Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

INPP5E inositol polyphosphate-5-phosphatase E [Homo sapiens (human)]

Gene Symbol INPP5E
Entrez Gene ID 56623
Full Name inositol polyphosphate-5-phosphatase E
General protein information
Preferred Names
72 kDa inositol polyphosphate 5-phosphatase
72 kDa inositol polyphosphate 5-phosphatase
phosphatidylinositol 4,5-bisphosphate 5-phosphatase
phosphatidylinositol-4,5-bisphosphate 5-phosphatase
phosphatidylinositol (4,5) bisphosphate 5-phosphatase
phosphatidylinositol polyphosphate 5-phosphatase type IV
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly.[provided by RefSeq, Feb 2011]. lac of sum
Disorder MIM:


Disorder Html: Mental retardation, truncal obesity, retinal dystrophy, and
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu27383 NM_019892 Homo sapiens inositol polyphosphate-5-phosphatase E (INPP5E), mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00
OHu43395 XM_005266094 PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu27383D
Sequence Information ORF Nucleotide Sequence (Length: 1935bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 23-AUG-2015
Organism Homo sapiens (human)
Product 72 kDa inositol polyphosphate 5-phosphatase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC028032.1 and BE044535.1. This sequence is a reference standard in the RefSeqGene project. On Mar 25, 2011 this sequence version replaced gi:47078290. Summary: The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly.[provided by RefSeq, Feb 2011]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC028032.1, AF187891.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)329..331(+)
Misc Feature(2)413..1111(+)
Misc Feature(3)680..682(+)
Misc Feature(4)680..682(+)
Misc Feature(5)1268..2164(+)
Misc Feature(6)1304..2137(+)
Misc Feature(7)1304..2137(+)
Misc Feature(8)1403..2134(+)
Misc Feature(9)1403..2134(+)
Misc Feature(10)1655..2137(+)
Misc Feature(11)2306..2308(+)
Exon (1)1..1197
Gene Synonym:
Exon (2)1198..1321
Gene Synonym:
Exon (3)1322..1419
Gene Synonym:
Exon (4)1420..1544
Gene Synonym:
Exon (5)1545..1664
Gene Synonym:
Exon (6)1665..1772
Gene Synonym:
Exon (7)1773..1934
Gene Synonym:
Exon (8)1935..2050
Gene Synonym:
Exon (9)2051..2187
Gene Synonym:
Exon (10)2188..3380
Gene Synonym:
Position Chain Variation Link
28 28 c, g dbSNP:527484741
48 48 a, g dbSNP:560157168
65 65 c, t dbSNP:542121150
117 117 c, t dbSNP:765685082
119 119 c, t dbSNP:529969701
147 147 c, g dbSNP:562519905
212 212 a, g dbSNP:544247720
236 236 c, t dbSNP:576919520
299 299 c, t dbSNP:559022606
309 309 a, g dbSNP:540428793
318 318 c, g dbSNP:374802206
344 344 c, t dbSNP:766217466
353 353 g, t dbSNP:113327405
354 354 a, c dbSNP:112874086
355 355 c, g dbSNP:554931078
375 375 a, g dbSNP:773201167
378 378 -, ga dbSNP:772797832
384 384 c, t dbSNP:767541765
391 391 a, g dbSNP:761850172
406 406 c, t dbSNP:571588033
418 418 c, g dbSNP:79161998
427 427 c, t dbSNP:746022747
435 435 c, t dbSNP:776845366
450 450 c, g dbSNP:556184252
492 492 c, g dbSNP:771207750
505 505 c, t dbSNP:377154166
506 506 a, g dbSNP:778156063
542 542 a, g dbSNP:758796987
568 568 a, g dbSNP:570404672
582 582 a, g dbSNP:778236228
586 586 a, g dbSNP:754529136
599 599 c, t dbSNP:753362488
602 602 c, t dbSNP:779841260
605 605 c, t dbSNP:755881439
606 606 c, t dbSNP:750213296
610 610 c, g dbSNP:767451997
620 620 c, g dbSNP:761611233
629 629 c, g dbSNP:751533117
631 631 a, g dbSNP:765166839
635 635 c, g dbSNP:759659346
640 640 a, c dbSNP:776746807
641 641 c, g dbSNP:552270496
643 643 g, t dbSNP:760923526
647 647 -, gac dbSNP:772462088
657 657 c, g dbSNP:773522021
667 667 -, agg dbSNP:748503945
667 667 a, g dbSNP:772508292
669 669 a, g dbSNP:192637923
686 686 c, g dbSNP:566641584
689 689 a, g, t dbSNP:187724945
696 696 a, t dbSNP:748786705
699 699 c, t dbSNP:779751422
701 701 a, c dbSNP:755788855
702 702 g, t dbSNP:750127451
703 703 a, g dbSNP:529933894
706 706 c, t dbSNP:781080297
707 707 a, g dbSNP:757082393
708 708 a, g dbSNP:562484803
709 709 g, t dbSNP:764076054
714 714 c, g dbSNP:762843928
715 715 c, t dbSNP:550522365
716 716 c, t dbSNP:766472975
724 724 a, g dbSNP:532376589
729 729 a, c dbSNP:773436168
733 733 a, g dbSNP:772257147
748 748 c, t dbSNP:762231724
752 752 c, g dbSNP:774630007
753 753 a, c dbSNP:769176351
758 758 c, g dbSNP:749845422
762 762 a, g dbSNP:779663196
768 768 g, t dbSNP:769446973
771 771 c, t dbSNP:745450500
772 772 c, g dbSNP:780895601
777 777 c, t dbSNP:756921162
785 785 a, c dbSNP:372930430
797 797 a, c dbSNP:777466600
814 814 c, t dbSNP:758289136
818 818 a, g dbSNP:752649797
820 820 a, c, g dbSNP:369302139
824 824 c, t dbSNP:71508856
834 834 a, g dbSNP:750566132
838 838 a, t dbSNP:374675444
845 845 c, t dbSNP:565209005
854 854 g, t dbSNP:78211353
858 858 -, g dbSNP:779450345
864 864 c, g dbSNP:774738007
886 886 c, g dbSNP:764388194
890 890 c, t dbSNP:573292248
895 895 c, g dbSNP:778210239
900 900 c, t dbSNP:770493776
901 901 g, t dbSNP:372551521
902 902 c, t dbSNP:776051206
913 913 c, t dbSNP:561511490
916 916 a, c dbSNP:58206296
917 917 a, g dbSNP:376003129
926 926 a, g dbSNP:758203217
931 931 g, t dbSNP:748011152
932 932 a, c, t dbSNP:754964359
934 934 c, t dbSNP:750486950
939 939 a, t dbSNP:372412898
945 945 -, gctgcccat dbSNP:769234632
945 945 a, g, t dbSNP:575967532
955 955 c, g dbSNP:751744722
957 957 c, g dbSNP:61734181
962 962 c, t dbSNP:763409993
965 965 c, g dbSNP:200223403
968 968 c, t dbSNP:765819603
969 969 c, g dbSNP:147268679
971 971 g, t dbSNP:376043087
972 972 c, t dbSNP:371950473
973 973 c, t dbSNP:368034918
978 978 c, g dbSNP:141286608
980 980 c, t dbSNP:771778184
988 988 c, g dbSNP:36064831
991 991 c, t dbSNP:778722047
995 995 a, g dbSNP:768542252
1000 1000 c, t dbSNP:749205417
1001 1001 c, t dbSNP:781276208
1006 1006 a, g dbSNP:757293173
1008 1008 c, t dbSNP:143107549
1009 1009 a, g dbSNP:374855241
1012 1012 a, g dbSNP:758745316
1013 1013 a, g dbSNP:753077558
1015 1015 c, t dbSNP:765725453
1020 1020 g, t dbSNP:533861933
1021 1021 a, c dbSNP:34071122
1038 1038 a, c dbSNP:753519048
1040 1040 g, t dbSNP:374690864
1042 1042 c, t dbSNP:772835287
1045 1045 a, g dbSNP:771688462
1056 1056 -, agccgc dbSNP:749826986
1060 1060 a, g dbSNP:766060428
1061 1061 c, t dbSNP:761485683
1064 1064 c, g dbSNP:547974643
1070 1070 c, t dbSNP:774085718
1071 1071 a, g dbSNP:768453555
1075 1075 c, g dbSNP:749184059
1077 1077 a, g dbSNP:779854628
1079 1079 a, t dbSNP:769831459
1081 1081 c, t dbSNP:536052945
1083 1083 c, g dbSNP:568767788
1089 1089 a, g dbSNP:758650948
1090 1090 c, t dbSNP:752987677
1093 1093 c, g, t dbSNP:755298134
1098 1098 g, t dbSNP:760298042
1111 1111 c, g dbSNP:766781844
1124 1124 a, g, t dbSNP:749897420
1128 1128 g, t dbSNP:767038608
1131 1131 c, g, t dbSNP:550485638
1132 1132 c, g dbSNP:763877519
1137 1137 c, g dbSNP:201792737
1139 1139 c, t dbSNP:775406790
1140 1140 c, t dbSNP:368053206
1142 1142 g, t dbSNP:745845949
1149 1149 a, c dbSNP:368817877
1153 1153 c, t dbSNP:546707911
1154 1154 c, t dbSNP:772286826
1162 1162 c, t dbSNP:748310442
1166 1166 a, g dbSNP:779271682
1167 1167 c, t dbSNP:528585360
1168 1168 a, g dbSNP:374720993
1174 1174 c, t dbSNP:780506826
1176 1176 a, g dbSNP:202197173
1184 1184 a, g dbSNP:750943687
1191 1191 a, g dbSNP:766948458
1205 1205 c, t dbSNP:749555123
1209 1209 a, c dbSNP:369890337
1211 1211 a, g dbSNP:780226706
1219 1219 c, t dbSNP:756506281
1223 1223 a, g dbSNP:746298415
1228 1228 c, t dbSNP:375981295
1229 1229 a, g dbSNP:138068434
1233 1233 c, t dbSNP:751040358
1238 1238 c, t dbSNP:763694461
1241 1241 a, g dbSNP:757936530
1245 1245 c, t dbSNP:752406011
1246 1246 a, g dbSNP:764869959
1257 1257 c, t dbSNP:759397125
1259 1259 c, g dbSNP:753742613
1260 1260 a, g dbSNP:199873582
1261 1261 a, c dbSNP:760732523
1263 1263 a, t dbSNP:145264797
1274 1274 c, t dbSNP:547445320
1278 1278 -, a dbSNP:750641489
1280 1280 a, g dbSNP:763020300
1291 1291 c, t dbSNP:140222295
1292 1292 a, g, t dbSNP:746212325
1310 1310 c, g dbSNP:568204894
1312 1312 a, g dbSNP:776017599
1315 1315 a, c dbSNP:771391803
1319 1319 -, aag dbSNP:781316816
1329 1329 -, c dbSNP:752443518
1329 1329 c, t dbSNP:754637179
1330 1330 a, g dbSNP:753567429
1348 1348 a, c dbSNP:779929155
1355 1355 c, g dbSNP:755969392
1357 1357 a, g dbSNP:10870199
1360 1360 c, g, t dbSNP:143258290
1361 1361 a, g dbSNP:200794870
1366 1366 c, t dbSNP:35498378
1367 1367 a, g dbSNP:201857820
1371 1371 a, g, t dbSNP:372066816
1373 1373 a, g dbSNP:761085367
1378 1378 g, t dbSNP:555308253
1382 1382 c, g, t dbSNP:151090087
1384 1384 g, t dbSNP:773949804
1391 1391 a, c dbSNP:768294500
1393 1393 c, t dbSNP:748874713
1394 1394 a, g dbSNP:368235861
1396 1396 a, g dbSNP:755772230
1399 1399 c, t dbSNP:370869769
1400 1400 c, t dbSNP:142906644
1406 1406 a, g dbSNP:780882740
1409 1409 c, t dbSNP:188488264
1421 1421 c, t dbSNP:767855660
1422 1422 a, g dbSNP:762071368
1432 1432 a, g dbSNP:752019065
1436 1436 c, t dbSNP:764667114
1437 1437 a, g, t dbSNP:775094328
1438 1438 c, t dbSNP:572650394
1450 1450 a, c, g dbSNP:374089192
1459 1459 a, g, t dbSNP:746782404
1474 1474 g, t dbSNP:777580798
1476 1476 c, t dbSNP:536052523
1480 1480 a, g dbSNP:748104868
1483 1483 a, g dbSNP:374142756
1489 1489 c, t dbSNP:148592275
1490 1490 a, g dbSNP:750574856
1492 1492 c, t dbSNP:374718674
1493 1493 a, g dbSNP:147531141
1494 1494 a, t dbSNP:751934943
1502 1502 a, g dbSNP:753085035
1506 1506 c, t dbSNP:764577370
1515 1515 g, t dbSNP:763499800
1517 1517 c, t dbSNP:121918130
1518 1518 a, g, t dbSNP:758951947
1521 1521 a, g dbSNP:200518324
1523 1523 a, g dbSNP:770456201
1531 1531 a, c dbSNP:760349095
1540 1540 c, g dbSNP:772941011
1541 1541 g, t dbSNP:771866083
1542 1542 c, g dbSNP:748011090
1543 1543 -, ggtgggcgtggctggagg dbSNP:71384081
1557 1557 c, t dbSNP:201481645
1560 1560 c, g, t dbSNP:771142015
1561 1561 a, g dbSNP:528176529
1562 1562 g, t dbSNP:778132708
1564 1564 c, g dbSNP:758738865
1571 1571 c, t dbSNP:528585797
1572 1572 a, g dbSNP:779363781
1574 1574 a, g dbSNP:140705002
1576 1576 c, t dbSNP:558778286
1577 1577 a, g dbSNP:200033750
1583 1583 c, g dbSNP:147285345
1597 1597 a, g dbSNP:749993515
1598 1598 a, g dbSNP:767126396
1599 1599 g, t dbSNP:761559591
1603 1603 c, t dbSNP:773970695
1604 1604 c, t dbSNP:372409943
1605 1605 c, t dbSNP:762734978
1606 1606 a, g dbSNP:775567331
1609 1609 c, t dbSNP:769914491
1621 1621 -, ctt dbSNP:749851382
1633 1633 c, t dbSNP:10781542
1642 1642 c, g dbSNP:773461610
1645 1645 c, t dbSNP:772376191
1648 1648 c, t dbSNP:370076159
1650 1650 a, c, t dbSNP:769067899
1651 1651 a, g dbSNP:749680652
1660 1660 c, t dbSNP:780525765
1663 1663 c, t dbSNP:375792698
1669 1669 c, t dbSNP:10870194
1684 1684 a, g dbSNP:56931633
1688 1688 c, t dbSNP:756789619
1689 1689 a, g dbSNP:121918129
1694 1694 c, g dbSNP:777463231
1695 1695 c, t dbSNP:758022536
1703 1703 a, g dbSNP:752497011
1710 1710 c, t dbSNP:201043370
1712 1712 a, g dbSNP:371811859
1716 1716 a, g dbSNP:545195109
1732 1732 c, g dbSNP:747222628
1737 1737 a, g dbSNP:368627245
1741 1741 a, g dbSNP:761938075
1744 1744 c, t dbSNP:35774078
1745 1745 a, g dbSNP:138150684
1749 1749 a, c dbSNP:763184550
1754 1754 a, c dbSNP:775772293
1761 1761 a, g dbSNP:770146958
1765 1765 c, t dbSNP:145543466
1768 1768 c, t dbSNP:777179836
1769 1769 a, g dbSNP:200837258
1773 1773 c, t dbSNP:199956627
1774 1774 a, g dbSNP:779735920
1777 1777 c, t dbSNP:756021340
1778 1778 a, g dbSNP:750331066
1787 1787 c, t dbSNP:375909217
1788 1788 a, g dbSNP:112089228
1792 1792 c, t dbSNP:377483407
1795 1795 c, t dbSNP:138552060
1801 1801 -, gt dbSNP:767066251
1808 1808 c, t dbSNP:759781033
1809 1809 c, t dbSNP:777010049
1818 1818 g, t dbSNP:766669439
1826 1826 c, t dbSNP:761179746
1827 1827 a, g dbSNP:773590570
1831 1831 a, g dbSNP:772765499
1836 1836 a, g dbSNP:761386815
1837 1837 c, t dbSNP:371729050
1838 1838 a, g dbSNP:768384414
1841 1841 a, c, g, t dbSNP:75939033
1842 1842 a, g dbSNP:367592401
1849 1849 c, t dbSNP:140255426
1850 1850 a, g dbSNP:781083748
1853 1853 a, g dbSNP:757222534
1855 1855 c, t dbSNP:375301475
1856 1856 a, g dbSNP:371375165
1863 1863 c, t dbSNP:374083402
1864 1864 a, g dbSNP:754015058
1866 1866 a, g dbSNP:766692376
1867 1867 c, t dbSNP:760936298
1872 1872 g, t dbSNP:538188644
1874 1874 c, t dbSNP:768106872
1879 1879 a, g dbSNP:138525676
1882 1882 g, t dbSNP:773939918
1885 1885 c, t dbSNP:372142221
1886 1886 a, c, g dbSNP:370876407
1890 1890 c, g dbSNP:769531967
1891 1891 a, g dbSNP:74880446
1893 1893 c, t dbSNP:370661476
1894 1894 a, g dbSNP:770801327
1895 1895 c, t dbSNP:746966122
1897 1897 a, g dbSNP:778901853
1906 1906 c, g, t dbSNP:10870188
1915 1915 c, t dbSNP:780119172
1919 1919 c, t dbSNP:374152018
1920 1920 a, g dbSNP:750777734
1925 1925 a, g dbSNP:768016672
1928 1928 a, c, t dbSNP:13297509
1929 1929 a, g dbSNP:752106876
1932 1932 a, g dbSNP:13294000
1936 1936 g, t dbSNP:201644680
1937 1937 g, t dbSNP:760443315
1945 1945 c, t dbSNP:762137331
1946 1946 a, g dbSNP:773033007
1950 1950 c, g dbSNP:771866500
1960 1960 g, t dbSNP:748139386
1962 1962 c, t dbSNP:746867724
1963 1963 a, g dbSNP:769912825
1970 1970 -, c dbSNP:747219455
1975 1975 c, t dbSNP:531628363
1976 1976 c, t dbSNP:781540345
1983 1983 c, t dbSNP:757592615
1985 1985 c, t dbSNP:747333701
1999 1999 c, t dbSNP:778220171
2000 2000 a, g dbSNP:375126841
2008 2008 c, t dbSNP:77248046
2010 2010 c, t dbSNP:370618502
2011 2011 a, g dbSNP:150464071
2014 2014 c, g, t dbSNP:753398503
2021 2021 a, g dbSNP:765986823
2026 2026 c, t dbSNP:376485593
2031 2031 a, g dbSNP:750136842
2036 2036 -, gga dbSNP:778019120
2037 2037 c, t dbSNP:75342839
2049 2049 c, t dbSNP:761578787
2050 2050 a, g dbSNP:774331779
2056 2056 a, c dbSNP:776792436
2060 2060 a, t dbSNP:376839080
2067 2067 a, g dbSNP:80111347
2071 2071 c, t dbSNP:760729838
2072 2072 c, t dbSNP:371960390
2073 2073 a, g dbSNP:121918128
2078 2078 a, g dbSNP:778536210
2082 2082 a, g dbSNP:140543689
2085 2085 a, t dbSNP:779177166
2086 2086 c, t dbSNP:368615705
2099 2099 a, g dbSNP:368296709
2100 2100 a, g dbSNP:769104210
2107 2107 c, t dbSNP:375615380
2108 2108 c, t dbSNP:749810093
2115 2115 c, g dbSNP:147967974
2116 2116 c, t dbSNP:371946549
2117 2117 a, g dbSNP:559636009
2128 2128 a, c, g dbSNP:368026621
2132 2132 a, g dbSNP:756888841
2133 2133 a, g dbSNP:751316714
2138 2138 c, t dbSNP:763992407
2139 2139 a, g dbSNP:752300607
2145 2145 -, t dbSNP:775518991
2155 2155 c, t dbSNP:143552175
2172 2172 c, g dbSNP:765327224
2173 2173 a, g dbSNP:530758804
2175 2175 c, t dbSNP:760790290
2176 2176 a, c, g dbSNP:10870182
2179 2179 g, t dbSNP:33982662
2181 2181 c, g, t dbSNP:750836133
2187 2187 a, g dbSNP:749720435
2193 2193 c, t dbSNP:746372090
2201 2201 c, g dbSNP:776136400
2203 2203 c, t dbSNP:770339939
2205 2205 a, g dbSNP:375144690
2211 2211 c, t dbSNP:777549235
2213 2213 a, g dbSNP:771894087
2215 2215 a, t dbSNP:199875003
2246 2246 c, t dbSNP:142759730
2253 2253 c, t dbSNP:754887212
2259 2259 a, c dbSNP:760420960
2260 2260 a, c, g dbSNP:148539728
2262 2262 c, t dbSNP:757272800
2264 2264 c, t dbSNP:121918127
2266 2266 a, g dbSNP:144720715
2279 2279 c, t dbSNP:764259572
2282 2282 c, g dbSNP:763184652
2304 2304 c, t dbSNP:753001340
2306 2306 g, t dbSNP:765521242
2311 2311 c, t dbSNP:201735585
2318 2318 g, t dbSNP:776988648
2323 2323 c, t dbSNP:551001538
2325 2325 g, t dbSNP:372454719
2332 2332 c, t dbSNP:369482968
2333 2333 -, gaggac dbSNP:755946289
2333 2333 a, g dbSNP:199734968
2342 2342 -, ca dbSNP:750377678
2347 2347 a, c, g dbSNP:372688482
2351 2351 a, c, t dbSNP:367781642
2352 2352 a, g dbSNP:372854854
2353 2353 c, t dbSNP:756074325
2357 2357 a, g dbSNP:374317604
2358 2358 -, t dbSNP:766931797
2362 2362 c, t dbSNP:751590391
2366 2366 c, t dbSNP:777844004
2369 2369 a, c, t dbSNP:752907539
2399 2399 g, t dbSNP:547171151
2402 2402 c, t dbSNP:528720588
2403 2403 a, g dbSNP:543729956
2418 2418 a, g dbSNP:35873563
2434 2434 c, t dbSNP:767206759
2435 2435 a, g dbSNP:763543097
2441 2441 c, g dbSNP:376716242
2447 2447 c, t dbSNP:763036675
2487 2487 c, t dbSNP:549388093
2506 2506 a, g dbSNP:531281897
2513 2513 a, g dbSNP:562334275
2533 2533 c, t dbSNP:544203657
2555 2555 a, g dbSNP:376604726
2595 2595 a, g dbSNP:184676308
2610 2610 -, tc dbSNP:761395507
2612 2612 c, g dbSNP:760676645
2622 2622 a, g dbSNP:540004766
2648 2648 a, c, g, t dbSNP:35763810
2678 2678 -, aaca dbSNP:140699240
2683 2683 c, g dbSNP:370800811
2797 2797 a, g dbSNP:142249567
2825 2825 -, g dbSNP:770566636
2839 2839 -, ag dbSNP:756634805
2870 2870 c, t dbSNP:536153618
2891 2891 c, t dbSNP:575536378
2892 2892 a, g dbSNP:545090232
2931 2931 c, t dbSNP:557035262
2932 2932 a, g dbSNP:774274698
2950 2950 a, g dbSNP:539039743
2987 2987 c, t dbSNP:749452229
2991 2991 c, t dbSNP:571744936
2998 2998 c, t dbSNP:775722685
3000 3000 a, g dbSNP:547134389
3016 3016 -, tgaaaccatctcatggtcttggtgacgtagaccatttt dbSNP:60028078
3023 3023 a, g dbSNP:1128874
3042 3042 a, g dbSNP:373479099
3043 3043 c, t dbSNP:567753155
3049 3049 a, g dbSNP:549593008
3053 3053 c, t dbSNP:531069478
3059 3059 c, g dbSNP:564010270
3067 3067 c, t dbSNP:191248562
3079 3079 c, t dbSNP:531994935
3083 3083 c, g dbSNP:564573606
3109 3109 a, g dbSNP:757763725
3110 3110 a, c, t dbSNP:147885381
3111 3111 a, g dbSNP:572933251
3131 3131 a, g dbSNP:778109117
3136 3136 a, g dbSNP:8413
3225 3225 c, t dbSNP:542809511
3231 3231 c, t dbSNP:567247143
3232 3232 a, g dbSNP:754686794
3246 3246 c, t dbSNP:1128877
3266 3266 a, g dbSNP:557235645
3339 3339 g, t dbSNP:545390204
3365 3365 c, t dbSNP:188724991

Target ORF information:

RefSeq Version NM_019892
Organism Homo sapiens (human)
Definition Homo sapiens inositol polyphosphate-5-phosphatase E (INPP5E), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu43395D
Sequence Information ORF Nucleotide Sequence (Length: 1932bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 72 kDa inositol polyphosphate 5-phosphatase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530426766. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1323..2216(+)
Misc Feature(2)1359..2189(+)
Misc Feature(3)1359..2189(+)
Misc Feature(4)1458..2186(+)
Misc Feature(5)1458..2186(+)
Misc Feature(6)1710..2189(+)
Position Chain Variation Link
12 12 c, t dbSNP:111413675
83 83 c, g dbSNP:527484741
103 103 a, g dbSNP:560157168
120 120 c, t dbSNP:542121150
172 172 c, t dbSNP:765685082
174 174 c, t dbSNP:529969701
202 202 c, g dbSNP:562519905
267 267 a, g dbSNP:544247720
291 291 c, t dbSNP:576919520
354 354 c, t dbSNP:559022606
364 364 a, g dbSNP:540428793
373 373 c, g dbSNP:374802206
399 399 c, t dbSNP:766217466
408 408 g, t dbSNP:113327405
409 409 a, c dbSNP:112874086
410 410 c, g dbSNP:554931078
430 430 a, g dbSNP:773201167
433 433 -, ga dbSNP:772797832
439 439 c, t dbSNP:767541765
446 446 a, g dbSNP:761850172
461 461 c, t dbSNP:571588033
473 473 c, g dbSNP:79161998
482 482 c, t dbSNP:746022747
490 490 c, t dbSNP:776845366
505 505 c, g dbSNP:556184252
547 547 c, g dbSNP:771207750
560 560 c, t dbSNP:377154166
561 561 a, g dbSNP:778156063
597 597 a, g dbSNP:758796987
623 623 a, g dbSNP:570404672
637 637 a, g dbSNP:778236228
641 641 a, g dbSNP:754529136
654 654 c, t dbSNP:753362488
657 657 c, t dbSNP:779841260
660 660 c, t dbSNP:755881439
661 661 c, t dbSNP:750213296
665 665 c, g dbSNP:767451997
675 675 c, g dbSNP:761611233
684 684 c, g dbSNP:751533117
686 686 a, g dbSNP:765166839
690 690 c, g dbSNP:759659346
695 695 a, c dbSNP:776746807
696 696 c, g dbSNP:552270496
698 698 g, t dbSNP:760923526
702 702 -, gac dbSNP:772462088
712 712 c, g dbSNP:773522021
722 722 -, agg dbSNP:748503945
722 722 a, g dbSNP:772508292
724 724 a, g dbSNP:192637923
741 741 c, g dbSNP:566641584
744 744 a, g, t dbSNP:187724945
751 751 a, t dbSNP:748786705
754 754 c, t dbSNP:779751422
756 756 a, c dbSNP:755788855
757 757 g, t dbSNP:750127451
758 758 a, g dbSNP:529933894
761 761 c, t dbSNP:781080297
762 762 a, g dbSNP:757082393
763 763 a, g dbSNP:562484803
764 764 g, t dbSNP:764076054
769 769 c, g dbSNP:762843928
770 770 c, t dbSNP:550522365
771 771 c, t dbSNP:766472975
779 779 a, g dbSNP:532376589
784 784 a, c dbSNP:773436168
788 788 a, g dbSNP:772257147
803 803 c, t dbSNP:762231724
807 807 c, g dbSNP:774630007
808 808 a, c dbSNP:769176351
813 813 c, g dbSNP:749845422
817 817 a, g dbSNP:779663196
823 823 g, t dbSNP:769446973
826 826 c, t dbSNP:745450500
827 827 c, g dbSNP:780895601
832 832 c, t dbSNP:756921162
840 840 a, c dbSNP:372930430
852 852 a, c dbSNP:777466600
869 869 c, t dbSNP:758289136
873 873 a, g dbSNP:752649797
875 875 a, c, g dbSNP:369302139
879 879 c, t dbSNP:71508856
889 889 a, g dbSNP:750566132
893 893 a, t dbSNP:374675444
900 900 c, t dbSNP:565209005
909 909 g, t dbSNP:78211353
913 913 -, g dbSNP:779450345
919 919 c, g dbSNP:774738007
941 941 c, g dbSNP:764388194
945 945 c, t dbSNP:573292248
950 950 c, g dbSNP:778210239
955 955 c, t dbSNP:770493776
956 956 g, t dbSNP:372551521
957 957 c, t dbSNP:776051206
968 968 c, t dbSNP:561511490
971 971 a, c dbSNP:58206296
972 972 a, g dbSNP:376003129
981 981 a, g dbSNP:758203217
986 986 g, t dbSNP:748011152
987 987 a, c, t dbSNP:754964359
989 989 c, t dbSNP:750486950
994 994 a, t dbSNP:372412898
1000 1000 -, gctgcccat dbSNP:769234632
1000 1000 a, g, t dbSNP:575967532
1010 1010 c, g dbSNP:751744722
1012 1012 c, g dbSNP:61734181
1017 1017 c, t dbSNP:763409993
1020 1020 c, g dbSNP:200223403
1023 1023 c, t dbSNP:765819603
1024 1024 c, g dbSNP:147268679
1026 1026 g, t dbSNP:376043087
1027 1027 c, t dbSNP:371950473
1028 1028 c, t dbSNP:368034918
1033 1033 c, g dbSNP:141286608
1035 1035 c, t dbSNP:771778184
1043 1043 c, g dbSNP:36064831
1046 1046 c, t dbSNP:778722047
1050 1050 a, g dbSNP:768542252
1055 1055 c, t dbSNP:749205417
1056 1056 c, t dbSNP:781276208
1061 1061 a, g dbSNP:757293173
1063 1063 c, t dbSNP:143107549
1064 1064 a, g dbSNP:374855241
1067 1067 a, g dbSNP:758745316
1068 1068 a, g dbSNP:753077558
1070 1070 c, t dbSNP:765725453
1075 1075 g, t dbSNP:533861933
1076 1076 a, c dbSNP:34071122
1093 1093 a, c dbSNP:753519048
1095 1095 g, t dbSNP:374690864
1097 1097 c, t dbSNP:772835287
1100 1100 a, g dbSNP:771688462
1111 1111 -, agccgc dbSNP:749826986
1115 1115 a, g dbSNP:766060428
1116 1116 c, t dbSNP:761485683
1119 1119 c, g dbSNP:547974643
1125 1125 c, t dbSNP:774085718
1126 1126 a, g dbSNP:768453555
1130 1130 c, g dbSNP:749184059
1132 1132 a, g dbSNP:779854628
1134 1134 a, t dbSNP:769831459
1136 1136 c, t dbSNP:536052945
1138 1138 c, g dbSNP:568767788
1144 1144 a, g dbSNP:758650948
1145 1145 c, t dbSNP:752987677
1148 1148 c, g, t dbSNP:755298134
1153 1153 g, t dbSNP:760298042
1166 1166 c, g dbSNP:766781844
1179 1179 a, g, t dbSNP:749897420
1183 1183 g, t dbSNP:767038608
1186 1186 c, g, t dbSNP:550485638
1187 1187 c, g dbSNP:763877519
1192 1192 c, g dbSNP:201792737
1194 1194 c, t dbSNP:775406790
1195 1195 c, t dbSNP:368053206
1197 1197 g, t dbSNP:745845949
1204 1204 a, c dbSNP:368817877
1208 1208 c, t dbSNP:546707911
1209 1209 c, t dbSNP:772286826
1217 1217 c, t dbSNP:748310442
1221 1221 a, g dbSNP:779271682
1222 1222 c, t dbSNP:528585360
1223 1223 a, g dbSNP:374720993
1229 1229 c, t dbSNP:780506826
1231 1231 a, g dbSNP:202197173
1239 1239 a, g dbSNP:750943687
1246 1246 a, g dbSNP:766948458
1260 1260 c, t dbSNP:749555123
1264 1264 a, c dbSNP:369890337
1266 1266 a, g dbSNP:780226706
1274 1274 c, t dbSNP:756506281
1278 1278 a, g dbSNP:746298415
1283 1283 c, t dbSNP:375981295
1284 1284 a, g dbSNP:138068434
1288 1288 c, t dbSNP:751040358
1293 1293 c, t dbSNP:763694461
1296 1296 a, g dbSNP:757936530
1300 1300 c, t dbSNP:752406011
1301 1301 a, g dbSNP:764869959
1312 1312 c, t dbSNP:759397125
1314 1314 c, g dbSNP:753742613
1315 1315 a, g dbSNP:199873582
1316 1316 a, c dbSNP:760732523
1318 1318 a, t dbSNP:145264797
1329 1329 c, t dbSNP:547445320
1333 1333 -, a dbSNP:750641489
1335 1335 a, g dbSNP:763020300
1346 1346 c, t dbSNP:140222295
1347 1347 a, g, t dbSNP:746212325
1365 1365 c, g dbSNP:568204894
1367 1367 a, g dbSNP:776017599
1370 1370 a, c dbSNP:771391803
1374 1374 -, aag dbSNP:781316816
1384 1384 -, c dbSNP:752443518
1384 1384 c, t dbSNP:754637179
1385 1385 a, g dbSNP:753567429
1403 1403 a, c dbSNP:779929155
1410 1410 c, g dbSNP:755969392
1412 1412 a, g dbSNP:10870199
1415 1415 c, g, t dbSNP:143258290
1416 1416 a, g dbSNP:200794870
1421 1421 c, t dbSNP:35498378
1422 1422 a, g dbSNP:201857820
1426 1426 a, g, t dbSNP:372066816
1428 1428 a, g dbSNP:761085367
1433 1433 g, t dbSNP:555308253
1437 1437 c, g, t dbSNP:151090087
1439 1439 g, t dbSNP:773949804
1446 1446 a, c dbSNP:768294500
1448 1448 c, t dbSNP:748874713
1449 1449 a, g dbSNP:368235861
1451 1451 a, g dbSNP:755772230
1454 1454 c, t dbSNP:370869769
1455 1455 c, t dbSNP:142906644
1461 1461 a, g dbSNP:780882740
1464 1464 c, t dbSNP:188488264
1476 1476 c, t dbSNP:767855660
1477 1477 a, g dbSNP:762071368
1487 1487 a, g dbSNP:752019065
1491 1491 c, t dbSNP:764667114
1492 1492 a, g, t dbSNP:775094328
1493 1493 c, t dbSNP:572650394
1505 1505 a, c, g dbSNP:374089192
1514 1514 a, g, t dbSNP:746782404
1529 1529 g, t dbSNP:777580798
1531 1531 c, t dbSNP:536052523
1535 1535 a, g dbSNP:748104868
1538 1538 a, g dbSNP:374142756
1544 1544 c, t dbSNP:148592275
1545 1545 a, g dbSNP:750574856
1547 1547 c, t dbSNP:374718674
1548 1548 a, g dbSNP:147531141
1549 1549 a, t dbSNP:751934943
1557 1557 a, g dbSNP:753085035
1561 1561 c, t dbSNP:764577370
1570 1570 g, t dbSNP:763499800
1572 1572 c, t dbSNP:121918130
1573 1573 a, g, t dbSNP:758951947
1576 1576 a, g dbSNP:200518324
1578 1578 a, g dbSNP:770456201
1586 1586 a, c dbSNP:760349095
1595 1595 c, g dbSNP:772941011
1596 1596 g, t dbSNP:771866083
1597 1597 c, g dbSNP:748011090
1598 1598 -, ggtgggcgtggctggagg dbSNP:71384081
1612 1612 c, t dbSNP:201481645
1615 1615 c, g, t dbSNP:771142015
1616 1616 a, g dbSNP:528176529
1617 1617 g, t dbSNP:778132708
1619 1619 c, g dbSNP:758738865
1626 1626 c, t dbSNP:528585797
1627 1627 a, g dbSNP:779363781
1629 1629 a, g dbSNP:140705002
1631 1631 c, t dbSNP:558778286
1632 1632 a, g dbSNP:200033750
1638 1638 c, g dbSNP:147285345
1652 1652 a, g dbSNP:749993515
1653 1653 a, g dbSNP:767126396
1654 1654 g, t dbSNP:761559591
1658 1658 c, t dbSNP:773970695
1659 1659 c, t dbSNP:372409943
1660 1660 c, t dbSNP:762734978
1661 1661 a, g dbSNP:775567331
1664 1664 c, t dbSNP:769914491
1676 1676 -, ctt dbSNP:749851382
1688 1688 c, t dbSNP:10781542
1697 1697 c, g dbSNP:773461610
1700 1700 c, t dbSNP:772376191
1703 1703 c, t dbSNP:370076159
1705 1705 a, c, t dbSNP:769067899
1706 1706 a, g dbSNP:749680652
1715 1715 c, t dbSNP:780525765
1718 1718 c, t dbSNP:375792698
1721 1721 c, t dbSNP:10870194
1736 1736 a, g dbSNP:56931633
1740 1740 c, t dbSNP:756789619
1741 1741 a, g dbSNP:121918129
1746 1746 c, g dbSNP:777463231
1747 1747 c, t dbSNP:758022536
1755 1755 a, g dbSNP:752497011
1762 1762 c, t dbSNP:201043370
1764 1764 a, g dbSNP:371811859
1768 1768 a, g dbSNP:545195109
1784 1784 c, g dbSNP:747222628
1789 1789 a, g dbSNP:368627245
1793 1793 a, g dbSNP:761938075
1796 1796 c, t dbSNP:35774078
1797 1797 a, g dbSNP:138150684
1801 1801 a, c dbSNP:763184550
1806 1806 a, c dbSNP:775772293
1813 1813 a, g dbSNP:770146958
1817 1817 c, t dbSNP:145543466
1820 1820 c, t dbSNP:777179836
1821 1821 a, g dbSNP:200837258
1825 1825 c, t dbSNP:199956627
1826 1826 a, g dbSNP:779735920
1829 1829 c, t dbSNP:756021340
1830 1830 a, g dbSNP:750331066
1839 1839 c, t dbSNP:375909217
1840 1840 a, g dbSNP:112089228
1844 1844 c, t dbSNP:377483407
1847 1847 c, t dbSNP:138552060
1853 1853 -, gt dbSNP:767066251
1860 1860 c, t dbSNP:759781033
1861 1861 c, t dbSNP:777010049
1870 1870 g, t dbSNP:766669439
1878 1878 c, t dbSNP:761179746
1879 1879 a, g dbSNP:773590570
1883 1883 a, g dbSNP:772765499
1888 1888 a, g dbSNP:761386815
1889 1889 c, t dbSNP:371729050
1890 1890 a, g dbSNP:768384414
1893 1893 a, c, g, t dbSNP:75939033
1894 1894 a, g dbSNP:367592401
1901 1901 c, t dbSNP:140255426
1902 1902 a, g dbSNP:781083748
1905 1905 a, g dbSNP:757222534
1907 1907 c, t dbSNP:375301475
1908 1908 a, g dbSNP:371375165
1915 1915 c, t dbSNP:374083402
1916 1916 a, g dbSNP:754015058
1918 1918 a, g dbSNP:766692376
1919 1919 c, t dbSNP:760936298
1924 1924 g, t dbSNP:538188644
1926 1926 c, t dbSNP:768106872
1931 1931 a, g dbSNP:138525676
1934 1934 g, t dbSNP:773939918
1937 1937 c, t dbSNP:372142221
1938 1938 a, c, g dbSNP:370876407
1942 1942 c, g dbSNP:769531967
1943 1943 a, g dbSNP:74880446
1945 1945 c, t dbSNP:370661476
1946 1946 a, g dbSNP:770801327
1947 1947 c, t dbSNP:746966122
1949 1949 a, g dbSNP:778901853
1958 1958 c, g, t dbSNP:10870188
1967 1967 c, t dbSNP:780119172
1971 1971 c, t dbSNP:374152018
1972 1972 a, g dbSNP:750777734
1977 1977 a, g dbSNP:768016672
1980 1980 a, c, t dbSNP:13297509
1981 1981 a, g dbSNP:752106876
1984 1984 a, g dbSNP:13294000
1988 1988 g, t dbSNP:201644680
1989 1989 g, t dbSNP:760443315
1997 1997 c, t dbSNP:762137331
1998 1998 a, g dbSNP:773033007
2002 2002 c, g dbSNP:771866500
2012 2012 g, t dbSNP:748139386
2014 2014 c, t dbSNP:746867724
2015 2015 a, g dbSNP:769912825
2022 2022 -, c dbSNP:747219455
2027 2027 c, t dbSNP:531628363
2028 2028 c, t dbSNP:781540345
2035 2035 c, t dbSNP:757592615
2037 2037 c, t dbSNP:747333701
2051 2051 c, t dbSNP:778220171
2052 2052 a, g dbSNP:375126841
2060 2060 c, t dbSNP:77248046
2062 2062 c, t dbSNP:370618502
2063 2063 a, g dbSNP:150464071
2066 2066 c, g, t dbSNP:753398503
2073 2073 a, g dbSNP:765986823
2078 2078 c, t dbSNP:376485593
2083 2083 a, g dbSNP:750136842
2088 2088 -, gga dbSNP:778019120
2089 2089 c, t dbSNP:75342839
2101 2101 c, t dbSNP:761578787
2102 2102 a, g dbSNP:774331779
2108 2108 a, c dbSNP:776792436
2112 2112 a, t dbSNP:376839080
2119 2119 a, g dbSNP:80111347
2123 2123 c, t dbSNP:760729838
2124 2124 c, t dbSNP:371960390
2125 2125 a, g dbSNP:121918128
2130 2130 a, g dbSNP:778536210
2134 2134 a, g dbSNP:140543689
2137 2137 a, t dbSNP:779177166
2138 2138 c, t dbSNP:368615705
2151 2151 a, g dbSNP:368296709
2152 2152 a, g dbSNP:769104210
2159 2159 c, t dbSNP:375615380
2160 2160 c, t dbSNP:749810093
2167 2167 c, g dbSNP:147967974
2168 2168 c, t dbSNP:371946549
2169 2169 a, g dbSNP:559636009
2180 2180 a, c, g dbSNP:368026621
2184 2184 a, g dbSNP:756888841
2185 2185 a, g dbSNP:751316714
2190 2190 c, t dbSNP:763992407
2191 2191 a, g dbSNP:752300607
2197 2197 -, t dbSNP:775518991
2207 2207 c, t dbSNP:143552175
2224 2224 c, g dbSNP:765327224
2225 2225 a, g dbSNP:530758804
2227 2227 c, t dbSNP:760790290
2228 2228 a, c, g dbSNP:10870182
2231 2231 g, t dbSNP:33982662
2233 2233 c, g, t dbSNP:750836133
2239 2239 a, g dbSNP:749720435
2245 2245 c, t dbSNP:746372090
2253 2253 c, g dbSNP:776136400
2255 2255 c, t dbSNP:770339939
2257 2257 a, g dbSNP:375144690
2263 2263 c, t dbSNP:777549235
2265 2265 a, g dbSNP:771894087
2267 2267 a, t dbSNP:199875003
2298 2298 c, t dbSNP:142759730
2305 2305 c, t dbSNP:754887212
2311 2311 a, c dbSNP:760420960
2312 2312 a, c, g dbSNP:148539728
2314 2314 c, t dbSNP:757272800
2316 2316 c, t dbSNP:121918127
2318 2318 a, g dbSNP:144720715
2331 2331 c, t dbSNP:764259572
2334 2334 c, g dbSNP:763184652
2356 2356 c, t dbSNP:753001340
2358 2358 g, t dbSNP:765521242
2363 2363 c, t dbSNP:201735585
2370 2370 g, t dbSNP:776988648
2375 2375 c, t dbSNP:551001538
2377 2377 g, t dbSNP:372454719
2384 2384 c, t dbSNP:369482968
2385 2385 -, gaggac dbSNP:755946289
2385 2385 a, g dbSNP:199734968
2394 2394 -, ca dbSNP:750377678
2399 2399 a, c, g dbSNP:372688482
2403 2403 a, c, t dbSNP:367781642
2404 2404 a, g dbSNP:372854854
2405 2405 c, t dbSNP:756074325
2409 2409 a, g dbSNP:374317604
2410 2410 -, t dbSNP:766931797
2414 2414 c, t dbSNP:751590391
2418 2418 c, t dbSNP:777844004
2421 2421 a, c, t dbSNP:752907539
2451 2451 g, t dbSNP:547171151
2454 2454 c, t dbSNP:528720588
2455 2455 a, g dbSNP:543729956
2470 2470 a, g dbSNP:35873563
2486 2486 c, t dbSNP:767206759
2487 2487 a, g dbSNP:763543097
2493 2493 c, g dbSNP:376716242
2499 2499 c, t dbSNP:763036675
2539 2539 c, t dbSNP:549388093
2558 2558 a, g dbSNP:531281897
2565 2565 a, g dbSNP:562334275
2585 2585 c, t dbSNP:544203657
2607 2607 a, g dbSNP:376604726
2647 2647 a, g dbSNP:184676308
2662 2662 -, tc dbSNP:761395507
2664 2664 c, g dbSNP:760676645
2674 2674 a, g dbSNP:540004766
2700 2700 a, c, g, t dbSNP:35763810
2730 2730 -, aaca dbSNP:140699240
2735 2735 c, g dbSNP:370800811
2849 2849 a, g dbSNP:142249567
2877 2877 -, g dbSNP:770566636
2891 2891 -, ag dbSNP:756634805
2922 2922 c, t dbSNP:536153618
2943 2943 c, t dbSNP:575536378
2944 2944 a, g dbSNP:545090232
2983 2983 c, t dbSNP:557035262
2984 2984 a, g dbSNP:774274698
3002 3002 a, g dbSNP:539039743
3039 3039 c, t dbSNP:749452229
3043 3043 c, t dbSNP:571744936
3050 3050 c, t dbSNP:775722685
3052 3052 a, g dbSNP:547134389
3068 3068 -, tgaaaccatctcatggtcttggtgacgtagaccatttt dbSNP:60028078
3075 3075 a, g dbSNP:1128874
3094 3094 a, g dbSNP:373479099
3095 3095 c, t dbSNP:567753155
3101 3101 a, g dbSNP:549593008
3105 3105 c, t dbSNP:531069478
3111 3111 c, g dbSNP:564010270
3119 3119 c, t dbSNP:191248562
3131 3131 c, t dbSNP:531994935
3135 3135 c, g dbSNP:564573606
3161 3161 a, g dbSNP:757763725
3162 3162 a, c, t dbSNP:147885381
3163 3163 a, g dbSNP:572933251
3183 3183 a, g dbSNP:778109117
3188 3188 a, g dbSNP:8413
3277 3277 c, t dbSNP:542809511
3283 3283 c, t dbSNP:567247143
3284 3284 a, g dbSNP:754686794
3298 3298 c, t dbSNP:1128877
3318 3318 a, g dbSNP:557235645
3391 3391 g, t dbSNP:545390204
3417 3417 c, t dbSNP:188724991

Target ORF information:

RefSeq Version XM_005266094
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.