Home » Species Summary » Homo sapiens » INPP5E cDNA ORF clone
Email to GenScript

INPP5E cDNA ORF clone, Homo sapiens (human)

Gene Symbol INPP5E
Entrez Gene ID 56623
Full Name inositol polyphosphate-5-phosphatase E
General protein information
Preferred Names
72 kDa inositol polyphosphate 5-phosphatase
72 kDa inositol polyphosphate 5-phosphatase
phosphatidylinositol 4,5-bisphosphate 5-phosphatase
phosphatidylinositol-4,5-bisphosphate 5-phosphatase
phosphatidylinositol (4,5) bisphosphate 5-phosphatase
phosphatidylinositol polyphosphate 5-phosphatase type IV
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly.[provided by RefSeq, Feb 2011]. lac of sum
Disorder MIM:


Disorder Html: Mental retardation, truncal obesity, retinal dystrophy, and

mRNA and Protein(s)

mRNA Protein Name
NM_019892 NP_063945 72 kDa inositol polyphosphate 5-phosphatase
XM_005266094 XP_005266151 72 kDa inositol polyphosphate 5-phosphatase isoform X1

hsa04070 Phosphatidylinositol signaling system
hsa00562 Inositol phosphate metabolism
hsa01100 Metabolic pathways
R-HSA-1852241 Organelle biogenesis and maintenance
R-HSA-5620920 Cargo trafficking to the periciliary membrane
R-HSA-5617833 Assembly of the primary cilium
R-HSA-5624958 ARL13B-mediated ciliary trafficking of INPP5E
R-HSA-1430728 Metabolism
R-HSA-556833 Metabolism of lipids and lipoproteins
R-HSA-1483255 PI Metabolism
R-HSA-1660514 Synthesis of PIPs at the Golgi membrane
R-HSA-1483257 Phospholipid metabolism
HUMAN_PWY-6368 3-phosphoinositide degradation

Homo sapiens (human) INPP5E NP_063945.2
Pan troglodytes (chimpanzee) INPP5E NP_001070981.1
Macaca mulatta (Rhesus monkey) INPP5E XP_001095203.1
Canis lupus familiaris (dog) INPP5E XP_005625166.1
Bos taurus (cattle) INPP5E NP_001179019.1
Mus musculus (house mouse) Inpp5e NP_149125.1
Rattus norvegicus (Norway rat) Inpp5e NP_446084.1
Gallus gallus (chicken) INPP5E XP_415418.2
Danio rerio (zebrafish) inpp5e NP_001096089.2
Xenopus (Silurana) tropicalis (western clawed frog) inpp5e XP_002935265.1


ID Name Evidence
GO:0005737 cytoplasm IEA
GO:0005794 Golgi apparatus IEA
GO:0005856 cytoskeleton IEA
GO:0005929 cilium IEA
GO:0016020 membrane IEA
GO:0032580 Golgi cisterna membrane IEA
GO:0035085 cilium axoneme IDA


ID Name Evidence
GO:0004437 inositol or phosphatidylinositol phosphatase activity IEA
GO:0004439 phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity IEA
GO:0004445 inositol-polyphosphate 5-phosphatase activity TAS
GO:0016787 hydrolase activity IEA


ID Name Evidence
GO:0006629 lipid metabolic process IEA
GO:0008150 biological_process ND
GO:0046488 phosphatidylinositol metabolic process IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following INPP5E gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the INPP5E cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu27383 NM_019892 Homo sapiens inositol polyphosphate-5-phosphatase E (INPP5E), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $379.00
OHu43395 XM_005266094 PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu27383
Accession Version NM_019892.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1935bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 23-AUG-2015
Organism Homo sapiens (human)
Product 72 kDa inositol polyphosphate 5-phosphatase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC028032.1 and BE044535.1. This sequence is a reference standard in the RefSeqGene project. On Mar 25, 2011 this sequence version replaced gi:47078290. Summary: The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly.[provided by RefSeq, Feb 2011]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC028032.1, AF187891.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)329..331(+)
Misc Feature(2)413..1111(+)
Misc Feature(3)680..682(+)
Misc Feature(4)680..682(+)
Misc Feature(5)1268..2164(+)
Misc Feature(6)1304..2137(+)
Misc Feature(7)1304..2137(+)
Misc Feature(8)1403..2134(+)
Misc Feature(9)1403..2134(+)
Misc Feature(10)1655..2137(+)
Misc Feature(11)2306..2308(+)
Exon (1)1..1197
Gene Synonym:
Exon (2)1198..1321
Gene Synonym:
Exon (3)1322..1419
Gene Synonym:
Exon (4)1420..1544
Gene Synonym:
Exon (5)1545..1664
Gene Synonym:
Exon (6)1665..1772
Gene Synonym:
Exon (7)1773..1934
Gene Synonym:
Exon (8)1935..2050
Gene Synonym:
Exon (9)2051..2187
Gene Synonym:
Exon (10)2188..3380
Gene Synonym:
Position Chain Variation Link
28 28 c, g dbSNP:527484741
48 48 a, g dbSNP:560157168
65 65 c, t dbSNP:542121150
117 117 c, t dbSNP:765685082
119 119 c, t dbSNP:529969701
147 147 c, g dbSNP:562519905
212 212 a, g dbSNP:544247720
236 236 c, t dbSNP:576919520
299 299 c, t dbSNP:559022606
309 309 a, g dbSNP:540428793
318 318 c, g dbSNP:374802206
344 344 c, t dbSNP:766217466
353 353 g, t dbSNP:113327405
354 354 a, c dbSNP:112874086
355 355 c, g dbSNP:554931078
375 375 a, g dbSNP:773201167
378 378 -, ga dbSNP:772797832
384 384 c, t dbSNP:767541765
391 391 a, g dbSNP:761850172
406 406 c, t dbSNP:571588033
418 418 c, g dbSNP:79161998
427 427 c, t dbSNP:746022747
435 435 c, t dbSNP:776845366
450 450 c, g dbSNP:556184252
492 492 c, g dbSNP:771207750
505 505 c, t dbSNP:377154166
506 506 a, g dbSNP:778156063
542 542 a, g dbSNP:758796987
568 568 a, g dbSNP:570404672
582 582 a, g dbSNP:778236228
586 586 a, g dbSNP:754529136
599 599 c, t dbSNP:753362488
602 602 c, t dbSNP:779841260
605 605 c, t dbSNP:755881439
606 606 c, t dbSNP:750213296
610 610 c, g dbSNP:767451997
620 620 c, g dbSNP:761611233
629 629 c, g dbSNP:751533117
631 631 a, g dbSNP:765166839
635 635 c, g dbSNP:759659346
640 640 a, c dbSNP:776746807
641 641 c, g dbSNP:552270496
643 643 g, t dbSNP:760923526
647 647 -, gac dbSNP:772462088
657 657 c, g dbSNP:773522021
667 667 -, agg dbSNP:748503945
667 667 a, g dbSNP:772508292
669 669 a, g dbSNP:192637923
686 686 c, g dbSNP:566641584
689 689 a, g, t dbSNP:187724945
696 696 a, t dbSNP:748786705
699 699 c, t dbSNP:779751422
701 701 a, c dbSNP:755788855
702 702 g, t dbSNP:750127451
703 703 a, g dbSNP:529933894
706 706 c, t dbSNP:781080297
707 707 a, g dbSNP:757082393
708 708 a, g dbSNP:562484803
709 709 g, t dbSNP:764076054
714 714 c, g dbSNP:762843928
715 715 c, t dbSNP:550522365
716 716 c, t dbSNP:766472975
724 724 a, g dbSNP:532376589
729 729 a, c dbSNP:773436168
733 733 a, g dbSNP:772257147
748 748 c, t dbSNP:762231724
752 752 c, g dbSNP:774630007
753 753 a, c dbSNP:769176351
758 758 c, g dbSNP:749845422
762 762 a, g dbSNP:779663196
768 768 g, t dbSNP:769446973
771 771 c, t dbSNP:745450500
772 772 c, g dbSNP:780895601
777 777 c, t dbSNP:756921162
785 785 a, c dbSNP:372930430
797 797 a, c dbSNP:777466600
814 814 c, t dbSNP:758289136
818 818 a, g dbSNP:752649797
820 820 a, c, g dbSNP:369302139
824 824 c, t dbSNP:71508856
834 834 a, g dbSNP:750566132
838 838 a, t dbSNP:374675444
845 845 c, t dbSNP:565209005
854 854 g, t dbSNP:78211353
858 858 -, g dbSNP:779450345
864 864 c, g dbSNP:774738007
886 886 c, g dbSNP:764388194
890 890 c, t dbSNP:573292248
895 895 c, g dbSNP:778210239
900 900 c, t dbSNP:770493776
901 901 g, t dbSNP:372551521
902 902 c, t dbSNP:776051206
913 913 c, t dbSNP:561511490
916 916 a, c dbSNP:58206296
917 917 a, g dbSNP:376003129
926 926 a, g dbSNP:758203217
931 931 g, t dbSNP:748011152
932 932 a, c, t dbSNP:754964359
934 934 c, t dbSNP:750486950
939 939 a, t dbSNP:372412898
945 945 -, gctgcccat dbSNP:769234632
945 945 a, g, t dbSNP:575967532
955 955 c, g dbSNP:751744722
957 957 c, g dbSNP:61734181
962 962 c, t dbSNP:763409993
965 965 c, g dbSNP:200223403
968 968 c, t dbSNP:765819603
969 969 c, g dbSNP:147268679
971 971 g, t dbSNP:376043087
972 972 c, t dbSNP:371950473
973 973 c, t dbSNP:368034918
978 978 c, g dbSNP:141286608
980 980 c, t dbSNP:771778184
988 988 c, g dbSNP:36064831
991 991 c, t dbSNP:778722047
995 995 a, g dbSNP:768542252
1000 1000 c, t dbSNP:749205417
1001 1001 c, t dbSNP:781276208
1006 1006 a, g dbSNP:757293173
1008 1008 c, t dbSNP:143107549
1009 1009 a, g dbSNP:374855241
1012 1012 a, g dbSNP:758745316
1013 1013 a, g dbSNP:753077558
1015 1015 c, t dbSNP:765725453
1020 1020 g, t dbSNP:533861933
1021 1021 a, c dbSNP:34071122
1038 1038 a, c dbSNP:753519048
1040 1040 g, t dbSNP:374690864
1042 1042 c, t dbSNP:772835287
1045 1045 a, g dbSNP:771688462
1056 1056 -, agccgc dbSNP:749826986
1060 1060 a, g dbSNP:766060428
1061 1061 c, t dbSNP:761485683
1064 1064 c, g dbSNP:547974643
1070 1070 c, t dbSNP:774085718
1071 1071 a, g dbSNP:768453555
1075 1075 c, g dbSNP:749184059
1077 1077 a, g dbSNP:779854628
1079 1079 a, t dbSNP:769831459
1081 1081 c, t dbSNP:536052945
1083 1083 c, g dbSNP:568767788
1089 1089 a, g dbSNP:758650948
1090 1090 c, t dbSNP:752987677
1093 1093 c, g, t dbSNP:755298134
1098 1098 g, t dbSNP:760298042
1111 1111 c, g dbSNP:766781844
1124 1124 a, g, t dbSNP:749897420
1128 1128 g, t dbSNP:767038608
1131 1131 c, g, t dbSNP:550485638
1132 1132 c, g dbSNP:763877519
1137 1137 c, g dbSNP:201792737
1139 1139 c, t dbSNP:775406790
1140 1140 c, t dbSNP:368053206
1142 1142 g, t dbSNP:745845949
1149 1149 a, c dbSNP:368817877
1153 1153 c, t dbSNP:546707911
1154 1154 c, t dbSNP:772286826
1162 1162 c, t dbSNP:748310442
1166 1166 a, g dbSNP:779271682
1167 1167 c, t dbSNP:528585360
1168 1168 a, g dbSNP:374720993
1174 1174 c, t dbSNP:780506826
1176 1176 a, g dbSNP:202197173
1184 1184 a, g dbSNP:750943687
1191 1191 a, g dbSNP:766948458
1205 1205 c, t dbSNP:749555123
1209 1209 a, c dbSNP:369890337
1211 1211 a, g dbSNP:780226706
1219 1219 c, t dbSNP:756506281
1223 1223 a, g dbSNP:746298415
1228 1228 c, t dbSNP:375981295
1229 1229 a, g dbSNP:138068434
1233 1233 c, t dbSNP:751040358
1238 1238 c, t dbSNP:763694461
1241 1241 a, g dbSNP:757936530
1245 1245 c, t dbSNP:752406011
1246 1246 a, g dbSNP:764869959
1257 1257 c, t dbSNP:759397125
1259 1259 c, g dbSNP:753742613
1260 1260 a, g dbSNP:199873582
1261 1261 a, c dbSNP:760732523
1263 1263 a, t dbSNP:145264797
1274 1274 c, t dbSNP:547445320
1278 1278 -, a dbSNP:750641489
1280 1280 a, g dbSNP:763020300
1291 1291 c, t dbSNP:140222295
1292 1292 a, g, t dbSNP:746212325
1310 1310 c, g dbSNP:568204894
1312 1312 a, g dbSNP:776017599
1315 1315 a, c dbSNP:771391803
1319 1319 -, aag dbSNP:781316816
1329 1329 -, c dbSNP:752443518
1329 1329 c, t dbSNP:754637179
1330 1330 a, g dbSNP:753567429
1348 1348 a, c dbSNP:779929155
1355 1355 c, g dbSNP:755969392
1357 1357 a, g dbSNP:10870199
1360 1360 c, g, t dbSNP:143258290
1361 1361 a, g dbSNP:200794870
1366 1366 c, t dbSNP:35498378
1367 1367 a, g dbSNP:201857820
1371 1371 a, g, t dbSNP:372066816
1373 1373 a, g dbSNP:761085367
1378 1378 g, t dbSNP:555308253
1382 1382 c, g, t dbSNP:151090087
1384 1384 g, t dbSNP:773949804
1391 1391 a, c dbSNP:768294500
1393 1393 c, t dbSNP:748874713
1394 1394 a, g dbSNP:368235861
1396 1396 a, g dbSNP:755772230
1399 1399 c, t dbSNP:370869769
1400 1400 c, t dbSNP:142906644
1406 1406 a, g dbSNP:780882740
1409 1409 c, t dbSNP:188488264
1421 1421 c, t dbSNP:767855660
1422 1422 a, g dbSNP:762071368
1432 1432 a, g dbSNP:752019065
1436 1436 c, t dbSNP:764667114
1437 1437 a, g, t dbSNP:775094328
1438 1438 c, t dbSNP:572650394
1450 1450 a, c, g dbSNP:374089192
1459 1459 a, g, t dbSNP:746782404
1474 1474 g, t dbSNP:777580798
1476 1476 c, t dbSNP:536052523
1480 1480 a, g dbSNP:748104868
1483 1483 a, g dbSNP:374142756
1489 1489 c, t dbSNP:148592275
1490 1490 a, g dbSNP:750574856
1492 1492 c, t dbSNP:374718674
1493 1493 a, g dbSNP:147531141
1494 1494 a, t dbSNP:751934943
1502 1502 a, g dbSNP:753085035
1506 1506 c, t dbSNP:764577370
1515 1515 g, t dbSNP:763499800
1517 1517 c, t dbSNP:121918130
1518 1518 a, g, t dbSNP:758951947
1521 1521 a, g dbSNP:200518324
1523 1523 a, g dbSNP:770456201
1531 1531 a, c dbSNP:760349095
1540 1540 c, g dbSNP:772941011
1541 1541 g, t dbSNP:771866083
1542 1542 c, g dbSNP:748011090
1543 1543 -, ggtgggcgtggctggagg dbSNP:71384081
1557 1557 c, t dbSNP:201481645
1560 1560 c, g, t dbSNP:771142015
1561 1561 a, g dbSNP:528176529
1562 1562 g, t dbSNP:778132708
1564 1564 c, g dbSNP:758738865
1571 1571 c, t dbSNP:528585797
1572 1572 a, g dbSNP:779363781
1574 1574 a, g dbSNP:140705002
1576 1576 c, t dbSNP:558778286
1577 1577 a, g dbSNP:200033750
1583 1583 c, g dbSNP:147285345
1597 1597 a, g dbSNP:749993515
1598 1598 a, g dbSNP:767126396
1599 1599 g, t dbSNP:761559591
1603 1603 c, t dbSNP:773970695
1604 1604 c, t dbSNP:372409943
1605 1605 c, t dbSNP:762734978
1606 1606 a, g dbSNP:775567331
1609 1609 c, t dbSNP:769914491
1621 1621 -, ctt dbSNP:749851382
1633 1633 c, t dbSNP:10781542
1642 1642 c, g dbSNP:773461610
1645 1645 c, t dbSNP:772376191
1648 1648 c, t dbSNP:370076159
1650 1650 a, c, t dbSNP:769067899
1651 1651 a, g dbSNP:749680652
1660 1660 c, t dbSNP:780525765
1663 1663 c, t dbSNP:375792698
1669 1669 c, t dbSNP:10870194
1684 1684 a, g dbSNP:56931633
1688 1688 c, t dbSNP:756789619
1689 1689 a, g dbSNP:121918129
1694 1694 c, g dbSNP:777463231
1695 1695 c, t dbSNP:758022536
1703 1703 a, g dbSNP:752497011
1710 1710 c, t dbSNP:201043370
1712 1712 a, g dbSNP:371811859
1716 1716 a, g dbSNP:545195109
1732 1732 c, g dbSNP:747222628
1737 1737 a, g dbSNP:368627245
1741 1741 a, g dbSNP:761938075
1744 1744 c, t dbSNP:35774078
1745 1745 a, g dbSNP:138150684
1749 1749 a, c dbSNP:763184550
1754 1754 a, c dbSNP:775772293
1761 1761 a, g dbSNP:770146958
1765 1765 c, t dbSNP:145543466
1768 1768 c, t dbSNP:777179836
1769 1769 a, g dbSNP:200837258
1773 1773 c, t dbSNP:199956627
1774 1774 a, g dbSNP:779735920
1777 1777 c, t dbSNP:756021340
1778 1778 a, g dbSNP:750331066
1787 1787 c, t dbSNP:375909217
1788 1788 a, g dbSNP:112089228
1792 1792 c, t dbSNP:377483407
1795 1795 c, t dbSNP:138552060
1801 1801 -, gt dbSNP:767066251
1808 1808 c, t dbSNP:759781033
1809 1809 c, t dbSNP:777010049
1818 1818 g, t dbSNP:766669439
1826 1826 c, t dbSNP:761179746
1827 1827 a, g dbSNP:773590570
1831 1831 a, g dbSNP:772765499
1836 1836 a, g dbSNP:761386815
1837 1837 c, t dbSNP:371729050
1838 1838 a, g dbSNP:768384414
1841 1841 a, c, g, t dbSNP:75939033
1842 1842 a, g dbSNP:367592401
1849 1849 c, t dbSNP:140255426
1850 1850 a, g dbSNP:781083748
1853 1853 a, g dbSNP:757222534
1855 1855 c, t dbSNP:375301475
1856 1856 a, g dbSNP:371375165
1863 1863 c, t dbSNP:374083402
1864 1864 a, g dbSNP:754015058
1866 1866 a, g dbSNP:766692376
1867 1867 c, t dbSNP:760936298
1872 1872 g, t dbSNP:538188644
1874 1874 c, t dbSNP:768106872
1879 1879 a, g dbSNP:138525676
1882 1882 g, t dbSNP:773939918
1885 1885 c, t dbSNP:372142221
1886 1886 a, c, g dbSNP:370876407
1890 1890 c, g dbSNP:769531967
1891 1891 a, g dbSNP:74880446
1893 1893 c, t dbSNP:370661476
1894 1894 a, g dbSNP:770801327
1895 1895 c, t dbSNP:746966122
1897 1897 a, g dbSNP:778901853
1906 1906 c, g, t dbSNP:10870188
1915 1915 c, t dbSNP:780119172
1919 1919 c, t dbSNP:374152018
1920 1920 a, g dbSNP:750777734
1925 1925 a, g dbSNP:768016672
1928 1928 a, c, t dbSNP:13297509
1929 1929 a, g dbSNP:752106876
1932 1932 a, g dbSNP:13294000
1936 1936 g, t dbSNP:201644680
1937 1937 g, t dbSNP:760443315
1945 1945 c, t dbSNP:762137331
1946 1946 a, g dbSNP:773033007
1950 1950 c, g dbSNP:771866500
1960 1960 g, t dbSNP:748139386
1962 1962 c, t dbSNP:746867724
1963 1963 a, g dbSNP:769912825
1970 1970 -, c dbSNP:747219455
1975 1975 c, t dbSNP:531628363
1976 1976 c, t dbSNP:781540345
1983 1983 c, t dbSNP:757592615
1985 1985 c, t dbSNP:747333701
1999 1999 c, t dbSNP:778220171
2000 2000 a, g dbSNP:375126841
2008 2008 c, t dbSNP:77248046
2010 2010 c, t dbSNP:370618502
2011 2011 a, g dbSNP:150464071
2014 2014 c, g, t dbSNP:753398503
2021 2021 a, g dbSNP:765986823
2026 2026 c, t dbSNP:376485593
2031 2031 a, g dbSNP:750136842
2036 2036 -, gga dbSNP:778019120
2037 2037 c, t dbSNP:75342839
2049 2049 c, t dbSNP:761578787
2050 2050 a, g dbSNP:774331779
2056 2056 a, c dbSNP:776792436
2060 2060 a, t dbSNP:376839080
2067 2067 a, g dbSNP:80111347
2071 2071 c, t dbSNP:760729838
2072 2072 c, t dbSNP:371960390
2073 2073 a, g dbSNP:121918128
2078 2078 a, g dbSNP:778536210
2082 2082 a, g dbSNP:140543689
2085 2085 a, t dbSNP:779177166
2086 2086 c, t dbSNP:368615705
2099 2099 a, g dbSNP:368296709
2100 2100 a, g dbSNP:769104210
2107 2107 c, t dbSNP:375615380
2108 2108 c, t dbSNP:749810093
2115 2115 c, g dbSNP:147967974
2116 2116 c, t dbSNP:371946549
2117 2117 a, g dbSNP:559636009
2128 2128 a, c, g dbSNP:368026621
2132 2132 a, g dbSNP:756888841
2133 2133 a, g dbSNP:751316714
2138 2138 c, t dbSNP:763992407
2139 2139 a, g dbSNP:752300607
2145 2145 -, t dbSNP:775518991
2155 2155 c, t dbSNP:143552175
2172 2172 c, g dbSNP:765327224
2173 2173 a, g dbSNP:530758804
2175 2175 c, t dbSNP:760790290
2176 2176 a, c, g dbSNP:10870182
2179 2179 g, t dbSNP:33982662
2181 2181 c, g, t dbSNP:750836133
2187 2187 a, g dbSNP:749720435
2193 2193 c, t dbSNP:746372090
2201 2201 c, g dbSNP:776136400
2203 2203 c, t dbSNP:770339939
2205 2205 a, g dbSNP:375144690
2211 2211 c, t dbSNP:777549235
2213 2213 a, g dbSNP:771894087
2215 2215 a, t dbSNP:199875003
2246 2246 c, t dbSNP:142759730
2253 2253 c, t dbSNP:754887212
2259 2259 a, c dbSNP:760420960
2260 2260 a, c, g dbSNP:148539728
2262 2262 c, t dbSNP:757272800
2264 2264 c, t dbSNP:121918127
2266 2266 a, g dbSNP:144720715
2279 2279 c, t dbSNP:764259572
2282 2282 c, g dbSNP:763184652
2304 2304 c, t dbSNP:753001340
2306 2306 g, t dbSNP:765521242
2311 2311 c, t dbSNP:201735585
2318 2318 g, t dbSNP:776988648
2323 2323 c, t dbSNP:551001538
2325 2325 g, t dbSNP:372454719
2332 2332 c, t dbSNP:369482968
2333 2333 -, gaggac dbSNP:755946289
2333 2333 a, g dbSNP:199734968
2342 2342 -, ca dbSNP:750377678
2347 2347 a, c, g dbSNP:372688482
2351 2351 a, c, t dbSNP:367781642
2352 2352 a, g dbSNP:372854854
2353 2353 c, t dbSNP:756074325
2357 2357 a, g dbSNP:374317604
2358 2358 -, t dbSNP:766931797
2362 2362 c, t dbSNP:751590391
2366 2366 c, t dbSNP:777844004
2369 2369 a, c, t dbSNP:752907539
2399 2399 g, t dbSNP:547171151
2402 2402 c, t dbSNP:528720588
2403 2403 a, g dbSNP:543729956
2418 2418 a, g dbSNP:35873563
2434 2434 c, t dbSNP:767206759
2435 2435 a, g dbSNP:763543097
2441 2441 c, g dbSNP:376716242
2447 2447 c, t dbSNP:763036675
2487 2487 c, t dbSNP:549388093
2506 2506 a, g dbSNP:531281897
2513 2513 a, g dbSNP:562334275
2533 2533 c, t dbSNP:544203657
2555 2555 a, g dbSNP:376604726
2595 2595 a, g dbSNP:184676308
2610 2610 -, tc dbSNP:761395507
2612 2612 c, g dbSNP:760676645
2622 2622 a, g dbSNP:540004766
2648 2648 a, c, g, t dbSNP:35763810
2678 2678 -, aaca dbSNP:140699240
2683 2683 c, g dbSNP:370800811
2797 2797 a, g dbSNP:142249567
2825 2825 -, g dbSNP:770566636
2839 2839 -, ag dbSNP:756634805
2870 2870 c, t dbSNP:536153618
2891 2891 c, t dbSNP:575536378
2892 2892 a, g dbSNP:545090232
2931 2931 c, t dbSNP:557035262
2932 2932 a, g dbSNP:774274698
2950 2950 a, g dbSNP:539039743
2987 2987 c, t dbSNP:749452229
2991 2991 c, t dbSNP:571744936
2998 2998 c, t dbSNP:775722685
3000 3000 a, g dbSNP:547134389
3016 3016 -, tgaaaccatctcatggtcttggtgacgtagaccatttt dbSNP:60028078
3023 3023 a, g dbSNP:1128874
3042 3042 a, g dbSNP:373479099
3043 3043 c, t dbSNP:567753155
3049 3049 a, g dbSNP:549593008
3053 3053 c, t dbSNP:531069478
3059 3059 c, g dbSNP:564010270
3067 3067 c, t dbSNP:191248562
3079 3079 c, t dbSNP:531994935
3083 3083 c, g dbSNP:564573606
3109 3109 a, g dbSNP:757763725
3110 3110 a, c, t dbSNP:147885381
3111 3111 a, g dbSNP:572933251
3131 3131 a, g dbSNP:778109117
3136 3136 a, g dbSNP:8413
3225 3225 c, t dbSNP:542809511
3231 3231 c, t dbSNP:567247143
3232 3232 a, g dbSNP:754686794
3246 3246 c, t dbSNP:1128877
3266 3266 a, g dbSNP:557235645
3339 3339 g, t dbSNP:545390204
3365 3365 c, t dbSNP:188724991

Target ORF information:

RefSeq Version NM_019892
Organism Homo sapiens (human)
Definition Homo sapiens inositol polyphosphate-5-phosphatase E (INPP5E), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu43395
Accession Version XM_005266094.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1932bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 72 kDa inositol polyphosphate 5-phosphatase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530426766. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1323..2216(+)
Misc Feature(2)1359..2189(+)
Misc Feature(3)1359..2189(+)
Misc Feature(4)1458..2186(+)
Misc Feature(5)1458..2186(+)
Misc Feature(6)1710..2189(+)
Position Chain Variation Link
12 12 c, t dbSNP:111413675
83 83 c, g dbSNP:527484741
103 103 a, g dbSNP:560157168
120 120 c, t dbSNP:542121150
172 172 c, t dbSNP:765685082
174 174 c, t dbSNP:529969701
202 202 c, g dbSNP:562519905
267 267 a, g dbSNP:544247720
291 291 c, t dbSNP:576919520
354 354 c, t dbSNP:559022606
364 364 a, g dbSNP:540428793
373 373 c, g dbSNP:374802206
399 399 c, t dbSNP:766217466
408 408 g, t dbSNP:113327405
409 409 a, c dbSNP:112874086
410 410 c, g dbSNP:554931078
430 430 a, g dbSNP:773201167
433 433 -, ga dbSNP:772797832
439 439 c, t dbSNP:767541765
446 446 a, g dbSNP:761850172
461 461 c, t dbSNP:571588033
473 473 c, g dbSNP:79161998
482 482 c, t dbSNP:746022747
490 490 c, t dbSNP:776845366
505 505 c, g dbSNP:556184252
547 547 c, g dbSNP:771207750
560 560 c, t dbSNP:377154166
561 561 a, g dbSNP:778156063
597 597 a, g dbSNP:758796987
623 623 a, g dbSNP:570404672
637 637 a, g dbSNP:778236228
641 641 a, g dbSNP:754529136
654 654 c, t dbSNP:753362488
657 657 c, t dbSNP:779841260
660 660 c, t dbSNP:755881439
661 661 c, t dbSNP:750213296
665 665 c, g dbSNP:767451997
675 675 c, g dbSNP:761611233
684 684 c, g dbSNP:751533117
686 686 a, g dbSNP:765166839
690 690 c, g dbSNP:759659346
695 695 a, c dbSNP:776746807
696 696 c, g dbSNP:552270496
698 698 g, t dbSNP:760923526
702 702 -, gac dbSNP:772462088
712 712 c, g dbSNP:773522021
722 722 -, agg dbSNP:748503945
722 722 a, g dbSNP:772508292
724 724 a, g dbSNP:192637923
741 741 c, g dbSNP:566641584
744 744 a, g, t dbSNP:187724945
751 751 a, t dbSNP:748786705
754 754 c, t dbSNP:779751422
756 756 a, c dbSNP:755788855
757 757 g, t dbSNP:750127451
758 758 a, g dbSNP:529933894
761 761 c, t dbSNP:781080297
762 762 a, g dbSNP:757082393
763 763 a, g dbSNP:562484803
764 764 g, t dbSNP:764076054
769 769 c, g dbSNP:762843928
770 770 c, t dbSNP:550522365
771 771 c, t dbSNP:766472975
779 779 a, g dbSNP:532376589
784 784 a, c dbSNP:773436168
788 788 a, g dbSNP:772257147
803 803 c, t dbSNP:762231724
807 807 c, g dbSNP:774630007
808 808 a, c dbSNP:769176351
813 813 c, g dbSNP:749845422
817 817 a, g dbSNP:779663196
823 823 g, t dbSNP:769446973
826 826 c, t dbSNP:745450500
827 827 c, g dbSNP:780895601
832 832 c, t dbSNP:756921162
840 840 a, c dbSNP:372930430
852 852 a, c dbSNP:777466600
869 869 c, t dbSNP:758289136
873 873 a, g dbSNP:752649797
875 875 a, c, g dbSNP:369302139
879 879 c, t dbSNP:71508856
889 889 a, g dbSNP:750566132
893 893 a, t dbSNP:374675444
900 900 c, t dbSNP:565209005
909 909 g, t dbSNP:78211353
913 913 -, g dbSNP:779450345
919 919 c, g dbSNP:774738007
941 941 c, g dbSNP:764388194
945 945 c, t dbSNP:573292248
950 950 c, g dbSNP:778210239
955 955 c, t dbSNP:770493776
956 956 g, t dbSNP:372551521
957 957 c, t dbSNP:776051206
968 968 c, t dbSNP:561511490
971 971 a, c dbSNP:58206296
972 972 a, g dbSNP:376003129
981 981 a, g dbSNP:758203217
986 986 g, t dbSNP:748011152
987 987 a, c, t dbSNP:754964359
989 989 c, t dbSNP:750486950
994 994 a, t dbSNP:372412898
1000 1000 -, gctgcccat dbSNP:769234632
1000 1000 a, g, t dbSNP:575967532
1010 1010 c, g dbSNP:751744722
1012 1012 c, g dbSNP:61734181
1017 1017 c, t dbSNP:763409993
1020 1020 c, g dbSNP:200223403
1023 1023 c, t dbSNP:765819603
1024 1024 c, g dbSNP:147268679
1026 1026 g, t dbSNP:376043087
1027 1027 c, t dbSNP:371950473
1028 1028 c, t dbSNP:368034918
1033 1033 c, g dbSNP:141286608
1035 1035 c, t dbSNP:771778184
1043 1043 c, g dbSNP:36064831
1046 1046 c, t dbSNP:778722047
1050 1050 a, g dbSNP:768542252
1055 1055 c, t dbSNP:749205417
1056 1056 c, t dbSNP:781276208
1061 1061 a, g dbSNP:757293173
1063 1063 c, t dbSNP:143107549
1064 1064 a, g dbSNP:374855241
1067 1067 a, g dbSNP:758745316
1068 1068 a, g dbSNP:753077558
1070 1070 c, t dbSNP:765725453
1075 1075 g, t dbSNP:533861933
1076 1076 a, c dbSNP:34071122
1093 1093 a, c dbSNP:753519048
1095 1095 g, t dbSNP:374690864
1097 1097 c, t dbSNP:772835287
1100 1100 a, g dbSNP:771688462
1111 1111 -, agccgc dbSNP:749826986
1115 1115 a, g dbSNP:766060428
1116 1116 c, t dbSNP:761485683
1119 1119 c, g dbSNP:547974643
1125 1125 c, t dbSNP:774085718
1126 1126 a, g dbSNP:768453555
1130 1130 c, g dbSNP:749184059
1132 1132 a, g dbSNP:779854628
1134 1134 a, t dbSNP:769831459
1136 1136 c, t dbSNP:536052945
1138 1138 c, g dbSNP:568767788
1144 1144 a, g dbSNP:758650948
1145 1145 c, t dbSNP:752987677
1148 1148 c, g, t dbSNP:755298134
1153 1153 g, t dbSNP:760298042
1166 1166 c, g dbSNP:766781844
1179 1179 a, g, t dbSNP:749897420
1183 1183 g, t dbSNP:767038608
1186 1186 c, g, t dbSNP:550485638
1187 1187 c, g dbSNP:763877519
1192 1192 c, g dbSNP:201792737
1194 1194 c, t dbSNP:775406790
1195 1195 c, t dbSNP:368053206
1197 1197 g, t dbSNP:745845949
1204 1204 a, c dbSNP:368817877
1208 1208 c, t dbSNP:546707911
1209 1209 c, t dbSNP:772286826
1217 1217 c, t dbSNP:748310442
1221 1221 a, g dbSNP:779271682
1222 1222 c, t dbSNP:528585360
1223 1223 a, g dbSNP:374720993
1229 1229 c, t dbSNP:780506826
1231 1231 a, g dbSNP:202197173
1239 1239 a, g dbSNP:750943687
1246 1246 a, g dbSNP:766948458
1260 1260 c, t dbSNP:749555123
1264 1264 a, c dbSNP:369890337
1266 1266 a, g dbSNP:780226706
1274 1274 c, t dbSNP:756506281
1278 1278 a, g dbSNP:746298415
1283 1283 c, t dbSNP:375981295
1284 1284 a, g dbSNP:138068434
1288 1288 c, t dbSNP:751040358
1293 1293 c, t dbSNP:763694461
1296 1296 a, g dbSNP:757936530
1300 1300 c, t dbSNP:752406011
1301 1301 a, g dbSNP:764869959
1312 1312 c, t dbSNP:759397125
1314 1314 c, g dbSNP:753742613
1315 1315 a, g dbSNP:199873582
1316 1316 a, c dbSNP:760732523
1318 1318 a, t dbSNP:145264797
1329 1329 c, t dbSNP:547445320
1333 1333 -, a dbSNP:750641489
1335 1335 a, g dbSNP:763020300
1346 1346 c, t dbSNP:140222295
1347 1347 a, g, t dbSNP:746212325
1365 1365 c, g dbSNP:568204894
1367 1367 a, g dbSNP:776017599
1370 1370 a, c dbSNP:771391803
1374 1374 -, aag dbSNP:781316816
1384 1384 -, c dbSNP:752443518
1384 1384 c, t dbSNP:754637179
1385 1385 a, g dbSNP:753567429
1403 1403 a, c dbSNP:779929155
1410 1410 c, g dbSNP:755969392
1412 1412 a, g dbSNP:10870199
1415 1415 c, g, t dbSNP:143258290
1416 1416 a, g dbSNP:200794870
1421 1421 c, t dbSNP:35498378
1422 1422 a, g dbSNP:201857820
1426 1426 a, g, t dbSNP:372066816
1428 1428 a, g dbSNP:761085367
1433 1433 g, t dbSNP:555308253
1437 1437 c, g, t dbSNP:151090087
1439 1439 g, t dbSNP:773949804
1446 1446 a, c dbSNP:768294500
1448 1448 c, t dbSNP:748874713
1449 1449 a, g dbSNP:368235861
1451 1451 a, g dbSNP:755772230
1454 1454 c, t dbSNP:370869769
1455 1455 c, t dbSNP:142906644
1461 1461 a, g dbSNP:780882740
1464 1464 c, t dbSNP:188488264
1476 1476 c, t dbSNP:767855660
1477 1477 a, g dbSNP:762071368
1487 1487 a, g dbSNP:752019065
1491 1491 c, t dbSNP:764667114
1492 1492 a, g, t dbSNP:775094328
1493 1493 c, t dbSNP:572650394
1505 1505 a, c, g dbSNP:374089192
1514 1514 a, g, t dbSNP:746782404
1529 1529 g, t dbSNP:777580798
1531 1531 c, t dbSNP:536052523
1535 1535 a, g dbSNP:748104868
1538 1538 a, g dbSNP:374142756
1544 1544 c, t dbSNP:148592275
1545 1545 a, g dbSNP:750574856
1547 1547 c, t dbSNP:374718674
1548 1548 a, g dbSNP:147531141
1549 1549 a, t dbSNP:751934943
1557 1557 a, g dbSNP:753085035
1561 1561 c, t dbSNP:764577370
1570 1570 g, t dbSNP:763499800
1572 1572 c, t dbSNP:121918130
1573 1573 a, g, t dbSNP:758951947
1576 1576 a, g dbSNP:200518324
1578 1578 a, g dbSNP:770456201
1586 1586 a, c dbSNP:760349095
1595 1595 c, g dbSNP:772941011
1596 1596 g, t dbSNP:771866083
1597 1597 c, g dbSNP:748011090
1598 1598 -, ggtgggcgtggctggagg dbSNP:71384081
1612 1612 c, t dbSNP:201481645
1615 1615 c, g, t dbSNP:771142015
1616 1616 a, g dbSNP:528176529
1617 1617 g, t dbSNP:778132708
1619 1619 c, g dbSNP:758738865
1626 1626 c, t dbSNP:528585797
1627 1627 a, g dbSNP:779363781
1629 1629 a, g dbSNP:140705002
1631 1631 c, t dbSNP:558778286
1632 1632 a, g dbSNP:200033750
1638 1638 c, g dbSNP:147285345
1652 1652 a, g dbSNP:749993515
1653 1653 a, g dbSNP:767126396
1654 1654 g, t dbSNP:761559591
1658 1658 c, t dbSNP:773970695
1659 1659 c, t dbSNP:372409943
1660 1660 c, t dbSNP:762734978
1661 1661 a, g dbSNP:775567331
1664 1664 c, t dbSNP:769914491
1676 1676 -, ctt dbSNP:749851382
1688 1688 c, t dbSNP:10781542
1697 1697 c, g dbSNP:773461610
1700 1700 c, t dbSNP:772376191
1703 1703 c, t dbSNP:370076159
1705 1705 a, c, t dbSNP:769067899
1706 1706 a, g dbSNP:749680652
1715 1715 c, t dbSNP:780525765
1718 1718 c, t dbSNP:375792698
1721 1721 c, t dbSNP:10870194
1736 1736 a, g dbSNP:56931633
1740 1740 c, t dbSNP:756789619
1741 1741 a, g dbSNP:121918129
1746 1746 c, g dbSNP:777463231
1747 1747 c, t dbSNP:758022536
1755 1755 a, g dbSNP:752497011
1762 1762 c, t dbSNP:201043370
1764 1764 a, g dbSNP:371811859
1768 1768 a, g dbSNP:545195109
1784 1784 c, g dbSNP:747222628
1789 1789 a, g dbSNP:368627245
1793 1793 a, g dbSNP:761938075
1796 1796 c, t dbSNP:35774078
1797 1797 a, g dbSNP:138150684
1801 1801 a, c dbSNP:763184550
1806 1806 a, c dbSNP:775772293
1813 1813 a, g dbSNP:770146958
1817 1817 c, t dbSNP:145543466
1820 1820 c, t dbSNP:777179836
1821 1821 a, g dbSNP:200837258
1825 1825 c, t dbSNP:199956627
1826 1826 a, g dbSNP:779735920
1829 1829 c, t dbSNP:756021340
1830 1830 a, g dbSNP:750331066
1839 1839 c, t dbSNP:375909217
1840 1840 a, g dbSNP:112089228
1844 1844 c, t dbSNP:377483407
1847 1847 c, t dbSNP:138552060
1853 1853 -, gt dbSNP:767066251
1860 1860 c, t dbSNP:759781033
1861 1861 c, t dbSNP:777010049
1870 1870 g, t dbSNP:766669439
1878 1878 c, t dbSNP:761179746
1879 1879 a, g dbSNP:773590570
1883 1883 a, g dbSNP:772765499
1888 1888 a, g dbSNP:761386815
1889 1889 c, t dbSNP:371729050
1890 1890 a, g dbSNP:768384414
1893 1893 a, c, g, t dbSNP:75939033
1894 1894 a, g dbSNP:367592401
1901 1901 c, t dbSNP:140255426
1902 1902 a, g dbSNP:781083748
1905 1905 a, g dbSNP:757222534
1907 1907 c, t dbSNP:375301475
1908 1908 a, g dbSNP:371375165
1915 1915 c, t dbSNP:374083402
1916 1916 a, g dbSNP:754015058
1918 1918 a, g dbSNP:766692376
1919 1919 c, t dbSNP:760936298
1924 1924 g, t dbSNP:538188644
1926 1926 c, t dbSNP:768106872
1931 1931 a, g dbSNP:138525676
1934 1934 g, t dbSNP:773939918
1937 1937 c, t dbSNP:372142221
1938 1938 a, c, g dbSNP:370876407
1942 1942 c, g dbSNP:769531967
1943 1943 a, g dbSNP:74880446
1945 1945 c, t dbSNP:370661476
1946 1946 a, g dbSNP:770801327
1947 1947 c, t dbSNP:746966122
1949 1949 a, g dbSNP:778901853
1958 1958 c, g, t dbSNP:10870188
1967 1967 c, t dbSNP:780119172
1971 1971 c, t dbSNP:374152018
1972 1972 a, g dbSNP:750777734
1977 1977 a, g dbSNP:768016672
1980 1980 a, c, t dbSNP:13297509
1981 1981 a, g dbSNP:752106876
1984 1984 a, g dbSNP:13294000
1988 1988 g, t dbSNP:201644680
1989 1989 g, t dbSNP:760443315
1997 1997 c, t dbSNP:762137331
1998 1998 a, g dbSNP:773033007
2002 2002 c, g dbSNP:771866500
2012 2012 g, t dbSNP:748139386
2014 2014 c, t dbSNP:746867724
2015 2015 a, g dbSNP:769912825
2022 2022 -, c dbSNP:747219455
2027 2027 c, t dbSNP:531628363
2028 2028 c, t dbSNP:781540345
2035 2035 c, t dbSNP:757592615
2037 2037 c, t dbSNP:747333701
2051 2051 c, t dbSNP:778220171
2052 2052 a, g dbSNP:375126841
2060 2060 c, t dbSNP:77248046
2062 2062 c, t dbSNP:370618502
2063 2063 a, g dbSNP:150464071
2066 2066 c, g, t dbSNP:753398503
2073 2073 a, g dbSNP:765986823
2078 2078 c, t dbSNP:376485593
2083 2083 a, g dbSNP:750136842
2088 2088 -, gga dbSNP:778019120
2089 2089 c, t dbSNP:75342839
2101 2101 c, t dbSNP:761578787
2102 2102 a, g dbSNP:774331779
2108 2108 a, c dbSNP:776792436
2112 2112 a, t dbSNP:376839080
2119 2119 a, g dbSNP:80111347
2123 2123 c, t dbSNP:760729838
2124 2124 c, t dbSNP:371960390
2125 2125 a, g dbSNP:121918128
2130 2130 a, g dbSNP:778536210
2134 2134 a, g dbSNP:140543689
2137 2137 a, t dbSNP:779177166
2138 2138 c, t dbSNP:368615705
2151 2151 a, g dbSNP:368296709
2152 2152 a, g dbSNP:769104210
2159 2159 c, t dbSNP:375615380
2160 2160 c, t dbSNP:749810093
2167 2167 c, g dbSNP:147967974
2168 2168 c, t dbSNP:371946549
2169 2169 a, g dbSNP:559636009
2180 2180 a, c, g dbSNP:368026621
2184 2184 a, g dbSNP:756888841
2185 2185 a, g dbSNP:751316714
2190 2190 c, t dbSNP:763992407
2191 2191 a, g dbSNP:752300607
2197 2197 -, t dbSNP:775518991
2207 2207 c, t dbSNP:143552175
2224 2224 c, g dbSNP:765327224
2225 2225 a, g dbSNP:530758804
2227 2227 c, t dbSNP:760790290
2228 2228 a, c, g dbSNP:10870182
2231 2231 g, t dbSNP:33982662
2233 2233 c, g, t dbSNP:750836133
2239 2239 a, g dbSNP:749720435
2245 2245 c, t dbSNP:746372090
2253 2253 c, g dbSNP:776136400
2255 2255 c, t dbSNP:770339939
2257 2257 a, g dbSNP:375144690
2263 2263 c, t dbSNP:777549235
2265 2265 a, g dbSNP:771894087
2267 2267 a, t dbSNP:199875003
2298 2298 c, t dbSNP:142759730
2305 2305 c, t dbSNP:754887212
2311 2311 a, c dbSNP:760420960
2312 2312 a, c, g dbSNP:148539728
2314 2314 c, t dbSNP:757272800
2316 2316 c, t dbSNP:121918127
2318 2318 a, g dbSNP:144720715
2331 2331 c, t dbSNP:764259572
2334 2334 c, g dbSNP:763184652
2356 2356 c, t dbSNP:753001340
2358 2358 g, t dbSNP:765521242
2363 2363 c, t dbSNP:201735585
2370 2370 g, t dbSNP:776988648
2375 2375 c, t dbSNP:551001538
2377 2377 g, t dbSNP:372454719
2384 2384 c, t dbSNP:369482968
2385 2385 -, gaggac dbSNP:755946289
2385 2385 a, g dbSNP:199734968
2394 2394 -, ca dbSNP:750377678
2399 2399 a, c, g dbSNP:372688482
2403 2403 a, c, t dbSNP:367781642
2404 2404 a, g dbSNP:372854854
2405 2405 c, t dbSNP:756074325
2409 2409 a, g dbSNP:374317604
2410 2410 -, t dbSNP:766931797
2414 2414 c, t dbSNP:751590391
2418 2418 c, t dbSNP:777844004
2421 2421 a, c, t dbSNP:752907539
2451 2451 g, t dbSNP:547171151
2454 2454 c, t dbSNP:528720588
2455 2455 a, g dbSNP:543729956
2470 2470 a, g dbSNP:35873563
2486 2486 c, t dbSNP:767206759
2487 2487 a, g dbSNP:763543097
2493 2493 c, g dbSNP:376716242
2499 2499 c, t dbSNP:763036675
2539 2539 c, t dbSNP:549388093
2558 2558 a, g dbSNP:531281897
2565 2565 a, g dbSNP:562334275
2585 2585 c, t dbSNP:544203657
2607 2607 a, g dbSNP:376604726
2647 2647 a, g dbSNP:184676308
2662 2662 -, tc dbSNP:761395507
2664 2664 c, g dbSNP:760676645
2674 2674 a, g dbSNP:540004766
2700 2700 a, c, g, t dbSNP:35763810
2730 2730 -, aaca dbSNP:140699240
2735 2735 c, g dbSNP:370800811
2849 2849 a, g dbSNP:142249567
2877 2877 -, g dbSNP:770566636
2891 2891 -, ag dbSNP:756634805
2922 2922 c, t dbSNP:536153618
2943 2943 c, t dbSNP:575536378
2944 2944 a, g dbSNP:545090232
2983 2983 c, t dbSNP:557035262
2984 2984 a, g dbSNP:774274698
3002 3002 a, g dbSNP:539039743
3039 3039 c, t dbSNP:749452229
3043 3043 c, t dbSNP:571744936
3050 3050 c, t dbSNP:775722685
3052 3052 a, g dbSNP:547134389
3068 3068 -, tgaaaccatctcatggtcttggtgacgtagaccatttt dbSNP:60028078
3075 3075 a, g dbSNP:1128874
3094 3094 a, g dbSNP:373479099
3095 3095 c, t dbSNP:567753155
3101 3101 a, g dbSNP:549593008
3105 3105 c, t dbSNP:531069478
3111 3111 c, g dbSNP:564010270
3119 3119 c, t dbSNP:191248562
3131 3131 c, t dbSNP:531994935
3135 3135 c, g dbSNP:564573606
3161 3161 a, g dbSNP:757763725
3162 3162 a, c, t dbSNP:147885381
3163 3163 a, g dbSNP:572933251
3183 3183 a, g dbSNP:778109117
3188 3188 a, g dbSNP:8413
3277 3277 c, t dbSNP:542809511
3283 3283 c, t dbSNP:567247143
3284 3284 a, g dbSNP:754686794
3298 3298 c, t dbSNP:1128877
3318 3318 a, g dbSNP:557235645
3391 3391 g, t dbSNP:545390204
3417 3417 c, t dbSNP:188724991

Target ORF information:

RefSeq Version XM_005266094
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


A homozygous PDE6D mutation in Joubert syndrome impairs targeting of farnesylated INPP5E protein to the primary cilium
Hum. Mutat. 35 (1), 137-146 (2014)
Thomas,S., Wright,K.J., Le Corre,S., Micalizzi,A., Romani,M., Abhyankar,A., Saada,J., Perrault,I., Amiel,J., Litzler,J., Filhol,E., Elkhartoufi,N., Kwong,M., Casanova,J.L., Boddaert,N., Baehr,W., Lyonnet,S., Munnich,A., Burglen,L., Chassaing,N., Encha-Ravazi,F., Vekemans,M., Gleeson,J.G., Valente,E.M., Jackson,P.K., Drummond,I.A., Saunier,S. and Attie-Bitach,T.


Phenotypic spectrum and prevalence of INPP5E mutations in Joubert syndrome and related disorders
Eur. J. Hum. Genet. 21 (10), 1074-1078 (2013)
Travaglini L, Brancati F, Silhavy J, Iannicelli M, Nickerson E, Elkhartoufi N, Scott E, Spencer E, Gabriel S, Thomas S, Ben-Zeev B, Bertini E, Boltshauser E, Chaouch M, Cilio MR, de Jong MM, Kayserili H, Ogur G, Poretti A, Signorini S, Uziel G, Zaki MS, Johnson C, Attie-Bitach T, Gleeson JG and Valente EM.


ARL13B, PDE6D, and CEP164 form a functional network for INPP5E ciliary targeting
Proc. Natl. Acad. Sci. U.S.A. 109 (48), 19691-19696 (2012)
Humbert MC, Weihbrecht K, Searby CC, Li Y, Pope RM, Sheffield VC and Seo S.


Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease
Nature 491 (7422), 119-124 (2012)
Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K, Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z, Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN, Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A, Boucher G, Brand S, Buning C, Cohain A, Cichon S, D'Amato M, De Jong D, Devaney KL, Dubinsky M, Edwards C, Ellinghaus D, Ferguson LR, Franchimont D, Fransen K, Gearry R, Georges M, Gieger C, Glas J, Haritunians T, Hart A, Hawkey C, Hedl M, Hu X, Karlsen TH, Kupcinskas L, Kugathasan S, Latiano A, Laukens D, Lawrance IC, Lees CW, Louis E, Mahy G, Mansfield J, Morgan AR, Mowat C, Newman W, Palmieri O, Ponsioen CY, Potocnik U, Prescott NJ, Regueiro M, Rotter JI, Russell RK, Sanderson JD, Sans M, Satsangi J, Schreiber S, Simms LA, Sventoraityte J, Targan SR, Taylor KD, Tremelling M, Verspaget HW, De Vos M, Wijmenga C, Wilson DC, Winkelmann J, Xavier RJ, Zeissig S, Zhang B, Zhang CK, Zhao H, Silverberg MS, Annese V, Hakonarson H, Brant SR, Radford-Smith G, Mathew CG, Rioux JD, Schadt EE, Daly MJ, Franke A, Parkes M, Vermeire S, Barrett JC and Cho JH.


Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization
Curr. Biol. 14 (16), 1436-1450 (2004)
Jin J, Smith FD, Stark C, Wells CD, Fawcett JP, Kulkarni S, Metalnikov P, O'Donnell P, Taylor P, Taylor L, Zougman A, Woodgett JR, Langeberg LK, Scott JD and Pawson T.


Cloning and characterization of a 72-kDa inositol-polyphosphate 5-phosphatase localized to the Golgi network
J. Biol. Chem. 275 (31), 24052-24064 (2000)
Kong AM, Speed CJ, O'Malley CJ, Layton MJ, Meehan T, Loveland KL, Cheema S, Ooms LM and Mitchell CA.


The isolation and characterization of a cDNA encoding phospholipid-specific inositol polyphosphate 5-phosphatase
J. Biol. Chem. 275 (26), 20110-20116 (2000)
Kisseleva MV, Wilson MP and Majerus PW.


Homozygosity mapping in families with Joubert syndrome identifies a locus on chromosome 9q34.3 and evidence for genetic heterogeneity
Am. J. Hum. Genet. 65 (6), 1666-1671 (1999)
Saar K, Al-Gazali L, Sztriha L, Rueschendorf F, Nur-E-Kamal M, Reis A and Bayoumi R.


Congenital Hepatic Fibrosis Overview
(in) Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Gunay-Aygun,M., Gahl,W.A. and Heller,T.


Joubert Syndrome and Related Disorders
(in) Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Parisi,M. and Glass,I.
