Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

FAM20C family with sequence similarity 20, member C [Homo sapiens (human)]

Gene Symbol FAM20C
Entrez Gene ID 56975
Full Name family with sequence similarity 20, member C
Synonyms DMP-4, DMP4, GEF-CK, RNS
General protein information
Preferred Names
extracellular serine/threonine protein kinase FAM20C
extracellular serine/threonine protein kinase FAM20C
dentin matrix protein 4
golgi-enriched fraction casein kinase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]. lac of sum
Disorder MIM:


Disorder Html: Raine syndrome, 259775 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu20191 NM_020223 Homo sapiens family with sequence similarity 20, member C (FAM20C), mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00
OHu70204 XM_011515457 PREDICTED: Homo sapiens family with sequence similarity 20, member C (FAM20C), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu20191D
Sequence Information ORF Nucleotide Sequence (Length: 1755bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 02-AUG-2015
Organism Homo sapiens (human)
Product extracellular serine/threonine protein kinase FAM20C precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF533706.1, BQ026938.1, BC040074.1 and AA135568.1. This sequence is a reference standard in the RefSeqGene project. On Dec 1, 2011 this sequence version replaced gi:116174741. Summary: This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF533706.1, BC040074.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)139..141(+)
Misc Feature(2)1291..1926(+)
Misc Feature(3)1291..1926(+)
Misc Feature(4)1582..1665(+)
Misc Feature(5)1594..1620(+)
Misc Feature(6)1618..1665(+)
Misc Feature(7)1663..1731(+)
Exon (1)1..836
Gene Synonym:
Exon (2)837..1015
Gene Synonym:
Exon (3)1016..1094
Gene Synonym:
Exon (4)1095..1187
Gene Synonym:
Exon (5)1188..1303
Gene Synonym:
Exon (6)1304..1484
Gene Synonym:
Exon (7)1485..1594
Gene Synonym:
Exon (8)1595..1676
Gene Synonym:
Exon (9)1677..1736
Gene Synonym:
Exon (10)1737..2780
Gene Synonym:
Position Chain Variation Link
24 24 a, c dbSNP:543187177
123 123 c, t dbSNP:116903250
129 129 c, t dbSNP:185095788
203 203 a, g dbSNP:367948898
217 217 c, t dbSNP:761786167
221 221 c, t dbSNP:767408512
237 237 a, g dbSNP:749965678
254 254 a, g dbSNP:73251052
277 277 g, t dbSNP:150401144
285 285 c, g dbSNP:753562131
286 286 g, t dbSNP:529612835
297 297 a, g dbSNP:779472552
378 378 a, g dbSNP:748496296
387 387 a, c dbSNP:759042509
391 391 a, g dbSNP:549713327
405 405 a, c dbSNP:567930512
422 422 c, g dbSNP:747416986
431 431 a, c dbSNP:538469200
432 432 c, t dbSNP:776532676
468 468 c, t dbSNP:556779335
483 483 a, c dbSNP:190382829
493 493 c, t dbSNP:13230032
498 498 c, t dbSNP:769980789
525 525 c, g dbSNP:774167843
528 528 c, t dbSNP:761589732
535 535 a, c dbSNP:767408183
550 550 c, g dbSNP:773210635
553 553 c, g, t dbSNP:760493570
554 554 a, t dbSNP:753268141
574 574 a, g dbSNP:754720957
578 578 c, g dbSNP:764977929
586 586 c, g dbSNP:753171820
610 610 a, g dbSNP:537411703
616 616 c, t dbSNP:539116395
651 651 a, g dbSNP:113842436
657 657 c, t dbSNP:777933402
658 658 c, t dbSNP:531384573
668 668 a, g dbSNP:747581446
689 689 a, g dbSNP:751592577
692 692 a, c dbSNP:757656546
705 705 c, t dbSNP:553928524
712 712 c, t dbSNP:781379485
719 719 g, t dbSNP:745916292
723 723 c, g dbSNP:770065356
748 748 g, t dbSNP:775673987
749 749 c, t dbSNP:749450491
750 750 g, t dbSNP:572411891
766 766 a, g dbSNP:771901909
774 774 c, t dbSNP:772838347
778 778 c, t dbSNP:542580647
785 785 a, g dbSNP:777240362
795 795 c, g dbSNP:761779092
806 806 g, t dbSNP:770746273
812 812 c, t dbSNP:776349784
813 813 c, t dbSNP:759105808
831 831 a, c, g dbSNP:201631664
835 835 g, t dbSNP:794726946
839 839 c, t dbSNP:763622631
840 840 a, g dbSNP:752027836
845 845 c, t dbSNP:755764751
846 846 c, g, t dbSNP:767807372
849 849 c, t dbSNP:756570743
852 852 g, t dbSNP:780159262
858 858 c, t dbSNP:753832568
859 859 a, g dbSNP:755298833
862 862 a, g dbSNP:187691945
872 872 a, c, t dbSNP:201436002
875 875 c, g dbSNP:781096645
876 876 c, g, t dbSNP:745823970
877 877 a, c, g dbSNP:61734970
879 879 a, g dbSNP:768409597
884 884 c, t dbSNP:200962622
885 885 a, g dbSNP:749129743
888 888 c, t dbSNP:375009760
889 889 a, g dbSNP:200381918
890 890 c, t dbSNP:761213707
896 896 c, t dbSNP:766871133
897 897 c, g dbSNP:754010880
905 905 a, g dbSNP:61732569
921 921 c, t dbSNP:765294314
926 926 g, t dbSNP:752896209
935 935 a, g dbSNP:758646891
939 939 c, t dbSNP:545268162
940 940 a, g dbSNP:200225309
944 944 c, t dbSNP:756187054
945 945 g, t dbSNP:780125740
953 953 c, g dbSNP:749188339
956 956 a, g dbSNP:768052338
962 962 c, g, t dbSNP:116181849
963 963 a, g dbSNP:376874896
964 964 a, g dbSNP:61730252
969 969 c, t dbSNP:574668517
970 970 a, g dbSNP:374098657
973 973 c, g dbSNP:773497163
984 984 c, t dbSNP:777009380
985 985 a, g dbSNP:760049058
987 987 c, t dbSNP:745637661
995 995 -, c dbSNP:758547451
996 996 c, g dbSNP:765256799
1008 1008 c, t dbSNP:752800765
1011 1011 c, t dbSNP:748161528
1012 1012 a, g dbSNP:760967233
1025 1025 -, g dbSNP:750171507
1026 1026 a, g, t dbSNP:766106805
1031 1031 a, g dbSNP:754940345
1034 1034 c, t dbSNP:778899041
1035 1035 a, c, g dbSNP:373718419
1041 1041 a, g dbSNP:757911391
1051 1051 a, g dbSNP:777225574
1054 1054 a, g dbSNP:575640418
1064 1064 a, g dbSNP:746686644
1068 1068 c, t dbSNP:770597698
1069 1069 a, g, t dbSNP:779708323
1077 1077 a, g dbSNP:746238378
1097 1097 a, g dbSNP:747702836
1103 1103 a, g dbSNP:537066502
1113 1113 c, g dbSNP:369253494
1116 1116 a, g dbSNP:141256626
1137 1137 c, t dbSNP:11546478
1146 1146 c, t dbSNP:150808056
1161 1161 a, g dbSNP:369287929
1179 1179 cctg, tccgc dbSNP:386709047
1182 1182 -, gacaggtgagcccttccttcctccctccatccgc, gacaggtgagcccttccttccttcctccatccgc, ggcaggtgagcccttccttcctccctccatccgc dbSNP:774848096
1215 1215 c, g dbSNP:753579879
1221 1221 c, t dbSNP:759219400
1249 1249 a, g dbSNP:538819921
1252 1252 c, t dbSNP:765745848
1257 1257 c, t dbSNP:377615599
1264 1264 a, c dbSNP:759012718
1265 1265 a, g dbSNP:527843022
1290 1290 c, t dbSNP:752044491
1308 1308 c, t dbSNP:370916083
1323 1323 c, t dbSNP:137978439
1324 1324 c, g dbSNP:267606795
1327 1327 a, g dbSNP:754919459
1338 1338 c, t dbSNP:562310548
1349 1349 c, t dbSNP:775983050
1356 1356 c, t dbSNP:149513190
1365 1365 c, t dbSNP:544733662
1383 1383 c, t dbSNP:373614292
1391 1391 c, t dbSNP:751682204
1410 1410 c, g, t dbSNP:527427394
1425 1425 c, t dbSNP:577450352
1441 1441 a, c, t dbSNP:547184013
1449 1449 a, t dbSNP:144007479
1456 1456 c, t dbSNP:730882220
1459 1459 a, t dbSNP:148276213
1467 1467 c, t dbSNP:141884969
1472 1472 a, g dbSNP:758159748
1485 1485 g, t dbSNP:768006208
1510 1510 a, g dbSNP:750557992
1529 1529 c, t dbSNP:756159495
1530 1530 a, g dbSNP:568534039
1532 1532 c, t dbSNP:530956875
1536 1536 c, t dbSNP:141959001
1537 1537 a, g dbSNP:755206779
1549 1549 c, t dbSNP:777751608
1575 1575 a, g dbSNP:570988860
1581 1581 c, t dbSNP:144664066
1584 1584 c, g dbSNP:757324719
1617 1617 c, t dbSNP:376430486
1647 1647 a, g dbSNP:140970872
1656 1656 c, g dbSNP:765546593
1665 1665 a, c dbSNP:531017309
1686 1686 a, g dbSNP:369693625
1691 1691 c, t dbSNP:536323098
1692 1692 a, g dbSNP:373079378
1695 1695 c, t dbSNP:139144760
1719 1719 a, g dbSNP:370400682
1760 1760 a, g dbSNP:754488338
1800 1800 c, g dbSNP:778347954
1809 1809 c, g, t dbSNP:140924363
1812 1812 a, g dbSNP:771682200
1819 1819 c, t dbSNP:778066437
1820 1820 a, g dbSNP:747389881
1828 1828 c, g dbSNP:546198723
1837 1837 c, t dbSNP:777202451
1839 1839 c, t dbSNP:746323195
1845 1845 g, t dbSNP:770014466
1847 1847 a, c dbSNP:775685888
1853 1853 c, t dbSNP:763303277
1874 1874 a, g dbSNP:764403309
1882 1882 c, t dbSNP:772938056
1883 1883 a, g dbSNP:150231592
1884 1884 c, t dbSNP:766020600
1885 1885 a, g dbSNP:753843872
1888 1888 a, g dbSNP:754889644
1890 1890 g, t dbSNP:36170987
1893 1893 a, g dbSNP:752200167
1899 1899 c, t dbSNP:758105238
1903 1903 c, t dbSNP:62644536
1904 1904 a, g dbSNP:562265099
1908 1908 c, g, t dbSNP:11546480
1911 1911 c, t dbSNP:371584776
1912 1912 a, g dbSNP:145750007
1921 1921 a, c, g dbSNP:36139924
1922 1922 a, t dbSNP:752735023
1923 1923 c, t dbSNP:749362099
1927 1927 c, t dbSNP:570803397
1929 1929 c, g dbSNP:539771117
1930 1930 c, t dbSNP:369608827
1935 1935 c, t dbSNP:371567802
1936 1936 a, g dbSNP:761899411
1947 1947 c, t dbSNP:377281925
1948 1948 a, g dbSNP:534686149
1949 1949 a, t dbSNP:547458228
1970 1970 c, t dbSNP:554371375
1971 1971 c, t dbSNP:563226142
1972 1972 a, g dbSNP:565864949
1976 1976 c, t dbSNP:537240435
1977 1977 a, g dbSNP:757913083
1979 1979 c, t dbSNP:557222235
1980 1980 a, g dbSNP:143027699
1989 1989 c, t dbSNP:756835293
1991 1991 c, t dbSNP:781648911
1998 1998 c, t dbSNP:746225841
2010 2010 c, t dbSNP:546135408
2011 2011 a, g dbSNP:553306452
2012 2012 a, g dbSNP:573159780
2015 2015 c, t dbSNP:768810351
2016 2016 a, g dbSNP:36173075
2027 2027 c, g dbSNP:36138803
2028 2028 a, g dbSNP:531078658
2030 2030 c, t dbSNP:776468924
2031 2031 a, g dbSNP:141144359
2053 2053 a, g dbSNP:190305972
2056 2056 c, t dbSNP:11546477
2059 2059 c, t dbSNP:775647431
2060 2060 a, g dbSNP:575403735
2076 2076 c, t dbSNP:150747032
2098 2098 a, g dbSNP:374362442
2101 2101 g, t dbSNP:763127496
2103 2103 c, t dbSNP:139509186
2104 2104 a, g dbSNP:143650974
2119 2119 a, g dbSNP:774568715
2125 2125 a, c dbSNP:548208475
2126 2126 a, g dbSNP:568040521
2151 2151 a, c dbSNP:537179333
2177 2177 g, t dbSNP:557159232
2192 2192 a, g dbSNP:147183623
2199 2199 a, g dbSNP:182516015
2201 2201 c, g dbSNP:553005020
2217 2217 a, g dbSNP:140489559
2221 2221 a, g dbSNP:11546481
2223 2223 c, t dbSNP:185910187
2224 2224 a, g dbSNP:144606574
2227 2227 a, g dbSNP:148728305
2231 2231 a, g dbSNP:755635915
2284 2284 c, t dbSNP:142252355
2312 2312 a, t dbSNP:533351140
2313 2313 c, t dbSNP:191201474
2314 2314 a, g dbSNP:560613535
2348 2348 c, g dbSNP:778692429
2357 2357 c, t dbSNP:556433691
2358 2358 a, g dbSNP:529619788
2371 2371 c, t dbSNP:747831102
2377 2377 a, g dbSNP:758225457
2386 2386 a, c, g dbSNP:547861600
2387 2387 g, t dbSNP:568064035
2462 2462 c, t dbSNP:182205590
2463 2463 a, g dbSNP:550699777
2487 2487 c, t dbSNP:570622013
2488 2488 a, g dbSNP:746976145
2497 2497 c, t dbSNP:376495591
2498 2498 a, g dbSNP:553182062
2507 2507 c, t dbSNP:566629574
2518 2518 c, t dbSNP:535773152
2519 2519 a, g dbSNP:151275643
2531 2531 c, t dbSNP:575255738
2532 2532 a, g dbSNP:140588788
2541 2541 c, t dbSNP:557839019
2542 2542 a, g dbSNP:144420589
2551 2551 c, t dbSNP:185304057
2552 2552 a, g dbSNP:11546479
2553 2553 c, t dbSNP:1134015
2569 2569 a, g dbSNP:574216974
2580 2580 a, g dbSNP:762026433
2592 2592 c, t dbSNP:543328547
2593 2593 a, g dbSNP:371369922
2596 2596 c, t dbSNP:767947619
2597 2597 a, g dbSNP:530531120
2611 2611 c, g dbSNP:761233899
2618 2618 c, t dbSNP:150281021
2658 2658 a, g dbSNP:753392041
2718 2718 a, g dbSNP:759090573
2739 2739 c, t dbSNP:138921693
2753 2753 g, t dbSNP:533085790
2755 2755 c, t dbSNP:546460619
2756 2756 a, g dbSNP:566672039
2764 2764 a, g dbSNP:535357753
2769 2769 a, g dbSNP:553885229
2777 2777 c, t dbSNP:190165180

Target ORF information:

RefSeq Version NM_020223
Organism Homo sapiens (human)
Definition Homo sapiens family with sequence similarity 20, member C (FAM20C), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu70204D
Sequence Information ORF Nucleotide Sequence (Length: 1152bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product extracellular serine/threonine protein kinase FAM20C isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007819.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Position Chain Variation Link
24 24 a, g dbSNP:4577908
29 29 c, t dbSNP:542909647
93 93 c, t dbSNP:560807031
103 103 c, g dbSNP:531420480
216 216 a, c dbSNP:543187177
315 315 c, t dbSNP:116903250
321 321 c, t dbSNP:185095788
395 395 a, g dbSNP:367948898
409 409 c, t dbSNP:761786167
413 413 c, t dbSNP:767408512
429 429 a, g dbSNP:749965678
446 446 a, g dbSNP:73251052
469 469 g, t dbSNP:150401144
477 477 c, g dbSNP:753562131
478 478 g, t dbSNP:529612835
489 489 a, g dbSNP:779472552
570 570 a, g dbSNP:748496296
579 579 a, c dbSNP:759042509
583 583 a, g dbSNP:549713327
597 597 a, c dbSNP:567930512
614 614 c, g dbSNP:747416986
623 623 a, c dbSNP:538469200
624 624 c, t dbSNP:776532676
660 660 c, t dbSNP:556779335
675 675 a, c dbSNP:190382829
685 685 c, t dbSNP:13230032
690 690 c, t dbSNP:769980789
717 717 c, g dbSNP:774167843
720 720 c, t dbSNP:761589732
727 727 a, c dbSNP:767408183
742 742 c, g dbSNP:773210635
745 745 c, g, t dbSNP:760493570
746 746 a, t dbSNP:753268141
766 766 a, g dbSNP:754720957
770 770 c, g dbSNP:764977929
778 778 c, g dbSNP:753171820
802 802 a, g dbSNP:537411703
808 808 c, t dbSNP:539116395
843 843 a, g dbSNP:113842436
849 849 c, t dbSNP:777933402
850 850 c, t dbSNP:531384573
860 860 a, g dbSNP:747581446
881 881 a, g dbSNP:751592577
884 884 a, c dbSNP:757656546
897 897 c, t dbSNP:553928524
904 904 c, t dbSNP:781379485
911 911 g, t dbSNP:745916292
915 915 c, g dbSNP:770065356
940 940 g, t dbSNP:775673987
941 941 c, t dbSNP:749450491
942 942 g, t dbSNP:572411891
958 958 a, g dbSNP:771901909
966 966 c, t dbSNP:772838347
970 970 c, t dbSNP:542580647
977 977 a, g dbSNP:777240362
987 987 c, g dbSNP:761779092
998 998 g, t dbSNP:770746273
1004 1004 c, t dbSNP:776349784
1005 1005 c, t dbSNP:759105808
1023 1023 a, c, g dbSNP:201631664
1027 1027 g, t dbSNP:794726946
1031 1031 c, t dbSNP:763622631
1032 1032 a, g dbSNP:752027836
1037 1037 c, t dbSNP:755764751
1038 1038 c, g, t dbSNP:767807372
1041 1041 c, t dbSNP:756570743
1044 1044 g, t dbSNP:780159262
1050 1050 c, t dbSNP:753832568
1051 1051 a, g dbSNP:755298833
1054 1054 a, g dbSNP:187691945
1064 1064 a, c, t dbSNP:201436002
1067 1067 c, g dbSNP:781096645
1068 1068 c, g, t dbSNP:745823970
1069 1069 a, c, g dbSNP:61734970
1071 1071 a, g dbSNP:768409597
1076 1076 c, t dbSNP:200962622
1077 1077 a, g dbSNP:749129743
1080 1080 c, t dbSNP:375009760
1081 1081 a, g dbSNP:200381918
1082 1082 c, t dbSNP:761213707
1088 1088 c, t dbSNP:766871133
1089 1089 c, g dbSNP:754010880
1097 1097 a, g dbSNP:61732569
1113 1113 c, t dbSNP:765294314
1118 1118 g, t dbSNP:752896209
1127 1127 a, g dbSNP:758646891
1131 1131 c, t dbSNP:545268162
1132 1132 a, g dbSNP:200225309
1136 1136 c, t dbSNP:756187054
1137 1137 g, t dbSNP:780125740
1145 1145 c, g dbSNP:749188339
1148 1148 a, g dbSNP:768052338
1154 1154 c, g, t dbSNP:116181849
1155 1155 a, g dbSNP:376874896
1156 1156 a, g dbSNP:61730252
1161 1161 c, t dbSNP:574668517
1162 1162 a, g dbSNP:374098657
1165 1165 c, g dbSNP:773497163
1176 1176 c, t dbSNP:777009380
1177 1177 a, g dbSNP:760049058
1179 1179 c, t dbSNP:745637661
1187 1187 -, c dbSNP:758547451
1188 1188 c, g dbSNP:765256799
1200 1200 c, t dbSNP:752800765
1203 1203 c, t dbSNP:748161528
1204 1204 a, g dbSNP:760967233
1211 1211 c, t dbSNP:555001257
1214 1214 c, g dbSNP:527504818
1255 1255 a, g dbSNP:113804701
1281 1281 c, g, t dbSNP:145035476
1291 1291 c, t dbSNP:534152176
1308 1308 c, t dbSNP:73671761
1335 1335 a, g dbSNP:114424995
1337 1337 c, t dbSNP:749457011
1342 1342 a, g dbSNP:4916935
1358 1358 c, g dbSNP:774647262
1372 1372 c, t dbSNP:771143426
1391 1391 a, g dbSNP:74674686
1397 1397 a, g dbSNP:6945992
1398 1398 a, g dbSNP:765662260
1411 1411 c, t dbSNP:556865982
1412 1412 a, c dbSNP:567144274
1445 1445 c, g dbSNP:773704162
1447 1447 c, t dbSNP:761143240
1466 1466 a, g dbSNP:184374606
1470 1470 a, g dbSNP:111739987
1472 1472 c, t dbSNP:555983709
1495 1495 a, g dbSNP:753320090
1503 1503 a, g dbSNP:62428649
1520 1520 c, t dbSNP:542458024
1521 1521 a, g dbSNP:538338097
1525 1525 a, g dbSNP:776952305
1538 1538 c, t dbSNP:556339983
1539 1539 a, g dbSNP:189197730
1555 1555 c, g dbSNP:763529713
1562 1562 c, t dbSNP:73040765
1563 1563 a, g, t dbSNP:150453564
1570 1570 a, g dbSNP:765006209
1573 1573 c, t dbSNP:752450004
1599 1599 c, g dbSNP:528187530
1610 1610 c, t dbSNP:6951112
1621 1621 c, t dbSNP:780850643
1624 1624 a, g dbSNP:181949161
1633 1633 a, g dbSNP:543514493
1645 1645 a, g dbSNP:539814552
1652 1652 g, t dbSNP:564794957
1667 1667 a, g dbSNP:532155025
1671 1671 c, g dbSNP:563995906
1693 1693 a, g dbSNP:138332959
1695 1695 a, g dbSNP:185861957
1696 1696 c, t dbSNP:189592408
1720 1720 c, t dbSNP:181240147
1721 1721 a, g dbSNP:567867416
1751 1751 a, g dbSNP:538018133
1786 1786 a, g dbSNP:749347274
1803 1803 a, g dbSNP:755131426
1808 1808 c, t dbSNP:369286137
1817 1817 c, t dbSNP:550268586
1822 1822 a, g dbSNP:531214628
1858 1858 c, g dbSNP:147146230
1875 1875 c, t dbSNP:779073914
1891 1891 a, g dbSNP:553739214
1931 1931 c, t dbSNP:572053858
1933 1933 c, t dbSNP:111581245
1943 1943 a, g dbSNP:748434092
1980 1980 c, t dbSNP:536146160
1987 1987 a, c dbSNP:10280417
1988 1988 a, c dbSNP:12540534
2005 2005 c, t dbSNP:751044434
2007 2007 a, c dbSNP:543225010
2008 2008 c, g dbSNP:4916972
2009 2009 a, g dbSNP:186740074
2011 2011 a, g dbSNP:541064146
2031 2031 g, t dbSNP:771372153
2044 2044 a, g dbSNP:551305084
2055 2055 a, g dbSNP:559389201
2073 2073 c, g dbSNP:529672236
2086 2086 -, t dbSNP:34074153
2090 2090 c, t dbSNP:558018913
2100 2100 a, g dbSNP:79794347
2110 2110 a, g dbSNP:12672929
2142 2142 c, t dbSNP:62428650
2145 2145 a, c dbSNP:549703538
2157 2157 c, t dbSNP:775279202
2161 2161 c, t dbSNP:550091840
2162 2162 a, g dbSNP:762756035
2165 2165 c, t dbSNP:571752443
2166 2166 a, g dbSNP:191182546
2224 2224 c, g dbSNP:34426530
2236 2236 a, g dbSNP:144057186
2276 2276 c, t dbSNP:534319018
2282 2282 c, t dbSNP:565747388
2288 2288 a, g dbSNP:552591677
2365 2365 c, g dbSNP:554466062
2369 2369 c, t dbSNP:576236150
2373 2373 c, t dbSNP:753315590
2386 2386 a, g dbSNP:757165962
2401 2401 c, t dbSNP:537289329
2402 2402 a, g dbSNP:558465360
2425 2425 c, t dbSNP:73251064
2426 2426 a, g dbSNP:138621633
2476 2476 c, t dbSNP:4075862
2496 2496 a, g dbSNP:574505362
2512 2512 a, c dbSNP:73671766
2513 2513 a, g dbSNP:561657423
2515 2515 a, g dbSNP:7799786
2547 2547 c, t dbSNP:779022508
2556 2556 a, g dbSNP:771066359
2560 2560 c, g dbSNP:748311341
2563 2563 a, g dbSNP:544039830
2603 2603 a, g dbSNP:781577218
2605 2605 a, g dbSNP:758624208
2628 2628 a, g dbSNP:182878921
2690 2690 a, g dbSNP:532701017
2698 2698 c, t dbSNP:747357631
2715 2715 a, g dbSNP:4244221
2720 2720 a, t dbSNP:75268097
2722 2722 c, t dbSNP:186147002
2732 2732 c, g dbSNP:190954016
2738 2738 c, t dbSNP:775112650
2748 2748 c, g dbSNP:569977312
2774 2774 c, t dbSNP:746456979
2778 2778 c, t dbSNP:147386503
2791 2791 gtg, taa dbSNP:386709038
2798 2798 c, t dbSNP:558771696
2808 2808 c, t dbSNP:775157763
2811 2811 c, t dbSNP:762651478
2854 2854 c, g dbSNP:80060214
2860 2860 c, t dbSNP:534779740
2872 2872 g, t dbSNP:768502204
2874 2874 a, g dbSNP:545879453
2877 2877 -, ctttgt dbSNP:199777552
2891 2891 a, g dbSNP:148429133
2930 2930 c, t dbSNP:541886978
2938 2938 a, g dbSNP:370760944
2944 2944 c, g dbSNP:183526417
2947 2947 c, t dbSNP:187575362
2952 2952 g, t dbSNP:543767768
2967 2967 c, g dbSNP:767411619
2972 2972 c, t dbSNP:142636244
2978 2978 c, t dbSNP:4074119
3005 3005 c, g dbSNP:528697446
3006 3006 a, g dbSNP:541205661
3018 3018 c, t dbSNP:150550879
3090 3090 a, g dbSNP:760619009
3102 3102 a, c dbSNP:139622532
3107 3107 c, t dbSNP:548227264
3118 3118 g, t dbSNP:569955662
3146 3146 a, g dbSNP:113406616
3150 3150 c, t dbSNP:192813494
3180 3180 g, t dbSNP:758567799
3238 3238 a, g dbSNP:4074118
3262 3262 a, g dbSNP:751848889
3274 3274 c, g dbSNP:760240431
3275 3275 a, g dbSNP:765674901
3277 3277 g, t dbSNP:370357638
3278 3278 a, g dbSNP:374829717
3284 3284 c, t dbSNP:182588588
3289 3289 g, t dbSNP:373568420
3331 3331 c, t dbSNP:570701601
3343 3343 c, t dbSNP:563163341
3350 3350 c, t dbSNP:746307002
3363 3363 a, g dbSNP:368907110
3380 3380 c, t dbSNP:553191826
3381 3381 c, t dbSNP:58698542
3404 3404 a, c dbSNP:535547699
3415 3415 -, ag dbSNP:560050343
3422 3422 a, g dbSNP:778427382
3461 3461 c, t dbSNP:188100436
3465 3465 a, g dbSNP:779659160
3495 3495 c, g dbSNP:115236224
3538 3538 c, g dbSNP:116679737
3550 3550 a, g dbSNP:114519399
3553 3553 a, c dbSNP:748780764
3554 3554 a, g dbSNP:113494499
3559 3559 c, g dbSNP:373531064
3563 3563 c, g dbSNP:577107002
3578 3578 c, t dbSNP:6959125
3591 3591 c, t dbSNP:559520908
3645 3645 a, g dbSNP:574647919
3650 3650 c, t dbSNP:761584049
3665 3665 -, g dbSNP:35458404
3670 3670 c, t dbSNP:541969314
3671 3671 a, g dbSNP:191752179
3682 3682 a, g dbSNP:773063355
3699 3699 c, t dbSNP:111872691
3706 3706 a, g dbSNP:375245018
3720 3720 a, g dbSNP:757469705
3726 3726 c, t dbSNP:115384904
3751 3751 a, g dbSNP:766326729
3757 3757 c, g dbSNP:753823316
3775 3775 g, t dbSNP:552526145
3788 3788 g, t dbSNP:564411570
3798 3798 c, t dbSNP:528391012
3821 3821 c, t dbSNP:184242553
3853 3853 a, g dbSNP:546868794
3857 3857 c, t dbSNP:548744124
3860 3860 g, t dbSNP:189042089
3872 3872 c, t dbSNP:74868620
3874 3874 g, t dbSNP:550426617
3894 3894 c, t dbSNP:764303911
3899 3899 a, t dbSNP:373143183
3916 3916 a, g dbSNP:377106640
3945 3945 a, t dbSNP:568913724
3960 3960 c, t dbSNP:192432076
4009 4009 c, t dbSNP:564850199
4010 4010 c, t dbSNP:555225422
4037 4037 a, g dbSNP:769882707
4084 4084 ctg, tta dbSNP:386709039
4084 4084 c, t dbSNP:118033279
4086 4086 a, g dbSNP:28665191
4119 4119 c, g dbSNP:553211365
4137 4137 c, t dbSNP:532209678
4156 4156 a, g dbSNP:73251070
4170 4170 c, t dbSNP:117028165
4186 4186 a, g dbSNP:570959181
4190 4190 a, g dbSNP:575680902
4223 4223 c, t dbSNP:545921321
4230 4230 c, g dbSNP:564474593
4287 4287 c, t dbSNP:528454545
4290 4290 -, c dbSNP:527562454
4297 4297 c, g dbSNP:546930090
4317 4317 a, g dbSNP:538196296
4334 4334 c, t dbSNP:774288403
4335 4335 a, g dbSNP:56015142
4345 4345 c, t dbSNP:529106630
4352 4352 c, t dbSNP:146550939
4356 4356 a, c dbSNP:113241771
4369 4369 g, t dbSNP:185846740
4383 4383 a, c dbSNP:771641185
4401 4401 c, t dbSNP:551145326
4406 4406 c, t dbSNP:189149354
4407 4407 c, g dbSNP:573207248
4413 4413 a, g dbSNP:566142887
4473 4473 a, t dbSNP:79240719
4482 4482 c, t dbSNP:141251736
4532 4532 c, g dbSNP:574774885
4560 4560 -, at dbSNP:199897083
4565 4565 c, t dbSNP:778496487
4579 4579 a, g dbSNP:562132517
4580 4580 c, t dbSNP:535706978
4591 4591 -, c dbSNP:754910252
4601 4601 c, t dbSNP:772682422
4607 4607 a, g dbSNP:116267035
4620 4620 a, t dbSNP:117000693
4625 4625 c, t dbSNP:10270445
4647 4647 a, g dbSNP:145785562
4650 4650 c, g dbSNP:573295747
4672 4672 c, t dbSNP:74917011
4675 4675 c, t dbSNP:547498202
4734 4734 a, g dbSNP:117941444
4747 4747 a, c dbSNP:760441207
4757 4757 a, g dbSNP:12718123

Target ORF information:

RefSeq Version XM_011515457
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens family with sequence similarity 20, member C (FAM20C), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.