Email to GenScript

CNGB3 cyclic nucleotide gated channel beta 3 [Homo sapiens (human)]

Gene Symbol CNGB3
Entrez Gene ID 54714
Full Name cyclic nucleotide gated channel beta 3
Synonyms ACHM1
General protein information
Preferred Names
cyclic nucleotide-gated cation channel beta-3
cyclic nucleotide-gated cation channel beta-3
CNG channel beta-3
cone photoreceptor cGMP-gated cation channel beta-subunit
cyclic nucleotide-gated cation channel modulatory subunit
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]. lac of sum
Disorder MIM:


Disorder Html: Achromatopsia-3, 262300 (3); Macular degeneration, juvenile, 248200

The following CNGB3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CNGB3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu68494 XM_011517138 PREDICTED: Homo sapiens cyclic nucleotide gated channel beta 3 (CNGB3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu18723 NM_019098 Homo sapiens cyclic nucleotide gated channel beta 3 (CNGB3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu68494
Accession Version XM_011517138.1
Sequence Information ORF Nucleotide Sequence (Length: 2016bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cyclic nucleotide-gated cation channel beta-3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008046.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)466..1026(+)
Misc Feature(2)1264..>1647(+)
Misc Feature(3)1273..1620(+)
Misc Feature(4)1474..1521(+)
Misc Feature(5)1579..1605(+)
Misc Feature(6)1702..>2001(+)
Position Chain Variation Link
32 32 a, g dbSNP:527702868
56 56 a, c, t dbSNP:755429797
56 56 -, c dbSNP:754804590
57 57 a, g, t dbSNP:75858066
73 73 a, g dbSNP:750041313
82 82 c, t dbSNP:764918540
84 84 c, t dbSNP:756986331
87 87 c, t dbSNP:137853910
88 88 a, g dbSNP:753353080
90 90 c, t dbSNP:758681401
92 92 c, g dbSNP:763732485
94 94 c, t dbSNP:786204492
100 100 c, t dbSNP:760503824
101 101 a, c dbSNP:753603630
106 106 a, c, g dbSNP:767209573
121 121 c, t dbSNP:146488853
122 122 a, g, t dbSNP:373216514
142 142 a, g dbSNP:749542487
143 143 a, g dbSNP:773243954
144 144 g, t dbSNP:769966310
145 145 a, g dbSNP:369138501
149 149 -, t dbSNP:748993388
151 151 c, t dbSNP:781757726
153 153 a, g, t dbSNP:201881873
162 162 a, c dbSNP:149945278
170 170 c, t dbSNP:139207764
177 177 a, c, g, t dbSNP:151230930
178 178 a, g dbSNP:777404947
182 182 c, t dbSNP:755714257
192 192 a, t dbSNP:752150266
197 197 a, c dbSNP:79360883
203 203 c, t dbSNP:142772954
206 206 c, t dbSNP:755130011
207 207 a, g, t dbSNP:751547136
211 211 g, t dbSNP:766148720
217 217 a, c dbSNP:762804298
227 227 a, g dbSNP:374926686
230 230 a, g dbSNP:750225207
231 231 c, t dbSNP:765444763
232 232 a, c, g dbSNP:561985484
234 234 c, t dbSNP:768661791
240 240 g, t dbSNP:540597078
242 242 c, t dbSNP:147480410
244 244 a, g dbSNP:776201634
265 265 c, g, t dbSNP:76237620
266 266 g, t dbSNP:369882898
271 271 c, t dbSNP:774599273
280 280 a, c dbSNP:769446058
281 281 a, t dbSNP:747794498
288 288 a, g dbSNP:201255984
290 290 a, c dbSNP:754540285
291 291 c, t dbSNP:746945953
298 298 a, c, g dbSNP:114305748
305 305 c, t dbSNP:371827109
310 310 c, g, t dbSNP:267606739
311 311 a, g dbSNP:16916632
313 313 a, g dbSNP:764226037
316 316 a, c dbSNP:760767009
322 322 c, g dbSNP:566511916
327 327 c, t dbSNP:144347980
329 329 c, g dbSNP:760149836
336 336 c, g, t dbSNP:557864352
340 340 c, t dbSNP:747823818
344 344 c, t dbSNP:776213332
349 349 c, t dbSNP:768345097
350 350 a, g dbSNP:760287680
356 356 a, g dbSNP:775009244
366 366 c, g dbSNP:771518546
369 369 c, t dbSNP:371758459
373 373 c, t dbSNP:373286939
376 376 g, t dbSNP:78724498
377 377 c, t dbSNP:770892026
380 380 a, c dbSNP:202240228
381 381 g, t dbSNP:777682278
382 382 c, g dbSNP:756438306
383 383 c, t dbSNP:752920111
385 385 g, t dbSNP:79167532
389 389 a, g dbSNP:777847593
395 395 c, g dbSNP:754946422
397 397 a, g dbSNP:751654416
404 404 a, g dbSNP:766852205
405 405 g, t dbSNP:6471482
408 408 c, t dbSNP:544264326
412 412 c, t dbSNP:765542992
413 413 a, c dbSNP:760338963
418 418 c, t dbSNP:200019416
419 419 a, g, t dbSNP:759029829
420 420 c, t dbSNP:369715877
423 423 c, t dbSNP:770816095
424 424 a, g dbSNP:138320784
426 426 c, t dbSNP:376769582
432 432 a, g dbSNP:769655993
436 436 c, t dbSNP:748386255
441 441 c, t dbSNP:781628736
442 442 a, g dbSNP:150490913
449 449 a, g dbSNP:113009675
450 450 c, t dbSNP:751638643
454 454 a, c dbSNP:780149372
456 456 a, c dbSNP:758858304
459 459 c, g dbSNP:371318766
463 463 c, t dbSNP:146828510
470 470 a, c, t dbSNP:369083450
471 471 a, g dbSNP:767128005
478 478 a, g dbSNP:764839662
479 479 c, t dbSNP:36099871
482 482 a, g dbSNP:773768338
493 493 c, t dbSNP:375062842
500 500 a, g dbSNP:765866760
502 502 a, g dbSNP:762813240
510 510 a, g dbSNP:773217705
522 522 -, cagactcc dbSNP:775796581
524 524 a, g dbSNP:769850965
528 528 c, t dbSNP:748014051
538 538 a, g dbSNP:141530733
539 539 a, g dbSNP:768800321
550 550 a, g dbSNP:747212057
553 553 a, g dbSNP:780016234
554 554 c, t dbSNP:758442588
568 568 a, g dbSNP:778936684
572 572 g, t dbSNP:760867802
573 573 a, g dbSNP:757796486
586 586 a, g dbSNP:749748983
587 587 a, g dbSNP:778013642
589 589 -, acttc dbSNP:759748892
592 592 g, t dbSNP:74602293
595 595 a, c, t dbSNP:4961206
596 596 -, caaaa dbSNP:776581420
596 596 c, g dbSNP:766113410
609 609 a, g dbSNP:528004507
615 615 c, t dbSNP:117806701
616 616 -, tcg dbSNP:748151167
616 616 a, g dbSNP:144637286
622 622 a, g dbSNP:13265557
630 630 -, a dbSNP:774405526
630 630 a, g dbSNP:750045904
641 641 a, g dbSNP:778576551
646 646 a, c dbSNP:756757567
647 647 c, t dbSNP:546831603
651 651 a, c dbSNP:764146474
655 655 a, g dbSNP:760502027
657 657 g, t dbSNP:752571885
663 663 a, t dbSNP:528278561
664 664 c, t dbSNP:267602034
671 671 g, t dbSNP:759770735
683 683 a, g dbSNP:774491892
684 684 c, g dbSNP:771140264
685 685 a, g dbSNP:570553767
703 703 g, t dbSNP:765179358
706 706 -, tttgaattt dbSNP:745456939
709 709 g, t dbSNP:373862340
716 716 a, g dbSNP:548817727
733 733 a, g dbSNP:769279449
734 734 a, t dbSNP:143542885
737 737 c, g, t dbSNP:775971746
739 739 a, g dbSNP:770651041
747 747 a, g dbSNP:199760664
755 755 a, g dbSNP:777359145
756 756 c, t dbSNP:755515261
763 763 a, t dbSNP:267602033
765 765 c, t dbSNP:267602032
766 766 c, t dbSNP:764742792
767 767 a, g dbSNP:555345043
768 768 a, g dbSNP:776023278
769 769 a, c dbSNP:772269319
790 790 a, g dbSNP:748977433
803 803 a, g dbSNP:772807972
813 813 c, t dbSNP:148884146
817 817 c, t dbSNP:190624430
820 820 c, t dbSNP:145619853
822 822 a, g dbSNP:786204762
828 828 a, g dbSNP:780650641
829 829 a, g dbSNP:754937899
832 832 c, t dbSNP:746899193
842 842 a, t dbSNP:779911016
848 848 c, t dbSNP:758061248
851 851 -, c dbSNP:397515360
852 852 c, t dbSNP:554368357
857 857 g, t dbSNP:779059841
865 865 a, g dbSNP:267602031
870 870 a, g dbSNP:757474781
872 872 a, g dbSNP:754007634
873 873 a, g dbSNP:764223759
874 874 a, g dbSNP:761282523
875 875 a, g dbSNP:267602030
879 879 c, g, t dbSNP:781293151
880 880 a, g dbSNP:538823901
886 886 c, t dbSNP:149755970
889 889 a, c dbSNP:760232682
893 893 -, gtt dbSNP:765574129
896 896 a, g dbSNP:564759960
897 897 c, t dbSNP:775038513
901 901 c, t dbSNP:771941989
905 905 c, t dbSNP:745774637
907 907 g, t dbSNP:139825253
910 910 c, t dbSNP:770786127
911 911 a, g dbSNP:147876778
914 914 c, t dbSNP:778202454
919 919 a, g dbSNP:756383300
927 927 c, t dbSNP:748216208
928 928 a, g dbSNP:781293627
930 930 c, t dbSNP:755463578
932 932 g, t dbSNP:200452343
936 936 a, t dbSNP:766732208
937 937 c, t dbSNP:758828078
948 948 a, g dbSNP:750772083
950 950 c, t dbSNP:763781146
951 951 a, t dbSNP:760285737
953 953 -, t dbSNP:759746961
955 955 c, t dbSNP:774891602
957 957 g, t dbSNP:767000862
958 958 a, g, t dbSNP:372302139
964 964 g, t dbSNP:770982640
976 976 c, t dbSNP:749145455
980 980 a, c dbSNP:773111269
988 988 -, t dbSNP:776896038
1003 1003 c, t dbSNP:113716962
1007 1007 c, t dbSNP:121918344
1008 1008 c, t dbSNP:770173277
1009 1009 a, c dbSNP:748354081
1010 1010 a, g dbSNP:781144217
1014 1014 a, c dbSNP:755016850
1016 1016 c, t dbSNP:375524869
1017 1017 -, t dbSNP:766415321
1018 1018 a, g dbSNP:201825105
1024 1024 a, t dbSNP:765939705
1030 1030 g, t dbSNP:144689967
1031 1031 a, t dbSNP:750317728
1037 1037 c, t dbSNP:765079041
1038 1038 c, t dbSNP:761725238
1043 1043 a, c dbSNP:533560246
1050 1050 a, t dbSNP:768959472
1055 1055 a, g dbSNP:760764530
1059 1059 a, g dbSNP:34839859
1069 1069 c, t dbSNP:544695310
1070 1070 a, g dbSNP:150650617
1071 1071 c, t dbSNP:141934736
1072 1072 a, g dbSNP:192568942
1073 1073 a, c dbSNP:749705666
1079 1079 c, t dbSNP:375886578
1081 1081 a, g dbSNP:148572872
1086 1086 c, t dbSNP:112847374
1100 1100 c, t dbSNP:35010099
1103 1103 a, g dbSNP:577006745
1108 1108 a, g, t dbSNP:35365413
1112 1112 c, g dbSNP:749937651
1114 1114 a, g dbSNP:765267761
1120 1120 a, g dbSNP:761623740
1127 1127 g, t dbSNP:753694130
1128 1128 a, g dbSNP:370600047
1130 1130 a, g dbSNP:763743295
1134 1134 g, t dbSNP:760898777
1135 1135 c, t dbSNP:201320564
1136 1136 a, g dbSNP:772270787
1141 1141 c, g, t dbSNP:774267267
1142 1142 a, g dbSNP:77277189
1144 1144 a, g dbSNP:749710977
1147 1147 g, t dbSNP:773640498
1150 1150 a, g, t dbSNP:373270306
1151 1151 a, g dbSNP:766310915
1156 1156 a, t dbSNP:748516981
1187 1187 a, c dbSNP:142387860
1191 1191 g, t dbSNP:137970340
1193 1193 a, g dbSNP:778496075
1195 1195 a, t dbSNP:115246141
1196 1196 -, t dbSNP:773381712
1198 1198 c, t dbSNP:748824134
1201 1201 a, g dbSNP:373679269
1207 1207 c, g dbSNP:777623754
1211 1211 a, c dbSNP:756017029
1213 1213 a, g dbSNP:140286824
1216 1216 a, g dbSNP:148248467
1217 1217 c, t dbSNP:755207461
1218 1218 a, g dbSNP:751667290
1219 1219 -, g dbSNP:768735888
1224 1224 a, g dbSNP:554578445
1234 1234 a, g dbSNP:150642676
1237 1237 a, g dbSNP:146062161
1240 1240 g, t dbSNP:765884344
1245 1245 c, g dbSNP:762370063
1247 1247 a, g dbSNP:376475935
1266 1266 a, g dbSNP:769081032
1269 1269 c, t dbSNP:201787120
1277 1277 -, tc dbSNP:749179501
1301 1301 c, t dbSNP:769226980
1310 1310 c, t dbSNP:367652647
1317 1317 a, g dbSNP:377603878
1325 1325 a, t dbSNP:747653530
1326 1326 a, g dbSNP:781166193
1329 1329 c, t dbSNP:35903042
1330 1330 a, g dbSNP:746817996
1347 1347 a, t dbSNP:140853266
1356 1356 c, g dbSNP:758570863
1357 1357 c, t dbSNP:750611810
1366 1366 c, g dbSNP:147867059
1373 1373 c, t dbSNP:779334711
1375 1375 a, g, t dbSNP:749413012
1378 1378 a, g dbSNP:777861643
1380 1380 a, g dbSNP:756592906
1382 1382 a, g dbSNP:753181003
1383 1383 a, g dbSNP:374391309
1387 1387 c, t dbSNP:755431853
1388 1388 a, g dbSNP:751901450
1390 1390 a, g dbSNP:764907730
1399 1399 c, t dbSNP:144605411
1401 1401 a, c, t dbSNP:34160136
1403 1403 a, g dbSNP:267602029
1410 1410 a, c dbSNP:760534509
1413 1413 a, c dbSNP:775564107
1417 1417 c, g dbSNP:771889150
1428 1428 c, t dbSNP:745705258
1433 1433 c, g dbSNP:774250292
1435 1435 a, t dbSNP:145247723
1437 1437 c, t dbSNP:749464355
1445 1445 c, t dbSNP:549451687
1459 1459 a, g dbSNP:186974377
1464 1464 a, g dbSNP:372717913
1466 1466 c, t dbSNP:748166954
1467 1467 a, g dbSNP:781749103
1473 1473 g, t dbSNP:755448793
1478 1478 a, g dbSNP:566844518
1481 1481 g, t dbSNP:780344162
1496 1496 a, c dbSNP:769889004
1503 1503 a, g dbSNP:779152246
1509 1509 c, g, t dbSNP:769171325
1511 1511 a, g dbSNP:747454175
1513 1513 c, t dbSNP:200805087
1514 1514 a, g dbSNP:369526115
1518 1518 g, t dbSNP:143131185
1522 1522 a, g dbSNP:777528651
1532 1532 c, t dbSNP:201093395
1536 1536 c, t dbSNP:368787128
1537 1537 g, t dbSNP:201675902
1547 1547 a, g dbSNP:759552248
1548 1548 a, t dbSNP:564189566
1555 1555 a, g dbSNP:766409709
1558 1558 c, g dbSNP:762859434
1560 1560 a, c dbSNP:772854845
1561 1561 c, g dbSNP:770088718
1564 1564 a, g dbSNP:761889451
1571 1571 c, t dbSNP:150021032
1573 1573 c, t dbSNP:374642816
1576 1576 c, t dbSNP:747082741
1601 1601 a, g, t dbSNP:139337746
1611 1611 g, t dbSNP:546000013
1615 1615 c, t dbSNP:779105068
1619 1619 c, t dbSNP:150878867
1627 1627 a, g dbSNP:371424750
1628 1628 c, g dbSNP:367888806
1629 1629 c, g dbSNP:199726942
1633 1633 c, g dbSNP:143875055
1635 1635 a, g, t dbSNP:753607658
1639 1639 c, t dbSNP:149119556
1640 1640 -, t dbSNP:745557293
1644 1644 a, g dbSNP:760845597
1656 1656 c, g dbSNP:370862624
1659 1659 c, t dbSNP:767430685
1660 1660 a, g dbSNP:368249894
1667 1667 c, t dbSNP:774779115
1671 1671 c, g dbSNP:771447950
1680 1680 a, g dbSNP:749714532
1687 1687 -, atc dbSNP:780866922
1693 1693 c, t dbSNP:773675958
1697 1697 c, t dbSNP:768447937
1702 1702 a, c dbSNP:746605655
1706 1706 c, t dbSNP:146161333
1707 1707 a, g dbSNP:142347723
1710 1710 a, g dbSNP:147991883
1714 1714 g, t dbSNP:761969118
1720 1720 c, t dbSNP:375843177
1728 1728 a, c, g dbSNP:753663511
1730 1730 g, t dbSNP:535555046
1739 1739 c, t dbSNP:756335664
1742 1742 c, t dbSNP:200892871
1744 1744 a, g dbSNP:752985345
1750 1750 a, c dbSNP:144474033
1754 1754 a, g dbSNP:759584325
1761 1761 a, t dbSNP:751631816
1763 1763 a, g dbSNP:766831491
1789 1789 c, t dbSNP:192448853
1790 1790 a, g dbSNP:377730576
1806 1806 c, g dbSNP:770214046
1809 1809 g, t dbSNP:141691152
1810 1810 a, g dbSNP:748785588
1816 1816 a, c dbSNP:773182582
1827 1827 a, g dbSNP:769689524
1829 1829 -, gag dbSNP:749597083
1833 1833 a, g dbSNP:149271453
1862 1862 a, g dbSNP:112573107
1863 1863 -, aaaa dbSNP:770450153
1870 1870 a, g dbSNP:145986524
1875 1875 a, g dbSNP:747190079
1882 1882 -, caaaaagaaaatgaagataaa dbSNP:746549330
1882 1882 c, g dbSNP:780131584
1883 1883 a, g dbSNP:758606162
1902 1902 -, caaaaagaaaatgaagataaa dbSNP:3832571
1902 1902 a, g dbSNP:750503876
1903 1903 a, c, g dbSNP:377050872
1904 1904 a, g dbSNP:757799031
1910 1910 a, g dbSNP:754176697
1917 1917 a, g dbSNP:3735970
1918 1918 g, t dbSNP:759113706
1926 1926 c, t dbSNP:774113227
1927 1927 a, g dbSNP:765995385
1934 1934 a, g dbSNP:762489931
1938 1938 c, g dbSNP:201770811
1940 1940 c, t dbSNP:769748710
1947 1947 a, g dbSNP:748065648
1948 1948 a, g dbSNP:190864281
1951 1951 c, t dbSNP:3735971
1961 1961 c, g dbSNP:746764627
1967 1967 a, g dbSNP:3735972
1970 1970 a, g dbSNP:758659088
1972 1972 a, g dbSNP:745975709
1973 1973 c, t dbSNP:779087273
1981 1981 c, t dbSNP:757716046
1983 1983 c, t dbSNP:754303041
1988 1988 c, t dbSNP:764496534
1991 1991 c, t dbSNP:756553232
1997 1997 a, g dbSNP:752973745
2002 2002 -, ccca dbSNP:199570140
2006 2006 a, c dbSNP:758454854
2007 2007 -, ccac dbSNP:777210982
2011 2011 c, g, t dbSNP:78239264
2016 2016 -, aag dbSNP:758914061
2019 2019 g, t dbSNP:762547089
2025 2025 c, t dbSNP:772725745
2028 2028 a, g dbSNP:764662692
2029 2029 c, t dbSNP:761227251
2037 2037 c, g dbSNP:776684960
2039 2039 c, t dbSNP:768453158
2042 2042 c, t dbSNP:760554096
2044 2044 c, t dbSNP:775381466
2045 2045 a, g dbSNP:772444831
2053 2053 c, t dbSNP:750535143
2064 2064 a, c dbSNP:559380014
2065 2065 a, g dbSNP:372823505
2068 2068 a, g dbSNP:267602028
2070 2070 c, t dbSNP:749307247
2071 2071 a, c dbSNP:778384043
2078 2078 c, t dbSNP:140932384
2086 2086 a, g dbSNP:753083465
2090 2090 a, g dbSNP:781481819
2092 2092 a, g dbSNP:758053992
2095 2095 c, g dbSNP:750147398
2098 2098 -, c dbSNP:753199958
2100 2100 c, t dbSNP:764860583
2113 2113 a, t dbSNP:151039691
2116 2116 c, g dbSNP:753251909
2118 2118 a, c dbSNP:186448979
2121 2121 g, t dbSNP:760477374
2122 2122 a, g dbSNP:375288585
2123 2123 c, g dbSNP:142846289
2133 2133 a, g dbSNP:369349856
2135 2135 c, t dbSNP:561845227
2138 2138 c, t dbSNP:774763662
2149 2149 c, t dbSNP:537918624
2150 2150 a, c dbSNP:201365222
2152 2152 a, t dbSNP:761282321
2153 2153 c, t dbSNP:777666964
2159 2159 -, a dbSNP:779201314
2159 2159 a, g dbSNP:770350464
2160 2160 c, t dbSNP:773875783
2162 2162 g, t dbSNP:138432513
2173 2173 a, t dbSNP:781664615
2184 2184 a, c, t dbSNP:189210452
2200 2200 a, c dbSNP:566764255
2209 2209 a, g dbSNP:762595113
2217 2217 c, t dbSNP:372938106
2258 2258 c, g dbSNP:186370374
2280 2280 a, g dbSNP:543097492
2301 2301 g, t dbSNP:116597007
2400 2400 a, c dbSNP:150149878
2414 2414 g, t dbSNP:770198026
2421 2421 a, g dbSNP:181350408
2426 2426 c, t dbSNP:141717983
2483 2483 a, c dbSNP:545964518
2512 2512 g, t dbSNP:188787381
2522 2522 a, c dbSNP:16915861
2566 2566 a, g dbSNP:781588883
2632 2632 c, g dbSNP:540507221
2656 2656 a, g dbSNP:574800928
2706 2706 atg, cta dbSNP:386727449
2706 2706 a, c dbSNP:554627292
2708 2708 a, g dbSNP:544597262
2732 2732 a, c dbSNP:372418583
2735 2735 c, g dbSNP:148066336
2743 2743 a, c dbSNP:771020902
2753 2753 c, t dbSNP:184468550
2754 2754 a, g dbSNP:116835980
2782 2782 a, g dbSNP:778028865
2796 2796 c, t dbSNP:758636884
2835 2835 a, g dbSNP:181725778
2868 2868 a, g dbSNP:73269601
2870 2870 c, t dbSNP:146999298
2882 2882 a, t dbSNP:779992584
2885 2885 g, t dbSNP:547825341
2908 2908 a, g dbSNP:552693713
2911 2911 c, t dbSNP:16915859
2917 2917 a, c dbSNP:568797945
3024 3024 c, g dbSNP:755903087
3042 3042 -, at dbSNP:3217489
3048 3048 c, g dbSNP:189446254
3071 3071 c, g, t dbSNP:184919402
3072 3072 a, g dbSNP:560355979
3082 3082 a, t dbSNP:770620814
3109 3109 a, t dbSNP:540438742
3130 3130 a, g dbSNP:141428300
3153 3153 c, t dbSNP:750355092
3158 3158 a, g dbSNP:749230737
3185 3185 a, g dbSNP:561233391
3212 3212 c, g dbSNP:536588342
3232 3232 a, g dbSNP:773062638
3257 3257 a, c dbSNP:77776334
3316 3316 c, t dbSNP:78927155
3362 3362 a, g dbSNP:761845806
3372 3372 a, c dbSNP:769607415
3403 3403 a, g dbSNP:558708727
3408 3408 a, t dbSNP:545070786
3436 3436 a, g dbSNP:17683284
3492 3492 a, t dbSNP:780284102
3504 3504 g, t dbSNP:372688369
3511 3511 c, t dbSNP:1059336
3513 3513 g, t dbSNP:1059337
3546 3546 c, g dbSNP:146323195
3550 3550 c, t dbSNP:574196021
3581 3581 a, g dbSNP:563975295
3592 3592 c, t dbSNP:192543896
3593 3593 a, g dbSNP:537374436
3603 3603 c, g dbSNP:568808064
3610 3610 g, t dbSNP:149173480
3611 3611 a, t dbSNP:538697794
3701 3701 c, t dbSNP:1059338
3730 3730 a, g dbSNP:770160518
3740 3740 a, t dbSNP:778952875
3750 3750 c, t dbSNP:759866106
3763 3763 c, t dbSNP:777073827
3767 3767 c, t dbSNP:757397657
3771 3771 ac, ga dbSNP:71510444
3771 3771 a, g dbSNP:28471019
3772 3772 a, c dbSNP:990192
3786 3786 -, t, tt dbSNP:142508439
3789 3789 c, g dbSNP:777986938
3814 3814 a, g dbSNP:529889744
3871 3871 c, t dbSNP:560958599
3939 3939 c, t dbSNP:199880215
3956 3956 a, g dbSNP:550829874
3978 3978 c, t dbSNP:756455481
4014 4014 c, t dbSNP:990193
4015 4015 a, g dbSNP:564900702

Target ORF information:

RefSeq Version XM_011517138
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cyclic nucleotide gated channel beta 3 (CNGB3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18723
Accession Version NM_019098.4
Sequence Information ORF Nucleotide Sequence (Length: 2430bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cyclic nucleotide-gated cation channel beta-3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL713036.1, AF272900.1, AF228520.1 and BX118844.1. This sequence is a reference standard in the RefSeqGene project. On Feb 19, 2010 this sequence version replaced gi:116642888. Summary: This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF272900.1, BC150601.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA1968968 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)13..15(+)
Misc Feature(2)697..759(+)
Misc Feature(3)799..861(+)
Misc Feature(4)811..1371(+)
Misc Feature(5)955..1017(+)
Misc Feature(6)1126..1188(+)
Misc Feature(7)1300..1362(+)
Misc Feature(8)1561..1623(+)
Misc Feature(9)1609..>1992(+)
Misc Feature(10)1618..1965(+)
Misc Feature(11)1819..1866(+)
Misc Feature(12)1924..1950(+)
Exon (1)1..177
Gene Synonym:
Exon (2)178..259
Gene Synonym:
Exon (3)260..386
Gene Synonym:
Exon (4)387..541
Gene Synonym:
Exon (5)542..691
Gene Synonym:
Exon (6)692..900
Gene Synonym:
Exon (7)901..951
Gene Synonym:
Exon (8)952..1038
Gene Synonym:
Exon (9)1039..1103
Gene Synonym:
Exon (10)1104..1226
Gene Synonym:
Exon (11)1227..1368
Gene Synonym:
Exon (12)1369..1528
Gene Synonym:
Exon (13)1529..1626
Gene Synonym:
Exon (14)1627..1710
Gene Synonym:
Exon (15)1711..1829
Gene Synonym:
Exon (16)1830..1976
Gene Synonym:
Exon (17)1977..2151
Gene Synonym:
Exon (18)2152..4347
Gene Synonym:
Position Chain Variation Link
5 5 a, c dbSNP:201317690
13 13 a, g, t dbSNP:7812496
15 15 a, t dbSNP:764998796
17 17 c, t dbSNP:376141938
19 19 a, c dbSNP:754005147
23 23 c, g dbSNP:764316139
24 24 a, c, g, t dbSNP:142988650
26 26 c, t dbSNP:139189735
31 31 -, a dbSNP:747017484
36 36 a, c dbSNP:749573576
59 59 a, c, t dbSNP:376711003
60 60 a, g dbSNP:139284415
68 68 -, aa dbSNP:777544479
69 69 a, t dbSNP:778013546
71 71 a, t dbSNP:768305532
91 91 c, g dbSNP:150260103
94 94 c, g dbSNP:779511288
101 101 a, g dbSNP:757956255
108 108 c, t dbSNP:750349839
121 121 c, g dbSNP:778891741
122 122 a, g, t dbSNP:141098074
124 124 c, t dbSNP:752014086
128 128 a, g dbSNP:35807406
130 130 a, g dbSNP:752910520
131 131 a, c dbSNP:767691320
134 134 a, t dbSNP:1053927
135 135 a, c dbSNP:759755619
138 138 c, t dbSNP:371664722
144 144 c, t dbSNP:528370477
160 160 c, t dbSNP:786204498
163 163 a, c dbSNP:375530321
170 170 c, t dbSNP:763392637
177 177 c, g dbSNP:773587353
190 190 a, g dbSNP:544962784
191 191 a, g dbSNP:766600503
201 201 a, g dbSNP:149091571
207 207 c, g dbSNP:773643974
210 210 a, g dbSNP:765623832
215 215 a, g dbSNP:762155107
218 218 c, t dbSNP:772746205
221 221 c, g, t dbSNP:771659828
230 230 a, c dbSNP:745546656
231 231 a, g dbSNP:767130603
244 244 c, t dbSNP:770393099
248 248 c, t dbSNP:749235146
254 254 c, t dbSNP:777636370
255 255 a, g, t dbSNP:35077504
259 259 a, g dbSNP:747892967
263 263 a, g dbSNP:188724178
265 265 c, g dbSNP:765889773
269 269 c, t dbSNP:762689312
283 283 c, t dbSNP:569899068
289 289 a, g dbSNP:148834016
293 293 c, t dbSNP:769386724
296 296 c, t dbSNP:761822317
297 297 c, t dbSNP:754960064
302 302 a, g dbSNP:776768303
306 306 c, t dbSNP:768570199
316 316 a, g dbSNP:746736708
338 338 c, t dbSNP:779917173
355 355 a, g dbSNP:772140410
358 358 a, c dbSNP:746138391
363 363 c, t dbSNP:778832930
367 367 a, g dbSNP:146688972
373 373 g, t dbSNP:754335400
379 379 c, g dbSNP:778184687
401 401 a, c, t dbSNP:755429797
401 401 -, c dbSNP:754804590
402 402 a, g, t dbSNP:75858066
418 418 a, g dbSNP:750041313
427 427 c, t dbSNP:764918540
429 429 c, t dbSNP:756986331
432 432 c, t dbSNP:137853910
433 433 a, g dbSNP:753353080
435 435 c, t dbSNP:758681401
437 437 c, g dbSNP:763732485
439 439 c, t dbSNP:786204492
445 445 c, t dbSNP:760503824
446 446 a, c dbSNP:753603630
451 451 a, c, g dbSNP:767209573
466 466 c, t dbSNP:146488853
467 467 a, g, t dbSNP:373216514
487 487 a, g dbSNP:749542487
488 488 a, g dbSNP:773243954
489 489 g, t dbSNP:769966310
490 490 a, g dbSNP:369138501
494 494 -, t dbSNP:748993388
496 496 c, t dbSNP:781757726
498 498 a, g, t dbSNP:201881873
507 507 a, c dbSNP:149945278
515 515 c, t dbSNP:139207764
522 522 a, c, g, t dbSNP:151230930
523 523 a, g dbSNP:777404947
527 527 c, t dbSNP:755714257
537 537 a, t dbSNP:752150266
542 542 a, c dbSNP:79360883
548 548 c, t dbSNP:142772954
551 551 c, t dbSNP:755130011
552 552 a, g, t dbSNP:751547136
556 556 g, t dbSNP:766148720
562 562 a, c dbSNP:762804298
572 572 a, g dbSNP:374926686
575 575 a, g dbSNP:750225207
576 576 c, t dbSNP:765444763
577 577 a, c, g dbSNP:561985484
579 579 c, t dbSNP:768661791
585 585 g, t dbSNP:540597078
587 587 c, t dbSNP:147480410
589 589 a, g dbSNP:776201634
610 610 c, g, t dbSNP:76237620
611 611 g, t dbSNP:369882898
616 616 c, t dbSNP:774599273
625 625 a, c dbSNP:769446058
626 626 a, t dbSNP:747794498
633 633 a, g dbSNP:201255984
635 635 a, c dbSNP:754540285
636 636 c, t dbSNP:746945953
643 643 a, c, g dbSNP:114305748
650 650 c, t dbSNP:371827109
655 655 c, g, t dbSNP:267606739
656 656 a, g dbSNP:16916632
658 658 a, g dbSNP:764226037
661 661 a, c dbSNP:760767009
667 667 c, g dbSNP:566511916
672 672 c, t dbSNP:144347980
674 674 c, g dbSNP:760149836
681 681 c, g, t dbSNP:557864352
685 685 c, t dbSNP:747823818
689 689 c, t dbSNP:776213332
694 694 c, t dbSNP:768345097
695 695 a, g dbSNP:760287680
701 701 a, g dbSNP:775009244
711 711 c, g dbSNP:771518546
714 714 c, t dbSNP:371758459
718 718 c, t dbSNP:373286939
721 721 g, t dbSNP:78724498
722 722 c, t dbSNP:770892026
725 725 a, c dbSNP:202240228
726 726 g, t dbSNP:777682278
727 727 c, g dbSNP:756438306
728 728 c, t dbSNP:752920111
730 730 g, t dbSNP:79167532
734 734 a, g dbSNP:777847593
740 740 c, g dbSNP:754946422
742 742 a, g dbSNP:751654416
749 749 a, g dbSNP:766852205
750 750 g, t dbSNP:6471482
753 753 c, t dbSNP:544264326
757 757 c, t dbSNP:765542992
758 758 a, c dbSNP:760338963
763 763 c, t dbSNP:200019416
764 764 a, g, t dbSNP:759029829
765 765 c, t dbSNP:369715877
768 768 c, t dbSNP:770816095
769 769 a, g dbSNP:138320784
771 771 c, t dbSNP:376769582
777 777 a, g dbSNP:769655993
781 781 c, t dbSNP:748386255
786 786 c, t dbSNP:781628736
787 787 a, g dbSNP:150490913
794 794 a, g dbSNP:113009675
795 795 c, t dbSNP:751638643
799 799 a, c dbSNP:780149372
801 801 a, c dbSNP:758858304
804 804 c, g dbSNP:371318766
808 808 c, t dbSNP:146828510
815 815 a, c, t dbSNP:369083450
816 816 a, g dbSNP:767128005
823 823 a, g dbSNP:764839662
824 824 c, t dbSNP:36099871
827 827 a, g dbSNP:773768338
838 838 c, t dbSNP:375062842
845 845 a, g dbSNP:765866760
847 847 a, g dbSNP:762813240
855 855 a, g dbSNP:773217705
867 867 -, cagactcc dbSNP:775796581
869 869 a, g dbSNP:769850965
873 873 c, t dbSNP:748014051
883 883 a, g dbSNP:141530733
884 884 a, g dbSNP:768800321
895 895 a, g dbSNP:747212057
898 898 a, g dbSNP:780016234
899 899 c, t dbSNP:758442588
913 913 a, g dbSNP:778936684
917 917 g, t dbSNP:760867802
918 918 a, g dbSNP:757796486
931 931 a, g dbSNP:749748983
932 932 a, g dbSNP:778013642
934 934 -, acttc dbSNP:759748892
937 937 g, t dbSNP:74602293
940 940 a, c, t dbSNP:4961206
941 941 -, caaaa dbSNP:776581420
941 941 c, g dbSNP:766113410
954 954 a, g dbSNP:528004507
960 960 c, t dbSNP:117806701
961 961 -, tcg dbSNP:748151167
961 961 a, g dbSNP:144637286
967 967 a, g dbSNP:13265557
975 975 -, a dbSNP:774405526
975 975 a, g dbSNP:750045904
986 986 a, g dbSNP:778576551
991 991 a, c dbSNP:756757567
992 992 c, t dbSNP:546831603
996 996 a, c dbSNP:764146474
1000 1000 a, g dbSNP:760502027
1002 1002 g, t dbSNP:752571885
1008 1008 a, t dbSNP:528278561
1009 1009 c, t dbSNP:267602034
1016 1016 g, t dbSNP:759770735
1028 1028 a, g dbSNP:774491892
1029 1029 c, g dbSNP:771140264
1030 1030 a, g dbSNP:570553767
1048 1048 g, t dbSNP:765179358
1051 1051 -, tttgaattt dbSNP:745456939
1054 1054 g, t dbSNP:373862340
1061 1061 a, g dbSNP:548817727
1078 1078 a, g dbSNP:769279449
1079 1079 a, t dbSNP:143542885
1082 1082 c, g, t dbSNP:775971746
1084 1084 a, g dbSNP:770651041
1092 1092 a, g dbSNP:199760664
1100 1100 a, g dbSNP:777359145
1101 1101 c, t dbSNP:755515261
1108 1108 a, t dbSNP:267602033
1110 1110 c, t dbSNP:267602032
1111 1111 c, t dbSNP:764742792
1112 1112 a, g dbSNP:555345043
1113 1113 a, g dbSNP:776023278
1114 1114 a, c dbSNP:772269319
1135 1135 a, g dbSNP:748977433
1148 1148 a, g dbSNP:772807972
1158 1158 c, t dbSNP:148884146
1162 1162 c, t dbSNP:190624430
1165 1165 c, t dbSNP:145619853
1167 1167 a, g dbSNP:786204762
1173 1173 a, g dbSNP:780650641
1174 1174 a, g dbSNP:754937899
1177 1177 c, t dbSNP:746899193
1187 1187 a, t dbSNP:779911016
1193 1193 c, t dbSNP:758061248
1196 1196 -, c dbSNP:397515360
1197 1197 c, t dbSNP:554368357
1202 1202 g, t dbSNP:779059841
1210 1210 a, g dbSNP:267602031
1215 1215 a, g dbSNP:757474781
1217 1217 a, g dbSNP:754007634
1218 1218 a, g dbSNP:764223759
1219 1219 a, g dbSNP:761282523
1220 1220 a, g dbSNP:267602030
1224 1224 c, g, t dbSNP:781293151
1225 1225 a, g dbSNP:538823901
1231 1231 c, t dbSNP:149755970
1234 1234 a, c dbSNP:760232682
1238 1238 -, gtt dbSNP:765574129
1241 1241 a, g dbSNP:564759960
1242 1242 c, t dbSNP:775038513
1246 1246 c, t dbSNP:771941989
1250 1250 c, t dbSNP:745774637
1252 1252 g, t dbSNP:139825253
1255 1255 c, t dbSNP:770786127
1256 1256 a, g dbSNP:147876778
1259 1259 c, t dbSNP:778202454
1264 1264 a, g dbSNP:756383300
1272 1272 c, t dbSNP:748216208
1273 1273 a, g dbSNP:781293627
1275 1275 c, t dbSNP:755463578
1277 1277 g, t dbSNP:200452343
1281 1281 a, t dbSNP:766732208
1282 1282 c, t dbSNP:758828078
1293 1293 a, g dbSNP:750772083
1295 1295 c, t dbSNP:763781146
1296 1296 a, t dbSNP:760285737
1298 1298 -, t dbSNP:759746961
1300 1300 c, t dbSNP:774891602
1302 1302 g, t dbSNP:767000862
1303 1303 a, g, t dbSNP:372302139
1309 1309 g, t dbSNP:770982640
1321 1321 c, t dbSNP:749145455
1325 1325 a, c dbSNP:773111269
1333 1333 -, t dbSNP:776896038
1348 1348 c, t dbSNP:113716962
1352 1352 c, t dbSNP:121918344
1353 1353 c, t dbSNP:770173277
1354 1354 a, c dbSNP:748354081
1355 1355 a, g dbSNP:781144217
1359 1359 a, c dbSNP:755016850
1361 1361 c, t dbSNP:375524869
1362 1362 -, t dbSNP:766415321
1363 1363 a, g dbSNP:201825105
1369 1369 a, t dbSNP:765939705
1375 1375 g, t dbSNP:144689967
1376 1376 a, t dbSNP:750317728
1382 1382 c, t dbSNP:765079041
1383 1383 c, t dbSNP:761725238
1388 1388 a, c dbSNP:533560246
1395 1395 a, t dbSNP:768959472
1400 1400 a, g dbSNP:760764530
1404 1404 a, g dbSNP:34839859
1414 1414 c, t dbSNP:544695310
1415 1415 a, g dbSNP:150650617
1416 1416 c, t dbSNP:141934736
1417 1417 a, g dbSNP:192568942
1418 1418 a, c dbSNP:749705666
1424 1424 c, t dbSNP:375886578
1426 1426 a, g dbSNP:148572872
1431 1431 c, t dbSNP:112847374
1445 1445 c, t dbSNP:35010099
1448 1448 a, g dbSNP:577006745
1453 1453 a, g, t dbSNP:35365413
1457 1457 c, g dbSNP:749937651
1459 1459 a, g dbSNP:765267761
1465 1465 a, g dbSNP:761623740
1472 1472 g, t dbSNP:753694130
1473 1473 a, g dbSNP:370600047
1475 1475 a, g dbSNP:763743295
1479 1479 g, t dbSNP:760898777
1480 1480 c, t dbSNP:201320564
1481 1481 a, g dbSNP:772270787
1486 1486 c, g, t dbSNP:774267267
1487 1487 a, g dbSNP:77277189
1489 1489 a, g dbSNP:749710977
1492 1492 g, t dbSNP:773640498
1495 1495 a, g, t dbSNP:373270306
1496 1496 a, g dbSNP:766310915
1501 1501 a, t dbSNP:748516981
1532 1532 a, c dbSNP:142387860
1536 1536 g, t dbSNP:137970340
1538 1538 a, g dbSNP:778496075
1540 1540 a, t dbSNP:115246141
1541 1541 -, t dbSNP:773381712
1543 1543 c, t dbSNP:748824134
1546 1546 a, g dbSNP:373679269
1552 1552 c, g dbSNP:777623754
1556 1556 a, c dbSNP:756017029
1558 1558 a, g dbSNP:140286824
1561 1561 a, g dbSNP:148248467
1562 1562 c, t dbSNP:755207461
1563 1563 a, g dbSNP:751667290
1564 1564 -, g dbSNP:768735888
1569 1569 a, g dbSNP:554578445
1579 1579 a, g dbSNP:150642676
1582 1582 a, g dbSNP:146062161
1585 1585 g, t dbSNP:765884344
1590 1590 c, g dbSNP:762370063
1592 1592 a, g dbSNP:376475935
1611 1611 a, g dbSNP:769081032
1614 1614 c, t dbSNP:201787120
1622 1622 -, tc dbSNP:749179501
1646 1646 c, t dbSNP:769226980
1655 1655 c, t dbSNP:367652647
1662 1662 a, g dbSNP:377603878
1670 1670 a, t dbSNP:747653530
1671 1671 a, g dbSNP:781166193
1674 1674 c, t dbSNP:35903042
1675 1675 a, g dbSNP:746817996
1692 1692 a, t dbSNP:140853266
1701 1701 c, g dbSNP:758570863
1702 1702 c, t dbSNP:750611810
1711 1711 c, g dbSNP:147867059
1718 1718 c, t dbSNP:779334711
1720 1720 a, g, t dbSNP:749413012
1723 1723 a, g dbSNP:777861643
1725 1725 a, g dbSNP:756592906
1727 1727 a, g dbSNP:753181003
1728 1728 a, g dbSNP:374391309
1732 1732 c, t dbSNP:755431853
1733 1733 a, g dbSNP:751901450
1735 1735 a, g dbSNP:764907730
1744 1744 c, t dbSNP:144605411
1746 1746 a, c, t dbSNP:34160136
1748 1748 a, g dbSNP:267602029
1755 1755 a, c dbSNP:760534509
1758 1758 a, c dbSNP:775564107
1762 1762 c, g dbSNP:771889150
1773 1773 c, t dbSNP:745705258
1778 1778 c, g dbSNP:774250292
1780 1780 a, t dbSNP:145247723
1782 1782 c, t dbSNP:749464355
1790 1790 c, t dbSNP:549451687
1804 1804 a, g dbSNP:186974377
1809 1809 a, g dbSNP:372717913
1811 1811 c, t dbSNP:748166954
1812 1812 a, g dbSNP:781749103
1818 1818 g, t dbSNP:755448793
1823 1823 a, g dbSNP:566844518
1826 1826 g, t dbSNP:780344162
1841 1841 a, c dbSNP:769889004
1848 1848 a, g dbSNP:779152246
1854 1854 c, g, t dbSNP:769171325
1856 1856 a, g dbSNP:747454175
1858 1858 c, t dbSNP:200805087
1859 1859 a, g dbSNP:369526115
1863 1863 g, t dbSNP:143131185
1867 1867 a, g dbSNP:777528651
1877 1877 c, t dbSNP:201093395
1881 1881 c, t dbSNP:368787128
1882 1882 g, t dbSNP:201675902
1892 1892 a, g dbSNP:759552248
1893 1893 a, t dbSNP:564189566
1900 1900 a, g dbSNP:766409709
1903 1903 c, g dbSNP:762859434
1905 1905 a, c dbSNP:772854845
1906 1906 c, g dbSNP:770088718
1909 1909 a, g dbSNP:761889451
1916 1916 c, t dbSNP:150021032
1918 1918 c, t dbSNP:374642816
1921 1921 c, t dbSNP:747082741
1946 1946 a, g, t dbSNP:139337746
1956 1956 g, t dbSNP:546000013
1960 1960 c, t dbSNP:779105068
1964 1964 c, t dbSNP:150878867
1972 1972 a, g dbSNP:371424750
1973 1973 c, g dbSNP:367888806
1974 1974 c, g dbSNP:199726942
1978 1978 c, g dbSNP:143875055
1980 1980 a, g, t dbSNP:753607658
1984 1984 c, t dbSNP:149119556
1985 1985 -, t dbSNP:745557293
1989 1989 a, g dbSNP:760845597
2001 2001 c, g dbSNP:370862624
2004 2004 c, t dbSNP:767430685
2005 2005 a, g dbSNP:368249894
2012 2012 c, t dbSNP:774779115
2016 2016 c, g dbSNP:771447950
2025 2025 a, g dbSNP:749714532
2032 2032 -, atc dbSNP:780866922
2038 2038 c, t dbSNP:773675958
2042 2042 c, t dbSNP:768447937
2047 2047 a, c dbSNP:746605655
2051 2051 c, t dbSNP:146161333
2052 2052 a, g dbSNP:142347723
2055 2055 a, g dbSNP:147991883
2059 2059 g, t dbSNP:761969118
2065 2065 c, t dbSNP:375843177
2073 2073 a, c, g dbSNP:753663511
2075 2075 g, t dbSNP:535555046
2084 2084 c, t dbSNP:756335664
2087 2087 c, t dbSNP:200892871
2089 2089 a, g dbSNP:752985345
2095 2095 a, c dbSNP:144474033
2099 2099 a, g dbSNP:759584325
2106 2106 a, t dbSNP:751631816
2108 2108 a, g dbSNP:766831491
2134 2134 c, t dbSNP:192448853
2135 2135 a, g dbSNP:377730576
2151 2151 c, g dbSNP:770214046
2154 2154 g, t dbSNP:141691152
2155 2155 a, g dbSNP:748785588
2161 2161 a, c dbSNP:773182582
2172 2172 a, g dbSNP:769689524
2174 2174 -, gag dbSNP:749597083
2178 2178 a, g dbSNP:149271453
2207 2207 a, g dbSNP:112573107
2208 2208 -, aaaa dbSNP:770450153
2215 2215 a, g dbSNP:145986524
2220 2220 a, g dbSNP:747190079
2227 2227 -, caaaaagaaaatgaagataaa dbSNP:746549330
2227 2227 c, g dbSNP:780131584
2228 2228 a, g dbSNP:758606162
2247 2247 -, caaaaagaaaatgaagataaa dbSNP:3832571
2247 2247 a, g dbSNP:750503876
2248 2248 a, c, g dbSNP:377050872
2249 2249 a, g dbSNP:757799031
2255 2255 a, g dbSNP:754176697
2262 2262 a, g dbSNP:3735970
2263 2263 g, t dbSNP:759113706
2271 2271 c, t dbSNP:774113227
2272 2272 a, g dbSNP:765995385
2279 2279 a, g dbSNP:762489931
2283 2283 c, g dbSNP:201770811
2285 2285 c, t dbSNP:769748710
2292 2292 a, g dbSNP:748065648
2293 2293 a, g dbSNP:190864281
2296 2296 c, t dbSNP:3735971
2306 2306 c, g dbSNP:746764627
2312 2312 a, g dbSNP:3735972
2315 2315 a, g dbSNP:758659088
2317 2317 a, g dbSNP:745975709
2318 2318 c, t dbSNP:779087273
2326 2326 c, t dbSNP:757716046
2328 2328 c, t dbSNP:754303041
2333 2333 c, t dbSNP:764496534
2336 2336 c, t dbSNP:756553232
2342 2342 a, g dbSNP:752973745
2347 2347 -, ccca dbSNP:199570140
2351 2351 a, c dbSNP:758454854
2352 2352 -, ccac dbSNP:777210982
2356 2356 c, g, t dbSNP:78239264
2361 2361 -, aag dbSNP:758914061
2364 2364 g, t dbSNP:762547089
2370 2370 c, t dbSNP:772725745
2373 2373 a, g dbSNP:764662692
2374 2374 c, t dbSNP:761227251
2382 2382 c, g dbSNP:776684960
2384 2384 c, t dbSNP:768453158
2387 2387 c, t dbSNP:760554096
2389 2389 c, t dbSNP:775381466
2390 2390 a, g dbSNP:772444831
2398 2398 c, t dbSNP:750535143
2409 2409 a, c dbSNP:559380014
2410 2410 a, g dbSNP:372823505
2413 2413 a, g dbSNP:267602028
2415 2415 c, t dbSNP:749307247
2416 2416 a, c dbSNP:778384043
2423 2423 c, t dbSNP:140932384
2431 2431 a, g dbSNP:753083465
2435 2435 a, g dbSNP:781481819
2437 2437 a, g dbSNP:758053992
2440 2440 c, g dbSNP:750147398
2443 2443 -, c dbSNP:753199958
2445 2445 c, t dbSNP:764860583
2458 2458 a, t dbSNP:151039691
2461 2461 c, g dbSNP:753251909
2463 2463 a, c dbSNP:186448979
2466 2466 g, t dbSNP:760477374
2467 2467 a, g dbSNP:375288585
2468 2468 c, g dbSNP:142846289
2478 2478 a, g dbSNP:369349856
2480 2480 c, t dbSNP:561845227
2483 2483 c, t dbSNP:774763662
2494 2494 c, t dbSNP:537918624
2495 2495 a, c dbSNP:201365222
2497 2497 a, t dbSNP:761282321
2498 2498 c, t dbSNP:777666964
2504 2504 -, a dbSNP:779201314
2504 2504 a, g dbSNP:770350464
2505 2505 c, t dbSNP:773875783
2507 2507 g, t dbSNP:138432513
2518 2518 a, t dbSNP:781664615
2529 2529 a, c, t dbSNP:189210452
2545 2545 a, c dbSNP:566764255
2554 2554 a, g dbSNP:762595113
2562 2562 c, t dbSNP:372938106
2603 2603 c, g dbSNP:186370374
2625 2625 a, g dbSNP:543097492
2646 2646 g, t dbSNP:116597007
2745 2745 a, c dbSNP:150149878
2759 2759 g, t dbSNP:770198026
2766 2766 a, g dbSNP:181350408
2771 2771 c, t dbSNP:141717983
2828 2828 a, c dbSNP:545964518
2857 2857 g, t dbSNP:188787381
2867 2867 a, c dbSNP:16915861
2911 2911 a, g dbSNP:781588883
2977 2977 c, g dbSNP:540507221
3001 3001 a, g dbSNP:574800928
3051 3051 atg, cta dbSNP:386727449
3051 3051 a, c dbSNP:554627292
3053 3053 a, g dbSNP:544597262
3077 3077 a, c dbSNP:372418583
3080 3080 c, g dbSNP:148066336
3088 3088 a, c dbSNP:771020902
3098 3098 c, t dbSNP:184468550
3099 3099 a, g dbSNP:116835980
3127 3127 a, g dbSNP:778028865
3141 3141 c, t dbSNP:758636884
3180 3180 a, g dbSNP:181725778
3213 3213 a, g dbSNP:73269601
3215 3215 c, t dbSNP:146999298
3227 3227 a, t dbSNP:779992584
3230 3230 g, t dbSNP:547825341
3253 3253 a, g dbSNP:552693713
3256 3256 c, t dbSNP:16915859
3262 3262 a, c dbSNP:568797945
3369 3369 c, g dbSNP:755903087
3387 3387 -, at dbSNP:3217489
3393 3393 c, g dbSNP:189446254
3416 3416 c, g, t dbSNP:184919402
3417 3417 a, g dbSNP:560355979
3427 3427 a, t dbSNP:770620814
3454 3454 a, t dbSNP:540438742
3475 3475 a, g dbSNP:141428300
3498 3498 c, t dbSNP:750355092
3503 3503 a, g dbSNP:749230737
3530 3530 a, g dbSNP:561233391
3557 3557 c, g dbSNP:536588342
3577 3577 a, g dbSNP:773062638
3602 3602 a, c dbSNP:77776334
3661 3661 c, t dbSNP:78927155
3707 3707 a, g dbSNP:761845806
3717 3717 a, c dbSNP:769607415
3748 3748 a, g dbSNP:558708727
3753 3753 a, t dbSNP:545070786
3781 3781 a, g dbSNP:17683284
3837 3837 a, t dbSNP:780284102
3849 3849 g, t dbSNP:372688369
3856 3856 c, t dbSNP:1059336
3858 3858 g, t dbSNP:1059337
3891 3891 c, g dbSNP:146323195
3895 3895 c, t dbSNP:574196021
3926 3926 a, g dbSNP:563975295
3937 3937 c, t dbSNP:192543896
3938 3938 a, g dbSNP:537374436
3948 3948 c, g dbSNP:568808064
3955 3955 g, t dbSNP:149173480
3956 3956 a, t dbSNP:538697794
4046 4046 c, t dbSNP:1059338
4075 4075 a, g dbSNP:770160518
4085 4085 a, t dbSNP:778952875
4095 4095 c, t dbSNP:759866106
4108 4108 c, t dbSNP:777073827
4112 4112 c, t dbSNP:757397657
4116 4116 ac, ga dbSNP:71510444
4116 4116 a, g dbSNP:28471019
4117 4117 a, c dbSNP:990192
4131 4131 -, t, tt dbSNP:142508439
4134 4134 c, g dbSNP:777986938
4159 4159 a, g dbSNP:529889744
4216 4216 c, t dbSNP:560958599
4284 4284 c, t dbSNP:199880215
4301 4301 a, g dbSNP:550829874
4323 4323 c, t dbSNP:756455481

Target ORF information:

RefSeq Version NM_019098
Organism Homo sapiens (human)
Definition Homo sapiens cyclic nucleotide gated channel beta 3 (CNGB3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.