Home » Species Summary » Homo sapiens » POU4F2 cDNA ORF clone
Email to GenScript

POU4F2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol POU4F2
Entrez Gene ID 5458
Full Name POU class 4 homeobox 2
Synonyms BRN3.2, BRN3B, Brn-3b
General protein information
Preferred Names
POU domain, class 4, transcription factor 2
POU domain, class 4, transcription factor 2
POU domain protein
Brn3b POU domain transcription factor
POU domain class 4 transcription factor 2
brain-specific homeobox/POU domain protein 3B
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_004575 NP_004566 POU domain, class 4, transcription factor 2

Pathway Interaction Database
p53downstreampathway Direct p53 effectors

Homo sapiens (human) POU4F2 NP_004566.2
Pan troglodytes (chimpanzee) POU4F2 XP_526699.2
Macaca mulatta (Rhesus monkey) POU4F2 XP_001098227.1
Canis lupus familiaris (dog) POU4F2 XP_853453.1
Bos taurus (cattle) POU4F2 NP_001179881.1
Mus musculus (house mouse) Pou4f2 NP_620394.2
Rattus norvegicus (Norway rat) Pou4f2 NP_599182.1
Danio rerio (zebrafish) pou4f2 NP_997972.1
Xenopus (Silurana) tropicalis (western clawed frog) pou4f2 XP_004911191.1


ID Name Evidence
GO:0005634 nucleus IEA
GO:0016607 nuclear speck IEA


ID Name Evidence
GO:0003682 chromatin binding IEA
GO:0003700 sequence-specific DNA binding transcription factor activity IEA
GO:0043565 sequence-specific DNA binding IEA


ID Name Evidence
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA
GO:0006351 transcription, DNA-dependent TAS
GO:0006355 regulation of transcription, DNA-dependent IEA
GO:0007399 nervous system development IEA
GO:0007605 sensory perception of sound IEA
GO:0030182 neuron differentiation IEA
GO:0031290 retinal ganglion cell axon guidance IEA
GO:0045597 positive regulation of cell differentiation IEA
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA
GO:0048676 axon extension involved in development IEA
GO:0050885 neuromuscular process controlling balance IEA
GO:0060041 retina development in camera-type eye IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following POU4F2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the POU4F2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu04465 NM_004575 Homo sapiens POU class 4 homeobox 2 (POU4F2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $379.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu04465
Accession Version NM_004575.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1230bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product POU domain, class 4, transcription factor 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB082745.1, BY796838.2, U06233.1 and X71488.1. On Jul 14, 2006 this sequence version replaced gi:4758947. Summary: The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U06233.1, EU439706.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)210..212(+)
Misc Feature(2)576..605(+)
Misc Feature(3)996..1229(+)
Misc Feature(4)1284..1460(+)
Misc Feature(5)1284..1454(+)
Misc Feature(6)1290..1442(+)
Exon (1)1..536
Gene Synonym:
Exon (2)537..3141
Gene Synonym:
Position Chain Variation Link
21 21 g, t dbSNP:143373833
30 30 a, g dbSNP:529808954
84 84 c, g dbSNP:573476128
88 88 -, gc dbSNP:573047005
97 97 a, g dbSNP:370191425
104 104 c, t dbSNP:532189913
112 112 g, t dbSNP:372544942
137 137 c, t dbSNP:566405740
155 155 a, g dbSNP:35733768
165 165 c, t dbSNP:548783098
166 166 a, g dbSNP:568422472
194 194 c, t dbSNP:369199465
200 200 c, t dbSNP:369625548
204 204 g, t dbSNP:757793275
209 209 c, g dbSNP:373501732
213 213 a, g dbSNP:750558475
217 217 c, t dbSNP:376572394
222 222 c, t dbSNP:780382461
231 231 a, g dbSNP:747178586
234 234 c, t dbSNP:570504750
236 236 a, g dbSNP:755908399
238 238 a, c dbSNP:539481195
239 239 a, g, t dbSNP:749059575
243 243 a, g dbSNP:202046663
245 245 a, g dbSNP:745439783
255 255 a, c dbSNP:771422888
266 266 a, g dbSNP:775283240
275 275 a, g dbSNP:200843721
280 280 a, c, g dbSNP:764572858
285 285 a, g dbSNP:762056981
293 293 g, t dbSNP:146671454
294 294 a, c dbSNP:62327967
296 296 a, c dbSNP:369358968
299 299 c, t dbSNP:758520224
300 300 c, g dbSNP:766304844
304 304 a, g dbSNP:751811339
312 312 c, g dbSNP:755145943
317 317 a, g, t dbSNP:781361250
319 319 c, t dbSNP:199899657
321 321 a, g dbSNP:756986974
338 338 c, t dbSNP:373682041
339 339 a, g dbSNP:745722834
344 344 c, t dbSNP:140261687
346 346 c, t dbSNP:775088221
347 347 g, t dbSNP:746499405
348 348 c, g dbSNP:768466628
367 367 c, t dbSNP:13152799
368 368 a, c, g dbSNP:554756745
369 369 a, g dbSNP:773775307
372 372 c, t dbSNP:184591480
376 376 c, t dbSNP:766469983
378 378 -, caagctccc dbSNP:753557223
384 384 a, t dbSNP:751678267
385 385 a, c, g dbSNP:759607270
389 389 c, g dbSNP:752858301
395 395 c, t dbSNP:757076223
397 397 c, g dbSNP:778528456
403 403 a, g dbSNP:543500000
405 405 a, g dbSNP:758312980
406 406 -, tgg dbSNP:764871244
407 407 -, tggtgg dbSNP:755426836
407 407 -, tgg dbSNP:750003036
410 410 -, ggtggc dbSNP:748395865
411 411 -, ggtggcggcggcggcggcggc dbSNP:781757657
411 411 -, ggtggcggc dbSNP:756518481
413 413 -, ggc dbSNP:530695040
414 414 -, ggcggcggcggcggc dbSNP:771897159
414 414 -, ggcggcggcggc dbSNP:771187205
414 414 -, ggcggcggc dbSNP:763100230
414 414 -, ggcggc dbSNP:778938652
414 414 -, ggc dbSNP:746013278
416 416 c, t dbSNP:189899086
422 422 -, ggc, ggt dbSNP:772231658
424 424 -, cga dbSNP:760328200
426 426 g, t dbSNP:563277042
432 432 a, g dbSNP:781008874
433 433 -, cga dbSNP:761525997
443 443 -, ggt dbSNP:767856113
446 446 -, gga dbSNP:753272645
448 448 -, cgg dbSNP:5862765
449 449 a, c dbSNP:532126509
452 452 c, t dbSNP:770225812
453 453 c, g dbSNP:773402503
454 454 a, c, g dbSNP:763355404
457 457 a, g dbSNP:774823455
469 469 -, gcagcagtg dbSNP:756398451
482 482 c, g dbSNP:199600550
488 488 a, c dbSNP:767517089
490 490 -, c dbSNP:778084431
491 491 a, c dbSNP:752990850
492 492 c, g dbSNP:760756175
494 494 a, g dbSNP:764352779
495 495 a, g dbSNP:750222572
499 499 c, t dbSNP:758265520
503 503 a, g dbSNP:780202922
507 507 a, g dbSNP:751487592
508 508 c, t dbSNP:145352817
510 510 a, c, g dbSNP:780810360
511 511 a, g dbSNP:769383031
512 512 a, g dbSNP:777475559
513 513 a, c dbSNP:148020860
514 514 a, g dbSNP:771228190
518 518 c, t dbSNP:774843548
522 522 a, c dbSNP:759993347
524 524 g, t dbSNP:776843010
525 525 c, g dbSNP:772158214
529 529 a, c dbSNP:775478910
530 530 c, t dbSNP:760773916
532 532 c, t dbSNP:141725106
536 536 c, g dbSNP:776901796
544 544 c, t dbSNP:201496393
545 545 a, g dbSNP:753506987
548 548 c, t dbSNP:756948351
551 551 c, t dbSNP:778503474
557 557 a, g dbSNP:746295952
568 568 c, t dbSNP:747618017
573 573 g, t dbSNP:780441210
575 575 a, c, g dbSNP:747487311
579 579 g, t dbSNP:776725541
581 581 c, t dbSNP:748216623
588 588 c, g dbSNP:770183243
596 596 a, c, t dbSNP:773565628
604 604 c, t dbSNP:771832144
605 605 c, t dbSNP:572923830
606 606 a, g dbSNP:760611375
620 620 c, g dbSNP:763913135
623 623 c, t dbSNP:753382247
625 625 a, g dbSNP:372609971
629 629 a, c dbSNP:761305816
637 637 c, t dbSNP:764924258
640 640 c, t dbSNP:150150229
646 646 a, c dbSNP:758697090
649 649 a, g dbSNP:542500694
665 665 a, c, t dbSNP:147517729
666 666 a, g dbSNP:74417037
678 678 a, g dbSNP:748306388
687 687 a, g dbSNP:769935131
688 688 c, t dbSNP:778143343
689 689 c, t dbSNP:749485798
694 694 c, t dbSNP:771785013
695 695 a, g, t dbSNP:143938073
700 700 c, t dbSNP:768702139
704 704 a, g dbSNP:776534071
707 707 c, t dbSNP:139883264
708 708 a, g, t dbSNP:764664393
711 711 -, tct dbSNP:757454662
716 716 c, t dbSNP:762622000
718 718 c, t dbSNP:765926130
721 721 c, t dbSNP:751995847
733 733 c, t dbSNP:755295639
743 743 c, t dbSNP:538905724
745 745 a, c, t dbSNP:753186078
751 751 c, t dbSNP:777950064
752 752 a, g dbSNP:143876216
757 757 c, t dbSNP:771220976
758 758 -, cac dbSNP:745866039
759 759 -, cac dbSNP:779170313
759 759 c, g dbSNP:778994622
764 764 c, t dbSNP:369535679
765 765 c, t dbSNP:746876184
768 768 -, caccaccat dbSNP:772204480
768 768 a, c dbSNP:376900695
776 776 -, cac dbSNP:746997301
777 777 -, caccac dbSNP:768754024
777 777 -, cac dbSNP:779805566
778 778 a, g dbSNP:768379922
779 779 c, t dbSNP:776556532
794 794 a, c dbSNP:748041541
798 798 c, t dbSNP:144284868
799 799 a, c, g, t dbSNP:772758327
801 801 c, t dbSNP:773864450
808 808 a, c dbSNP:759947204
809 809 a, g dbSNP:376581460
821 821 a, g dbSNP:753277964
826 826 c, t dbSNP:566523433
828 828 a, g dbSNP:371559221
832 832 a, c dbSNP:764661037
838 838 g, t dbSNP:754012836
843 843 a, g dbSNP:757268615
845 845 g, t dbSNP:779206656
849 849 c, g dbSNP:746012753
851 851 c, t dbSNP:200464919
854 854 a, g dbSNP:780920421
857 857 c, t dbSNP:747920598
858 858 g, t dbSNP:769762929
862 862 c, t dbSNP:373979098
866 866 a, g dbSNP:202030431
878 878 c, t dbSNP:376822201
879 879 c, g dbSNP:770290821
882 882 g, t dbSNP:774082611
892 892 c, t dbSNP:567994457
893 893 a, c, g dbSNP:200695260
895 895 c, t dbSNP:761112950
899 899 g, t dbSNP:373088055
912 912 a, t dbSNP:754238090
915 915 a, g dbSNP:377219455
920 920 c, t dbSNP:765193554
923 923 a, g dbSNP:537218174
927 927 c, t dbSNP:777098293
939 939 g, t dbSNP:758672868
942 942 a, g dbSNP:780222125
943 943 c, t dbSNP:376992021
944 944 a, c, g dbSNP:557204309
947 947 c, t dbSNP:777781827
948 948 a, g dbSNP:749138680
954 954 a, g dbSNP:770495524
959 959 c, t dbSNP:778334450
962 962 a, g dbSNP:148751103
965 965 a, c, g, t dbSNP:373594627
966 966 a, c, g dbSNP:539536913
967 967 g, t dbSNP:768833334
973 973 c, g, t dbSNP:777228879
979 979 a, c dbSNP:765756416
991 991 g, t dbSNP:373360428
995 995 c, t dbSNP:750545796
998 998 a, c dbSNP:763016561
999 999 g, t dbSNP:766646381
1002 1002 c, g dbSNP:751723666
1004 1004 c, t dbSNP:755910426
1005 1005 a, g dbSNP:3827593
1008 1008 a, g dbSNP:777381197
1012 1012 c, t dbSNP:753645099
1015 1015 a, g dbSNP:757181039
1034 1034 c, t dbSNP:778905155
1035 1035 c, g dbSNP:745424096
1038 1038 c, t dbSNP:771646896
1053 1053 c, t dbSNP:779853704
1059 1059 a, c dbSNP:200579530
1064 1064 a, g, t dbSNP:769090250
1065 1065 c, g dbSNP:142395313
1066 1066 a, g dbSNP:759945625
1073 1073 a, c dbSNP:151303999
1086 1086 c, g dbSNP:762211143
1091 1091 a, c, t dbSNP:770276185
1092 1092 a, g dbSNP:763035040
1095 1095 c, t dbSNP:76129457
1099 1099 c, t dbSNP:751800890
1104 1104 c, t dbSNP:759722784
1105 1105 a, t dbSNP:373485818
1107 1107 a, c dbSNP:376482978
1114 1114 c, g dbSNP:144507526
1115 1115 c, t dbSNP:778728774
1116 1116 a, g dbSNP:750317758
1119 1119 a, g dbSNP:369337694
1121 1121 a, g dbSNP:547217412
1122 1122 a, g dbSNP:372535541
1123 1123 g, t dbSNP:200312228
1126 1126 c, t dbSNP:371120198
1133 1133 c, t dbSNP:754628247
1148 1148 c, t dbSNP:780893360
1154 1154 c, t dbSNP:748522769
1166 1166 a, t dbSNP:763900829
1172 1172 c, g dbSNP:3827594
1189 1189 a, c, t dbSNP:749757264
1190 1190 c, g, t dbSNP:61733420
1209 1209 a, g dbSNP:145278389
1215 1215 c, g dbSNP:775723549
1217 1217 c, g dbSNP:761517259
1218 1218 c, g dbSNP:765082245
1221 1221 a, g dbSNP:750407383
1226 1226 c, t dbSNP:758460226
1227 1227 c, g dbSNP:766389226
1232 1232 a, g, t dbSNP:751098355
1236 1236 c, t dbSNP:780725416
1238 1238 c, t dbSNP:144940288
1241 1241 c, t dbSNP:756468313
1242 1242 a, c, g dbSNP:267600031
1246 1246 a, c dbSNP:199979947
1257 1257 a, c, t dbSNP:575863247
1265 1265 a, c dbSNP:774821401
1273 1273 c, g dbSNP:745947870
1275 1275 a, g dbSNP:377411656
1276 1276 c, t dbSNP:544750597
1277 1277 -, gga dbSNP:776554135
1277 1277 a, g, t dbSNP:370767940
1278 1278 a, g dbSNP:375025437
1285 1285 a, c dbSNP:764391266
1287 1287 c, g dbSNP:773182911
1288 1288 a, g dbSNP:564340231
1292 1292 a, g dbSNP:766482351
1294 1294 a, g dbSNP:751460020
1297 1297 a, c dbSNP:754454809
1298 1298 g, t dbSNP:371952832
1301 1301 c, g dbSNP:752317762
1304 1304 c, t dbSNP:755801755
1306 1306 c, g dbSNP:200705430
1308 1308 a, g dbSNP:374901217
1310 1310 a, g dbSNP:367653245
1313 1313 a, g dbSNP:61733419
1321 1321 a, g dbSNP:546678292
1325 1325 a, g dbSNP:746344869
1326 1326 c, t dbSNP:772066657
1328 1328 c, g dbSNP:143117935
1329 1329 a, g dbSNP:747030570
1334 1334 c, t dbSNP:148247830
1341 1341 g, t dbSNP:180935169
1344 1344 a, g dbSNP:142851123
1349 1349 c, g dbSNP:372860552
1358 1358 c, g, t dbSNP:199813288
1373 1373 c, g, t dbSNP:751581466
1374 1374 a, g dbSNP:147007829
1376 1376 c, t dbSNP:200415873
1380 1380 a, t dbSNP:760161101
1382 1382 c, t dbSNP:572053159
1383 1383 g, t dbSNP:753421189
1385 1385 a, g, t dbSNP:369917575
1402 1402 a, g dbSNP:750729905
1408 1408 a, g dbSNP:758986301
1409 1409 a, c dbSNP:138240408
1418 1418 c, t dbSNP:747145178
1432 1432 a, g dbSNP:113095745
1452 1452 a, c dbSNP:768798955
1453 1453 g, t dbSNP:201841354
1454 1454 a, g dbSNP:748345010
1456 1456 a, t dbSNP:770874396
1458 1458 a, t dbSNP:774253916
1466 1466 c, t dbSNP:370757448
1467 1467 a, g dbSNP:759244883
1468 1468 c, t dbSNP:772102156
1469 1469 a, c, t dbSNP:143812023
1470 1470 g, t dbSNP:763554724
1473 1473 a, g dbSNP:753510787
1481 1481 c, g dbSNP:761501754
1489 1489 g, t dbSNP:3810843
1491 1491 c, g dbSNP:750868586
1497 1497 a, g dbSNP:759889268
1502 1502 c, t dbSNP:758678612
1503 1503 a, g, t dbSNP:376016201
1504 1504 a, c dbSNP:755144946
1507 1507 a, c dbSNP:750265120
1508 1508 a, g, t dbSNP:370553185
1514 1514 a, c dbSNP:756402096
1518 1518 c, t dbSNP:777842647
1519 1519 g, t dbSNP:745684665
1522 1522 c, t dbSNP:771694639
1531 1531 c, t dbSNP:755855425
1543 1543 c, t dbSNP:539680681
1572 1572 c, t dbSNP:553083434
1592 1592 a, g dbSNP:572872296
1602 1602 -, g dbSNP:528757530
1610 1610 g, t dbSNP:765481755
1613 1613 a, g dbSNP:368127169
1616 1616 c, g dbSNP:576828718
1618 1618 g, t dbSNP:537768855
1621 1621 c, g dbSNP:555076472
1622 1622 a, g dbSNP:753420756
1645 1645 a, g dbSNP:575847464
1652 1652 a, c dbSNP:544497964
1663 1663 c, t dbSNP:372340520
1690 1690 a, t dbSNP:369146164
1691 1691 c, g dbSNP:778543116
1700 1700 c, t dbSNP:747584601
1719 1719 a, c dbSNP:752223847
1724 1724 c, g dbSNP:558068608
1777 1777 a, g dbSNP:771505182
1783 1783 a, c dbSNP:577799221
1820 1820 c, t dbSNP:540452369
1840 1840 a, g dbSNP:376565147
1850 1850 -, c dbSNP:201294453
1850 1850 c, g dbSNP:762679275
1861 1861 c, g dbSNP:560180778
1904 1904 g, t dbSNP:763496961
1929 1929 c, g dbSNP:529379828
1947 1947 a, c dbSNP:542963248
1989 1989 g, t dbSNP:72956271
2013 2013 a, g dbSNP:76180708
2070 2070 a, t dbSNP:550880231
2091 2091 a, g dbSNP:186245328
2105 2105 c, g dbSNP:763118542
2140 2140 a, c dbSNP:556009401
2208 2208 -, ctt dbSNP:549012100
2216 2216 a, g dbSNP:139670347
2220 2220 -, a dbSNP:539583889
2226 2226 a, c dbSNP:546831697
2280 2280 c, t dbSNP:114364181
2307 2307 c, t dbSNP:535201496
2366 2366 a, g dbSNP:775996631
2423 2423 c, t dbSNP:7669891
2462 2462 c, t dbSNP:768739276
2480 2480 g, t dbSNP:552978816
2481 2481 a, t dbSNP:566903155
2488 2488 c, t dbSNP:756057478
2494 2494 c, t dbSNP:372851210
2502 2502 c, t dbSNP:568748935
2504 2504 c, t dbSNP:541411056
2511 2511 g, t dbSNP:537480855
2526 2526 -, ac, acacac, acacacac dbSNP:71592457
2526 2526 c, t dbSNP:200297474
2542 2542 -, ca dbSNP:72274820
2552 2552 -, ac, acac, acacacac dbSNP:60422325
2567 2567 a, g dbSNP:558005411
2590 2590 a, g dbSNP:6825713
2595 2595 a, g dbSNP:111877076
2598 2598 a, g dbSNP:540388743
2638 2638 c, t dbSNP:757239441
2664 2664 a, g dbSNP:774529609
2665 2665 c, t dbSNP:191340422
2720 2720 -, t dbSNP:766409762
2727 2727 a, g dbSNP:761760637
2748 2748 -, g dbSNP:559593444
2756 2756 a, g dbSNP:574224859
2777 2777 a, g dbSNP:183140735
2837 2837 a, g dbSNP:767513951
2841 2841 g, t dbSNP:369169254
2846 2846 a, c dbSNP:186059151
2857 2857 a, t dbSNP:531717356
2872 2872 -, aat dbSNP:780613232
2882 2882 g, t dbSNP:753756715
2884 2884 a, t dbSNP:545441921
2896 2896 a, c dbSNP:577911804
2919 2919 c, t dbSNP:144585453
2948 2948 c, t dbSNP:750269420
2969 2969 a, g dbSNP:577677595
2978 2978 a, g dbSNP:74571172
3044 3044 g, t dbSNP:754792419
3047 3047 c, t dbSNP:778678271
3048 3048 a, g dbSNP:555469738
3078 3078 a, t dbSNP:546770376
3083 3083 c, t dbSNP:573705095
3092 3092 c, t dbSNP:190835038
3093 3093 a, g dbSNP:545611121
3100 3100 a, g dbSNP:548785959

Target ORF information:

RefSeq Version NM_004575
Organism Homo sapiens (human)
Definition Homo sapiens POU class 4 homeobox 2 (POU4F2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Diagnosis of bladder cancer recurrence based on urinary levels of EOMES, HOXA9, POU4F2, TWIST1, VIM, and ZNF154 hypermethylation
PLoS ONE 7 (10), E46297 (2012)
Reinert T, Borre M, Christiansen A, Hermann GG, Orntoft TF and Dyrskjot L.


Hsp-27 induction requires POU4F2/Brn-3b TF in doxorubicin-treated breast cancer cells, whereas phosphorylation alters its cellular localisation following drug treatment
Cell Stress Chaperones 16 (4), 427-439 (2011)
Fujita R, Ounzain S, Wang AC, Heads RJ and Budhram-Mahadeo VS.


A comprehensive negative regulatory program controlled by Brn3b to ensure ganglion cell specification from multipotential retinal precursors
J. Neurosci. 28 (13), 3392-3403 (2008)
Qiu F, Jiang H and Xiang M.


Proliferation-associated Brn-3b transcription factor can activate cyclin D1 expression in neuroblastoma and breast cancer cells
Oncogene 27 (1), 145-154 (2008)
Budhram-Mahadeo VS, Irshad S, Bowen S, Lee SA, Samady L, Tonini GP and Latchman DS.


Post-transcriptional regulation of the Brn-3b transcription factor in differentiating neuroblastoma cells
FEBS Lett. 581 (13), 2490-2496 (2007)
Calissano M, Diss JK and Latchman DS.


Inhibition of neuronal process outgrowth and neuronal specific gene activation by the Brn-3b transcription factor
J. Biol. Chem. 272 (2), 1382-1388 (1997)
Smith MD, Dawson SJ and Latchman DS.


The Brn-3 family of POU-domain factors: primary structure, binding specificity, and expression in subsets of retinal ganglion cells and somatosensory neurons
J. Neurosci. 15 (7 PT 1), 4762-4785 (1995)
Xiang M, Zhou L, Macke JP, Yoshioka T, Hendry SH, Eddy RL, Shows TB and Nathans J.


Differential expression of four members of the POU family of proteins in activated and phorbol 12-myristate 13-acetate-treated Jurkat T cells
Proc. Natl. Acad. Sci. U.S.A. 90 (21), 10260-10264 (1993)
Bhargava AK, Li Z and Weissman SM.


Brn-3b: a POU domain gene expressed in a subset of retinal ganglion cells
Neuron 11 (4), 689-701 (1993)
Xiang M, Zhou L, Peng YW, Eddy RL, Shows TB and Nathans J.


The human Brn-3b POU transcription factor shows only limited homology to the Brn-3a/RDC-1 factor outside the conserved POU domain
Nucleic Acids Res. 21 (12), 2946 (1993)
Ring CJ and Latchman DS.
