
POR cDNA ORF clone, Homo sapiens (human)

Gene Symbol POR
Entrez Gene ID 5447
Full Name P450 (cytochrome) oxidoreductase
Synonyms CPR, CYPOR, P450R
General protein information
Preferred Names
NADPH--cytochrome P450 reductase
NADPH--cytochrome P450 reductase
NADPH-dependent cytochrome P450 reductase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Antley-Bixler syndrome with genital anomalies and disordered

mRNA and Protein(s)

mRNA Protein Name
NM_000941 NP_000932 NADPH--cytochrome P450 reductase

WP43 cytochrome P450
META_PWY-6076 vitamin D3 biosynthesis
HUMAN_PWY-6398 melatonin degradation I
META_PWY-6402 superpathway of melatonin degradation
HUMAN_PWY-6076 vitamin D3 biosynthesis
HUMAN_PWY-6402 superpathway of melatonin degradation
HUMAN_PWY-6061 bile acid biosynthesis, neutral pathway
META_PWY-6398 melatonin degradation I
HUMAN_PWY66-401 superpathway of tryptophan utilization

Homo sapiens (human) POR NP_000932.3
Pan troglodytes (chimpanzee) POR XP_001155755.2
Macaca mulatta (Rhesus monkey) POR XP_001109664.1
Canis lupus familiaris (dog) POR NP_001171276.1
Bos taurus (cattle) POR NP_001030467.1
Mus musculus (house mouse) Por NP_032924.1
Rattus norvegicus (Norway rat) Por NP_113764.1
Gallus gallus (chicken) POR NP_001182725.1
Danio rerio (zebrafish) por NP_001030154.1
Drosophila melanogaster (fruit fly) Cpr NP_001260128.1
Caenorhabditis elegans emb-8 NP_498103.1
Arabidopsis thaliana (thale cress) ATR2 NP_849472.2
Xenopus (Silurana) tropicalis (western clawed frog) por XP_002933864.1


ID Name Evidence
GO:0005625 soluble fraction IEA
GO:0005739 mitochondrion IEA
GO:0005783 endoplasmic reticulum TAS
GO:0005789 endoplasmic reticulum membrane IEA
GO:0005792 microsome IEA
GO:0016020 membrane IEA


ID Name Evidence
GO:0003958 NADPH-hemoprotein reductase activity IDA
GO:0003958 NADPH-hemoprotein reductase activity TAS
GO:0005506 iron ion binding IEA
GO:0010181 FMN binding IEA
GO:0016491 oxidoreductase activity IEA
GO:0019899 enzyme binding IEA
GO:0050660 flavin adenine dinucleotide binding IEA
GO:0050661 NADP binding IEA


ID Name Evidence
GO:0032770 positive regulation of monooxygenase activity IDA
GO:0046210 nitric oxide catabolic process IEA
GO:0055114 oxidation-reduction process IDA
GO:0055114 oxidation-reduction process TAS
GO:0071375 cellular response to peptide hormone stimulus IEA
GO:0090181 regulation of cholesterol metabolic process IEA
GO:0090346 cellular organofluorine metabolic process IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following POR gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the POR cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_000941 Homo sapiens P450 (cytochrome) oxidoreductase (POR), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu25584
Accession Version NM_000941.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2043bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product NADPH--cytochrome P450 reductase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA701694.1, BP244929.1, BC034277.1, AF258341.1, BG104767.1 and AK129978.1. This sequence is a reference standard in the RefSeqGene project. On or before Aug 31, 2013 this sequence version replaced gi:530386140, gi:530432544, gi:24307876. Summary: This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primate species. This starting position is most commonly referred to in the literature, and the numbering system used to describe disease-associated mutations is based on this protein start. This includes data in the P450 oxidoreductase (POR) allele nomenclature locus-specific database, and the Human Gene Mutation Database (HGMD). This start codon is restricted to higher primate species, and it has a weak Kozak signal. However, it should be noted that an alternative downstream start codon, which has a strong Kozak signal and is much more widely conserved, is also present. The use of this downstream start codon would result in a protein that is 3 aa shorter at the N-terminus. Protein sequencing in PMID:2513880 indicates that this is the preferred start codon in vivo. It is therefore possible that the ribosome will initiate at the upstream start codon only a small fraction of the time (if at all), while leaky scanning will allow the downstream start codon to be used predominantly. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK290529.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)245..2119(+)
Misc Feature(2)335..748(+)
Misc Feature(3)920..2119(+)
Misc Feature(4)983..2005(+)
Misc Feature(5)1046..2119(+)
Misc Feature(6)1451..1462(+)
Misc Feature(7)1460..2119(+)
Misc Feature(8)1553..1573(+)
Misc Feature(9)1679..1708(+)
Exon (1)1..78
Gene Synonym:
Exon (2)79..270
Gene Synonym:
Exon (3)271..319
Gene Synonym:
Exon (4)320..448
Gene Synonym:
Exon (5)449..598
Gene Synonym:
Exon (6)599..723
Gene Synonym:
Exon (7)724..813
Gene Synonym:
Exon (8)814..912
Gene Synonym:
Exon (9)913..1029
Gene Synonym:
Exon (10)1030..1148
Gene Synonym:
Exon (11)1149..1330
Gene Synonym:
Exon (12)1331..1480
Gene Synonym:
Exon (13)1481..1751
Gene Synonym:
Exon (14)1752..1897
Gene Synonym:
Exon (15)1898..1980
Gene Synonym:
Exon (16)1981..2499
Gene Synonym:
Position Chain Variation Link
36 36 a, c dbSNP:3823884
97 97 a, g dbSNP:786205877
469 469 a, g, t dbSNP:1135612
623 623 g, t dbSNP:72552771
662 662 -, tacgtggacaagc dbSNP:786205878
663 663 a, g dbSNP:769916309
906 906 a, g dbSNP:201697814
941 941 c, g dbSNP:121912974
1048 1048 a, c dbSNP:112270565
1120 1120 c, t dbSNP:201568454
1216 1216 a, g dbSNP:112719660
1396 1396 a, g dbSNP:199937789
1411 1411 -, c dbSNP:786205875
1452 1452 a, g dbSNP:28931608
1537 1537 a, c, t dbSNP:2228104
1557 1557 a, t dbSNP:28931606
1590 1590 c, t dbSNP:1057868
1697 1697 a, c, g dbSNP:121912976
1784 1784 a, g dbSNP:779082897
1788 1788 a, g dbSNP:28931607
1815 1815 a, g dbSNP:121912975
1904 1904 a, g, t dbSNP:72552772
1917 1917 -, taaagcaagaccgagagcacctgt dbSNP:786205876
1931 1931 a, g dbSNP:771477130
1972 1972 c, t dbSNP:113741710
2160 2160 a, g dbSNP:773928554
2425 2425 c, g dbSNP:112507039
2431 2431 a, g dbSNP:17685

Target ORF information:

RefSeq Version NM_000941
Organism Homo sapiens (human)
Definition Homo sapiens P450 (cytochrome) oxidoreductase (POR), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


A cellular stress response (CSR) that interacts with NADPH-P450 reductase (NPR) is a new regulator of hypoxic response
Biochem. Biophys. Res. Commun. 445 (1), 43-47 (2014)
Oguro A, Koyama C, Xu J and Imaoka S.


Zinc finger nuclease knock-out of NADPH:cytochrome P450 oxidoreductase (POR) in human tumor cell lines demonstrates that hypoxia-activated prodrugs differ in POR dependence
J. Biol. Chem. 288 (52), 37138-37153 (2013)
Su J, Gu Y, Pruijn FB, Smaill JB, Patterson AV, Guise CP and Wilson WR.


Single-nucleotide polymorphisms in P450 oxidoreductase and peroxisome proliferator-activated receptor-alpha are associated with the development of new-onset diabetes after transplantation in kidney transplant recipients treated with tacrolimus
Pharmacogenet. Genomics 23 (12), 649-657 (2013)
Elens L, Sombogaard F, Hesselink DA, van Schaik RH and van Gelder T.


Redox-linked domain movements in the catalytic cycle of cytochrome p450 reductase
Structure 21 (9), 1581-1589 (2013)
Huang WC, Ellis J, Moody PC, Raven EL and Roberts GC.


Expression and characterization of truncated human heme oxygenase (hHO-1) and a fusion protein of hHO-1 with human cytochrome P450 reductase
Biochemistry 34 (13), 4421-4427 (1995)
Wilks A, Black SM, Miller WL and Ortiz de Montellano PR.


Purification of multiple forms of cytochrome P450 from a human brain and reconstitution of catalytic activities
Arch. Biochem. Biophys. 301 (2), 251-255 (1993)
Bhamre S, Anandatheerathavarada HK, Shankar SK, Boyd MR and Ravindranath V.


Cytochrome P450 Oxidoreductase Deficiency
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Cragun,D. and Hopkin,R.J.


Quantification of cytochrome P450 reductase gene expression in human tissues
Arch. Biochem. Biophys. 294 (1), 168-172 (1992)
Shephard EA, Palmer CN, Segall HJ and Phillips IR.


Structural and functional analysis of NADPH-cytochrome P-450 reductase from human liver: complete sequence of human enzyme and NADPH-binding sites
Biochemistry 28 (21), 8639-8645 (1989)
Haniu M, McManus ME, Birkett DJ, Lee TD and Shively JE.


Isolation of a human cytochrome P-450 reductase cDNA clone and localization of the corresponding gene to chromosome 7q11.2
Ann. Hum. Genet. 53 (PT 4), 291-301 (1989)
Shephard EA, Phillips IR, Santisteban I, West LF, Palmer CN, Ashworth A and Povey S.
