308
2517 2517 a, c, t dbSNP:11538025
2518 2518 a, g dbSNP:201858459
2519 2519 -, tgca dbSNP:369182316
2523 2523 -, gatatggtatccggacacacacgtgca dbSNP:35896028
2529 2529 ctg, gta dbSNP:386670451
2531 2531 a, g dbSNP:533874850
2534 2534 c, t dbSNP:377108343
2538 2538 -, gc dbSNP:376865502
2541 2541 a, g dbSNP:772556487
2547 2547 a, g dbSNP:762546540
2552 2552 g, t dbSNP:571817420
2553 2553 a, t dbSNP:765885844
2560 2560 g, t dbSNP:538817789
2562 2562 c, t dbSNP:192541751
2564 2564 g, t dbSNP:575982814
2573 2573 c, g dbSNP:773993761
2586 2586 g, t dbSNP:28602600
2587 2587 -, ac dbSNP:762493335
2588 2588 a, t dbSNP:759248664
2601 2601 c, t dbSNP:756451035
2602 2602 a, g dbSNP:543072483
2614 2614 -, ac dbSNP:56398186
2615 2615 -, ac dbSNP:781533771
2616 2616 -, ac dbSNP:771747710
2618 2618 c, g dbSNP:554987351
2629 2629 acgt, gc dbSNP:386670452
2630 2630 -, ac dbSNP:397935892
2630 2630 c, t dbSNP:560739572
2631 2631 a, g dbSNP:199852820
2632 2632 c, t dbSNP:1064838
2642 2642 c, t dbSNP:576981416
2648 2648 a, g dbSNP:573172534
2649 2649 c, t dbSNP:28668809
2655 2655 c, t dbSNP:543974698
2657 2657 c, g, t dbSNP:1064839
2663 2663 c, t dbSNP:529919727
2687 2687 a, t dbSNP:547820432
2705 2705 c, g dbSNP:764687219
2735 2735 c, t dbSNP:559712155
2738 2738 a, g dbSNP:527237566
2753 2753 a, g dbSNP:184928800
2756 2756 -, caca dbSNP:570296680
2756 2756 -, ca dbSNP:751002701
2757 2757 -, ca dbSNP:760257693
2759 2759 -, ca dbSNP:529106784
2762 2762 c, t dbSNP:142792896
2765 2765 a, g dbSNP:539246283
2766 2766 -, ac dbSNP:35640602
2766 2766 c, t dbSNP:551177228
2773 2773 a, g dbSNP:569605885
2781 2781 c, t dbSNP:536936448
2782 2782 a, g dbSNP:151232580
2793 2793 c, t dbSNP:573197554
2794 2794 a, g dbSNP:115679552
2804 2804 a, g dbSNP:559031465
2807 2807 c, t dbSNP:758744980
2810 2810 c, t dbSNP:781101014
2814 2814 c, t dbSNP:577245313
2817 2817 -, acac dbSNP:369250502
2819 2819 -, ac dbSNP:776639287
2826 2826 c, t dbSNP:544033211
2831 2831 a, g dbSNP:562331083
2839 2839 a, g dbSNP:574437474
2841 2841 c, t dbSNP:574683299
2848 2848 -, ac dbSNP:538923386
2856 2856 a, g dbSNP:560149049
2857 2857 -, ca dbSNP:57445348
2869 2869 c, g dbSNP:187572457
2886 2886 a, g dbSNP:551862508
2895 2895 c, t dbSNP:564238440
2903 2903 -, ac dbSNP:542089125
2911 2911 -, at dbSNP:34428342
2945 2945 c, t dbSNP:531419076
2946 2946 a, g dbSNP:370714398
2958 2958 c, t dbSNP:569472053
2962 2962 c, t dbSNP:192813350
2967 2967 -, acac dbSNP:528378155
2972 2972 c, t dbSNP:4647936
2973 2973 a, g dbSNP:4647943
2976 2976 c, t dbSNP:748675670
2977 2977 a, g dbSNP:567024820
2989 2989 a, g dbSNP:140919592
3012 3012 a, c dbSNP:534225926
3013 3013 c, t dbSNP:770466875
3014 3014 a, g dbSNP:558664418
3022 3022 a, g dbSNP:577305280
3025 3025 -, ca dbSNP:748899241
3037 3037 c, t dbSNP:530852681
3042 3042 a, t dbSNP:537942579
3052 3052 -, ac dbSNP:201331455
3058 3058 c, t dbSNP:545798369
3063 3063 a, g dbSNP:556189339
3068 3068 a, c, t dbSNP:189183107
3077 3077 -, g dbSNP:778748230
3089 3089 c, t dbSNP:3733350
3112 3112 c, t dbSNP:573362339
3113 3113 a, g dbSNP:775786632
3152 3152 c, t dbSNP:572227834
3172 3172 c, t dbSNP:545820664
3173 3173 c, t dbSNP:370896791
3179 3179 -, tgtccccgcctc dbSNP:376088822
3179 3179 a, t dbSNP:148837233
3185 3185 c, t dbSNP:543546237
3186 3186 g, t dbSNP:143441743
3197 3197 c, t dbSNP:561727372
3203 3203 -, catccccgcctc dbSNP:4647941
3204 3204 a, g dbSNP:370377465
3209 3209 c, t dbSNP:530339594
3231 3231 c, t dbSNP:192584184
3243 3243 c, t dbSNP:548473385
3250 3250 c, g dbSNP:567188360
3269 3269 c, g dbSNP:527966255
3274 3274 c, t dbSNP:748302174
3296 3296 a, g dbSNP:4647938
3310 3310 a, g dbSNP:778080073
3318 3318 a, g dbSNP:570513184
3351 3351 c, g dbSNP:4647940
3360 3360 -, c dbSNP:544137988
3372 3372 c, g dbSNP:568107933
3414 3414 a, g dbSNP:762285982
3415 3415 a, t dbSNP:765388428
3431 3431 a, g dbSNP:556256579
3470 3470 c, t dbSNP:568189259
3477 3477 c, t dbSNP:113502766
3478 3478 a, g dbSNP:758652958
3509 3509 c, t dbSNP:377102874
3512 3512 c, t dbSNP:780444862
3513 3513 a, g dbSNP:114230525
3515 3515 c, t dbSNP:762308289
3521 3521 c, t dbSNP:765895558
3529 3529 -, c dbSNP:59896854
3535 3535 -, c dbSNP:397941425
3535 3535 c, t dbSNP:375839578
3546 3546 c, g, t dbSNP:545776199
3560 3560 a, t dbSNP:764609587
3562 3562 a, c dbSNP:777493059
3565 3565 g, t dbSNP:557985553
3587 3587 g, t dbSNP:754163645
3588 3588 a, c, g dbSNP:148169986
3592 3592 a, g dbSNP:749233111
3597 3597 c, t dbSNP:770901335
3598 3598 a, g dbSNP:750645767
3600 3600 a, g dbSNP:778356397
3604 3604 c, t dbSNP:118095428
3640 3640 c, t dbSNP:141073382
3641 3641 c, t dbSNP:745408023

Target ORF information:

RefSeq Version XM_011513487
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu03560
Accession Version NM_021923.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1515bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu03560D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor-like 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ277437.1, BC036769.1 and BC013955.2. On Sep 13, 2004 this sequence version replaced gi:13112053. Summary: The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) has an alternate 5' UTR, and encodes the same isoform, as compared to variant 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ277437.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)119..370(+)
Misc Feature(2)161..370(+)
Misc Feature(3)491..736(+)
Misc Feature(4)497..511(+)
Misc Feature(5)500..535(+)
Misc Feature(6)515..706(+)
Misc Feature(7)779..1087(+)
Misc Feature(8)803..1090(+)
Misc Feature(9)1157..1219(+)
Exon (1)1..101
Gene Synonym:
Exon (2)102..374
Gene Synonym:
Exon (3)375..455
Gene Synonym:
Exon (4)456..740
Gene Synonym:
Exon (5)741..1094
Gene Synonym:
Exon (6)1095..3088
Gene Synonym:
Position Chain Variation Link
3 3 c, t dbSNP:777733998
7 7 a, g dbSNP:749047276
9 9 c, g dbSNP:770787708
10 10 a, c, g, t dbSNP:778383576
12 12 c, g, t dbSNP:368027099
15 15 a, g dbSNP:557157256
16 16 a, c, g dbSNP:372270864
18 18 c, t dbSNP:763187872
19 19 a, c dbSNP:766779845
20 20 a, g dbSNP:774369555
22 22 c, g dbSNP:759797809
30 30 c, t dbSNP:767784488
32 32 -, agcccc dbSNP:747194253
35 35 c, t dbSNP:575630622
37 37 c, t dbSNP:756223516
40 40 a, c, g dbSNP:376206035
44 44 c, t dbSNP:753833720
60 60 -, gct dbSNP:769021838
73 73 a, g dbSNP:756947825
74 74 a, g dbSNP:778776233
81 81 c, t dbSNP:745720792
82 82 a, g dbSNP:4647942
86 86 -, gcc dbSNP:776508642
89 89 g, t dbSNP:779902508
91 91 a, c dbSNP:746487161
98 98 c, g dbSNP:768315040
101 101 a, g dbSNP:773807067
103 103 c, t dbSNP:760894803
104 104 a, c dbSNP:547113709
106 106 c, g dbSNP:776762633
110 110 a, g dbSNP:761850703
115 115 a, g dbSNP:765191650
117 117 c, t dbSNP:78299800
121 121 c, g dbSNP:762788863
124 124 g, t dbSNP:766291232
128 128 a, g dbSNP:751465034
134 134 c, t dbSNP:754661810
135 135 a, g dbSNP:557619683
136 136 a, g dbSNP:201988101
139 139 c, g dbSNP:755606953
141 141 g, t dbSNP:199787006
146 146 c, t dbSNP:746384176
147 147 a, g dbSNP:772358818
155 155 c, t dbSNP:780395159
156 156 a, g dbSNP:747436071
160 160 c, t dbSNP:768846760
161 161 c, g dbSNP:776759278
162 162 c, t dbSNP:761913241
163 163 g, t dbSNP:373335067
164 164 c, t dbSNP:769788707
165 165 a, g dbSNP:375489366
179 179 a, g, t dbSNP:550722940
182 182 a, g dbSNP:766480123
184 184 g, t dbSNP:751377059
192 192 c, t dbSNP:759444080
193 193 a, g dbSNP:767154264
195 195 c, t dbSNP:752311377
196 196 a, g dbSNP:569083517
197 197 c, t dbSNP:777150201
199 199 a, g dbSNP:753416769
203 203 a, c dbSNP:758895914
206 206 a, g dbSNP:780591496
211 211 a, g dbSNP:747346476
220 220 c, t dbSNP:201067344
224 224 c, g, t dbSNP:191062034
225 225 a, g dbSNP:769847502
227 227 a, t dbSNP:773150815
229 229 c, t dbSNP:749427340
235 235 c, t dbSNP:770960248
238 238 a, c, t dbSNP:372553975
245 245 a, g dbSNP:759352019
248 248 c, t dbSNP:767226381
249 249 a, g dbSNP:775138464
254 254 c, t dbSNP:760242543
255 255 a, g dbSNP:763867368
256 256 a, c, t dbSNP:61733101
257 257 a, g dbSNP:766832234
263 263 c, t dbSNP:533496126
264 264 c, t dbSNP:776843445
271 271 a, g dbSNP:781415322
274 274 g, t dbSNP:748603105
283 283 c, g dbSNP:756265844
287 287 a, c, g dbSNP:377619943
293 293 c, t dbSNP:369657280
294 294 a, g dbSNP:774368943
299 299 a, g dbSNP:71604335
304 304 c, t dbSNP:558236459
307 307 c, t dbSNP:576840405
308 308 a, g dbSNP:200736918
309 309 c, t dbSNP:142763226
313 313 c, g, t dbSNP:113418020
314 314 c, g dbSNP:776300560
320 320 a, g dbSNP:371631827
322 322 a, g dbSNP:147343114
324 324 c, t dbSNP:757572064
325 325 a, c, t dbSNP:751997519
328 328 c, t dbSNP:768117149
331 331 c, t dbSNP:752971788
337 337 c, t dbSNP:756531169
338 338 a, g dbSNP:778092068
340 340 c, t dbSNP:754122283
342 342 a, g dbSNP:757336835
345 345 g, t dbSNP:779128594
348 348 a, g dbSNP:746021134
349 349 c, t dbSNP:771885034
350 350 a, g dbSNP:372607043
356 356 -, ta dbSNP:762347391
357 357 a, g dbSNP:746746134
358 358 c, t dbSNP:139057147
360 360 c, t dbSNP:377060032
361 361 a, c, t dbSNP:200350712
364 364 c, t dbSNP:781572073
365 365 a, g dbSNP:772572830
367 367 c, t dbSNP:762562937
368 368 a, g dbSNP:767870668
374 374 c, g dbSNP:753268976
375 375 a, g dbSNP:781145411
379 379 c, t dbSNP:747896165
380 380 a, g dbSNP:758696948
386 386 c, t dbSNP:755924836
390 390 a, g dbSNP:777232211
396 396 a, t dbSNP:748971007
400 400 c, t dbSNP:371664807
406 406 g, t dbSNP:770552349
407 407 c, t dbSNP:773895801
409 409 c, t dbSNP:745417758
410 410 a, g dbSNP:769257115
411 411 a, g dbSNP:556264405
418 418 c, t dbSNP:762223132
426 426 a, g, t dbSNP:765652265
434 434 a, g dbSNP:763233631
435 435 a, c dbSNP:766569185
437 437 a, c dbSNP:751619106
439 439 c, t dbSNP:376193356
447 447 a, c dbSNP:767392280
452 452 g, t dbSNP:752643862
455 455 a, g dbSNP:755840443
459 459 a, g dbSNP:749613570
462 462 c, g dbSNP:771210370
463 463 a, g dbSNP:774485968
464 464 c, t dbSNP:201696860
468 468 c, t dbSNP:772338165
492 492 a, g dbSNP:775524754
494 494 c, t dbSNP:760707374
499 499 c, g dbSNP:764055305
506 506 c, t dbSNP:753743806
507 507 a, g dbSNP:761612724
511 511 a, c, g, t dbSNP:113814624
512 512 a, g dbSNP:779904701
521 521 a, t dbSNP:751051234
523 523 c, t dbSNP:140852364
524 524 a, g dbSNP:778281827
527 527 c, t dbSNP:749760188
528 528 a, g dbSNP:771531742
538 538 c, t dbSNP:779235733
539 539 a, g dbSNP:377175884
544 544 c, g dbSNP:772250235
557 557 c, t dbSNP:775719058
558 558 a, g dbSNP:760761457
559 559 g, t dbSNP:768632874
562 562 a, c, t dbSNP:776565730
563 563 a, g dbSNP:201262483
569 569 a, t dbSNP:773123389
570 570 c, t dbSNP:762884996
571 571 a, g dbSNP:766091807
583 583 c, t dbSNP:200618237
597 597 a, c, t dbSNP:369436907
598 598 a, g dbSNP:199798050
599 599 c, t dbSNP:757739388
600 600 a, g, t dbSNP:4647937
601 601 c, t dbSNP:374115931
608 608 a, g, t dbSNP:758783277
610 610 c, t dbSNP:144863877
611 611 a, g, t dbSNP:768990087
622 622 -, gaa dbSNP:773886054
631 631 a, g dbSNP:547516754
632 632 g, t dbSNP:769826602
636 636 c, t dbSNP:773316252
637 637 a, g dbSNP:762776382
640 640 a, g dbSNP:766278654
656 656 c, t dbSNP:774266040
657 657 a, g dbSNP:759093103
660 660 c, t dbSNP:767248157
661 661 a, g dbSNP:752117207
664 664 a, g dbSNP:755650629
670 670 c, t dbSNP:765681967
671 671 g, t dbSNP:752653233
680 680 a, c dbSNP:565792759
686 686 c, t dbSNP:148556821
687 687 a, g dbSNP:780279438
688 688 c, t dbSNP:747464840
694 694 a, c, g dbSNP:144361678
698 698 c, t dbSNP:201667493
699 699 a, g dbSNP:146608674
702 702 c, t dbSNP:773213801
703 703 a, g dbSNP:749230766
706 706 c, t dbSNP:771046121
715 715 c, t dbSNP:773991255
718 718 c, t dbSNP:759415964
724 724 c, t dbSNP:771584275
743 743 c, t dbSNP:768269824
744 744 a, g dbSNP:776300610
745 745 a, g dbSNP:116837147
749 749 c, g, t dbSNP:143714694
753 753 c, t dbSNP:543347696
759 759 c, t dbSNP:768184121
760 760 c, t dbSNP:114935241
761 761 a, g dbSNP:368039756
765 765 g, t dbSNP:764362615
771 771 a, g dbSNP:754124213
774 774 c, t dbSNP:757215836
775 775 a, g dbSNP:765357209
777 777 a, g dbSNP:750528701
781 781 a, c, t dbSNP:140460823
782 782 a, g dbSNP:746770205
789 789 c, t dbSNP:754793602
790 790 a, g dbSNP:780767290
793 793 a, g dbSNP:747844379
794 794 a, g dbSNP:769387185
796 796 a, g dbSNP:772753740
801 801 c, t dbSNP:748784356
802 802 c, t dbSNP:371754554
803 803 g, t dbSNP:776162191
805 805 c, g dbSNP:758196459
807 807 a, g dbSNP:764556581
813 813 c, t dbSNP:776925588
814 814 a, g dbSNP:540991862
833 833 c, g dbSNP:765429291
834 834 a, g dbSNP:370772573
838 838 c, t dbSNP:758442194
839 839 a, g dbSNP:766259424
841 841 c, t dbSNP:751514315
842 842 a, g dbSNP:754703776
850 850 a, g dbSNP:58679007
854 854 a, c dbSNP:747940022
856 856 c, t dbSNP:532862696
864 864 -, gaa dbSNP:757673940
869 869 c, t dbSNP:777318066
870 870 a, g dbSNP:372119720
871 871 c, g, t dbSNP:770577862
872 872 g, t dbSNP:376072293
880 880 c, t dbSNP:769346621
881 881 a, g dbSNP:777032994
883 883 c, t dbSNP:762124519
884 884 a, g dbSNP:770019120
886 886 c, t dbSNP:138109269
887 887 a, g dbSNP:200852436
889 889 g, t dbSNP:564517711
890 890 a, g dbSNP:149112646
894 894 a, g dbSNP:759443799
895 895 c, t dbSNP:767391975
898 898 c, t dbSNP:370405185
899 899 a, g dbSNP:752493793
900 900 a, g dbSNP:755880461
901 901 c, t dbSNP:777425704
908 908 a, g dbSNP:753437773
910 910 c, g dbSNP:757035366
911 911 a, g, t dbSNP:532080560
912 912 a, g dbSNP:372708838
913 913 c, t dbSNP:4647946
916 916 a, g dbSNP:781580876
919 919 c, g, t dbSNP:138843839
920 920 a, g dbSNP:773419444
941 941 c, t dbSNP:763160215
942 942 c, t dbSNP:568375042
945 945 c, t dbSNP:774380288
946 946 a, g dbSNP:375942692
952 952 c, t dbSNP:142743042
953 953 a, c, g dbSNP:529265854
960 960 c, t dbSNP:200863947
963 963 a, g dbSNP:370584141
966 966 a, c dbSNP:756949305
967 967 c, t dbSNP:778748309
968 968 a, g dbSNP:749914986
970 970 c, t dbSNP:147385493
979 979 c, t dbSNP:781684420
982 982 c, t dbSNP:748610298
991 991 g, t dbSNP:756715366
994 994 c, g, t dbSNP:202228086
996 996 g, t dbSNP:771097582
997 997 c, t dbSNP:774575940
1001 1001 c, t dbSNP:745887685
1002 1002 a, g dbSNP:147980100
1004 1004 a, g dbSNP:200153294
1007 1007 c, t dbSNP:760516188
1008 1008 a, g dbSNP:374222149
1009 1009 c, t dbSNP:368634271
1011 1011 a, g dbSNP:761732244
1012 1012 a, g dbSNP:141649779
1014 1014 a, g dbSNP:750115262
1015 1015 c, t dbSNP:757861533
1018 1018 c, t dbSNP:765806312
1019 1019 g, t dbSNP:751142885
1020 1020 c, t dbSNP:756543798
1021 1021 a, g dbSNP:778280412
1030 1030 c, t dbSNP:749603726
1031 1031 a, g dbSNP:757629043
1042 1042 c, t dbSNP:138509526
1049 1049 a, t dbSNP:746084833
1052 1052 a, g dbSNP:139387602
1063 1063 a, c dbSNP:775409417
1066 1066 a, c dbSNP:747154466
1067 1067 c, t dbSNP:768438794
1072 1072 c, t dbSNP:776735135
1073 1073 a, g dbSNP:374309032
1084 1084 c, t dbSNP:765131320
1102 1102 -, c dbSNP:369065988
1104 1104 c, t dbSNP:771759616
1105 1105 a, c, g dbSNP:537262686
1107 1107 a, c dbSNP:4647930
1109 1109 g, t dbSNP:773783296
1116 1116 c, t dbSNP:763163157
1120 1120 a, g dbSNP:745740200
1128 1128 c, t dbSNP:368961378
1129 1129 a, g dbSNP:755231134
1134 1134 c, t dbSNP:767896163
1135 1135 a, g dbSNP:752771234
1136 1136 a, g dbSNP:756272863
1137 1137 c, g dbSNP:567597911
1148 1148 c, t dbSNP:749241683
1149 1149 c, t dbSNP:371943795
1151 1151 a, c, t dbSNP:778745736
1152 1152 a, g dbSNP:376903367
1155 1155 c, t dbSNP:775146211
1156 1156 c, t dbSNP:111246053
1157 1157 a, g dbSNP:201440347
1165 1165 c, g, t dbSNP:146112374
1166 1166 a, g dbSNP:766847951
1169 1169 a, c dbSNP:774750247
1172 1172 c, t dbSNP:373660136
1177 1177 a, c, t dbSNP:140148549
1180 1180 c, t dbSNP:375677549
1181 1181 a, g dbSNP:202037959
1182 1182 c, g dbSNP:753912109
1186 1186 c, g dbSNP:757186468
1190 1190 a, c dbSNP:778746987
1205 1205 c, t dbSNP:745613727
1207 1207 c, g dbSNP:758203364
1219 1219 c, t dbSNP:779615534
1223 1223 c, g dbSNP:746661915
1236 1236 c, t dbSNP:768252857
1237 1237 a, g dbSNP:776185476
1242 1242 a, c dbSNP:747654089
1243 1243 a, c dbSNP:577572432
1246 1246 c, t dbSNP:201062727
1247 1247 a, g dbSNP:373506035
1248 1248 c, t dbSNP:759910460
1249 1249 a, g dbSNP:61734883
1255 1255 c, g dbSNP:776053533
1256 1256 c, t dbSNP:760955260
1267 1267 a, t dbSNP:764261493
1271 1271 a, c, g dbSNP:201377348
1273 1273 c, t dbSNP:370211317
1274 1274 c, t dbSNP:750366202
1276 1276 c, g dbSNP:758398284
1278 1278 a, c, t dbSNP:200338999
1279 1279 a, g dbSNP:754631527
1281 1281 a, c, t dbSNP:375985073
1282 1282 a, g dbSNP:201785648
1286 1286 a, t dbSNP:777488330
1287 1287 a, c, t dbSNP:746360727
1288 1288 a, g dbSNP:375150331
1289 1289 a, g dbSNP:760976677
1292 1292 c, t dbSNP:368437012
1293 1293 a, g, t dbSNP:4647931
1294 1294 c, t dbSNP:765297271
1295 1295 a, g dbSNP:750561767
1296 1296 a, g dbSNP:374653229
1298 1298 c, t dbSNP:766347101
1299 1299 a, c, g, t dbSNP:751318362
1300 1300 c, t dbSNP:752283163
1303 1303 c, t dbSNP:367617448
1304 1304 a, g dbSNP:200822222
1307 1307 a, g dbSNP:376736117
1311 1311 a, g dbSNP:367966622
1315 1315 c, t dbSNP:772665357
1322 1322 c, t dbSNP:780728675
1323 1323 c, t dbSNP:747340530
1324 1324 a, c, g dbSNP:145786390
1330 1330 c, t dbSNP:748306032
1331 1331 a, g dbSNP:770052916
1339 1339 c, t dbSNP:371849695
1340 1340 a, g dbSNP:376400181
1341 1341 c, t dbSNP:766259286
1345 1345 a, c dbSNP:774173217
1350 1350 c, g dbSNP:759581394
1356 1356 a, g dbSNP:767199588
1360 1360 a, g dbSNP:551721504
1367 1367 a, g dbSNP:755794980
1369 1369 a, c, g dbSNP:200350207
1370 1370 c, t dbSNP:756840934
1371 1371 a, g dbSNP:182915641
1375 1375 a, g dbSNP:747467662
1380 1380 c, t dbSNP:755567722
1381 1381 a, g dbSNP:373825808
1386 1386 -, ccc dbSNP:765638279
1386 1386 c, t dbSNP:748588827
1388 1388 c, t dbSNP:549237929
1389 1389 c, t dbSNP:773448649
1395 1395 a, c, g dbSNP:567468058
1399 1399 a, g dbSNP:774561854
1400 1400 c, t dbSNP:769491696
1404 1404 a, g, t dbSNP:767542507
1405 1405 c, t dbSNP:148505744
1412 1412 c, g dbSNP:80019124
1413 1413 a, c, t dbSNP:4647932
1422 1422 a, g dbSNP:764647868
1424 1424 c, t dbSNP:749989018
1440 1440 a, c, g dbSNP:755416353
1445 1445 c, t dbSNP:375421159
1451 1451 -, gacatc dbSNP:750976145
1455 1455 -, tc dbSNP:758856602
1455 1455 c, t dbSNP:756472488
1456 1456 -, ca, caca, cacaca dbSNP:751700498
1457 1457 -, cacaca dbSNP:769679151
1457 1457 -, caca dbSNP:781628478
1457 1457 -, ca dbSNP:145808953
1457 1457 c, g dbSNP:571486674
1458 1458 -, caca dbSNP:747154781
1458 1458 a, c dbSNP:749511854
1459 1459 c, t dbSNP:771187237
1460 1460 a, g dbSNP:778839265
1464 1464 -, cacacacacacactct dbSNP:777542278
1467 1467 c, t dbSNP:745984551
1468 1468 -, cacacacactct dbSNP:770799450
1469 1469 -, cacacacactct dbSNP:749212877
1475 1475 -, cact dbSNP:773797947
1477 1477 -, ct dbSNP:759055320
1477 1477 c, t dbSNP:771866499
1478 1478 a, t dbSNP:775503014
1479 1479 c, g dbSNP:199548478
1481 1481 -, cacacacactca dbSNP:771696328
1481 1481 -, caca dbSNP:775168543
1484 1484 a, t dbSNP:768557913
1486 1486 a, g dbSNP:776633899
1492 1492 a, g dbSNP:761525836
1494 1494 a, g dbSNP:372496076
1495 1495 c, t dbSNP:749851372
1496 1496 a, g dbSNP:138327840
1503 1503 a, g dbSNP:149625647
1511 1511 c, t dbSNP:753212127
1527 1527 a, g dbSNP:111608568
1528 1528 g, t dbSNP:144318134
1539 1539 c, t dbSNP:370665283
1540 1540 a, g dbSNP:554196152
1544 1544 c, t dbSNP:779229022
1545 1545 c, t dbSNP:748164211
1546 1546 a, g dbSNP:372960046
1561 1561 -, c dbSNP:762050692
1563 1563 -, g dbSNP:765594414
1564 1564 c, g dbSNP:541578778
1565 1565 c, g, t dbSNP:377284409
1568 1568 a, g dbSNP:768753902
1569 1569 a, g dbSNP:370871387
1571 1571 c, g, t dbSNP:761720392
1572 1572 a, g dbSNP:777973033
1574 1574 c, t dbSNP:578178286
1596 1596 c, t dbSNP:545104718
1603 1603 c, t dbSNP:749451713
1615 1615 c, t dbSNP:563689502
1616 1616 c, g dbSNP:531075308
1643 1643 a, g dbSNP:61007088
1645 1645 c, t dbSNP:552234059
1654 1654 c, t dbSNP:561328425
1660 1660 g, t dbSNP:528313149
1679 1679 c, t dbSNP:771227332
1689 1689 -, ac dbSNP:147695405
1703 1703 -, acac dbSNP:113926759
1711 1711 a, g dbSNP:546746341
1714 1714 a, g dbSNP:4647939
1718 1718 a, g dbSNP:746826540
1723 1723 c, t dbSNP:532423431
1726 1726 a, g dbSNP:768657932
1728 1728 a, g dbSNP:534686121
1737 1737 c, t dbSNP:568514652
1742 1742 a, g dbSNP:371059354
1743 1743 c, t dbSNP:546391446
1744 1744 a, g dbSNP:554259719
1749 1749 c, t dbSNP:761910406
1763 1763 c, g dbSNP:566202202
1770 1770 c, t dbSNP:568598861
1772 1772 -, cg dbSNP:201031675
1774 1774 -, cacaca dbSNP:761442334
1774 1774 -, ca dbSNP:4647945
1775 1775 a, g dbSNP:772827102
1779 1779 -, ac dbSNP:372298935
1780 1780 c, t dbSNP:534932929
1798 1798 c, t dbSNP:553513239
1799 1799 c, t dbSNP:147461484
1800 1800 a, g dbSNP:545679240
1809 1809 c, t dbSNP:557228247
1823 1823 c, g dbSNP:573619022
1832 1832 a, c dbSNP:73070424
1833 1833 a, g dbSNP:115824203
1835 1835 a, g dbSNP:561393016
1836 1836 c, g dbSNP:187595155
1838 1838 c, t dbSNP:751872526
1847 1847 a, g dbSNP:562604726
1860 1860 c, t dbSNP:755346435
1865 1865 a, g dbSNP:540089482
1883 1883 g, t dbSNP:565082475
1884 1884 -, acac dbSNP:575306605
1886 1886 a, g dbSNP:767940786
1889 1889 a, c, t dbSNP:753195481
1890 1890 a, g dbSNP:575572545
1898 1898 a, g dbSNP:372948683
1901 1901 c, t dbSNP:139909269
1902 1902 a, g dbSNP:116173564
1919 1919 -, acac dbSNP:751956500
1919 1919 -, ac dbSNP:376462828
1921 1921 -, ac dbSNP:748391991
1932 1932 c, t dbSNP:529661387
1935 1935 a, g dbSNP:779210431
1951 1951 c, t dbSNP:746734756
1952 1952 a, g dbSNP:768568238
1953 1953 -, cacacacgtgcagatatggtatccgga dbSNP:533634308
1959 1959 a, c, t dbSNP:11538025
1960 1960 a, g dbSNP:201858459
1961 1961 -, tgca dbSNP:369182316
1965 1965 -, gatatggtatccggacacacacgtgca dbSNP:35896028
1971 1971 ctg, gta dbSNP:386670451
1973 1973 a, g dbSNP:533874850
1976 1976 c, t dbSNP:377108343
1980 1980 -, gc dbSNP:376865502
1983 1983 a, g dbSNP:772556487
1989 1989 a, g dbSNP:762546540
1994 1994 g, t dbSNP:571817420
1995 1995 a, t dbSNP:765885844
2002 2002 g, t dbSNP:538817789
2004 2004 c, t dbSNP:192541751
2006 2006 g, t dbSNP:575982814
2015 2015 c, g dbSNP:773993761
2028 2028 g, t dbSNP:28602600
2029 2029 -, ac dbSNP:762493335
2030 2030 a, t dbSNP:759248664
2043 2043 c, t dbSNP:756451035
2044 2044 a, g dbSNP:543072483
2056 2056 -, ac dbSNP:56398186
2057 2057 -, ac dbSNP:781533771
2058 2058 -, ac dbSNP:771747710
2060 2060 c, g dbSNP:554987351
2071 2071 acgt, gc dbSNP:386670452
2072 2072 -, ac dbSNP:397935892
2072 2072 c, t dbSNP:560739572
2073 2073 a, g dbSNP:199852820
2074 2074 c, t dbSNP:1064838
2084 2084 c, t dbSNP:576981416
2090 2090 a, g dbSNP:573172534
2091 2091 c, t dbSNP:28668809
2097 2097 c, t dbSNP:543974698
2099 2099 c, g, t dbSNP:1064839
2105 2105 c, t dbSNP:529919727
2129 2129 a, t dbSNP:547820432
2147 2147 c, g dbSNP:764687219
2177 2177 c, t dbSNP:559712155
2180 2180 a, g dbSNP:527237566
2195 2195 a, g dbSNP:184928800
2198 2198 -, caca dbSNP:570296680
2198 2198 -, ca dbSNP:751002701
2199 2199 -, ca dbSNP:760257693
2201 2201 -, ca dbSNP:529106784
2204 2204 c, t dbSNP:142792896
2207 2207 a, g dbSNP:539246283
2208 2208 -, ac dbSNP:35640602
2208 2208 c, t dbSNP:551177228
2215 2215 a, g dbSNP:569605885
2223 2223 c, t dbSNP:536936448
2224 2224 a, g dbSNP:151232580
2235 2235 c, t dbSNP:573197554
2236 2236 a, g dbSNP:115679552
2246 2246 a, g dbSNP:559031465
2249 2249 c, t dbSNP:758744980
2252 2252 c, t dbSNP:781101014
2256 2256 c, t dbSNP:577245313
2259 2259 -, acac dbSNP:369250502
2261 2261 -, ac dbSNP:776639287
2268 2268 c, t dbSNP:544033211
2273 2273 a, g dbSNP:562331083
2281 2281 a, g dbSNP:574437474
2283 2283 c, t dbSNP:574683299
2290 2290 -, ac dbSNP:538923386
2298 2298 a, g dbSNP:560149049
2299 2299 -, ca dbSNP:57445348
2311 2311 c, g dbSNP:187572457
2328 2328 a, g dbSNP:551862508
2337 2337 c, t dbSNP:564238440
2345 2345 -, ac dbSNP:542089125
2353 2353 -, at dbSNP:34428342
2387 2387 c, t dbSNP:531419076
2388 2388 a, g dbSNP:370714398
2400 2400 c, t dbSNP:569472053
2404 2404 c, t dbSNP:192813350
2409 2409 -, acac dbSNP:528378155
2414 2414 c, t dbSNP:4647936
2415 2415 a, g dbSNP:4647943
2418 2418 c, t dbSNP:748675670
2419 2419 a, g dbSNP:567024820
2431 2431 a, g dbSNP:140919592
2454 2454 a, c dbSNP:534225926
2455 2455 c, t dbSNP:770466875
2456 2456 a, g dbSNP:558664418
2464 2464 a, g dbSNP:577305280
2467 2467 -, ca dbSNP:748899241
2479 2479 c, t dbSNP:530852681
2484 2484 a, t dbSNP:537942579
2494 2494 -, ac dbSNP:201331455
2500 2500 c, t dbSNP:545798369
2505 2505 a, g dbSNP:556189339
2510 2510 a, c, t dbSNP:189183107
2519 2519 -, g dbSNP:778748230
2531 2531 c, t dbSNP:3733350
2554 2554 c, t dbSNP:573362339
2555 2555 a, g dbSNP:775786632
2594 2594 c, t dbSNP:572227834
2614 2614 c, t dbSNP:545820664
2615 2615 c, t dbSNP:370896791
2621 2621 -, tgtccccgcctc dbSNP:376088822
2621 2621 a, t dbSNP:148837233
2627 2627 c, t dbSNP:543546237
2628 2628 g, t dbSNP:143441743
2639 2639 c, t dbSNP:561727372
2645 2645 -, catccccgcctc dbSNP:4647941
2646 2646 a, g dbSNP:370377465
2651 2651 c, t dbSNP:530339594
2673 2673 c, t dbSNP:192584184
2685 2685 c, t dbSNP:548473385
2692 2692 c, g dbSNP:567188360
2711 2711 c, g dbSNP:527966255
2716 2716 c, t dbSNP:748302174
2738 2738 a, g dbSNP:4647938
2752 2752 a, g dbSNP:778080073
2760 2760 a, g dbSNP:570513184
2793 2793 c, g dbSNP:4647940
2802 2802 -, c dbSNP:544137988
2814 2814 c, g dbSNP:568107933
2856 2856 a, g dbSNP:762285982
2857 2857 a, t dbSNP:765388428
2873 2873 a, g dbSNP:556256579
2912 2912 c, t dbSNP:568189259
2919 2919 c, t dbSNP:113502766
2920 2920 a, g dbSNP:758652958
2951 2951 c, t dbSNP:377102874
2954 2954 c, t dbSNP:780444862
2955 2955 a, g dbSNP:114230525
2957 2957 c, t dbSNP:762308289
2963 2963 c, t dbSNP:765895558
2971 2971 -, c dbSNP:59896854
2977 2977 -, c dbSNP:397941425
2977 2977 c, t dbSNP:375839578
2988 2988 c, g, t dbSNP:545776199
3002 3002 a, t dbSNP:764609587
3004 3004 a, c dbSNP:777493059
3007 3007 g, t dbSNP:557985553
3029 3029 g, t dbSNP:754163645
3030 3030 a, c, g dbSNP:148169986
3034 3034 a, g dbSNP:749233111
3039 3039 c, t dbSNP:770901335
3040 3040 a, g dbSNP:750645767
3042 3042 a, g dbSNP:778356397
3046 3046 c, t dbSNP:118095428
3082 3082 c, t dbSNP:141073382
3083 3083 c, t dbSNP:745408023

Target ORF information:

RefSeq Version NM_021923
Organism Homo sapiens (human)
Definition Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu03560
Accession Version NM_001004358.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1515bp)
Protein sequence