Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

POU4F2 POU class 4 homeobox 2 [Homo sapiens (human)]

Gene Symbol POU4F2
Entrez Gene ID 5458
Full Name POU class 4 homeobox 2
Synonyms BRN3.2, BRN3B, Brn-3b
General protein information
Preferred Names
POU domain, class 4, transcription factor 2
POU domain, class 4, transcription factor 2
POU domain protein
Brn3b POU domain transcription factor
POU domain class 4 transcription factor 2
brain-specific homeobox/POU domain protein 3B
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu04465 NM_004575 Homo sapiens POU class 4 homeobox 2 (POU4F2), mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu04465D
Sequence Information ORF Nucleotide Sequence (Length: 1230bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product POU domain, class 4, transcription factor 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB082745.1, BY796838.2, U06233.1 and X71488.1. On Jul 14, 2006 this sequence version replaced gi:4758947. Summary: The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U06233.1, EU439706.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)210..212(+)
Misc Feature(2)576..605(+)
Misc Feature(3)996..1229(+)
Misc Feature(4)1284..1460(+)
Misc Feature(5)1284..1454(+)
Misc Feature(6)1290..1442(+)
Exon (1)1..536
Gene Synonym:
Exon (2)537..3141
Gene Synonym:
Position Chain Variation Link
21 21 g, t dbSNP:143373833
30 30 a, g dbSNP:529808954
84 84 c, g dbSNP:573476128
88 88 -, gc dbSNP:573047005
97 97 a, g dbSNP:370191425
104 104 c, t dbSNP:532189913
112 112 g, t dbSNP:372544942
137 137 c, t dbSNP:566405740
155 155 a, g dbSNP:35733768
165 165 c, t dbSNP:548783098
166 166 a, g dbSNP:568422472
194 194 c, t dbSNP:369199465
200 200 c, t dbSNP:369625548
204 204 g, t dbSNP:757793275
209 209 c, g dbSNP:373501732
213 213 a, g dbSNP:750558475
217 217 c, t dbSNP:376572394
222 222 c, t dbSNP:780382461
231 231 a, g dbSNP:747178586
234 234 c, t dbSNP:570504750
236 236 a, g dbSNP:755908399
238 238 a, c dbSNP:539481195
239 239 a, g, t dbSNP:749059575
243 243 a, g dbSNP:202046663
245 245 a, g dbSNP:745439783
255 255 a, c dbSNP:771422888
266 266 a, g dbSNP:775283240
275 275 a, g dbSNP:200843721
280 280 a, c, g dbSNP:764572858
285 285 a, g dbSNP:762056981
293 293 g, t dbSNP:146671454
294 294 a, c dbSNP:62327967
296 296 a, c dbSNP:369358968
299 299 c, t dbSNP:758520224
300 300 c, g dbSNP:766304844
304 304 a, g dbSNP:751811339
312 312 c, g dbSNP:755145943
317 317 a, g, t dbSNP:781361250
319 319 c, t dbSNP:199899657
321 321 a, g dbSNP:756986974
338 338 c, t dbSNP:373682041
339 339 a, g dbSNP:745722834
344 344 c, t dbSNP:140261687
346 346 c, t dbSNP:775088221
347 347 g, t dbSNP:746499405
348 348 c, g dbSNP:768466628
367 367 c, t dbSNP:13152799
368 368 a, c, g dbSNP:554756745
369 369 a, g dbSNP:773775307
372 372 c, t dbSNP:184591480
376 376 c, t dbSNP:766469983
378 378 -, caagctccc dbSNP:753557223
384 384 a, t dbSNP:751678267
385 385 a, c, g dbSNP:759607270
389 389 c, g dbSNP:752858301
395 395 c, t dbSNP:757076223
397 397 c, g dbSNP:778528456
403 403 a, g dbSNP:543500000
405 405 a, g dbSNP:758312980
406 406 -, tgg dbSNP:764871244
407 407 -, tggtgg dbSNP:755426836
407 407 -, tgg dbSNP:750003036
410 410 -, ggtggc dbSNP:748395865
411 411 -, ggtggcggcggcggcggcggc dbSNP:781757657
411 411 -, ggtggcggc dbSNP:756518481
413 413 -, ggc dbSNP:530695040
414 414 -, ggcggcggcggcggc dbSNP:771897159
414 414 -, ggcggcggcggc dbSNP:771187205
414 414 -, ggcggcggc dbSNP:763100230
414 414 -, ggcggc dbSNP:778938652
414 414 -, ggc dbSNP:746013278
416 416 c, t dbSNP:189899086
422 422 -, ggc, ggt dbSNP:772231658
424 424 -, cga dbSNP:760328200
426 426 g, t dbSNP:563277042
432 432 a, g dbSNP:781008874
433 433 -, cga dbSNP:761525997
443 443 -, ggt dbSNP:767856113
446 446 -, gga dbSNP:753272645
448 448 -, cgg dbSNP:5862765
449 449 a, c dbSNP:532126509
452 452 c, t dbSNP:770225812
453 453 c, g dbSNP:773402503
454 454 a, c, g dbSNP:763355404
457 457 a, g dbSNP:774823455
469 469 -, gcagcagtg dbSNP:756398451
482 482 c, g dbSNP:199600550
488 488 a, c dbSNP:767517089
490 490 -, c dbSNP:778084431
491 491 a, c dbSNP:752990850
492 492 c, g dbSNP:760756175
494 494 a, g dbSNP:764352779
495 495 a, g dbSNP:750222572
499 499 c, t dbSNP:758265520
503 503 a, g dbSNP:780202922
507 507 a, g dbSNP:751487592
508 508 c, t dbSNP:145352817
510 510 a, c, g dbSNP:780810360
511 511 a, g dbSNP:769383031
512 512 a, g dbSNP:777475559
513 513 a, c dbSNP:148020860
514 514 a, g dbSNP:771228190
518 518 c, t dbSNP:774843548
522 522 a, c dbSNP:759993347
524 524 g, t dbSNP:776843010
525 525 c, g dbSNP:772158214
529 529 a, c dbSNP:775478910
530 530 c, t dbSNP:760773916
532 532 c, t dbSNP:141725106
536 536 c, g dbSNP:776901796
544 544 c, t dbSNP:201496393
545 545 a, g dbSNP:753506987
548 548 c, t dbSNP:756948351
551 551 c, t dbSNP:778503474
557 557 a, g dbSNP:746295952
568 568 c, t dbSNP:747618017
573 573 g, t dbSNP:780441210
575 575 a, c, g dbSNP:747487311
579 579 g, t dbSNP:776725541
581 581 c, t dbSNP:748216623
588 588 c, g dbSNP:770183243
596 596 a, c, t dbSNP:773565628
604 604 c, t dbSNP:771832144
605 605 c, t dbSNP:572923830
606 606 a, g dbSNP:760611375
620 620 c, g dbSNP:763913135
623 623 c, t dbSNP:753382247
625 625 a, g dbSNP:372609971
629 629 a, c dbSNP:761305816
637 637 c, t dbSNP:764924258
640 640 c, t dbSNP:150150229
646 646 a, c dbSNP:758697090
649 649 a, g dbSNP:542500694
665 665 a, c, t dbSNP:147517729
666 666 a, g dbSNP:74417037
678 678 a, g dbSNP:748306388
687 687 a, g dbSNP:769935131
688 688 c, t dbSNP:778143343
689 689 c, t dbSNP:749485798
694 694 c, t dbSNP:771785013
695 695 a, g, t dbSNP:143938073
700 700 c, t dbSNP:768702139
704 704 a, g dbSNP:776534071
707 707 c, t dbSNP:139883264
708 708 a, g, t dbSNP:764664393
711 711 -, tct dbSNP:757454662
716 716 c, t dbSNP:762622000
718 718 c, t dbSNP:765926130
721 721 c, t dbSNP:751995847
733 733 c, t dbSNP:755295639
743 743 c, t dbSNP:538905724
745 745 a, c, t dbSNP:753186078
751 751 c, t dbSNP:777950064
752 752 a, g dbSNP:143876216
757 757 c, t dbSNP:771220976
758 758 -, cac dbSNP:745866039
759 759 -, cac dbSNP:779170313
759 759 c, g dbSNP:778994622
764 764 c, t dbSNP:369535679
765 765 c, t dbSNP:746876184
768 768 -, caccaccat dbSNP:772204480
768 768 a, c dbSNP:376900695
776 776 -, cac dbSNP:746997301
777 777 -, caccac dbSNP:768754024
777 777 -, cac dbSNP:779805566
778 778 a, g dbSNP:768379922
779 779 c, t dbSNP:776556532
794 794 a, c dbSNP:748041541
798 798 c, t dbSNP:144284868
799 799 a, c, g, t dbSNP:772758327
801 801 c, t dbSNP:773864450
808 808 a, c dbSNP:759947204
809 809 a, g dbSNP:376581460
821 821 a, g dbSNP:753277964
826 826 c, t dbSNP:566523433
828 828 a, g dbSNP:371559221
832 832 a, c dbSNP:764661037
838 838 g, t dbSNP:754012836
843 843 a, g dbSNP:757268615
845 845 g, t dbSNP:779206656
849 849 c, g dbSNP:746012753
851 851 c, t dbSNP:200464919
854 854 a, g dbSNP:780920421
857 857 c, t dbSNP:747920598
858 858 g, t dbSNP:769762929
862 862 c, t dbSNP:373979098
866 866 a, g dbSNP:202030431
878 878 c, t dbSNP:376822201
879 879 c, g dbSNP:770290821
882 882 g, t dbSNP:774082611
892 892 c, t dbSNP:567994457
893 893 a, c, g dbSNP:200695260
895 895 c, t dbSNP:761112950
899 899 g, t dbSNP:373088055
912 912 a, t dbSNP:754238090
915 915 a, g dbSNP:377219455
920 920 c, t dbSNP:765193554
923 923 a, g dbSNP:537218174
927 927 c, t dbSNP:777098293
939 939 g, t dbSNP:758672868
942 942 a, g dbSNP:780222125
943 943 c, t dbSNP:376992021
944 944 a, c, g dbSNP:557204309
947 947 c, t dbSNP:777781827
948 948 a, g dbSNP:749138680
954 954 a, g dbSNP:770495524
959 959 c, t dbSNP:778334450
962 962 a, g dbSNP:148751103
965 965 a, c, g, t dbSNP:373594627
966 966 a, c, g dbSNP:539536913
967 967 g, t dbSNP:768833334
973 973 c, g, t dbSNP:777228879
979 979 a, c dbSNP:765756416
991 991 g, t dbSNP:373360428
995 995 c, t dbSNP:750545796
998 998 a, c dbSNP:763016561
999 999 g, t dbSNP:766646381
1002 1002 c, g dbSNP:751723666
1004 1004 c, t dbSNP:755910426
1005 1005 a, g dbSNP:3827593
1008 1008 a, g dbSNP:777381197
1012 1012 c, t dbSNP:753645099
1015 1015 a, g dbSNP:757181039
1034 1034 c, t dbSNP:778905155
1035 1035 c, g dbSNP:745424096
1038 1038 c, t dbSNP:771646896
1053 1053 c, t dbSNP:779853704
1059 1059 a, c dbSNP:200579530
1064 1064 a, g, t dbSNP:769090250
1065 1065 c, g dbSNP:142395313
1066 1066 a, g dbSNP:759945625
1073 1073 a, c dbSNP:151303999
1086 1086 c, g dbSNP:762211143
1091 1091 a, c, t dbSNP:770276185
1092 1092 a, g dbSNP:763035040
1095 1095 c, t dbSNP:76129457
1099 1099 c, t dbSNP:751800890
1104 1104 c, t dbSNP:759722784
1105 1105 a, t dbSNP:373485818
1107 1107 a, c dbSNP:376482978
1114 1114 c, g dbSNP:144507526
1115 1115 c, t dbSNP:778728774
1116 1116 a, g dbSNP:750317758
1119 1119 a, g dbSNP:369337694
1121 1121 a, g dbSNP:547217412
1122 1122 a, g dbSNP:372535541
1123 1123 g, t dbSNP:200312228
1126 1126 c, t dbSNP:371120198
1133 1133 c, t dbSNP:754628247
1148 1148 c, t dbSNP:780893360
1154 1154 c, t dbSNP:748522769
1166 1166 a, t dbSNP:763900829
1172 1172 c, g dbSNP:3827594
1189 1189 a, c, t dbSNP:749757264
1190 1190 c, g, t dbSNP:61733420
1209 1209 a, g dbSNP:145278389
1215 1215 c, g dbSNP:775723549
1217 1217 c, g dbSNP:761517259
1218 1218 c, g dbSNP:765082245
1221 1221 a, g dbSNP:750407383
1226 1226 c, t dbSNP:758460226
1227 1227 c, g dbSNP:766389226
1232 1232 a, g, t dbSNP:751098355
1236 1236 c, t dbSNP:780725416
1238 1238 c, t dbSNP:144940288
1241 1241 c, t dbSNP:756468313
1242 1242 a, c, g dbSNP:267600031
1246 1246 a, c dbSNP:199979947
1257 1257 a, c, t dbSNP:575863247
1265 1265 a, c dbSNP:774821401
1273 1273 c, g dbSNP:745947870
1275 1275 a, g dbSNP:377411656
1276 1276 c, t dbSNP:544750597
1277 1277 -, gga dbSNP:776554135
1277 1277 a, g, t dbSNP:370767940
1278 1278 a, g dbSNP:375025437
1285 1285 a, c dbSNP:764391266
1287 1287 c, g dbSNP:773182911
1288 1288 a, g dbSNP:564340231
1292 1292 a, g dbSNP:766482351
1294 1294 a, g dbSNP:751460020
1297 1297 a, c dbSNP:754454809
1298 1298 g, t dbSNP:371952832
1301 1301 c, g dbSNP:752317762
1304 1304 c, t dbSNP:755801755
1306 1306 c, g dbSNP:200705430
1308 1308 a, g dbSNP:374901217
1310 1310 a, g dbSNP:367653245
1313 1313 a, g dbSNP:61733419
1321 1321 a, g dbSNP:546678292
1325 1325 a, g dbSNP:746344869
1326 1326 c, t dbSNP:772066657
1328 1328 c, g dbSNP:143117935
1329 1329 a, g dbSNP:747030570
1334 1334 c, t dbSNP:148247830
1341 1341 g, t dbSNP:180935169
1344 1344 a, g dbSNP:142851123
1349 1349 c, g dbSNP:372860552
1358 1358 c, g, t dbSNP:199813288
1373 1373 c, g, t dbSNP:751581466
1374 1374 a, g dbSNP:147007829
1376 1376 c, t dbSNP:200415873
1380 1380 a, t dbSNP:760161101
1382 1382 c, t dbSNP:572053159
1383 1383 g, t dbSNP:753421189
1385 1385 a, g, t dbSNP:369917575
1402 1402 a, g dbSNP:750729905
1408 1408 a, g dbSNP:758986301
1409 1409 a, c dbSNP:138240408
1418 1418 c, t dbSNP:747145178
1432 1432 a, g dbSNP:113095745
1452 1452 a, c dbSNP:768798955
1453 1453 g, t dbSNP:201841354
1454 1454 a, g dbSNP:748345010
1456 1456 a, t dbSNP:770874396
1458 1458 a, t dbSNP:774253916
1466 1466 c, t dbSNP:370757448
1467 1467 a, g dbSNP:759244883
1468 1468 c, t dbSNP:772102156
1469 1469 a, c, t dbSNP:143812023
1470 1470 g, t dbSNP:763554724
1473 1473 a, g dbSNP:753510787
1481 1481 c, g dbSNP:761501754
1489 1489 g, t dbSNP:3810843
1491 1491 c, g dbSNP:750868586
1497 1497 a, g dbSNP:759889268
1502 1502 c, t dbSNP:758678612
1503 1503 a, g, t dbSNP:376016201
1504 1504 a, c dbSNP:755144946
1507 1507 a, c dbSNP:750265120
1508 1508 a, g, t dbSNP:370553185
1514 1514 a, c dbSNP:756402096
1518 1518 c, t dbSNP:777842647
1519 1519 g, t dbSNP:745684665
1522 1522 c, t dbSNP:771694639
1531 1531 c, t dbSNP:755855425
1543 1543 c, t dbSNP:539680681
1572 1572 c, t dbSNP:553083434
1592 1592 a, g dbSNP:572872296
1602 1602 -, g dbSNP:528757530
1610 1610 g, t dbSNP:765481755
1613 1613 a, g dbSNP:368127169
1616 1616 c, g dbSNP:576828718
1618 1618 g, t dbSNP:537768855
1621 1621 c, g dbSNP:555076472
1622 1622 a, g dbSNP:753420756
1645 1645 a, g dbSNP:575847464
1652 1652 a, c dbSNP:544497964
1663 1663 c, t dbSNP:372340520
1690 1690 a, t dbSNP:369146164
1691 1691 c, g dbSNP:778543116
1700 1700 c, t dbSNP:747584601
1719 1719 a, c dbSNP:752223847
1724 1724 c, g dbSNP:558068608
1777 1777 a, g dbSNP:771505182
1783 1783 a, c dbSNP:577799221
1820 1820 c, t dbSNP:540452369
1840 1840 a, g dbSNP:376565147
1850 1850 -, c dbSNP:201294453
1850 1850 c, g dbSNP:762679275
1861 1861 c, g dbSNP:560180778
1904 1904 g, t dbSNP:763496961
1929 1929 c, g dbSNP:529379828
1947 1947 a, c dbSNP:542963248
1989 1989 g, t dbSNP:72956271
2013 2013 a, g dbSNP:76180708
2070 2070 a, t dbSNP:550880231
2091 2091 a, g dbSNP:186245328
2105 2105 c, g dbSNP:763118542
2140 2140 a, c dbSNP:556009401
2208 2208 -, ctt dbSNP:549012100
2216 2216 a, g dbSNP:139670347
2220 2220 -, a dbSNP:539583889
2226 2226 a, c dbSNP:546831697
2280 2280 c, t dbSNP:114364181
2307 2307 c, t dbSNP:535201496
2366 2366 a, g dbSNP:775996631
2423 2423 c, t dbSNP:7669891
2462 2462 c, t dbSNP:768739276
2480 2480 g, t dbSNP:552978816
2481 2481 a, t dbSNP:566903155
2488 2488 c, t dbSNP:756057478
2494 2494 c, t dbSNP:372851210
2502 2502 c, t dbSNP:568748935
2504 2504 c, t dbSNP:541411056
2511 2511 g, t dbSNP:537480855
2526 2526 -, ac, acacac, acacacac dbSNP:71592457
2526 2526 c, t dbSNP:200297474
2542 2542 -, ca dbSNP:72274820
2552 2552 -, ac, acac, acacacac dbSNP:60422325
2567 2567 a, g dbSNP:558005411
2590 2590 a, g dbSNP:6825713
2595 2595 a, g dbSNP:111877076
2598 2598 a, g dbSNP:540388743
2638 2638 c, t dbSNP:757239441
2664 2664 a, g dbSNP:774529609
2665 2665 c, t dbSNP:191340422
2720 2720 -, t dbSNP:766409762
2727 2727 a, g dbSNP:761760637
2748 2748 -, g dbSNP:559593444
2756 2756 a, g dbSNP:574224859
2777 2777 a, g dbSNP:183140735
2837 2837 a, g dbSNP:767513951
2841 2841 g, t dbSNP:369169254
2846 2846 a, c dbSNP:186059151
2857 2857 a, t dbSNP:531717356
2872 2872 -, aat dbSNP:780613232
2882 2882 g, t dbSNP:753756715
2884 2884 a, t dbSNP:545441921
2896 2896 a, c dbSNP:577911804
2919 2919 c, t dbSNP:144585453
2948 2948 c, t dbSNP:750269420
2969 2969 a, g dbSNP:577677595
2978 2978 a, g dbSNP:74571172
3044 3044 g, t dbSNP:754792419
3047 3047 c, t dbSNP:778678271
3048 3048 a, g dbSNP:555469738
3078 3078 a, t dbSNP:546770376
3083 3083 c, t dbSNP:573705095
3092 3092 c, t dbSNP:190835038
3093 3093 a, g dbSNP:545611121
3100 3100 a, g dbSNP:548785959

Target ORF information:

RefSeq Version NM_004575
Organism Homo sapiens (human)
Definition Homo sapiens POU class 4 homeobox 2 (POU4F2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.