Email to GenScript

PPP2R2C protein phosphatase 2, regulatory subunit B, gamma [Homo sapiens (human)]

Gene Symbol PPP2R2C
Entrez Gene ID 5522
Full Name protein phosphatase 2, regulatory subunit B, gamma
Synonyms B55-GAMMA, IMYPNO, IMYPNO1, PR52, PR55G
General protein information
Preferred Names
protein phosphatase 2, regulatory subunit B, gamma
protein phosphatase 2, regulatory subunit B, gamma
PP2A, subunit B, B-gamma isoform
PP2A, subunit B, R2-gamma isoform
PP2A, subunit B, B55-gamma isoform
PP2A, subunit B, PR55-gamma isoform
protein phosphatase 2A1 B gamma subunit
phosphoprotein phosphatase 2A BR gamma regulatory chain
gamma isoform of regulatory subunit B55, protein phosphatase 2
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform
serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:

The following PPP2R2C gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PPP2R2C gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59872 XM_011513495 PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu38360 XM_005247978 PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu59873 XM_011513496 PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199
OHu38361 XM_005247979 PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199
OHu28473 NM_001206994 Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu28473 NM_001206995 Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu28472 NM_001206996 Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu28465 NM_020416 Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu28479 NM_181876 Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu59872
Accession Version XM_011513495.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1302bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)183..1433(+)
Misc Feature(2)192..1217(+)
Misc Feature(3)240..1217(+)
Position Chain Variation Link
14 14 g, t dbSNP:760849032
22 22 a, g dbSNP:772972699
39 39 g, t dbSNP:548658448
41 41 g, t dbSNP:772077663
44 44 a, g dbSNP:747864353
46 46 a, g dbSNP:774247617
48 48 c, g dbSNP:768280067
58 58 a, c, g dbSNP:150211739
70 70 a, g dbSNP:755574828
79 79 c, t dbSNP:745416334
91 91 a, g dbSNP:778115453
118 118 a, c, t dbSNP:752990333
121 121 a, t dbSNP:765701187
123 123 g, t dbSNP:755400465
149 149 c, g dbSNP:754056862
151 151 a, g dbSNP:369597960
152 152 c, t dbSNP:760795780
157 157 a, t dbSNP:773380650
197 197 c, t dbSNP:745646342
206 206 a, c, t dbSNP:563983100
217 217 a, g dbSNP:751114949
221 221 c, t dbSNP:777507975
223 223 c, t dbSNP:757810061
224 224 a, g, t dbSNP:766852399
230 230 c, g dbSNP:761226047
233 233 g, t dbSNP:750778362
239 239 a, c dbSNP:767799128
242 242 a, g dbSNP:770639714
254 254 c, t dbSNP:762247987
260 260 a, g dbSNP:774387666
263 263 c, t dbSNP:540827872
276 276 c, t dbSNP:762909236
279 279 c, g dbSNP:775771834
289 289 c, g dbSNP:375793522
290 290 c, t dbSNP:201343301
291 291 a, c dbSNP:781641771
298 298 c, t dbSNP:202026671
299 299 a, g dbSNP:751855715
314 314 c, t dbSNP:764453190
315 315 a, g dbSNP:200176027
320 320 c, t dbSNP:758703360
321 321 a, g dbSNP:752918306
323 323 c, t dbSNP:200481224
326 326 a, g dbSNP:759660871
347 347 c, t dbSNP:140187944
350 350 a, g dbSNP:200538202
352 352 c, t dbSNP:760729044
353 353 a, g dbSNP:147944662
362 362 c, t dbSNP:771838476
373 373 c, g dbSNP:761614602
425 425 c, t dbSNP:773951608
426 426 c, g dbSNP:768337204
428 428 c, t dbSNP:748773208
429 429 a, g dbSNP:779671991
432 432 c, t dbSNP:769193125
449 449 c, t dbSNP:536567890
452 452 c, t dbSNP:778166439
470 470 a, g dbSNP:763820029
472 472 c, g dbSNP:762760790
481 481 c, g dbSNP:775168990
482 482 c, t dbSNP:200755929
484 484 a, g dbSNP:759067979
489 489 a, g dbSNP:150954241
491 491 c, t dbSNP:564494305
496 496 a, g dbSNP:190838630
500 500 c, t dbSNP:748602611
515 515 a, g dbSNP:775008868
521 521 c, t dbSNP:144935113
530 530 a, g dbSNP:371617770
536 536 g, t dbSNP:780288378
543 543 a, c, g dbSNP:139419142
545 545 a, g dbSNP:781314421
550 550 c, t dbSNP:763126722
551 551 a, g dbSNP:144455156
556 556 c, t dbSNP:764052676
557 557 a, g dbSNP:35368770
564 564 a, c dbSNP:752487442
626 626 c, t dbSNP:764683644
639 639 g, t dbSNP:544553155
650 650 c, t dbSNP:139536190
659 659 c, t dbSNP:201965712
660 660 a, g dbSNP:373814468
668 668 c, t dbSNP:759977783
673 673 a, g dbSNP:150561015
674 674 c, t dbSNP:142509881
689 689 a, g dbSNP:747082352
691 691 c, t dbSNP:369585524
692 692 a, g dbSNP:138031809
702 702 c, t dbSNP:747980900
703 703 c, g dbSNP:778929388
725 725 c, t dbSNP:145521227
731 731 c, t dbSNP:35410672
749 749 a, c, t dbSNP:756692262
750 750 a, g dbSNP:371827360
767 767 c, t dbSNP:144852197
768 768 a, c dbSNP:765650812
782 782 c, t dbSNP:367556203
785 785 a, g dbSNP:749078721
797 797 a, g dbSNP:766676790
800 800 a, g dbSNP:761054245
812 812 a, t dbSNP:773263494
815 815 a, g dbSNP:767816512
821 821 c, t dbSNP:183987526
826 826 a, g dbSNP:774545521
828 828 c, t dbSNP:768473282
833 833 c, t dbSNP:749169351
834 834 a, g dbSNP:775581608
836 836 c, t dbSNP:769662338
845 845 c, t dbSNP:745699183
854 854 c, t dbSNP:780686553
862 862 a, g dbSNP:756994097
869 869 c, t dbSNP:199885426
876 876 a, c, t dbSNP:757919406
893 893 c, t dbSNP:754298356
905 905 a, c, t dbSNP:202247157
908 908 a, g dbSNP:756435972
909 909 c, t dbSNP:750844235
917 917 a, g dbSNP:765263780
923 923 c, t dbSNP:148293311
940 940 a, g dbSNP:776449314
944 944 a, g dbSNP:374065917
947 947 c, t dbSNP:143254935
952 952 c, t dbSNP:760422388
953 953 a, g dbSNP:371801715
968 968 c, t dbSNP:771757681
969 969 a, g dbSNP:747639231
971 971 a, g dbSNP:778458711
974 974 c, t dbSNP:141600291
977 977 c, t dbSNP:372205984
978 978 a, g dbSNP:781570469
986 986 c, t dbSNP:757601971
995 995 c, t dbSNP:751908987
1005 1005 a, g dbSNP:368801587
1010 1010 a, c dbSNP:758761295
1023 1023 c, t dbSNP:374362764
1043 1043 c, t dbSNP:765351896
1055 1055 a, g dbSNP:759559815
1060 1060 a, g dbSNP:531829023
1066 1066 c, t dbSNP:753771610
1073 1073 c, g, t dbSNP:370744573
1076 1076 c, t dbSNP:760492669
1086 1086 a, g dbSNP:763692349
1087 1087 a, g dbSNP:762501712
1096 1096 a, g dbSNP:374272092
1106 1106 c, g dbSNP:76426507
1118 1118 c, t dbSNP:747462237
1121 1121 c, g dbSNP:773880296
1124 1124 c, t dbSNP:369542799
1125 1125 c, g dbSNP:748566105
1136 1136 c, t dbSNP:145291210
1139 1139 a, c dbSNP:755209779
1141 1141 a, c dbSNP:749379375
1152 1152 g, t dbSNP:779928185
1160 1160 c, t dbSNP:549246766
1161 1161 a, g dbSNP:267600204
1163 1163 a, g dbSNP:767472157
1166 1166 c, t dbSNP:757014009
1172 1172 c, t dbSNP:201893469
1173 1173 a, g dbSNP:762339661
1184 1184 c, t dbSNP:150430481
1188 1188 a, g dbSNP:768851640
1207 1207 a, g dbSNP:763404513
1208 1208 c, t dbSNP:575334919
1212 1212 c, t dbSNP:775542255
1215 1215 a, g dbSNP:770049137
1219 1219 a, g dbSNP:367696094
1231 1231 a, g dbSNP:781182513
1232 1232 c, g dbSNP:771013516
1235 1235 c, t dbSNP:746873206
1250 1250 c, t dbSNP:181812477
1253 1253 a, g dbSNP:199531720
1255 1255 a, g dbSNP:752589937
1256 1256 a, g dbSNP:547383959
1258 1258 a, g dbSNP:754747800
1260 1260 a, g dbSNP:753541104
1270 1270 c, t dbSNP:765926966
1272 1272 c, t dbSNP:760251644
1277 1277 a, t dbSNP:751968235
1290 1290 c, t dbSNP:750077410
1293 1293 c, t dbSNP:763204097
1295 1295 c, t dbSNP:775980958
1301 1301 c, t dbSNP:527384551
1302 1302 a, g, t dbSNP:375066274
1309 1309 g, t dbSNP:770960380
1313 1313 a, g dbSNP:747154763
1315 1315 a, g dbSNP:200809882
1316 1316 a, c, t dbSNP:576151108
1317 1317 c, t dbSNP:778779009
1318 1318 a, g dbSNP:747148764
1320 1320 c, t dbSNP:754837498
1321 1321 a, g dbSNP:748903409
1337 1337 a, g dbSNP:779886326
1344 1344 c, t dbSNP:755549961
1364 1364 c, t dbSNP:750001141
1372 1372 c, t dbSNP:371740090
1385 1385 a, g dbSNP:368843114
1405 1405 c, t dbSNP:545674626
1406 1406 c, t dbSNP:3796403
1409 1409 c, t dbSNP:765536718
1410 1410 a, g dbSNP:759923972
1412 1412 a, c dbSNP:11545013
1434 1434 c, t dbSNP:776801658
1442 1442 -, ggtaaa dbSNP:749579027
1446 1446 a, g dbSNP:766669913
1451 1451 c, t dbSNP:758377483
1456 1456 c, t dbSNP:760655172
1473 1473 c, g dbSNP:773405080
1474 1474 a, t dbSNP:3796402
1476 1476 c, t dbSNP:748065617
1479 1479 a, g dbSNP:774456706
1483 1483 a, c dbSNP:768533555
1492 1492 -, c dbSNP:778136971
1513 1513 c, t dbSNP:749137407
1514 1514 a, g dbSNP:779378774
1516 1516 a, c dbSNP:78432169
1531 1531 c, t dbSNP:574889150
1535 1535 a, g dbSNP:371613753
1614 1614 c, t dbSNP:3796401
1616 1616 c, g dbSNP:7678282
1689 1689 a, g dbSNP:3796400
1703 1703 c, t dbSNP:3796399
1707 1707 a, g dbSNP:3796398
1737 1737 c, t dbSNP:146991409
1740 1740 c, t dbSNP:13124495
1748 1748 a, g dbSNP:148843324
1756 1756 g, t dbSNP:547424895
1765 1765 a, g dbSNP:189509101
1779 1779 c, t dbSNP:561867902
1780 1780 a, g dbSNP:759256644
1787 1787 a, g dbSNP:772604056
1818 1818 c, t dbSNP:185136534
1822 1822 c, t dbSNP:369057517
1823 1823 a, g dbSNP:551627211
1845 1845 c, t dbSNP:6446490
1848 1848 a, c dbSNP:562555368
1862 1862 c, t dbSNP:545563888
1863 1863 a, g dbSNP:765957206
1867 1867 a, c dbSNP:13147522
1874 1874 -, g dbSNP:35327508
1876 1876 c, g dbSNP:372796719
1879 1879 c, g dbSNP:181636663
1915 1915 a, c, g, t dbSNP:576732329
1942 1942 c, t dbSNP:563058082
2011 2011 c, t dbSNP:190070382
2067 2067 a, c dbSNP:35822102
2081 2081 c, t dbSNP:73795969
2100 2100 g, t dbSNP:555074687
2116 2116 g, t dbSNP:550885364
2122 2122 c, t dbSNP:368420157
2130 2130 a, g dbSNP:184737111
2202 2202 c, t dbSNP:374858349
2229 2229 a, g dbSNP:11554992
2246 2246 c, t dbSNP:7697730
2264 2264 a, g dbSNP:369532481
2298 2298 a, g dbSNP:149656712
2323 2323 a, g dbSNP:768291833
2325 2325 a, t dbSNP:80290617
2349 2349 g, t dbSNP:191890734
2384 2384 c, g dbSNP:562018223
2399 2399 a, g dbSNP:567945190
2431 2431 a, g dbSNP:186703078
2433 2433 g, t dbSNP:201845209
2449 2449 a, c dbSNP:11554991
2451 2451 c, t dbSNP:768616454
2483 2483 c, t dbSNP:114583572
2484 2484 a, g dbSNP:568567675
2498 2498 c, t dbSNP:745942937
2534 2534 a, g dbSNP:139465916
2571 2571 c, t dbSNP:532168765
2572 2572 a, g dbSNP:76906079
2578 2578 a, g dbSNP:757776014
2582 2582 a, c dbSNP:540115630
2593 2593 a, g dbSNP:530142530
2601 2601 a, c dbSNP:146438954
2612 2612 g, t dbSNP:544566739
2619 2619 a, g dbSNP:575657866
2643 2643 -, gacatggcagacttggcgac dbSNP:59379151
2647 2647 -, tggcagacttggcgacgaca dbSNP:11271562
2647 2647 a, t dbSNP:77509415
2650 2650 c, g dbSNP:186129753
2663 2663 a, g dbSNP:559083007
2666 2666 -, tggcagacttggcgacgaca dbSNP:765347933
2666 2666 a, g dbSNP:545664511
2674 2674 a, g dbSNP:12501278
2680 2680 a, g dbSNP:553734061
2739 2739 a, g dbSNP:536556290
2751 2751 c, g, t dbSNP:7696558
2759 2759 c, t dbSNP:10007480
2807 2807 a, c dbSNP:537810863
2814 2814 c, t dbSNP:568653244
2850 2850 a, g dbSNP:756406611
2876 2876 -, ca dbSNP:564870338
2891 2891 c, t dbSNP:751277657
2898 2898 c, t dbSNP:551855872
2899 2899 a, g dbSNP:765938516
2915 2915 g, t dbSNP:532205614
2920 2920 a, g dbSNP:566315299
2934 2934 c, g dbSNP:139773786
2936 2936 a, g dbSNP:183955971
2941 2941 a, g dbSNP:146354420
2943 2943 a, g dbSNP:561190914
2969 2969 g, t dbSNP:192481004
3001 3001 a, g dbSNP:749963923
3012 3012 c, t dbSNP:777517034
3027 3027 a, g dbSNP:6446489
3032 3032 a, g dbSNP:752283128
3038 3038 g, t dbSNP:2269920
3088 3088 -, tt dbSNP:10606346
3088 3088 c, t dbSNP:185713176
3088 3088 -, t dbSNP:398092138
3095 3095 -, tt dbSNP:542595229
3095 3095 -, t dbSNP:397878825
3096 3096 g, t dbSNP:79992697
3096 3096 -, t dbSNP:11358702
3097 3097 g, t dbSNP:545500948
3098 3098 -, g dbSNP:199670128
3119 3119 -, t dbSNP:201330999
3127 3127 -, ataac dbSNP:370471755
3132 3132 -, ataac dbSNP:534423194
3138 3138 c, t dbSNP:573338661
3179 3179 a, g dbSNP:553624490
3223 3223 c, t dbSNP:188886256
3232 3232 a, g dbSNP:577925041
3235 3235 c, t dbSNP:776678007
3272 3272 c, t dbSNP:183878869
3273 3273 -, t dbSNP:11428044
3293 3293 c, t dbSNP:773055626
3306 3306 a, g dbSNP:142410877
3355 3355 c, t dbSNP:568494100
3378 3378 a, g dbSNP:558265049
3382 3382 c, t dbSNP:772189427
3415 3415 c, t dbSNP:538363335
3429 3429 a, g dbSNP:566202513
3442 3442 c, t dbSNP:73204082
3445 3445 a, g dbSNP:770958776
3505 3505 a, c dbSNP:536436783
3523 3523 a, t dbSNP:567495471
3577 3577 a, g dbSNP:749837780
3591 3591 a, g dbSNP:778121975
3613 3613 a, g dbSNP:550829821
3634 3634 a, t dbSNP:748461048
3638 3638 a, t dbSNP:530962615
3732 3732 g, t dbSNP:565291893
3805 3805 c, t dbSNP:74688502
3813 3813 a, g dbSNP:538636509
3834 3834 a, g dbSNP:148732170
3842 3842 a, g dbSNP:573710815
3904 3904 c, t dbSNP:555133572
3906 3906 a, g dbSNP:571664811
3909 3909 a, g dbSNP:773903145
3913 3913 a, c dbSNP:533561719
3929 3929 a, g dbSNP:542894164
3947 3947 a, g dbSNP:764877505
3979 3979 c, t dbSNP:73073116
3980 3980 a, g dbSNP:566082215
3987 3987 g, t dbSNP:563856975
3989 3989 c, g dbSNP:544080782
4000 4000 g, t dbSNP:760240514
4006 4006 g, t dbSNP:577881417
4030 4030 g, t dbSNP:370519808
4032 4032 g, t dbSNP:558152505
4035 4035 a, g dbSNP:538201869
4045 4045 a, c dbSNP:572613951
4056 4056 c, t dbSNP:553028608
4081 4081 c, t dbSNP:144288061
4092 4092 c, t dbSNP:567438408
4094 4094 c, g dbSNP:550465497
4122 4122 a, g dbSNP:188444246
4146 4146 c, t dbSNP:753882177

Target ORF information:

RefSeq Version XM_011513495
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38360
Accession Version XM_005247978.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1029bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530376091. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)73..885(+)
Misc Feature(2)76..876(+)
Position Chain Variation Link
10 10 c, t dbSNP:536567890
13 13 c, t dbSNP:778166439
17 17 a, g dbSNP:187213691
21 21 c, t dbSNP:753155505
22 22 g, t dbSNP:201598243
28 28 c, t dbSNP:376854021
29 29 a, g dbSNP:753966127
34 34 c, t dbSNP:766412136
35 35 a, g dbSNP:760681638
39 39 g, t dbSNP:750322142
41 41 a, g dbSNP:767383400
43 43 a, g dbSNP:199717140
44 44 a, g dbSNP:774179994
46 46 c, t dbSNP:768282004
53 53 a, c, g, t dbSNP:769298892
54 54 a, g dbSNP:745402259
57 57 c, g dbSNP:778316281
58 58 a, t dbSNP:373445172
59 59 c, t dbSNP:772759270
93 93 a, g dbSNP:763820029
95 95 c, g dbSNP:762760790
104 104 c, g dbSNP:775168990
105 105 c, t dbSNP:200755929
107 107 a, g dbSNP:759067979
112 112 a, g dbSNP:150954241
114 114 c, t dbSNP:564494305
119 119 a, g dbSNP:190838630
123 123 c, t dbSNP:748602611
138 138 a, g dbSNP:775008868
144 144 c, t dbSNP:144935113
153 153 a, g dbSNP:371617770
159 159 g, t dbSNP:780288378
166 166 a, c, g dbSNP:139419142
168 168 a, g dbSNP:781314421
173 173 c, t dbSNP:763126722
174 174 a, g dbSNP:144455156
179 179 c, t dbSNP:764052676
180 180 a, g dbSNP:35368770
187 187 a, c dbSNP:752487442
249 249 c, t dbSNP:764683644
262 262 g, t dbSNP:544553155
273 273 c, t dbSNP:139536190
282 282 c, t dbSNP:201965712
283 283 a, g dbSNP:373814468
291 291 c, t dbSNP:759977783
296 296 a, g dbSNP:150561015
297 297 c, t dbSNP:142509881
312 312 a, g dbSNP:747082352
314 314 c, t dbSNP:369585524
315 315 a, g dbSNP:138031809
325 325 c, t dbSNP:747980900
326 326 c, g dbSNP:778929388
348 348 c, t dbSNP:145521227
354 354 c, t dbSNP:35410672
372 372 a, c, t dbSNP:756692262
373 373 a, g dbSNP:371827360
390 390 c, t dbSNP:144852197
391 391 a, c dbSNP:765650812
405 405 c, t dbSNP:367556203
408 408 a, g dbSNP:749078721
420 420 a, g dbSNP:766676790
423 423 a, g dbSNP:761054245
435 435 a, t dbSNP:773263494
438 438 a, g dbSNP:767816512
444 444 c, t dbSNP:183987526
449 449 a, g dbSNP:774545521
451 451 c, t dbSNP:768473282
456 456 c, t dbSNP:749169351
457 457 a, g dbSNP:775581608
459 459 c, t dbSNP:769662338
468 468 c, t dbSNP:745699183
477 477 c, t dbSNP:780686553
485 485 a, g dbSNP:756994097
492 492 c, t dbSNP:199885426
499 499 a, c, t dbSNP:757919406
516 516 c, t dbSNP:754298356
528 528 a, c, t dbSNP:202247157
531 531 a, g dbSNP:756435972
532 532 c, t dbSNP:750844235
540 540 a, g dbSNP:765263780
546 546 c, t dbSNP:148293311
563 563 a, g dbSNP:776449314
567 567 a, g dbSNP:374065917
570 570 c, t dbSNP:143254935
575 575 c, t dbSNP:760422388
576 576 a, g dbSNP:371801715
591 591 c, t dbSNP:771757681
592 592 a, g dbSNP:747639231
594 594 a, g dbSNP:778458711
597 597 c, t dbSNP:141600291
600 600 c, t dbSNP:372205984
601 601 a, g dbSNP:781570469
609 609 c, t dbSNP:757601971
618 618 c, t dbSNP:751908987
628 628 a, g dbSNP:368801587
633 633 a, c dbSNP:758761295
646 646 c, t dbSNP:374362764
666 666 c, t dbSNP:765351896
678 678 a, g dbSNP:759559815
683 683 a, g dbSNP:531829023
689 689 c, t dbSNP:753771610
696 696 c, g, t dbSNP:370744573
699 699 c, t dbSNP:760492669
709 709 a, g dbSNP:763692349
710 710 a, g dbSNP:762501712
719 719 a, g dbSNP:374272092
729 729 c, g dbSNP:76426507
741 741 c, t dbSNP:747462237
744 744 c, g dbSNP:773880296
747 747 c, t dbSNP:369542799
748 748 c, g dbSNP:748566105
759 759 c, t dbSNP:145291210
762 762 a, c dbSNP:755209779
764 764 a, c dbSNP:749379375
775 775 g, t dbSNP:779928185
783 783 c, t dbSNP:549246766
784 784 a, g dbSNP:267600204
786 786 a, g dbSNP:767472157
789 789 c, t dbSNP:757014009
795 795 c, t dbSNP:201893469
796 796 a, g dbSNP:762339661
807 807 c, t dbSNP:150430481
811 811 a, g dbSNP:768851640
830 830 a, g dbSNP:763404513
831 831 c, t dbSNP:575334919
835 835 c, t dbSNP:775542255
838 838 a, g dbSNP:770049137
842 842 a, g dbSNP:367696094
854 854 a, g dbSNP:781182513
855 855 c, g dbSNP:771013516
858 858 c, t dbSNP:746873206
873 873 c, t dbSNP:181812477
876 876 a, g dbSNP:199531720
878 878 a, g dbSNP:752589937
879 879 a, g dbSNP:547383959
881 881 a, g dbSNP:754747800
883 883 a, g dbSNP:753541104
893 893 c, t dbSNP:765926966
895 895 c, t dbSNP:760251644
900 900 a, t dbSNP:751968235
913 913 c, t dbSNP:750077410
916 916 c, t dbSNP:763204097
918 918 c, t dbSNP:775980958
924 924 c, t dbSNP:527384551
925 925 a, g, t dbSNP:375066274
932 932 g, t dbSNP:770960380
936 936 a, g dbSNP:747154763
938 938 a, g dbSNP:200809882
939 939 a, c, t dbSNP:576151108
940 940 c, t dbSNP:778779009
941 941 a, g dbSNP:747148764
943 943 c, t dbSNP:754837498
944 944 a, g dbSNP:748903409
960 960 a, g dbSNP:779886326
967 967 c, t dbSNP:755549961
987 987 c, t dbSNP:750001141
995 995 c, t dbSNP:371740090
1008 1008 a, g dbSNP:368843114
1028 1028 c, t dbSNP:545674626
1029 1029 c, t dbSNP:3796403
1032 1032 c, t dbSNP:765536718
1033 1033 a, g dbSNP:759923972
1035 1035 a, c dbSNP:11545013
1057 1057 c, t dbSNP:776801658
1065 1065 -, ggtaaa dbSNP:749579027
1069 1069 a, g dbSNP:766669913
1074 1074 c, t dbSNP:758377483
1079 1079 c, t dbSNP:760655172
1096 1096 c, g dbSNP:773405080
1097 1097 a, t dbSNP:3796402
1099 1099 c, t dbSNP:748065617
1102 1102 a, g dbSNP:774456706
1106 1106 a, c dbSNP:768533555
1115 1115 -, c dbSNP:778136971
1136 1136 c, t dbSNP:749137407
1137 1137 a, g dbSNP:779378774
1139 1139 a, c dbSNP:78432169
1154 1154 c, t dbSNP:574889150
1158 1158 a, g dbSNP:371613753
1237 1237 c, t dbSNP:3796401
1239 1239 c, g dbSNP:7678282
1312 1312 a, g dbSNP:3796400
1326 1326 c, t dbSNP:3796399
1330 1330 a, g dbSNP:3796398
1360 1360 c, t dbSNP:146991409
1363 1363 c, t dbSNP:13124495
1371 1371 a, g dbSNP:148843324
1379 1379 g, t dbSNP:547424895
1388 1388 a, g dbSNP:189509101
1402 1402 c, t dbSNP:561867902
1403 1403 a, g dbSNP:759256644
1410 1410 a, g dbSNP:772604056
1441 1441 c, t dbSNP:185136534
1445 1445 c, t dbSNP:369057517
1446 1446 a, g dbSNP:551627211
1468 1468 c, t dbSNP:6446490
1471 1471 a, c dbSNP:562555368
1485 1485 c, t dbSNP:545563888
1486 1486 a, g dbSNP:765957206
1490 1490 a, c dbSNP:13147522
1497 1497 -, g dbSNP:35327508
1499 1499 c, g dbSNP:372796719
1502 1502 c, g dbSNP:181636663
1538 1538 a, c, g, t dbSNP:576732329
1565 1565 c, t dbSNP:563058082
1634 1634 c, t dbSNP:190070382
1690 1690 a, c dbSNP:35822102
1704 1704 c, t dbSNP:73795969
1723 1723 g, t dbSNP:555074687
1739 1739 g, t dbSNP:550885364
1745 1745 c, t dbSNP:368420157
1753 1753 a, g dbSNP:184737111
1825 1825 c, t dbSNP:374858349
1852 1852 a, g dbSNP:11554992
1869 1869 c, t dbSNP:7697730
1887 1887 a, g dbSNP:369532481
1921 1921 a, g dbSNP:149656712
1946 1946 a, g dbSNP:768291833
1948 1948 a, t dbSNP:80290617
1972 1972 g, t dbSNP:191890734
2007 2007 c, g dbSNP:562018223
2022 2022 a, g dbSNP:567945190
2054 2054 a, g dbSNP:186703078
2056 2056 g, t dbSNP:201845209
2072 2072 a, c dbSNP:11554991
2074 2074 c, t dbSNP:768616454
2106 2106 c, t dbSNP:114583572
2107 2107 a, g dbSNP:568567675
2121 2121 c, t dbSNP:745942937
2157 2157 a, g dbSNP:139465916
2194 2194 c, t dbSNP:532168765
2195 2195 a, g dbSNP:76906079
2201 2201 a, g dbSNP:757776014
2205 2205 a, c dbSNP:540115630
2216 2216 a, g dbSNP:530142530
2224 2224 a, c dbSNP:146438954
2235 2235 g, t dbSNP:544566739
2242 2242 a, g dbSNP:575657866
2266 2266 -, gacatggcagacttggcgac dbSNP:59379151
2270 2270 -, tggcagacttggcgacgaca dbSNP:11271562
2270 2270 a, t dbSNP:77509415
2273 2273 c, g dbSNP:186129753
2286 2286 a, g dbSNP:559083007
2289 2289 -, tggcagacttggcgacgaca dbSNP:765347933
2289 2289 a, g dbSNP:545664511
2297 2297 a, g dbSNP:12501278
2303 2303 a, g dbSNP:553734061
2362 2362 a, g dbSNP:536556290
2374 2374 c, g, t dbSNP:7696558
2382 2382 c, t dbSNP:10007480
2430 2430 a, c dbSNP:537810863
2437 2437 c, t dbSNP:568653244
2473 2473 a, g dbSNP:756406611
2499 2499 -, ca dbSNP:564870338
2514 2514 c, t dbSNP:751277657
2521 2521 c, t dbSNP:551855872
2522 2522 a, g dbSNP:765938516
2538 2538 g, t dbSNP:532205614
2543 2543 a, g dbSNP:566315299
2557 2557 c, g dbSNP:139773786
2559 2559 a, g dbSNP:183955971
2564 2564 a, g dbSNP:146354420
2566 2566 a, g dbSNP:561190914
2592 2592 g, t dbSNP:192481004
2624 2624 a, g dbSNP:749963923
2635 2635 c, t dbSNP:777517034
2650 2650 a, g dbSNP:6446489
2655 2655 a, g dbSNP:752283128
2661 2661 g, t dbSNP:2269920
2711 2711 -, tt dbSNP:10606346
2711 2711 c, t dbSNP:185713176
2711 2711 -, t dbSNP:398092138
2718 2718 -, tt dbSNP:542595229
2718 2718 -, t dbSNP:397878825
2719 2719 g, t dbSNP:79992697
2719 2719 -, t dbSNP:11358702
2720 2720 g, t dbSNP:545500948
2721 2721 -, g dbSNP:199670128
2742 2742 -, t dbSNP:201330999
2750 2750 -, ataac dbSNP:370471755
2755 2755 -, ataac dbSNP:534423194
2761 2761 c, t dbSNP:573338661
2802 2802 a, g dbSNP:553624490
2846 2846 c, t dbSNP:188886256
2855 2855 a, g dbSNP:577925041
2858 2858 c, t dbSNP:776678007
2895 2895 c, t dbSNP:183878869
2896 2896 -, t dbSNP:11428044
2916 2916 c, t dbSNP:773055626
2929 2929 a, g dbSNP:142410877
2978 2978 c, t dbSNP:568494100
3001 3001 a, g dbSNP:558265049
3005 3005 c, t dbSNP:772189427
3038 3038 c, t dbSNP:538363335
3052 3052 a, g dbSNP:566202513
3065 3065 c, t dbSNP:73204082
3068 3068 a, g dbSNP:770958776
3128 3128 a, c dbSNP:536436783
3146 3146 a, t dbSNP:567495471
3200 3200 a, g dbSNP:749837780
3214 3214 a, g dbSNP:778121975
3236 3236 a, g dbSNP:550829821
3257 3257 a, t dbSNP:748461048
3261 3261 a, t dbSNP:530962615
3355 3355 g, t dbSNP:565291893
3428 3428 c, t dbSNP:74688502
3436 3436 a, g dbSNP:538636509
3457 3457 a, g dbSNP:148732170
3465 3465 a, g dbSNP:573710815
3527 3527 c, t dbSNP:555133572
3529 3529 a, g dbSNP:571664811
3532 3532 a, g dbSNP:773903145
3536 3536 a, c dbSNP:533561719
3552 3552 a, g dbSNP:542894164
3570 3570 a, g dbSNP:764877505
3602 3602 c, t dbSNP:73073116
3603 3603 a, g dbSNP:566082215
3610 3610 g, t dbSNP:563856975
3612 3612 c, g dbSNP:544080782
3623 3623 g, t dbSNP:760240514
3629 3629 g, t dbSNP:577881417
3653 3653 g, t dbSNP:370519808
3655 3655 g, t dbSNP:558152505
3658 3658 a, g dbSNP:538201869
3668 3668 a, c dbSNP:572613951
3679 3679 c, t dbSNP:553028608
3704 3704 c, t dbSNP:144288061
3715 3715 c, t dbSNP:567438408
3717 3717 c, g dbSNP:550465497
3745 3745 a, g dbSNP:188444246
3769 3769 c, t dbSNP:753882177

Target ORF information:

RefSeq Version XM_005247978
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59873
Accession Version XM_011513496.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 879bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)645..1232(+)
Misc Feature(2)645..1232(+)
Position Chain Variation Link
29 29 g, t dbSNP:570534250
32 32 a, g dbSNP:566405321
50 50 a, g dbSNP:747462286
55 55 a, g dbSNP:181152309
60 60 a, g dbSNP:530489635
74 74 c, t dbSNP:562968134
89 89 a, c dbSNP:768199560
91 91 a, g, t dbSNP:116456820
109 109 c, t dbSNP:530705469
126 126 c, t dbSNP:188683619
139 139 c, t dbSNP:545025562
143 143 a, g dbSNP:4689441
151 151 c, t dbSNP:367747056
152 152 a, g dbSNP:553156218
163 163 c, g dbSNP:543225511
169 169 c, t dbSNP:574321545
212 212 c, t dbSNP:745646342
221 221 a, c, t dbSNP:563983100
232 232 a, g dbSNP:751114949
236 236 c, t dbSNP:777507975
238 238 c, t dbSNP:757810061
239 239 a, g, t dbSNP:766852399
245 245 c, g dbSNP:761226047
248 248 g, t dbSNP:750778362
254 254 a, c dbSNP:767799128
257 257 a, g dbSNP:770639714
269 269 c, t dbSNP:762247987
275 275 a, g dbSNP:774387666
278 278 c, t dbSNP:540827872
291 291 c, t dbSNP:762909236
294 294 c, g dbSNP:775771834
304 304 c, g dbSNP:375793522
305 305 c, t dbSNP:201343301
306 306 a, c dbSNP:781641771
313 313 c, t dbSNP:202026671
314 314 a, g dbSNP:751855715
329 329 c, t dbSNP:764453190
330 330 a, g dbSNP:200176027
335 335 c, t dbSNP:758703360
336 336 a, g dbSNP:752918306
338 338 c, t dbSNP:200481224
341 341 a, g dbSNP:759660871
362 362 c, t dbSNP:140187944
365 365 a, g dbSNP:200538202
367 367 c, t dbSNP:760729044
368 368 a, g dbSNP:147944662
377 377 c, t dbSNP:771838476
388 388 c, g dbSNP:761614602
440 440 c, t dbSNP:773951608
441 441 c, g dbSNP:768337204
443 443 c, t dbSNP:748773208
444 444 a, g dbSNP:779671991
447 447 c, t dbSNP:769193125
464 464 c, t dbSNP:536567890
467 467 c, t dbSNP:778166439
485 485 a, g dbSNP:763820029
487 487 c, g dbSNP:762760790
496 496 c, g dbSNP:775168990
497 497 c, t dbSNP:200755929
499 499 a, g dbSNP:759067979
504 504 a, g dbSNP:150954241
506 506 c, t dbSNP:564494305
511 511 a, g dbSNP:190838630
515 515 c, t dbSNP:748602611
530 530 a, g dbSNP:775008868
536 536 c, t dbSNP:144935113
545 545 a, g dbSNP:371617770
551 551 g, t dbSNP:780288378
558 558 a, c, g dbSNP:139419142
560 560 a, g dbSNP:781314421
565 565 c, t dbSNP:763126722
566 566 a, g dbSNP:144455156
571 571 c, t dbSNP:764052676
572 572 a, g dbSNP:35368770
579 579 a, c dbSNP:752487442
641 641 c, t dbSNP:764683644
654 654 g, t dbSNP:544553155
665 665 c, t dbSNP:139536190
674 674 c, t dbSNP:201965712
675 675 a, g dbSNP:373814468
683 683 c, t dbSNP:759977783
688 688 a, g dbSNP:150561015
689 689 c, t dbSNP:142509881
704 704 a, g dbSNP:747082352
706 706 c, t dbSNP:369585524
707 707 a, g dbSNP:138031809
717 717 c, t dbSNP:747980900
718 718 c, g dbSNP:778929388
740 740 c, t dbSNP:145521227
746 746 c, t dbSNP:35410672
764 764 a, c, t dbSNP:756692262
765 765 a, g dbSNP:371827360
782 782 c, t dbSNP:144852197
783 783 a, c dbSNP:765650812
797 797 c, t dbSNP:367556203
800 800 a, g dbSNP:749078721
812 812 a, g dbSNP:766676790
815 815 a, g dbSNP:761054245
827 827 a, t dbSNP:773263494
830 830 a, g dbSNP:767816512
836 836 c, t dbSNP:183987526
841 841 a, g dbSNP:774545521
843 843 c, t dbSNP:768473282
848 848 c, t dbSNP:749169351
849 849 a, g dbSNP:775581608
851 851 c, t dbSNP:769662338
860 860 c, t dbSNP:745699183
869 869 c, t dbSNP:780686553
877 877 a, g dbSNP:756994097
884 884 c, t dbSNP:199885426
891 891 a, c, t dbSNP:757919406
908 908 c, t dbSNP:754298356
920 920 a, c, t dbSNP:202247157
923 923 a, g dbSNP:756435972
924 924 c, t dbSNP:750844235
932 932 a, g dbSNP:765263780
938 938 c, t dbSNP:148293311
955 955 a, g dbSNP:776449314
959 959 a, g dbSNP:374065917
962 962 c, t dbSNP:143254935
967 967 c, t dbSNP:760422388
968 968 a, g dbSNP:371801715
983 983 c, t dbSNP:771757681
984 984 a, g dbSNP:747639231
986 986 a, g dbSNP:778458711
989 989 c, t dbSNP:141600291
992 992 c, t dbSNP:372205984
993 993 a, g dbSNP:781570469
1001 1001 c, t dbSNP:757601971
1010 1010 c, t dbSNP:751908987
1020 1020 a, g dbSNP:368801587
1025 1025 a, c dbSNP:758761295
1038 1038 c, t dbSNP:374362764
1058 1058 c, t dbSNP:765351896
1070 1070 a, g dbSNP:759559815
1075 1075 a, g dbSNP:531829023
1081 1081 c, t dbSNP:753771610
1088 1088 c, g, t dbSNP:370744573
1091 1091 c, t dbSNP:760492669
1101 1101 a, g dbSNP:763692349
1102 1102 a, g dbSNP:762501712
1111 1111 a, g dbSNP:374272092
1121 1121 c, g dbSNP:76426507
1133 1133 c, t dbSNP:747462237
1136 1136 c, g dbSNP:773880296
1139 1139 c, t dbSNP:369542799
1140 1140 c, g dbSNP:748566105
1151 1151 c, t dbSNP:145291210
1154 1154 a, c dbSNP:755209779
1156 1156 a, c dbSNP:749379375
1167 1167 g, t dbSNP:779928185
1175 1175 c, t dbSNP:549246766
1176 1176 a, g dbSNP:267600204
1178 1178 a, g dbSNP:767472157
1181 1181 c, t dbSNP:757014009
1187 1187 c, t dbSNP:201893469
1188 1188 a, g dbSNP:762339661
1199 1199 c, t dbSNP:150430481
1203 1203 a, g dbSNP:768851640
1222 1222 a, g dbSNP:763404513
1223 1223 c, t dbSNP:575334919
1227 1227 c, t dbSNP:775542255
1230 1230 a, g dbSNP:770049137
1234 1234 a, g dbSNP:367696094
1246 1246 a, g dbSNP:781182513
1247 1247 c, g dbSNP:771013516
1250 1250 c, t dbSNP:746873206
1265 1265 c, t dbSNP:181812477
1268 1268 a, g dbSNP:199531720
1270 1270 a, g dbSNP:752589937
1271 1271 a, g dbSNP:547383959
1273 1273 a, g dbSNP:754747800
1275 1275 a, g dbSNP:753541104
1285 1285 c, t dbSNP:765926966
1287 1287 c, t dbSNP:760251644
1292 1292 a, t dbSNP:751968235
1305 1305 c, t dbSNP:750077410
1308 1308 c, t dbSNP:763204097
1310 1310 c, t dbSNP:775980958
1316 1316 c, t dbSNP:527384551
1317 1317 a, g, t dbSNP:375066274
1324 1324 g, t dbSNP:770960380
1328 1328 a, g dbSNP:747154763
1330 1330 a, g dbSNP:200809882
1331 1331 a, c, t dbSNP:576151108
1332 1332 c, t dbSNP:778779009
1333 1333 a, g dbSNP:747148764
1335 1335 c, t dbSNP:754837498
1336 1336 a, g dbSNP:748903409
1352 1352 a, g dbSNP:779886326
1359 1359 c, t dbSNP:755549961
1379 1379 c, t dbSNP:750001141
1387 1387 c, t dbSNP:371740090
1400 1400 a, g dbSNP:368843114
1420 1420 c, t dbSNP:545674626
1421 1421 c, t dbSNP:3796403
1424 1424 c, t dbSNP:765536718
1425 1425 a, g dbSNP:759923972
1427 1427 a, c dbSNP:11545013
1449 1449 c, t dbSNP:776801658
1457 1457 -, ggtaaa dbSNP:749579027
1461 1461 a, g dbSNP:766669913
1466 1466 c, t dbSNP:758377483
1471 1471 c, t dbSNP:760655172
1488 1488 c, g dbSNP:773405080
1489 1489 a, t dbSNP:3796402
1491 1491 c, t dbSNP:748065617
1494 1494 a, g dbSNP:774456706
1498 1498 a, c dbSNP:768533555
1507 1507 -, c dbSNP:778136971
1528 1528 c, t dbSNP:749137407
1529 1529 a, g dbSNP:779378774
1531 1531 a, c dbSNP:78432169
1546 1546 c, t dbSNP:574889150
1550 1550 a, g dbSNP:371613753
1629 1629 c, t dbSNP:3796401
1631 1631 c, g dbSNP:7678282
1704 1704 a, g dbSNP:3796400
1718 1718 c, t dbSNP:3796399
1722 1722 a, g dbSNP:3796398
1752 1752 c, t dbSNP:146991409
1755 1755 c, t dbSNP:13124495
1763 1763 a, g dbSNP:148843324
1771 1771 g, t dbSNP:547424895
1780 1780 a, g dbSNP:189509101
1794 1794 c, t dbSNP:561867902
1795 1795 a, g dbSNP:759256644
1802 1802 a, g dbSNP:772604056
1833 1833 c, t dbSNP:185136534
1837 1837 c, t dbSNP:369057517
1838 1838 a, g dbSNP:551627211
1860 1860 c, t dbSNP:6446490
1863 1863 a, c dbSNP:562555368
1877 1877 c, t dbSNP:545563888
1878 1878 a, g dbSNP:765957206
1882 1882 a, c dbSNP:13147522
1889 1889 -, g dbSNP:35327508
1891 1891 c, g dbSNP:372796719
1894 1894 c, g dbSNP:181636663
1930 1930 a, c, g, t dbSNP:576732329
1957 1957 c, t dbSNP:563058082
2026 2026 c, t dbSNP:190070382
2082 2082 a, c dbSNP:35822102
2096 2096 c, t dbSNP:73795969
2115 2115 g, t dbSNP:555074687
2131 2131 g, t dbSNP:550885364
2137 2137 c, t dbSNP:368420157
2145 2145 a, g dbSNP:184737111
2217 2217 c, t dbSNP:374858349
2244 2244 a, g dbSNP:11554992
2261 2261 c, t dbSNP:7697730
2279 2279 a, g dbSNP:369532481
2313 2313 a, g dbSNP:149656712
2338 2338 a, g dbSNP:768291833
2340 2340 a, t dbSNP:80290617
2364 2364 g, t dbSNP:191890734
2399 2399 c, g dbSNP:562018223
2414 2414 a, g dbSNP:567945190
2446 2446 a, g dbSNP:186703078
2448 2448 g, t dbSNP:201845209
2464 2464 a, c dbSNP:11554991
2466 2466 c, t dbSNP:768616454
2498 2498 c, t dbSNP:114583572
2499 2499 a, g dbSNP:568567675
2513 2513 c, t dbSNP:745942937
2549 2549 a, g dbSNP:139465916
2586 2586 c, t dbSNP:532168765
2587 2587 a, g dbSNP:76906079
2593 2593 a, g dbSNP:757776014
2597 2597 a, c dbSNP:540115630
2608 2608 a, g dbSNP:530142530
2616 2616 a, c dbSNP:146438954
2627 2627 g, t dbSNP:544566739
2634 2634 a, g dbSNP:575657866
2658 2658 -, gacatggcagacttggcgac dbSNP:59379151
2662 2662 -, tggcagacttggcgacgaca dbSNP:11271562
2662 2662 a, t dbSNP:77509415
2665 2665 c, g dbSNP:186129753
2678 2678 a, g dbSNP:559083007
2681 2681 -, tggcagacttggcgacgaca dbSNP:765347933
2681 2681 a, g dbSNP:545664511
2689 2689 a, g dbSNP:12501278
2695 2695 a, g dbSNP:553734061
2754 2754 a, g dbSNP:536556290
2766 2766 c, g, t dbSNP:7696558
2774 2774 c, t dbSNP:10007480
2822 2822 a, c dbSNP:537810863
2829 2829 c, t dbSNP:568653244
2865 2865 a, g dbSNP:756406611
2891 2891 -, ca dbSNP:564870338
2906 2906 c, t dbSNP:751277657
2913 2913 c, t dbSNP:551855872
2914 2914 a, g dbSNP:765938516
2930 2930 g, t dbSNP:532205614
2935 2935 a, g dbSNP:566315299
2949 2949 c, g dbSNP:139773786
2951 2951 a, g dbSNP:183955971
2956 2956 a, g dbSNP:146354420
2958 2958 a, g dbSNP:561190914
2984 2984 g, t dbSNP:192481004
3016 3016 a, g dbSNP:749963923
3027 3027 c, t dbSNP:777517034
3042 3042 a, g dbSNP:6446489
3047 3047 a, g dbSNP:752283128
3053 3053 g, t dbSNP:2269920
3103 3103 -, tt dbSNP:10606346
3103 3103 c, t dbSNP:185713176
3103 3103 -, t dbSNP:398092138
3110 3110 -, tt dbSNP:542595229
3110 3110 -, t dbSNP:397878825
3111 3111 g, t dbSNP:79992697
3111 3111 -, t dbSNP:11358702
3112 3112 g, t dbSNP:545500948
3113 3113 -, g dbSNP:199670128
3134 3134 -, t dbSNP:201330999
3142 3142 -, ataac dbSNP:370471755
3147 3147 -, ataac dbSNP:534423194
3153 3153 c, t dbSNP:573338661
3194 3194 a, g dbSNP:553624490
3238 3238 c, t dbSNP:188886256
3247 3247 a, g dbSNP:577925041
3250 3250 c, t dbSNP:776678007
3287 3287 c, t dbSNP:183878869
3288 3288 -, t dbSNP:11428044
3308 3308 c, t dbSNP:773055626
3321 3321 a, g dbSNP:142410877
3370 3370 c, t dbSNP:568494100
3393 3393 a, g dbSNP:558265049
3397 3397 c, t dbSNP:772189427
3430 3430 c, t dbSNP:538363335
3444 3444 a, g dbSNP:566202513
3457 3457 c, t dbSNP:73204082
3460 3460 a, g dbSNP:770958776
3520 3520 a, c dbSNP:536436783
3538 3538 a, t dbSNP:567495471
3592 3592 a, g dbSNP:749837780
3606 3606 a, g dbSNP:778121975
3628 3628 a, g dbSNP:550829821
3649 3649 a, t dbSNP:748461048
3653 3653 a, t dbSNP:530962615
3747 3747 g, t dbSNP:565291893
3820 3820 c, t dbSNP:74688502
3828 3828 a, g dbSNP:538636509
3849 3849 a, g dbSNP:148732170
3857 3857 a, g dbSNP:573710815
3919 3919 c, t dbSNP:555133572
3921 3921 a, g dbSNP:571664811
3924 3924 a, g dbSNP:773903145
3928 3928 a, c dbSNP:533561719
3944 3944 a, g dbSNP:542894164
3962 3962 a, g dbSNP:764877505
3994 3994 c, t dbSNP:73073116
3995 3995 a, g dbSNP:566082215
4002 4002 g, t dbSNP:563856975
4004 4004 c, g dbSNP:544080782
4015 4015 g, t dbSNP:760240514
4021 4021 g, t dbSNP:577881417
4045 4045 g, t dbSNP:370519808
4047 4047 g, t dbSNP:558152505
4050 4050 a, g dbSNP:538201869
4060 4060 a, c dbSNP:572613951
4071 4071 c, t dbSNP:553028608
4096 4096 c, t dbSNP:144288061
4107 4107 c, t dbSNP:567438408
4109 4109 c, g dbSNP:550465497
4137 4137 a, g dbSNP:188444246
4161 4161 c, t dbSNP:753882177

Target ORF information:

RefSeq Version XM_011513496
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38361
Accession Version XM_005247979.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 693bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578808182. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)148..549(+)
Position Chain Variation Link
10 10 c, t dbSNP:757022329
29 29 a, g dbSNP:10035042
81 81 a, c, t dbSNP:756692262
82 82 a, g dbSNP:371827360
99 99 c, t dbSNP:144852197
100 100 a, c dbSNP:765650812
114 114 c, t dbSNP:367556203
117 117 a, g dbSNP:749078721
129 129 a, g dbSNP:766676790
132 132 a, g dbSNP:761054245
144 144 a, t dbSNP:773263494
147 147 a, g dbSNP:767816512
153 153 c, t dbSNP:183987526
158 158 a, g dbSNP:774545521
160 160 c, t dbSNP:768473282
165 165 c, t dbSNP:749169351
166 166 a, g dbSNP:775581608
168 168 c, t dbSNP:769662338
177 177 c, t dbSNP:745699183
186 186 c, t dbSNP:780686553
194 194 a, g dbSNP:756994097
201 201 c, t dbSNP:199885426
208 208 a, c, t dbSNP:757919406
225 225 c, t dbSNP:754298356
237 237 a, c, t dbSNP:202247157
240 240 a, g dbSNP:756435972
241 241 c, t dbSNP:750844235
249 249 a, g dbSNP:765263780
255 255 c, t dbSNP:148293311
272 272 a, g dbSNP:776449314
276 276 a, g dbSNP:374065917
279 279 c, t dbSNP:143254935
284 284 c, t dbSNP:760422388
285 285 a, g dbSNP:371801715
300 300 c, t dbSNP:771757681
301 301 a, g dbSNP:747639231
303 303 a, g dbSNP:778458711
306 306 c, t dbSNP:141600291
309 309 c, t dbSNP:372205984
310 310 a, g dbSNP:781570469
318 318 c, t dbSNP:757601971
327 327 c, t dbSNP:751908987
337 337 a, g dbSNP:368801587
342 342 a, c dbSNP:758761295
355 355 c, t dbSNP:374362764
375 375 c, t dbSNP:765351896
387 387 a, g dbSNP:759559815
392 392 a, g dbSNP:531829023
398 398 c, t dbSNP:753771610
405 405 c, g, t dbSNP:370744573
408 408 c, t dbSNP:760492669
418 418 a, g dbSNP:763692349
419 419 a, g dbSNP:762501712
428 428 a, g dbSNP:374272092
438 438 c, g dbSNP:76426507
450 450 c, t dbSNP:747462237
453 453 c, g dbSNP:773880296
456 456 c, t dbSNP:369542799
457 457 c, g dbSNP:748566105
468 468 c, t dbSNP:145291210
471 471 a, c dbSNP:755209779
473 473 a, c dbSNP:749379375
484 484 g, t dbSNP:779928185
492 492 c, t dbSNP:549246766
493 493 a, g dbSNP:267600204
495 495 a, g dbSNP:767472157
498 498 c, t dbSNP:757014009
504 504 c, t dbSNP:201893469
505 505 a, g dbSNP:762339661
516 516 c, t dbSNP:150430481
520 520 a, g dbSNP:768851640
539 539 a, g dbSNP:763404513
540 540 c, t dbSNP:575334919
544 544 c, t dbSNP:775542255
547 547 a, g dbSNP:770049137
551 551 a, g dbSNP:367696094
563 563 a, g dbSNP:781182513
564 564 c, g dbSNP:771013516
567 567 c, t dbSNP:746873206
582 582 c, t dbSNP:181812477
585 585 a, g dbSNP:199531720
587 587 a, g dbSNP:752589937
588 588 a, g dbSNP:547383959
590 590 a, g dbSNP:754747800
592 592 a, g dbSNP:753541104
602 602 c, t dbSNP:765926966
604 604 c, t dbSNP:760251644
609 609 a, t dbSNP:751968235
622 622 c, t dbSNP:750077410
625 625 c, t dbSNP:763204097
627 627 c, t dbSNP:775980958
633 633 c, t dbSNP:527384551
634 634 a, g, t dbSNP:375066274
641 641 g, t dbSNP:770960380
645 645 a, g dbSNP:747154763
647 647 a, g dbSNP:200809882
648 648 a, c, t dbSNP:576151108
649 649 c, t dbSNP:778779009
650 650 a, g dbSNP:747148764
652 652 c, t dbSNP:754837498
653 653 a, g dbSNP:748903409
669 669 a, g dbSNP:779886326
676 676 c, t dbSNP:755549961
696 696 c, t dbSNP:750001141
704 704 c, t dbSNP:371740090
717 717 a, g dbSNP:368843114
737 737 c, t dbSNP:545674626
738 738 c, t dbSNP:3796403
741 741 c, t dbSNP:765536718
742 742 a, g dbSNP:759923972
744 744 a, c dbSNP:11545013
766 766 c, t dbSNP:776801658
774 774 -, ggtaaa dbSNP:749579027
778 778 a, g dbSNP:766669913
783 783 c, t dbSNP:758377483
788 788 c, t dbSNP:760655172
805 805 c, g dbSNP:773405080
806 806 a, t dbSNP:3796402
808 808 c, t dbSNP:748065617
811 811 a, g dbSNP:774456706
815 815 a, c dbSNP:768533555
824 824 -, c dbSNP:778136971
845 845 c, t dbSNP:749137407
846 846 a, g dbSNP:779378774
848 848 a, c dbSNP:78432169
863 863 c, t dbSNP:574889150
867 867 a, g dbSNP:371613753
946 946 c, t dbSNP:3796401
948 948 c, g dbSNP:7678282
1021 1021 a, g dbSNP:3796400
1035 1035 c, t dbSNP:3796399
1039 1039 a, g dbSNP:3796398
1069 1069 c, t dbSNP:146991409
1072 1072 c, t dbSNP:13124495
1080 1080 a, g dbSNP:148843324
1088 1088 g, t dbSNP:547424895
1097 1097 a, g dbSNP:189509101
1111 1111 c, t dbSNP:561867902
1112 1112 a, g dbSNP:759256644
1119 1119 a, g dbSNP:772604056
1150 1150 c, t dbSNP:185136534
1154 1154 c, t dbSNP:369057517
1155 1155 a, g dbSNP:551627211
1177 1177 c, t dbSNP:6446490
1180 1180 a, c dbSNP:562555368
1194 1194 c, t dbSNP:545563888
1195 1195 a, g dbSNP:765957206
1199 1199 a, c dbSNP:13147522
1206 1206 -, g dbSNP:35327508
1208 1208 c, g dbSNP:372796719
1211 1211 c, g dbSNP:181636663
1247 1247 a, c, g, t dbSNP:576732329
1274 1274 c, t dbSNP:563058082
1343 1343 c, t dbSNP:190070382
1399 1399 a, c dbSNP:35822102
1413 1413 c, t dbSNP:73795969
1432 1432 g, t dbSNP:555074687
1448 1448 g, t dbSNP:550885364
1454 1454 c, t dbSNP:368420157
1462 1462 a, g dbSNP:184737111
1534 1534 c, t dbSNP:374858349
1561 1561 a, g dbSNP:11554992
1578 1578 c, t dbSNP:7697730
1596 1596 a, g dbSNP:369532481
1630 1630 a, g dbSNP:149656712
1655 1655 a, g dbSNP:768291833
1657 1657 a, t dbSNP:80290617
1681 1681 g, t dbSNP:191890734
1716 1716 c, g dbSNP:562018223
1731 1731 a, g dbSNP:567945190
1763 1763 a, g dbSNP:186703078
1765 1765 g, t dbSNP:201845209
1781 1781 a, c dbSNP:11554991
1783 1783 c, t dbSNP:768616454
1815 1815 c, t dbSNP:114583572
1816 1816 a, g dbSNP:568567675
1830 1830 c, t dbSNP:745942937
1866 1866 a, g dbSNP:139465916
1903 1903 c, t dbSNP:532168765
1904 1904 a, g dbSNP:76906079
1910 1910 a, g dbSNP:757776014
1914 1914 a, c dbSNP:540115630
1925 1925 a, g dbSNP:530142530
1933 1933 a, c dbSNP:146438954
1944 1944 g, t dbSNP:544566739
1951 1951 a, g dbSNP:575657866
1975 1975 -, gacatggcagacttggcgac dbSNP:59379151
1979 1979 -, tggcagacttggcgacgaca dbSNP:11271562
1979 1979 a, t dbSNP:77509415
1982 1982 c, g dbSNP:186129753
1995 1995 a, g dbSNP:559083007
1998 1998 -, tggcagacttggcgacgaca dbSNP:765347933
1998 1998 a, g dbSNP:545664511
2006 2006 a, g dbSNP:12501278
2012 2012 a, g dbSNP:553734061
2071 2071 a, g dbSNP:536556290
2083 2083 c, g, t dbSNP:7696558
2091 2091 c, t dbSNP:10007480
2139 2139 a, c dbSNP:537810863
2146 2146 c, t dbSNP:568653244
2182 2182 a, g dbSNP:756406611
2208 2208 -, ca dbSNP:564870338
2223 2223 c, t dbSNP:751277657
2230 2230 c, t dbSNP:551855872
2231 2231 a, g dbSNP:765938516
2247 2247 g, t dbSNP:532205614
2252 2252 a, g dbSNP:566315299
2266 2266 c, g dbSNP:139773786
2268 2268 a, g dbSNP:183955971
2273 2273 a, g dbSNP:146354420
2275 2275 a, g dbSNP:561190914
2301 2301 g, t dbSNP:192481004
2333 2333 a, g dbSNP:749963923
2344 2344 c, t dbSNP:777517034
2359 2359 a, g dbSNP:6446489
2364 2364 a, g dbSNP:752283128
2370 2370 g, t dbSNP:2269920
2420 2420 -, tt dbSNP:10606346
2420 2420 c, t dbSNP:185713176
2420 2420 -, t dbSNP:398092138
2427 2427 -, tt dbSNP:542595229
2427 2427 -, t dbSNP:397878825
2428 2428 g, t dbSNP:79992697
2428 2428 -, t dbSNP:11358702
2429 2429 g, t dbSNP:545500948
2430 2430 -, g dbSNP:199670128
2451 2451 -, t dbSNP:201330999
2459 2459 -, ataac dbSNP:370471755
2464 2464 -, ataac dbSNP:534423194
2470 2470 c, t dbSNP:573338661
2511 2511 a, g dbSNP:553624490
2555 2555 c, t dbSNP:188886256
2564 2564 a, g dbSNP:577925041
2567 2567 c, t dbSNP:776678007
2604 2604 c, t dbSNP:183878869
2605 2605 -, t dbSNP:11428044
2625 2625 c, t dbSNP:773055626
2638 2638 a, g dbSNP:142410877
2687 2687 c, t dbSNP:568494100
2710 2710 a, g dbSNP:558265049
2714 2714 c, t dbSNP:772189427
2747 2747 c, t dbSNP:538363335
2761 2761 a, g dbSNP:566202513
2774 2774 c, t dbSNP:73204082
2777 2777 a, g dbSNP:770958776
2837 2837 a, c dbSNP:536436783
2855 2855 a, t dbSNP:567495471
2909 2909 a, g dbSNP:749837780
2923 2923 a, g dbSNP:778121975
2945 2945 a, g dbSNP:550829821
2966 2966 a, t dbSNP:748461048
2970 2970 a, t dbSNP:530962615
3064 3064 g, t dbSNP:565291893
3137 3137 c, t dbSNP:74688502
3145 3145 a, g dbSNP:538636509
3166 3166 a, g dbSNP:148732170
3174 3174 a, g dbSNP:573710815
3236 3236 c, t dbSNP:555133572
3238 3238 a, g dbSNP:571664811
3241 3241 a, g dbSNP:773903145
3245 3245 a, c dbSNP:533561719
3261 3261 a, g dbSNP:542894164
3279 3279 a, g dbSNP:764877505
3311 3311 c, t dbSNP:73073116
3312 3312 a, g dbSNP:566082215
3319 3319 g, t dbSNP:563856975
3321 3321 c, g dbSNP:544080782
3332 3332 g, t dbSNP:760240514
3338 3338 g, t dbSNP:577881417
3362 3362 g, t dbSNP:370519808
3364 3364 g, t dbSNP:558152505
3367 3367 a, g dbSNP:538201869
3377 3377 a, c dbSNP:572613951
3388 3388 c, t dbSNP:553028608
3413 3413 c, t dbSNP:144288061
3424 3424 c, t dbSNP:567438408
3426 3426 c, g dbSNP:550465497
3454 3454 a, g dbSNP:188444246
3478 3478 c, t dbSNP:753882177

Target ORF information:

RefSeq Version XM_005247979
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28473
Accession Version NM_001206994.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1323bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform c
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK296474.1, AC116317.4 and BC045682.1. This sequence is a reference standard in the RefSeqGene project. Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) contains alternate 5' exon structure, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296474.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)73..75(+)
Misc Feature(2)148..1392(+)
Misc Feature(3)151..1176(+)
Misc Feature(4)199..1176(+)
Exon (1)1..41
Gene Synonym:
Exon (2)42..148
Gene Synonym:
Exon (3)149..246
Gene Synonym:
Exon (4)247..412
Gene Synonym:
Exon (5)413..525
Gene Synonym:
Exon (6)526..703
Gene Synonym:
Exon (7)704..868
Gene Synonym:
Exon (8)869..1038
Gene Synonym:
Exon (9)1039..1130
Gene Synonym:
Exon (10)1131..4146
Gene Synonym:
Position Chain Variation Link
16 16 a, g dbSNP:568957924
78 78 c, t dbSNP:73086920
81 81 a, g dbSNP:528496736
104 104 a, g dbSNP:756238396
116 116 c, t dbSNP:757753779
117 117 a, g dbSNP:752007791
147 147 c, t dbSNP:559297431
156 156 c, t dbSNP:745646342
165 165 a, c, t dbSNP:563983100
176 176 a, g dbSNP:751114949
180 180 c, t dbSNP:777507975
182 182 c, t dbSNP:757810061
183 183 a, g, t dbSNP:766852399
189 189 c, g dbSNP:761226047
192 192 g, t dbSNP:750778362
198 198 a, c dbSNP:767799128
201 201 a, g dbSNP:770639714
213 213 c, t dbSNP:762247987
219 219 a, g dbSNP:774387666
222 222 c, t dbSNP:540827872
235 235 c, t dbSNP:762909236
238 238 c, g dbSNP:775771834
248 248 c, g dbSNP:375793522
249 249 c, t dbSNP:201343301
250 250 a, c dbSNP:781641771
257 257 c, t dbSNP:202026671
258 258 a, g dbSNP:751855715
273 273 c, t dbSNP:764453190
274 274 a, g dbSNP:200176027
279 279 c, t dbSNP:758703360
280 280 a, g dbSNP:752918306
282 282 c, t dbSNP:200481224
285 285 a, g dbSNP:759660871
306 306 c, t dbSNP:140187944
309 309 a, g dbSNP:200538202
311 311 c, t dbSNP:760729044
312 312 a, g dbSNP:147944662
321 321 c, t dbSNP:771838476
332 332 c, g dbSNP:761614602
384 384 c, t dbSNP:773951608
385 385 c, g dbSNP:768337204
387 387 c, t dbSNP:748773208
388 388 a, g dbSNP:779671991
391 391 c, t dbSNP:769193125
408 408 c, t dbSNP:536567890
411 411 c, t dbSNP:778166439
429 429 a, g dbSNP:763820029
431 431 c, g dbSNP:762760790
440 440 c, g dbSNP:775168990
441 441 c, t dbSNP:200755929
443 443 a, g dbSNP:759067979
448 448 a, g dbSNP:150954241
450 450 c, t dbSNP:564494305
455 455 a, g dbSNP:190838630
459 459 c, t dbSNP:748602611
474 474 a, g dbSNP:775008868
480 480 c, t dbSNP:144935113
489 489 a, g dbSNP:371617770
495 495 g, t dbSNP:780288378
502 502 a, c, g dbSNP:139419142
504 504 a, g dbSNP:781314421
509 509 c, t dbSNP:763126722
510 510 a, g dbSNP:144455156
515 515 c, t dbSNP:764052676
516 516 a, g dbSNP:35368770
523 523 a, c dbSNP:752487442
585 585 c, t dbSNP:764683644
598 598 g, t dbSNP:544553155
609 609 c, t dbSNP:139536190
618 618 c, t dbSNP:201965712
619 619 a, g dbSNP:373814468
627 627 c, t dbSNP:759977783
632 632 a, g dbSNP:150561015
633 633 c, t dbSNP:142509881
648 648 a, g dbSNP:747082352
650 650 c, t dbSNP:369585524
651 651 a, g dbSNP:138031809
661 661 c, t dbSNP:747980900
662 662 c, g dbSNP:778929388
684 684 c, t dbSNP:145521227
690 690 c, t dbSNP:35410672
708 708 a, c, t dbSNP:756692262
709 709 a, g dbSNP:371827360
726 726 c, t dbSNP:144852197
727 727 a, c dbSNP:765650812
741 741 c, t dbSNP:367556203
744 744 a, g dbSNP:749078721
756 756 a, g dbSNP:766676790
759 759 a, g dbSNP:761054245
771 771 a, t dbSNP:773263494
774 774 a, g dbSNP:767816512
780 780 c, t dbSNP:183987526
785 785 a, g dbSNP:774545521
787 787 c, t dbSNP:768473282
792 792 c, t dbSNP:749169351
793 793 a, g dbSNP:775581608
795 795 c, t dbSNP:769662338
804 804 c, t dbSNP:745699183
813 813 c, t dbSNP:780686553
821 821 a, g dbSNP:756994097
828 828 c, t dbSNP:199885426
835 835 a, c, t dbSNP:757919406
852 852 c, t dbSNP:754298356
864 864 a, c, t dbSNP:202247157
867 867 a, g dbSNP:756435972
868 868 c, t dbSNP:750844235
876 876 a, g dbSNP:765263780
882 882 c, t dbSNP:148293311
899 899 a, g dbSNP:776449314
903 903 a, g dbSNP:374065917
906 906 c, t dbSNP:143254935
911 911 c, t dbSNP:760422388
912 912 a, g dbSNP:371801715
927 927 c, t dbSNP:771757681
928 928 a, g dbSNP:747639231
930 930 a, g dbSNP:778458711
933 933 c, t dbSNP:141600291
936 936 c, t dbSNP:372205984
937 937 a, g dbSNP:781570469
945 945 c, t dbSNP:757601971
954 954 c, t dbSNP:751908987
964 964 a, g dbSNP:368801587
969 969 a, c dbSNP:758761295
982 982 c, t dbSNP:374362764
1002 1002 c, t dbSNP:765351896
1014 1014 a, g dbSNP:759559815
1019 1019 a, g dbSNP:531829023
1025 1025 c, t dbSNP:753771610
1032 1032 c, g, t dbSNP:370744573
1035 1035 c, t dbSNP:760492669
1045 1045 a, g dbSNP:763692349
1046 1046 a, g dbSNP:762501712
1055 1055 a, g dbSNP:374272092
1065 1065 c, g dbSNP:76426507
1077 1077 c, t dbSNP:747462237
1080 1080 c, g dbSNP:773880296
1083 1083 c, t dbSNP:369542799
1084 1084 c, g dbSNP:748566105
1095 1095 c, t dbSNP:145291210
1098 1098 a, c dbSNP:755209779
1100 1100 a, c dbSNP:749379375
1111 1111 g, t dbSNP:779928185
1119 1119 c, t dbSNP:549246766
1120 1120 a, g dbSNP:267600204
1122 1122 a, g dbSNP:767472157
1125 1125 c, t dbSNP:757014009
1131 1131 c, t dbSNP:201893469
1132 1132 a, g dbSNP:762339661
1143 1143 c, t dbSNP:150430481
1147 1147 a, g dbSNP:768851640
1166 1166 a, g dbSNP:763404513
1167 1167 c, t dbSNP:575334919
1171 1171 c, t dbSNP:775542255
1174 1174 a, g dbSNP:770049137
1178 1178 a, g dbSNP:367696094
1190 1190 a, g dbSNP:781182513
1191 1191 c, g dbSNP:771013516
1194 1194 c, t dbSNP:746873206
1209 1209 c, t dbSNP:181812477
1212 1212 a, g dbSNP:199531720
1214 1214 a, g dbSNP:752589937
1215 1215 a, g dbSNP:547383959
1217 1217 a, g dbSNP:754747800
1219 1219 a, g dbSNP:753541104
1229 1229 c, t dbSNP:765926966
1231 1231 c, t dbSNP:760251644
1236 1236 a, t dbSNP:751968235
1249 1249 c, t dbSNP:750077410
1252 1252 c, t dbSNP:763204097
1254 1254 c, t dbSNP:775980958
1260 1260 c, t dbSNP:527384551
1261 1261 a, g, t dbSNP:375066274
1268 1268 g, t dbSNP:770960380
1272 1272 a, g dbSNP:747154763
1274 1274 a, g dbSNP:200809882
1275 1275 a, c, t dbSNP:576151108
1276 1276 c, t dbSNP:778779009
1277 1277 a, g dbSNP:747148764
1279 1279 c, t dbSNP:754837498
1280 1280 a, g dbSNP:748903409
1296 1296 a, g dbSNP:779886326
1303 1303 c, t dbSNP:755549961
1323 1323 c, t dbSNP:750001141
1331 1331 c, t dbSNP:371740090
1344 1344 a, g dbSNP:368843114
1364 1364 c, t dbSNP:545674626
1365 1365 c, t dbSNP:3796403
1368 1368 c, t dbSNP:765536718
1369 1369 a, g dbSNP:759923972
1371 1371 a, c dbSNP:11545013
1393 1393 c, t dbSNP:776801658
1401 1401 -, ggtaaa dbSNP:749579027
1405 1405 a, g dbSNP:766669913
1410 1410 c, t dbSNP:758377483
1415 1415 c, t dbSNP:760655172
1432 1432 c, g dbSNP:773405080
1433 1433 a, t dbSNP:3796402
1435 1435 c, t dbSNP:748065617
1438 1438 a, g dbSNP:774456706
1442 1442 a, c dbSNP:768533555
1451 1451 -, c dbSNP:778136971
1472 1472 c, t dbSNP:749137407
1473 1473 a, g dbSNP:779378774
1475 1475 a, c dbSNP:78432169
1490 1490 c, t dbSNP:574889150
1494 1494 a, g dbSNP:371613753
1573 1573 c, t dbSNP:3796401
1575 1575 c, g dbSNP:7678282
1648 1648 a, g dbSNP:3796400
1662 1662 c, t dbSNP:3796399
1666 1666 a, g dbSNP:3796398
1696 1696 c, t dbSNP:146991409
1699 1699 c, t dbSNP:13124495
1707 1707 a, g dbSNP:148843324
1715 1715 g, t dbSNP:547424895
1724 1724 a, g dbSNP:189509101
1738 1738 c, t dbSNP:561867902
1739 1739 a, g dbSNP:759256644
1746 1746 a, g dbSNP:772604056
1777 1777 c, t dbSNP:185136534
1781 1781 c, t dbSNP:369057517
1782 1782 a, g dbSNP:551627211
1804 1804 c, t dbSNP:6446490
1807 1807 a, c dbSNP:562555368
1821 1821 c, t dbSNP:545563888
1822 1822 a, g dbSNP:765957206
1826 1826 a, c dbSNP:13147522
1833 1833 -, g dbSNP:35327508
1835 1835 c, g dbSNP:372796719
1838 1838 c, g dbSNP:181636663
1874 1874 a, c, g, t dbSNP:576732329
1901 1901 c, t dbSNP:563058082
1970 1970 c, t dbSNP:190070382
2026 2026 a, c dbSNP:35822102
2040 2040 c, t dbSNP:73795969
2059 2059 g, t dbSNP:555074687
2075 2075 g, t dbSNP:550885364
2081 2081 c, t dbSNP:368420157
2089 2089 a, g dbSNP:184737111
2161 2161 c, t dbSNP:374858349
2188 2188 a, g dbSNP:11554992
2205 2205 c, t dbSNP:7697730
2223 2223 a, g dbSNP:369532481
2257 2257 a, g dbSNP:149656712
2282 2282 a, g dbSNP:768291833
2284 2284 a, t dbSNP:80290617
2308 2308 g, t dbSNP:191890734
2343 2343 c, g dbSNP:562018223
2358 2358 a, g dbSNP:567945190
2390 2390 a, g dbSNP:186703078
2392 2392 g, t dbSNP:201845209
2408 2408 a, c dbSNP:11554991
2410 2410 c, t dbSNP:768616454
2442 2442 c, t dbSNP:114583572
2443 2443 a, g dbSNP:568567675
2457 2457 c, t dbSNP:745942937
2493 2493 a, g dbSNP:139465916
2530 2530 c, t dbSNP:532168765
2531 2531 a, g dbSNP:76906079
2537 2537 a, g dbSNP:757776014
2541 2541 a, c dbSNP:540115630
2552 2552 a, g dbSNP:530142530
2560 2560 a, c dbSNP:146438954
2571 2571 g, t dbSNP:544566739
2578 2578 a, g dbSNP:575657866
2602 2602 -, gacatggcagacttggcgac dbSNP:59379151
2606 2606 -, tggcagacttggcgacgaca dbSNP:11271562
2606 2606 a, t dbSNP:77509415
2609 2609 c, g dbSNP:186129753
2622 2622 a, g dbSNP:559083007
2625 2625 -, tggcagacttggcgacgaca dbSNP:765347933
2625 2625 a, g dbSNP:545664511
2633 2633 a, g dbSNP:12501278
2639 2639 a, g dbSNP:553734061
2698 2698 a, g dbSNP:536556290
2710 2710 c, g, t dbSNP:7696558
2718 2718 c, t dbSNP:10007480
2766 2766 a, c dbSNP:537810863
2773 2773 c, t dbSNP:568653244
2809 2809 a, g dbSNP:756406611
2835 2835 -, ca dbSNP:564870338
2850 2850 c, t dbSNP:751277657
2857 2857 c, t dbSNP:551855872
2858 2858 a, g dbSNP:765938516
2874 2874 g, t dbSNP:532205614
2879 2879 a, g dbSNP:566315299
2893 2893 c, g dbSNP:139773786
2895 2895 a, g dbSNP:183955971
2900 2900 a, g dbSNP:146354420
2902 2902 a, g dbSNP:561190914
2928 2928 g, t dbSNP:192481004
2960 2960 a, g dbSNP:749963923
2971 2971 c, t dbSNP:777517034
2986 2986 a, g dbSNP:6446489
2991 2991 a, g dbSNP:752283128
2997 2997 g, t dbSNP:2269920
3047 3047 -, tt dbSNP:10606346
3047 3047 c, t dbSNP:185713176
3047 3047 -, t dbSNP:398092138
3054 3054 -, tt dbSNP:542595229
3054 3054 -, t dbSNP:397878825
3055 3055 g, t dbSNP:79992697
3055 3055 -, t dbSNP:11358702
3056 3056 g, t dbSNP:545500948
3057 3057 -, g dbSNP:199670128
3078 3078 -, t dbSNP:201330999
3086 3086 -, ataac dbSNP:370471755
3091 3091 -, ataac dbSNP:534423194
3097 3097 c, t dbSNP:573338661
3138 3138 a, g dbSNP:553624490
3182 3182 c, t dbSNP:188886256
3191 3191 a, g dbSNP:577925041
3194 3194 c, t dbSNP:776678007
3231 3231 c, t dbSNP:183878869
3232 3232 -, t dbSNP:11428044
3252 3252 c, t dbSNP:773055626
3265 3265 a, g dbSNP:142410877
3314 3314 c, t dbSNP:568494100
3337 3337 a, g dbSNP:558265049
3341 3341 c, t dbSNP:772189427
3374 3374 c, t dbSNP:538363335
3388 3388 a, g dbSNP:566202513
3401 3401 c, t dbSNP:73204082
3404 3404 a, g dbSNP:770958776
3464 3464 a, c dbSNP:536436783
3482 3482 a, t dbSNP:567495471
3536 3536 a, g dbSNP:749837780
3550 3550 a, g dbSNP:778121975
3572 3572 a, g dbSNP:550829821
3593 3593 a, t dbSNP:748461048
3597 3597 a, t dbSNP:530962615
3691 3691 g, t dbSNP:565291893
3764 3764 c, t dbSNP:74688502
3772 3772 a, g dbSNP:538636509
3793 3793 a, g dbSNP:148732170
3801 3801 a, g dbSNP:573710815
3863 3863 c, t dbSNP:555133572
3865 3865 a, g dbSNP:571664811
3868 3868 a, g dbSNP:773903145
3872 3872 a, c dbSNP:533561719
3888 3888 a, g dbSNP:542894164
3906 3906 a, g dbSNP:764877505
3938 3938 c, t dbSNP:73073116
3939 3939 a, g dbSNP:566082215
3946 3946 g, t dbSNP:563856975
3948 3948 c, g dbSNP:544080782
3959 3959 g, t dbSNP:760240514
3965 3965 g, t dbSNP:577881417
3989 3989 g, t dbSNP:370519808
3991 3991 g, t dbSNP:558152505
3994 3994 a, g dbSNP:538201869
4004 4004 a, c dbSNP:572613951
4015 4015 c, t dbSNP:553028608
4040 4040 c, t dbSNP:144288061
4051 4051 c, t dbSNP:567438408
4053 4053 c, g dbSNP:550465497
4081 4081 a, g dbSNP:188444246
4105 4105 c, t dbSNP:753882177

Target ORF information:

RefSeq Version NM_001206994
Organism Homo sapiens (human)
Definition Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28473
Accession Version NM_001206995.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1323bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein phosphatase 2, regulatory subunit B, gamma isoform c
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC327075.1, AK316003.1, AC116317.4 and BC045682.1. Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (4) contains alternate 5' exon structure, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK316003.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)177..179(+)
Misc Feature(2)252..1496(+)
Misc Feature(3)255..1280(+)
Misc Feature(4)303..1280(+)
Exon (1)1..145
Gene Synonym:
Exon (2)146..252
Gene Synonym:
Exon (3)253..350
Gene Synonym:
Exon (4)351..516
Gene Synonym:
Exon (5)517..629
Gene Synonym:
Exon (6)630..807
Gene Synonym:
Exon (7)808..972
Gene Synonym:
Exon (8)973..1142
Gene Synonym:
Exon (9)1143..1234
Gene Synonym:
Exon (10)1235..4250
Gene Synonym:
Position Chain Variation Link
21 21 a, g dbSNP:572202014
22 22 g, t dbSNP:555529594
50 50 c, t dbSNP:751513451
55 55 a, g dbSNP:766285789
59 59 a, g dbSNP:535953068
88 88 a, g dbSNP:570114994
98 98 c, t dbSNP:57291781
122 122 c, t dbSNP:185728914
134 134 a, c dbSNP:773022864
135 135 a, g dbSNP:11727636
138 138 c, t dbSNP:762037487
182 182 c, t dbSNP:73086920
185 185 a, g dbSNP:528496736
208 208 a, g dbSNP:756238396
220 220 c, t dbSNP:757753779
221 221 a, g dbSNP:752007791
251 251 c, t dbSNP:559297431
260 260 c, t dbSNP:745646342
269 269 a, c, t dbSNP:563983100
280 280 a, g dbSNP:751114949
284 284 c, t dbSNP:777507975
286 286 c, t dbSNP:757810061
287 287 a, g, t dbSNP:766852399
293 293 c, g dbSNP:761226047
296 296 g, t dbSNP:750778362
302 302 a, c dbSNP:767799128
305 305 a, g dbSNP:770639714
317 317 c, t dbSNP:762247987
323 323 a, g dbSNP:774387666
326 326 c, t dbSNP:540827872
339 339 c, t dbSNP:762909236
342 342 c, g dbSNP:775771834
352 352 c, g dbSNP:375793522
353 353 c, t dbSNP:201343301
354 354 a, c dbSNP:781641771
361 361 c, t dbSNP:202026671
362 362 a, g dbSNP:751855715
377 377 c, t dbSNP:764453190
378 378 a, g dbSNP:200176027
383 383 c, t dbSNP:758703360
384 384 a, g dbSNP:752918306
386 386 c, t dbSNP:200481224
389 389 a, g dbSNP:759660871
410 410 c, t dbSNP:140187944
413 413 a, g dbSNP:200538202
415 415 c, t dbSNP:760729044
416 416 a, g dbSNP:147944662
425 425 c, t dbSNP:771838476
436 436 c, g dbSNP:761614602
488 488 c, t dbSNP:773951608
489 489 c, g dbSNP:768337204
491 491 c, t dbSNP:748773208
492 492 a, g dbSNP:779671991
495 495 c, t dbSNP:769193125
512 512 c, t dbSNP:536567890
515 515 c, t dbSNP:778166439
533 533 a, g dbSNP:763820029
535 535 c, g dbSNP:762760790
544 544 c, g dbSNP:775168990
545 545 c, t dbSNP:200755929
547 547 a, g dbSNP:759067979
552 552 a, g dbSNP:150954241
554 554 c, t dbSNP:564494305
559 559 a, g dbSNP:190838630
563 563 c, t dbSNP:748602611
578 578 a, g dbSNP:775008868
584 584 c, t dbSNP:144935113
593 593 a, g dbSNP:371617770
599 599 g, t dbSNP:780288378
606 606 a, c, g dbSNP:139419142
608 608 a, g dbSNP:781314421
613 613 c, t dbSNP:763126722
614 614 a, g dbSNP:144455156
619 619 c, t dbSNP:764052676
620 620 a, g dbSNP:35368770
627 627 a, c dbSNP:752487442
689 689 c, t dbSNP:764683644
702 702 g, t dbSNP:544553155
713 713 c, t dbSNP:139536190
722 722 c, t dbSNP:201965712
723 723 a, g dbSNP:373814468
731 731 c, t dbSNP:759977783
736 736 a, g dbSNP:150561015
737 737 c, t dbSNP:142509881
752 752 a, g dbSNP:747082352
754 754 c, t dbSNP:369585524
755 755 a, g dbSNP:138031809
765 765 c, t dbSNP:747980900
766 766 c, g dbSNP:778929388
788 788 c, t dbSNP:145521227
794 794 c, t dbSNP:35410672
812 812 a, c, t dbSNP:756692262
813 813 a, g dbSNP:371827360
830 830 c, t dbSNP:144852197
831 831 a, c dbSNP:765650812
845 845 c, t dbSNP:367556203
848 848 a, g dbSNP:749078721
860 860 a, g dbSNP:766676790
863 863 a, g dbSNP:761054245
875 875 a, t dbSNP:773263494
878 878 a, g dbSNP:767816512
884 884 c, t dbSNP:183987526
889 889 a, g dbSNP:774545521
891 891 c, t dbSNP:768473282
896 896 c, t dbSNP:749169351
897 897 a, g dbSNP:775581608
899 899 c, t dbSNP:769662338
908 908 c, t dbSNP:745699183
917 917 c, t dbSNP:780686553
925 925 a, g dbSNP:756994097
932 932 c, t dbSNP:199885426
939 939 a, c, t dbSNP:757919406
956 956 c, t dbSNP:754298356
968 968 a, c, t dbSNP:202247157
971 971 a, g dbSNP:756435972
972 972 c, t dbSNP:750844235
980 980 a, g dbSNP:765263780
986 986 c, t dbSNP:148293311
1003 1003 a, g dbSNP:776449314
1007 1007 a, g dbSNP:374065917
1010 1010 c, t dbSNP:143254935
1015 1015 c, t dbSNP:760422388
1016 1016 a, g dbSNP:371801715
1031 1031 c, t dbSNP:771757681
1032 1032 a, g dbSNP:747639231
1034 1034 a, g dbSNP:778458711
1037 1037 c, t dbSNP:141600291
1040 1040 c, t dbSNP:372205984
1041 1041 a, g dbSNP:781570469
1049 1049 c, t dbSNP:757601971
1058 1058 c, t dbSNP:751908987
1068 1068 a, g dbSNP:368801587
1073 1073 a, c dbSNP:758761295
1086 1086 c, t dbSNP:374362764
1106 1106 c, t dbSNP:765351896
1118 1118 a, g dbSNP:759559815
1123 1123 a, g dbSNP:531829023
1129 1129 c, t dbSNP:753771610
1136 1136 c, g, t dbSNP:370744573
1139 1139 c, t dbSNP:760492669
1149 1149 a, g dbSNP:763692349
1150 1150 a, g dbSNP:762501712
1159 1159 a, g dbSNP:374272092
1169 1169 c, g dbSNP:76426507
1181 1181 c, t dbSNP:747462237
1184 1184 c, g dbSNP:773880296
1187 1187 c, t dbSNP:369542799
1188 1188 c, g dbSNP:748566105
1199 1199 c, t dbSNP:145291210
1202 1202 a, c dbSNP:755209779
1204 1204 a, c dbSNP:749379375
1215 1215 g, t dbSNP:779928185
1223 1223 c, t dbSNP:549246766
1224 1224 a, g dbSNP:267600204
1226 1226 a, g dbSNP:767472157
1229 1229 c, t dbSNP:757014009
1235 1235 c, t dbSNP:201893469
1236 1236 a, g dbSNP:762339661
1247 1247 c, t dbSNP:150430481
1251 1251 a, g dbSNP:768851640
1270 1270 a, g dbSNP:763404513
1271 1271 c, t dbSNP:575334919
1275 1275 c, t dbSNP:775542255
1278 1278 a, g dbSNP:770049137
1282 1282 a, g dbSNP:367696094
1294 1294 a, g dbSNP:781182513
1295 1295 c, g dbSNP:771013516
1298 1298 c, t dbSNP:746873206
1313 1313 c, t dbSNP:181812477
1316 1316 a, g dbSNP:199531720
1318 1318 a, g dbSNP:752589937
1319 1319 a, g dbSNP:547383959
1321 1321 a, g dbSNP:754747800
1323 1323 a, g dbSNP:753541104
1333 1333 c, t dbSNP:765926966
1335 1335 c, t dbSNP:760251644
1340 1340 a, t dbSNP:751968235
1353 1353 c, t dbSNP:750077410
1356 1356 c, t dbSNP:763204097
1358 1358 c, t dbSNP:775980958
1364 1364 c, t dbSNP:527384551
1365 1365 a, g, t dbSNP:375066274
1372 1372 g, t dbSNP:770960380
1376 1376 a, g dbSNP:747154763
1378 1378 a, g dbSNP:200809882
1379 1379 a, c, t dbSNP:576151108
1380 1380 c, t dbSNP:778779009
1381 1381 a, g dbSNP:747148764
1383 1383 c, t dbSNP:754837498
1384 1384 a, g dbSNP:748903409
1400 1400 a, g dbSNP:779886326
1407 1407 c, t dbSNP:755549961
1427 1427 c, t dbSNP:750001141
1435 1435 c, t dbSNP:371740090
1448 1448 a, g dbSNP:368843114
1468 1468 c, t dbSNP:545674626
1469 1469 c, t dbSNP:3796403
1472 1472 c, t dbSNP:765536718
1473 1473 a, g dbSNP:759923972
1475 1475 a, c dbSNP:11545013
1497 1497 c, t dbSNP:776801658
1505 1505 -, ggtaaa dbSNP:749579027
1509 1509 a, g dbSNP:766669913
1514 1514 c, t dbSNP:758377483
1519 1519 c, t dbSNP:760655172
1536 1536 c, g dbSNP:773405080
1537 1537 a, t