Email to GenScript

PTEN phosphatase and tensin homolog [Homo sapiens (human)]

Gene Symbol PTEN
Entrez Gene ID 5728
Full Name phosphatase and tensin homolog
Synonyms 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, TEP1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]. lac of sum
Disorder MIM:


Disorder Html: Cowden disease, 158350 (3); Lhermitte-Duclos syndrome, 158350 (3); Bannayan-Riley-Ruvalcaba syndrome, 153480 (3); {Meningioma}, 607174 (3);

The following PTEN gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PTEN gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59999 NM_001304717 Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu44441 XM_006717926 PREDICTED: Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu60000 XM_011539981 PREDICTED: Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu60001 XM_011539982 PREDICTED: Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu60002 NM_001304718 Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199
OHu27709 NM_000314 Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector in pcDNA3.1+/C-(K)DYK $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu59999
Accession Version NM_001304717.2
Sequence Information ORF Nucleotide Sequence (Length: 1731bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 10-JUL-2015
Organism Homo sapiens (human)
Product phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN isoform PTEN-L
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U92436.1, AC063965.8, BC005821.2 and AA836562.1. On Apr 1, 2015 this sequence version replaced gi:754502061. Summary: This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]. Transcript Variant: This variant (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longest isoform (PTEN-L, PMID:23744781; also known as PTENalpha, PMID: 24768297) is derived from the use of an upstream non-AUG (CUG) start codon, while two shorter isoforms are derived from downstream AUG start codons. PTEN-L, initiates with a Leucine, rather than a Methionine, is thought to be preferentially associated with the mitochondrial inner membrane (PMID: 24768297), and is represented in this RefSeq. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U92436.1, BC005821.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## non-AUG initiation codon :: PMID: 23744781, 24768297 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)318..320(+)
Misc Feature(2)1032..1034(+)
Misc Feature(3)1305..1580(+)
Misc Feature(4)1305..1424(+)
Misc Feature(5)1593..2078(+)
Exon (1)1..1110
Gene Synonym:
Exon (2)1111..1195
Gene Synonym:
Exon (3)1196..1240
Gene Synonym:
Exon (4)1241..1284
Gene Synonym:
Exon (5)1285..1523
Gene Synonym:
Exon (6)1524..1665
Gene Synonym:
Exon (7)1666..1832
Gene Synonym:
Exon (8)1833..2057
Gene Synonym:
Exon (9)2058..8701
Gene Synonym:
Position Chain Variation Link
3 3 -, gccct dbSNP:587781357
3 3 g, t dbSNP:587781524
5 5 a, c dbSNP:587781128
6 6 a, c dbSNP:34149102
19 19 g, t dbSNP:786204923
30 30 a, c dbSNP:786202476
39 39 c, g dbSNP:587780002
43 43 c, t dbSNP:786204924
45 45 c, t dbSNP:786202097
48 48 -, tcgcctcccgc dbSNP:587782811
53 53 c, g dbSNP:786203535
57 57 a, c, g dbSNP:587780001
60 60 c, t dbSNP:587781603
76 76 c, g dbSNP:786205433
86 86 c, t dbSNP:567739104
89 89 c, t dbSNP:587779999
90 90 a, g dbSNP:786204935
98 98 c, g dbSNP:786203534
99 99 a, g dbSNP:786203419
102 102 a, g dbSNP:587781959
109 109 c, t dbSNP:786204936
111 111 a, g dbSNP:786203676
112 112 a, g dbSNP:786204937
120 120 c, t dbSNP:535142665
123 123 c, t dbSNP:550385924
125 125 g, t dbSNP:587779998
128 128 a, c dbSNP:587779997
129 129 a, g dbSNP:1044322
135 135 c, g dbSNP:587781981
140 140 c, t dbSNP:786204938
145 145 c, t dbSNP:587782793
150 150 -, gggactctttatgcgctgcggc dbSNP:786204888
163 163 c, t dbSNP:786204939
164 164 c, g, t dbSNP:587782133
168 168 c, t dbSNP:537241946
170 170 g, t dbSNP:587781706
171 171 c, g, t dbSNP:587776675
176 176 c, g dbSNP:587779996
182 182 c, t dbSNP:559145151
186 186 -, ggcgctgggacgcgactgcgctc dbSNP:786204889
186 186 c, t dbSNP:786204860
187 187 a, c dbSNP:786204861
189 189 c, t dbSNP:587779995
193 193 c, g dbSNP:587781920
195 195 c, t dbSNP:786201900
196 196 c, t dbSNP:786204940
197 197 g, t dbSNP:587782253
198 198 c, t dbSNP:587779994
201 201 a, g dbSNP:587781938
211 211 c, g dbSNP:587779993
234 234 c, g dbSNP:587779992
235 235 a, g dbSNP:577569375
236 236 g, t dbSNP:786204941
238 238 c, g dbSNP:786204942
261 261 a, c dbSNP:587781883
262 262 a, g dbSNP:786202516
265 265 g, t dbSNP:587779991
267 267 a, g dbSNP:587782580
268 268 a, g dbSNP:587776674
290 290 c, t dbSNP:786204945
299 299 -, g dbSNP:786204891
299 299 a, g dbSNP:786205432
303 303 c, g dbSNP:786204869
305 305 c, t dbSNP:786204870
319 319 a, g dbSNP:587779989
332 332 a, g dbSNP:587779988
341 341 c, t dbSNP:587779987
347 347 a, g dbSNP:786204874
359 359 c, t dbSNP:557053666
360 360 c, t dbSNP:786204947
365 365 c, t dbSNP:786204948
366 366 a, g dbSNP:587779986
367 367 a, g dbSNP:553371022
370 370 -, gcagcggcggcg dbSNP:786204880
395 395 c, t dbSNP:574873281
440 440 a, g dbSNP:375557261
442 442 a, g dbSNP:35736544
455 455 c, t dbSNP:563629336
456 456 c, t dbSNP:575733984
484 484 -, gcg dbSNP:531157350
500 500 g, t dbSNP:545639327
501 501 -, ggc dbSNP:34413673
501 501 c, t dbSNP:564308116
519 519 c, g dbSNP:528340982
520 520 a, g dbSNP:546504608
522 522 a, g dbSNP:12573787
614 614 c, t dbSNP:528834090
688 688 a, c dbSNP:550595518
706 706 c, g dbSNP:2943772
725 725 a, c dbSNP:539526332
748 748 c, t dbSNP:552470098
752 752 c, t dbSNP:571072832
764 764 c, t dbSNP:11538382
767 767 a, g dbSNP:535269453
840 840 c, t dbSNP:553682570
867 867 c, g dbSNP:575260016
876 876 c, g dbSNP:535471450
880 880 a, g dbSNP:369849061
884 884 c, g dbSNP:575602488
921 921 a, g dbSNP:761148721
932 932 c, t dbSNP:546299914
941 941 c, t dbSNP:766830242
975 975 c, t dbSNP:572922017
981 981 c, t dbSNP:760696127
987 987 c, t dbSNP:763993091
998 998 -, ctc dbSNP:749497048
1000 1000 c, t dbSNP:376610243
1003 1003 c, t dbSNP:761265816
1004 1004 c, t dbSNP:764917503
1006 1006 c, t dbSNP:750098228
1007 1007 c, t dbSNP:786204909
1018 1018 a, c, g dbSNP:755295390
1020 1020 a, g dbSNP:753142719
1021 1021 a, g dbSNP:756632919
1023 1023 c, g dbSNP:11202592
1024 1024 c, t dbSNP:749356977
1031 1031 c, t dbSNP:770965327
1048 1048 -, aa dbSNP:121913290
1052 1052 -, gatcgttagcagaaaca dbSNP:786204882
1052 1052 -, ga dbSNP:786204881
1059 1059 a, g dbSNP:572685299
1067 1067 c, g dbSNP:587781957
1071 1071 -, a dbSNP:587776671
1073 1073 -, g dbSNP:786202786
1075 1075 g, t dbSNP:398123324
1077 1077 -, t dbSNP:786204883
1079 1079 a, t dbSNP:587782187
1080 1080 c, t dbSNP:786204910
1081 1081 -, aa dbSNP:587781912
1086 1086 a, g dbSNP:121909233
1088 1088 g, t dbSNP:540063602
1097 1097 c, t dbSNP:786201335
1101 1101 a, c, g, t dbSNP:786201995
1104 1104 g, t dbSNP:398123326
1105 1105 c, t dbSNP:786204912
1106 1106 a, g dbSNP:786201506
1108 1108 c, t dbSNP:786204853
1109 1109 c, t dbSNP:786201280
1110 1110 a, t dbSNP:746128825
1112 1112 -, ct dbSNP:786203477
1116 1116 -, tatc dbSNP:786204894
1119 1119 a, c dbSNP:794727243
1130 1130 c, t dbSNP:786201650
1135 1135 g, t dbSNP:121909225
1136 1136 ac, gg dbSNP:786202517
1137 1137 c, g dbSNP:786204854
1143 1143 c, t dbSNP:587780004
1145 1145 g, t dbSNP:748040144
1148 1148 -, a dbSNP:786204895
1153 1153 g, t dbSNP:794727244
1159 1159 -, tga dbSNP:786204896
1163 1163 a, c, t dbSNP:150651961
1165 1165 -, gcgt dbSNP:786202894
1168 1168 a, g dbSNP:786204915
1170 1170 a, g dbSNP:786204855
1175 1175 c, t dbSNP:762518389
1189 1189 a, t dbSNP:786203375
1190 1190 a, g dbSNP:189583426
1191 1191 a, g dbSNP:786204916
1198 1198 g, t dbSNP:748031178
1201 1201 g, t dbSNP:786202398
1205 1205 c, t dbSNP:769719835
1212 1212 c, g dbSNP:121909236
1213 1213 a, g, t dbSNP:398123316
1221 1221 c, t dbSNP:587781535
1224 1224 g, t dbSNP:587780005
1233 1233 a, c, t dbSNP:398123317
1235 1235 c, t dbSNP:773176120
1237 1237 a, g dbSNP:786204922
1239 1239 c, t dbSNP:794727480
1240 1240 c, t dbSNP:121909226
1253 1253 -, aaga dbSNP:786204898
1253 1253 a, g dbSNP:781542973
1261 1261 a, g dbSNP:747865777
1262 1262 c, t dbSNP:755953294
1264 1264 a, c dbSNP:777640028
1265 1265 c, t dbSNP:35917308
1266 1266 a, g dbSNP:202004587
1269 1269 a, c dbSNP:786204925
1289 1289 a, g dbSNP:587780710
1292 1292 a, g dbSNP:149772796
1296 1296 c, t dbSNP:587783059
1307 1307 a, c dbSNP:779530981
1308 1308 c, g dbSNP:786204927
1309 1309 a, g dbSNP:121909238
1310 1310 c, t dbSNP:145695240
1315 1315 c, t dbSNP:786204856
1317 1317 c, t dbSNP:398123320
1319 1319 a, g dbSNP:746661067
1320 1320 c, t dbSNP:786204928
1324 1324 g, t dbSNP:781647403
1325 1325 a, g dbSNP:770224289
1332 1332 a, t dbSNP:786204857
1335 1335 a, c dbSNP:786202944
1337 1337 -, aaa dbSNP:587782641
1345 1345 a, g dbSNP:587782343
1350 1350 a, g dbSNP:57374291
1351 1351 a, g dbSNP:786204858
1352 1352 c, t dbSNP:372876243
1352 1352 -, t dbSNP:786204899
1358 1358 c, t dbSNP:763477642
1361 1361 a, g dbSNP:786201929
1362 1362 c, t dbSNP:398123321
1366 1366 c, t dbSNP:121909230
1369 1369 g, t dbSNP:587781254
1374 1374 a, g dbSNP:145124907
1378 1378 -, acaat dbSNP:587776666
1380 1380 a, c dbSNP:771310592
1381 1381 a, g dbSNP:551221430
1386 1386 c, g dbSNP:139767111
1389 1389 a, g dbSNP:786204930
1391 1391 a, c dbSNP:759485888
1393 1393 c, g dbSNP:121909237
1395 1395 a, g dbSNP:786202740
1398 1398 c, t dbSNP:786204931
1399 1399 a, g dbSNP:121909222
1401 1401 c, g, t dbSNP:121909223
1410 1410 a, g dbSNP:587781255
1411 1411 g, t dbSNP:398123322
1416 1416 a, g dbSNP:786204929
1417 1417 a, g dbSNP:121909218
1419 1419 c, g, t dbSNP:121909224
1420 1420 a, c, g dbSNP:121909229
1420 1420 -, g dbSNP:121913292
1422 1422 a, t dbSNP:786204932
1423 1423 c, t dbSNP:397514560
1426 1426 a, g, t dbSNP:121909241
1434 1434 a, g dbSNP:587782360
1435 1435 c, t dbSNP:370795352
1436 1436 -, a dbSNP:398123323
1437 1437 c, t dbSNP:786201044
1438 1438 a, g dbSNP:786204859
1442 1442 a, g dbSNP:144545031
1455 1455 c, g, t dbSNP:746152219
1456 1456 a, g dbSNP:753630034
1459 1459 a, g dbSNP:786202047
1468 1468 a, t dbSNP:786204933
1471 1471 a, g dbSNP:757087471
1475 1475 a, c dbSNP:778663292
1478 1478 a, g dbSNP:750401982
1479 1479 g, t dbSNP:786204934
1481 1481 a, g dbSNP:757777398
1487 1487 a, g dbSNP:779626613
1488 1488 c, g dbSNP:9651492
1494 1494 a, t dbSNP:398123325
1500 1500 g, t dbSNP:121909220
1506 1506 a, g dbSNP:786202688
1511 1511 c, t dbSNP:746574957
1519 1519 a, g dbSNP:786202753
1522 1522 -, a dbSNP:786204900
1523 1523 a, c, g dbSNP:146629065
1524 1524 g, t dbSNP:587782603
1525 1525 g, t dbSNP:786204863
1527 1527 a, g dbSNP:780943695
1531 1531 a, c dbSNP:397514559
1538 1538 -, c dbSNP:587776673
1541 1541 a, t dbSNP:121909221
1542 1542 c, t dbSNP:786204864
1543 1543 a, g dbSNP:786204865
1548 1548 c, t dbSNP:121913293
1549 1549 a, c, g dbSNP:121913294
1551 1551 a, t dbSNP:587782316
1553 1553 c, t dbSNP:786201867
1557 1557 -, tat dbSNP:587780711
1558 1558 a, g dbSNP:757498880
1564 1564 a, g dbSNP:786204866
1565 1565 at, ta dbSNP:397515374
1565 1565 a, c, g, t dbSNP:104894184
1568 1568 c, t dbSNP:779349848
1569 1569 c, t dbSNP:746280047
1571 1571 c, g dbSNP:786202733
1576 1576 c, t dbSNP:794729664
1578 1578 aag, t dbSNP:786204890
1582 1582 a, t dbSNP:587781895
1586 1586 c, t dbSNP:757799618
1591 1591 a, g dbSNP:786204943
1595 1595 a, t dbSNP:606231170
1604 1604 a, g dbSNP:374478092
1608 1608 c, t dbSNP:772631069
1610 1610 a, g dbSNP:568851024
1616 1616 -, t dbSNP:786204901
1617 1617 -, c dbSNP:587776670
1625 1625 a, g dbSNP:747072478
1627 1627 c, t dbSNP:587781538
1629 1629 g, t dbSNP:587782473
1630 1630 c, t dbSNP:786204867
1635 1635 a, t dbSNP:786204944
1641 1641 c, g dbSNP:786204868
1643 1643 a, g dbSNP:539074063
1644 1644 a, g dbSNP:776763121
1649 1649 c, t dbSNP:786202773
1655 1655 c, t dbSNP:370162160
1656 1656 a, g dbSNP:765433422
1664 1664 a, c dbSNP:121909232
1671 1671 c, t dbSNP:121909227
1680 1680 a, g dbSNP:121909234
1690 1690 c, t dbSNP:141373793
1699 1699 a, t dbSNP:778528056
1703 1703 a, g dbSNP:786204946
1712 1712 c, g, t dbSNP:768662424
1714 1714 a, g dbSNP:748240670
1716 1716 a, t dbSNP:587781998
1727 1727 -, a dbSNP:587776669
1728 1728 c, t dbSNP:121909219
1729 1729 a, g dbSNP:770025422
1731 1731 c, t dbSNP:786201730
1732 1732 a, g dbSNP:121909235
1737 1737 -, g dbSNP:786202529
1742 1742 a, g dbSNP:773353820
1746 1746 a, g dbSNP:786201758
1747 1747 g, t dbSNP:786204871
1751 1751 c, t dbSNP:190070312
1753 1753 c, t dbSNP:121909240
1754 1754 c, t dbSNP:17849090
1764 1764 c, t dbSNP:786202918
1768 1768 c, t dbSNP:587782350
1769 1769 a, g dbSNP:774364894
1770 1770 -, at dbSNP:786204902
1772 1772 -, a dbSNP:587782341
1774 1774 c, g dbSNP:759560822
1775 1775 -, tg dbSNP:780264945
1781 1781 c, t dbSNP:767623493
1786 1786 a, g dbSNP:121909239
1789 1789 -, tcaa dbSNP:786204903
1790 1790 c, t dbSNP:752250585
1792 1792 -, aagta dbSNP:606231169
1797 1797 g, t dbSNP:121909228
1802 1802 -, ct dbSNP:786204904
1803 1803 -, tt dbSNP:587781354
1812 1812 c, t dbSNP:730882131
1814 1814 a, g dbSNP:760146269
1816 1816 a, g dbSNP:763784377
1824 1824 c, g dbSNP:786204872
1831 1831 -, a dbSNP:121913289
1833 1833 -, g dbSNP:587776672
1835 1835 a, c dbSNP:398123328
1843 1843 c, t dbSNP:142420551
1852 1852 a, g dbSNP:786204875
1853 1853 a, g dbSNP:587782607
1861 1861 a, c, t dbSNP:398123329
1862 1862 a, g dbSNP:376886779
1872 1872 c, g dbSNP:750705904
1881 1881 g, t dbSNP:786202840
1886 1886 a, g dbSNP:751888926
1896 1896 a, g dbSNP:562015640
1899 1899 c, g dbSNP:35600253
1901 1901 a, g dbSNP:529155918
1906 1906 -, a dbSNP:786204905
1913 1913 g, t dbSNP:143335584
1914 1914 c, t dbSNP:756152824
1915 1915 -, tt dbSNP:587780006
1916 1916 a, g dbSNP:587780713
1917 1917 c, t dbSNP:786202207
1920 1920 g, t dbSNP:370064195
1921 1921 -, at dbSNP:267602610
1923 1923 -, c dbSNP:786204884
1923 1923 c, g, t dbSNP:371387815
1931 1931 c, t dbSNP:550122918
1932 1932 a, g dbSNP:758644748
1936 1936 a, g dbSNP:745638189
1939 1939 g, t dbSNP:772018727
1944 1944 a, g dbSNP:775461980
1945 1945 a, g dbSNP:587780007
1947 1947 a, g dbSNP:786203858
1950 1950 c, g, t dbSNP:746930141
1954 1954 a, g dbSNP:786201507
1959 1959 -, gtgca dbSNP:786204906
1968 1968 -, aagga dbSNP:764753843
1970 1970 a, g dbSNP:562164491
1977 1977 -, ctagtac dbSNP:775171435
1979 1979 a, g dbSNP:775997892
1986 1986 -, actt dbSNP:146650273
1986 1986 -, a dbSNP:786204892
1987 1987 -, cttt dbSNP:398123330
1987 1987 a, c, t dbSNP:761350690
1995 1995 a, t dbSNP:786202004
1997 1997 a, g dbSNP:786201392
1999 1999 -, a dbSNP:587783058
1999 1999 -, a dbSNP:121913291
2012 2012 a, g dbSNP:772872626
2015 2015 -, aaat dbSNP:587782304
2018 2018 -, taaa dbSNP:786204893
2034 2034 c, t dbSNP:121909231
2039 2039 c, t dbSNP:786201816
2049 2049 a, c, g dbSNP:759852661
2057 2057 c, g dbSNP:398123314
2071 2071 -, a dbSNP:398123315
2075 2075 a, g dbSNP:747606399
2081 2081 a, g dbSNP:769324650
2083 2083 -, tag dbSNP:587780003
2090 2090 a, g dbSNP:772784762
2092 2092 a, c, t dbSNP:375709098
2093 2093 a, g dbSNP:786202751
2097 2097 a, c, g, t dbSNP:587782345
2102 2102 a, g dbSNP:764488459
2109 2109 a, g dbSNP:587781273
2117 2117 a, g dbSNP:761948873
2118 2118 a, g dbSNP:765416558
2119 2119 a, c dbSNP:750585255
2124 2124 a, g dbSNP:758542021
2135 2135 a, c, t dbSNP:35979531
2136 2136 a, g dbSNP:587782224
2161 2161 a, t dbSNP:751286806
2202 2202 c, t dbSNP:786203911
2218 2218 a, g dbSNP:754821870
2219 2219 a, g dbSNP:786202062
2228 2228 a, g dbSNP:374684043
2244 2244 -, t dbSNP:756681683
2245 2245 -, t dbSNP:766924726
2251 2251 g, t dbSNP:727504115
2252 2252 g, t dbSNP:748082411
2253 2253 a, t dbSNP:769236743
2253 2253 -, t dbSNP:786204876
2266 2266 a, g dbSNP:777252107
2270 2270 a, c dbSNP:748897412
2272 2272 c, g dbSNP:770460423
2280 2280 a, c dbSNP:774105075
2281 2281 g, t dbSNP:760901642
2291 2291 c, t dbSNP:368984469
2294 2294 a, g dbSNP:769098710
2308 2308 c, t dbSNP:1044487
2318 2318 a, t dbSNP:74535369
2320 2320 a, t dbSNP:74489567
2326 2326 a, g dbSNP:537081967
2340 2340 -, a dbSNP:578049537
2363 2363 c, t dbSNP:774400345
2459 2459 a, g dbSNP:558365328
2468 2468 g, t dbSNP:3895069
2525 2525 a, g dbSNP:576872432
2563 2563 g, t dbSNP:3895070
2578 2578 a, t dbSNP:545229150
2596 2596 c, t dbSNP:181234898
2633 2633 c, t dbSNP:746867863
2664 2664 c, t dbSNP:141648241
2677 2677 c, g dbSNP:376860960
2707 2707 a, g dbSNP:2673835
2718 2718 c, t dbSNP:541039409
2737 2737 a, g dbSNP:560599448
2746 2746 c, g dbSNP:1044492
2791 2791 -, tg dbSNP:774674775
2796 2796 a, c dbSNP:561279008
2830 2830 c, t dbSNP:531589996
2833 2833 a, t dbSNP:183510626
2844 2844 a, g dbSNP:371547288
2849 2849 c, t dbSNP:532648593
2862 2862 g, t dbSNP:761682131
2877 2877 -, a dbSNP:530317615
2880 2880 a, t dbSNP:770650569
2889 2889 c, g dbSNP:776368591
2894 2894 g, t dbSNP:547244072
2897 2897 c, t dbSNP:540531969
2898 2898 a, g dbSNP:756513970
2900 2900 -, t dbSNP:543873570
2936 2936 a, g dbSNP:769858445
3031 3031 c, t dbSNP:138309082
3082 3082 a, g dbSNP:529945687
3093 3093 c, t dbSNP:548492439
3099 3099 c, t dbSNP:570010681
3103 3103 a, g dbSNP:759474309
3105 3105 a, g dbSNP:536995550
3145 3145 c, t dbSNP:749778496
3154 3154 c, t dbSNP:765100893
3172 3172 a, c dbSNP:558530548
3184 3184 c, t dbSNP:570416975
3200 3200 g, t dbSNP:2735347
3213 3213 a, c dbSNP:773513402
3217 3217 c, t dbSNP:532759542
3258 3258 c, t dbSNP:534737012
3271 3271 c, t dbSNP:775039992
3278 3278 g, t dbSNP:369992151
3362 3362 a, t dbSNP:376153776
3367 3367 -, t dbSNP:547262170
3376 3376 c, t dbSNP:2736630
3385 3385 g, t dbSNP:552819280
3395 3395 c, t dbSNP:552354954
3432 3432 c, t dbSNP:569316988
3480 3480 a, g dbSNP:547879223
3576 3576 a, g dbSNP:542854347
3588 3588 a, g dbSNP:188246270
3603 3603 a, g dbSNP:373943966
3612 3612 a, t dbSNP:576331425
3638 3638 a, c dbSNP:79395513
3673 3673 g, t dbSNP:35460383
3674 3674 -, ttttttttttttttt dbSNP:201131651
3676 3676 g, t dbSNP:762987781
3677 3677 -, ttg dbSNP:563751927
3682 3682 -, g dbSNP:764649748
3684 3684 g, t dbSNP:34885400
3701 3701 -, tt dbSNP:5786797
3703 3703 a, t dbSNP:35632884
3706 3706 -, ttt dbSNP:78439318
3708 3708 g, t dbSNP:11202606
3742 3742 c, t dbSNP:180953647
3756 3756 a, g dbSNP:775659811
3759 3759 c, t dbSNP:701848
3774 3774 -, a dbSNP:550961951
3781 3781 a, t dbSNP:541494941
3803 3803 a, c dbSNP:751151588
3808 3808 a, c, g dbSNP:34140758
3818 3818 g, t dbSNP:529908733
3826 3826 a, g dbSNP:548599209
3863 3863 c, t dbSNP:568474293
3874 3874 -, t dbSNP:201650436
3887 3887 a, g dbSNP:2142135
3921 3921 c, g dbSNP:569923405
3938 3938 a, c dbSNP:141857855
3940 3940 a, g dbSNP:35481105
3945 3945 a, g dbSNP:150265244
3956 3956 a, g dbSNP:754704111
3988 3988 a, g dbSNP:116248217
4041 4041 c, t dbSNP:546939869
4047 4047 -, a dbSNP:756887853
4048 4048 g, t dbSNP:768027159
4068 4068 a, g dbSNP:553022623
4076 4076 a, t dbSNP:772654487
4118 4118 c, t dbSNP:762499494
4136 4136 c, t dbSNP:750754949
4188 4188 a, g dbSNP:567800059
4197 4197 a, t dbSNP:35914322
4198 4198 a, t dbSNP:41284072
4200 4200 a, t dbSNP:576294635
4204 4204 c, t dbSNP:754624881
4226 4226 c, t dbSNP:138981406
4267 4267 g, t dbSNP:544118607
4293 4293 a, t dbSNP:559017397
4296 4296 a, c dbSNP:577156522
4308 4308 a, g dbSNP:192484947
4316 4316 g, t dbSNP:558501841
4352 4352 g, t dbSNP:754229502
4357 4357 a, g dbSNP:181468070
4405 4405 a, g dbSNP:574993688
4409 4409 c, t dbSNP:542009439
4416 4416 c, t dbSNP:186996550
4428 4428 c, t dbSNP:11202607
4431 4431 a, g dbSNP:754989049
4447 4447 a, t dbSNP:552431817
4466 4466 g, t dbSNP:745975387
4504 4504 -, tta dbSNP:775116816
4551 4551 g, t dbSNP:564263681
4556 4556 a, g dbSNP:780059644
4564 4564 a, g dbSNP:528086505
4658 4658 c, g dbSNP:34761252
4670 4670 a, t dbSNP:567776779
4675 4675 a, t dbSNP:190099872
4748 4748 c, t dbSNP:149401400
4750 4750 c, t dbSNP:548348131
4758 4758 a, g dbSNP:569895598
4794 4794 a, g dbSNP:537283839
4802 4802 -, tg dbSNP:745440689
5016 5016 -, aagtg dbSNP:763833268
5029 5029 c, t dbSNP:574096019
5059 5059 a, g dbSNP:368180514
5064 5064 -, agt dbSNP:776568434
5064 5064 a, t dbSNP:11591427
5070 5070 g, t dbSNP:182746814
5090 5090 a, t dbSNP:371289955
5141 5141 a, g dbSNP:540495271
5199 5199 a, g dbSNP:187266004
5213 5213 g, t dbSNP:574955389
5255 5255 c, t dbSNP:542319798
5274 5274 a, g dbSNP:563805612
5359 5359 a, g dbSNP:575385694
5393 5393 a, g dbSNP:545725183
5471 5471 c, t dbSNP:189780354
5535 5535 g, t dbSNP:747959604
5553 5553 c, g dbSNP:528385253
5599 5599 a, g dbSNP:546156099
5648 5648 -, t dbSNP:201866164
5665 5665 a, g dbSNP:183009813
5686 5686 -, a dbSNP:763859619
5686 5686 a, g dbSNP:769667659
5696 5696 a, c dbSNP:528887876
5702 5702 a, c dbSNP:550247784
5704 5704 a, c dbSNP:55761968
5706 5706 a, g dbSNP:535200721
5713 5713 -, c dbSNP:71487196
5730 5730 -, g dbSNP:71487197
5758 5758 a, g dbSNP:188761136
5771 5771 c, g dbSNP:773167486
5778 5778 a, t dbSNP:7899343
5780 5780 a, c dbSNP:193256751
5798 5798 -, aca dbSNP:765239024
5816 5816 a, t dbSNP:766006725
5867 5867 g, t dbSNP:571089818
5892 5892 a, c dbSNP:776424062
5896 5896 a, c, g dbSNP:12249651
5916 5916 a, g dbSNP:535027543
5922 5922 a, g dbSNP:773937535
5997 5997 g, t dbSNP:759333613
6019 6019 c, t dbSNP:146367554
6042 6042 a, g dbSNP:754207343
6059 6059 -, tgt dbSNP:775375557
6093 6093 a, g dbSNP:185012826
6109 6109 a, g dbSNP:763535823
6128 6128 -, aag dbSNP:778263539
6129 6129 -, aag dbSNP:200568059
6131 6131 -, gaa dbSNP:372571424
6155 6155 -, aaaa dbSNP:375709234
6159 6159 -, aaat dbSNP:529457056
6165 6165 -, ag dbSNP:528681218
6180 6180 a, g dbSNP:765480550
6188 6188 -, tta dbSNP:761378460
6211 6211 c, t dbSNP:531822223
6214 6214 c, t dbSNP:188725691
6227 6227 a, t dbSNP:191569505
6239 6239 -, a dbSNP:752772727
6256 6256 g, t dbSNP:183906511
6267 6267 a, g dbSNP:188690010
6272 6272 a, t dbSNP:780111875
6298 6298 c, t dbSNP:557684559
6312 6312 a, g dbSNP:535998922
6326 6326 -, ta dbSNP:3069410
6327 6327 a, c, g dbSNP:191253899
6328 6328 -, ta dbSNP:397838211
6334 6334 a, c dbSNP:540117541
6342 6342 a, g dbSNP:755248588
6344 6344 -, tattc dbSNP:199660293
6350 6350 a, g dbSNP:561683873
6364 6364 c, t dbSNP:139150866
6410 6410 a, g dbSNP:747930487
6412 6412 a, g dbSNP:543854055
6448 6448 a, g dbSNP:562560032
6479 6479 a, t dbSNP:184681549
6490 6490 c, t dbSNP:552707960
6526 6526 a, g dbSNP:142481740
6539 6539 a, g dbSNP:777378988
6541 6541 -, c dbSNP:779304482
6571 6571 a, t dbSNP:17107461
6583 6583 g, t dbSNP:750879702
6624 6624 c, g dbSNP:540049561
6637 6637 a, t dbSNP:527703056
6664 6664 c, t dbSNP:774065789
6738 6738 c, t dbSNP:547847959
6751 6751 a, g dbSNP:759099649
6761 6761 a, g dbSNP:558036625
6763 6763 a, g dbSNP:568817581
6765 6765 -, a dbSNP:566739794
6783 6783 c, g dbSNP:535800994
6786 6786 a, g dbSNP:41284074
6807 6807 c, t dbSNP:145930149
6827 6827 c, t dbSNP:190213569
6847 6847 -, ttgc dbSNP:754321761
6857 6857 c, t dbSNP:182441621
6865 6865 a, g dbSNP:760197248
6873 6873 a, c dbSNP:572938444
6909 6909 c, t dbSNP:540079072
6915 6915 a, g dbSNP:186631475
6920 6920 c, t dbSNP:573603699
6930 6930 c, t dbSNP:188980094
7005 7005 a, g dbSNP:568964584
7011 7011 a, g dbSNP:181704450
7087 7087 a, g dbSNP:537498767
7093 7093 a, g dbSNP:532969702
7098 7098 -, a dbSNP:35177748
7174 7174 c, t dbSNP:185664312
7183 7183 c, t dbSNP:76945565
7186 7186 a, g dbSNP:553438770
7226 7226 -, a dbSNP:775206752
7256 7256 g, t dbSNP:778861760
7288 7288 c, t dbSNP:148608390
7297 7297 a, g dbSNP:540524962
7308 7308 g, t dbSNP:751686778
7342 7342 c, t dbSNP:758677110
7355 7355 c, t dbSNP:190429014
7363 7363 a, g dbSNP:142077584
7367 7367 c, t dbSNP:550925852
7377 7377 a, g dbSNP:755019299
7388 7388 a, c dbSNP:781088972
7483 7483 g, t dbSNP:41284076
7530 7530 a, g dbSNP:539857720
7565 7565 c, t dbSNP:756230864
7579 7579 -, c dbSNP:35101638
7589 7589 a, g dbSNP:557963676
7595 7595 -, caaa dbSNP:147513181
7604 7604 a, g dbSNP:369529395
7626 7626 a, t dbSNP:74146238
7656 7656 c, g dbSNP:533696498
7694 7694 -, tt dbSNP:574059273
7701 7701 a, t dbSNP:749084211
7750 7750 c, t dbSNP:555155532
7752 7752 c, t dbSNP:573569187
7762 7762 c, t dbSNP:11202608
7770 7770 c, g dbSNP:771043766
7793 7793 c, t dbSNP:537724154
7804 7804 a, t dbSNP:182357882
7872 7872 a, t dbSNP:577554384
7922 7922 a, g dbSNP:376075453
7933 7933 a, t dbSNP:113279263
7957 7957 a, g dbSNP:559944228
7960 7960 g, t dbSNP:572180082
7968 7968 g, t dbSNP:778966967
8023 8023 a, g dbSNP:745764516
8038 8038 c, t dbSNP:186122957
8086 8086 g, t dbSNP:540795798
8088 8088 a, g dbSNP:41284078
8097 8097 c, g dbSNP:771635871
8144 8144 c, t dbSNP:774805689
8153 8153 g, t dbSNP:373413370
8164 8164 c, t dbSNP:760382159
8263 8263 a, g dbSNP:562290135
8280 8280 a, g dbSNP:191848908
8311 8311 c, t dbSNP:473354
8329 8329 -, gt dbSNP:549302381
8330 8330 -, gt dbSNP:139316712
8331 8331 -, gt dbSNP:754938261
8331 8331 a, t dbSNP:550977540
8345 8345 -, gt dbSNP:373120049
8348 8348 c, g dbSNP:563238435
8373 8373 a, g dbSNP:773622448
8376 8376 g, t dbSNP:139203450
8383 8383 c, g dbSNP:551758251
8419 8419 a, g dbSNP:184148472
8469 8469 c, t dbSNP:763281750
8482 8482 -, acatacagtaa dbSNP:769556905
8485 8485 a, g dbSNP:534046526
8490 8490 a, g dbSNP:766911725
8500 8500 c, t dbSNP:574085926
8647 8647 g, t dbSNP:149918220

Target ORF information:

RefSeq Version NM_001304717
Organism Homo sapiens (human)
Definition Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu44441
Accession Version XM_006717926.2
Sequence Information ORF Nucleotide Sequence (Length: 1167bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_030059.14) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578819652. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)941..1216(+)
Misc Feature(2)941..1060(+)
Misc Feature(3)1229..1714(+)
Position Chain Variation Link
12 12 a, g dbSNP:587779988
21 21 c, t dbSNP:587779987
27 27 a, g dbSNP:786204874
39 39 c, t dbSNP:557053666
40 40 c, t dbSNP:786204947
45 45 c, t dbSNP:786204948
46 46 a, g dbSNP:587779986
47 47 a, g dbSNP:553371022
50 50 -, gcagcggcggcg dbSNP:786204880
75 75 c, t dbSNP:574873281
120 120 a, g dbSNP:375557261
122 122 a, g dbSNP:35736544
135 135 c, t dbSNP:563629336
136 136 c, t dbSNP:575733984
164 164 -, gcg dbSNP:531157350
180 180 g, t dbSNP:545639327
181 181 -, ggc dbSNP:34413673
181 181 c, t dbSNP:564308116
199 199 c, g dbSNP:528340982
200 200 a, g dbSNP:546504608
202 202 a, g dbSNP:12573787
294 294 c, t dbSNP:528834090
346 346 -, t dbSNP:768523368
347 347 -, t dbSNP:71022512
369 369 a, c dbSNP:550595518
387 387 c, g dbSNP:2943772
406 406 a, c dbSNP:539526332
429 429 c, t dbSNP:552470098
433 433 c, t dbSNP:571072832
445 445 c, t dbSNP:11538382
448 448 a, g dbSNP:535269453
521 521 c, t dbSNP:553682570
548 548 c, g dbSNP:575260016
557 557 c, g dbSNP:535471450
561 561 a, g dbSNP:369849061
565 565 c, g dbSNP:575602488
602 602 a, g dbSNP:761148721
613 613 c, t dbSNP:546299914
622 622 c, t dbSNP:766830242
656 656 c, t dbSNP:572922017
662 662 c, t dbSNP:760696127
668 668 c, t dbSNP:763993091
679 679 -, ctc dbSNP:749497048
681 681 c, t dbSNP:376610243
684 684 c, t dbSNP:761265816
685 685 c, t dbSNP:764917503
687 687 c, t dbSNP:750098228
688 688 c, t dbSNP:786204909
699 699 a, c, g dbSNP:755295390
701 701 a, g dbSNP:753142719
702 702 a, g dbSNP:756632919
704 704 c, g dbSNP:11202592
705 705 c, t dbSNP:749356977
712 712 c, t dbSNP:770965327
729 729 -, aa dbSNP:121913290
733 733 -, gatcgttagcagaaaca dbSNP:786204882
733 733 -, ga dbSNP:786204881
740 740 a, g dbSNP:572685299
748 748 c, g dbSNP:587781957
752 752 -, a dbSNP:587776671
754 754 -, g dbSNP:786202786
756 756 g, t dbSNP:398123324
758 758 -, t dbSNP:786204883
760 760 a, t dbSNP:587782187
761 761 c, t dbSNP:786204910
762 762 -, aa dbSNP:587781912
767 767 a, g dbSNP:121909233
769 769 g, t dbSNP:540063602
778 778 c, t dbSNP:786201335
782 782 a, c, g, t dbSNP:786201995
785 785 g, t dbSNP:398123326
786 786 c, t dbSNP:786204912
787 787 a, g dbSNP:786201506
789 789 c, t dbSNP:786204853
790 790 c, t dbSNP:786201280
791 791 a, t dbSNP:746128825
793 793 -, ct dbSNP:786203477
797 797 -, tatc dbSNP:786204894
800 800 a, c dbSNP:794727243
811 811 c, t dbSNP:786201650
816 816 g, t dbSNP:121909225
817 817 ac, gg dbSNP:786202517
818 818 c, g dbSNP:786204854
824 824 c, t dbSNP:587780004
826 826 g, t dbSNP:748040144
829 829 -, a dbSNP:786204895
834 834 g, t dbSNP:794727244
840 840 -, tga dbSNP:786204896
844 844 a, c, t dbSNP:150651961
846 846 -, gcgt dbSNP:786202894
849 849 a, g dbSNP:786204915
851 851 a, g dbSNP:786204855
856 856 c, t dbSNP:762518389
870 870 a, t dbSNP:786203375
871 871 a, g dbSNP:189583426
872 872 a, g dbSNP:786204916
889 889 -, aaga dbSNP:786204898
889 889 a, g dbSNP:781542973
897 897 a, g dbSNP:747865777
898 898 c, t dbSNP:755953294
900 900 a, c dbSNP:777640028
901 901 c, t dbSNP:35917308
902 902 a, g dbSNP:202004587
905 905 a, c dbSNP:786204925
925 925 a, g dbSNP:587780710
928 928 a, g dbSNP:149772796
932 932 c, t dbSNP:587783059
943 943 a, c dbSNP:779530981
944 944 c, g dbSNP:786204927
945 945 a, g dbSNP:121909238
946 946 c, t dbSNP:145695240
951 951 c, t dbSNP:786204856
953 953 c, t dbSNP:398123320
955 955 a, g dbSNP:746661067
956 956 c, t dbSNP:786204928
960 960 g, t dbSNP:781647403
961 961 a, g dbSNP:770224289
968 968 a, t dbSNP:786204857
971 971 a, c dbSNP:786202944
973 973 -, aaa dbSNP:587782641
981 981 a, g dbSNP:587782343
986 986 a, g dbSNP:57374291
987 987 a, g dbSNP:786204858
988 988 c, t dbSNP:372876243
988 988 -, t dbSNP:786204899
994 994 c, t dbSNP:763477642
997 997 a, g dbSNP:786201929
998 998 c, t dbSNP:398123321
1002 1002 c, t dbSNP:121909230
1005 1005 g, t dbSNP:587781254
1010 1010 a, g dbSNP:145124907
1014 1014 -, acaat dbSNP:587776666
1016 1016 a, c dbSNP:771310592
1017 1017 a, g dbSNP:551221430
1022 1022 c, g dbSNP:139767111
1025 1025 a, g dbSNP:786204930
1027 1027 a, c dbSNP:759485888
1029 1029 c, g dbSNP:121909237
1031 1031 a, g dbSNP:786202740
1034 1034 c, t dbSNP:786204931
1035 1035 a, g dbSNP:121909222
1037 1037 c, g, t dbSNP:121909223
1046 1046 a, g dbSNP:587781255
1047 1047 g, t dbSNP:398123322
1052 1052 a, g dbSNP:786204929
1053 1053 a, g dbSNP:121909218
1055 1055 c, g, t dbSNP:121909224
1056 1056 a, c, g dbSNP:121909229
1056 1056 -, g dbSNP:121913292
1058 1058 a, t dbSNP:786204932
1059 1059 c, t dbSNP:397514560
1062 1062 a, g, t dbSNP:121909241
1070 1070 a, g dbSNP:587782360
1071 1071 c, t dbSNP:370795352
1072 1072 -, a dbSNP:398123323
1073 1073 c, t dbSNP:786201044
1074 1074 a, g dbSNP:786204859
1078 1078 a, g dbSNP:144545031
1091 1091 c, g, t dbSNP:746152219
1092 1092 a, g dbSNP:753630034
1095 1095 a, g dbSNP:786202047
1104 1104 a, t dbSNP:786204933
1107 1107 a, g dbSNP:757087471
1111 1111 a, c dbSNP:778663292
1114 1114 a, g dbSNP:750401982
1115 1115 g, t dbSNP:786204934
1117 1117 a, g dbSNP:757777398
1123 1123 a, g dbSNP:779626613
1124 1124 c, g dbSNP:9651492
1130 1130 a, t dbSNP:398123325
1136 1136 g, t dbSNP:121909220
1142 1142 a, g dbSNP:786202688
1147 1147 c, t dbSNP:746574957
1155 1155 a, g dbSNP:786202753
1158 1158 -, a dbSNP:786204900
1159 1159 a, c, g dbSNP:146629065
1160 1160 g, t dbSNP:587782603
1161 1161 g, t dbSNP:786204863
1163 1163 a, g dbSNP:780943695
1167 1167 a, c dbSNP:397514559
1174 1174 -, c dbSNP:587776673
1177 1177 a, t dbSNP:121909221
1178 1178 c, t dbSNP:786204864
1179 1179 a, g dbSNP:786204865
1184 1184 c, t dbSNP:121913293
1185 1185 a, c, g dbSNP:121913294
1187 1187 a, t dbSNP:587782316
1189 1189 c, t dbSNP:786201867
1193 1193 -, tat dbSNP:587780711
1194 1194 a, g dbSNP:757498880
1200 1200 a, g dbSNP:786204866
1201 1201 at, ta dbSNP:397515374
1201 1201 a, c, g, t dbSNP:104894184
1204 1204 c, t dbSNP:779349848
1205 1205 c, t dbSNP:746280047
1207 1207 c, g dbSNP:786202733
1212 1212 c, t dbSNP:794729664
1214 1214 aag, t dbSNP:786204890
1218 1218 a, t dbSNP:587781895
1222 1222 c, t dbSNP:757799618
1227 1227 a, g dbSNP:786204943
1231 1231 a, t dbSNP:606231170
1240 1240 a, g dbSNP:374478092
1244 1244 c, t dbSNP:772631069
1246 1246 a, g dbSNP:568851024
1252 1252 -, t dbSNP:786204901
1253 1253 -, c dbSNP:587776670
1261 1261 a, g dbSNP:747072478
1263 1263 c, t dbSNP:587781538
1265 1265 g, t dbSNP:587782473
1266 1266 c, t dbSNP:786204867
1271 1271 a, t dbSNP:786204944
1277 1277 c, g dbSNP:786204868
1279 1279 a, g dbSNP:539074063
1280 1280 a, g dbSNP:776763121
1285 1285 c, t dbSNP:786202773
1291 1291 c, t dbSNP:370162160
1292 1292 a, g dbSNP:765433422
1300 1300 a, c dbSNP:121909232
1307 1307 c, t dbSNP:121909227
1316 1316 a, g dbSNP:121909234
1326 1326 c, t dbSNP:141373793
1335 1335 a, t dbSNP:778528056
1339 1339 a, g dbSNP:786204946
1348 1348 c, g, t dbSNP:768662424
1350 1350 a, g dbSNP:748240670
1352 1352 a, t dbSNP:587781998
1363 1363 -, a dbSNP:587776669
1364 1364 c, t dbSNP:121909219
1365 1365 a, g dbSNP:770025422
1367 1367 c, t dbSNP:786201730
1368 1368 a, g dbSNP:121909235
1373 1373 -, g dbSNP:786202529
1378 1378 a, g dbSNP:773353820
1382 1382 a, g dbSNP:786201758
1383 1383 g, t dbSNP:786204871
1387 1387 c, t dbSNP:190070312
1389 1389 c, t dbSNP:121909240
1390 1390 c, t dbSNP:17849090
1400 1400 c, t dbSNP:786202918
1404 1404 c, t dbSNP:587782350
1405 1405 a, g dbSNP:774364894
1406 1406 -, at dbSNP:786204902
1408 1408 -, a dbSNP:587782341
1410 1410 c, g dbSNP:759560822
1411 1411 -, tg dbSNP:780264945
1417 1417 c, t dbSNP:767623493
1422 1422 a, g dbSNP:121909239
1425 1425 -, tcaa dbSNP:786204903
1426 1426 c, t dbSNP:752250585
1428 1428 -, aagta dbSNP:606231169
1433 1433 g, t dbSNP:121909228
1438 1438 -, ct dbSNP:786204904
1439 1439 -, tt dbSNP:587781354
1448 1448 c, t dbSNP:730882131
1450 1450 a, g dbSNP:760146269
1452 1452 a, g dbSNP:763784377
1460 1460 c, g dbSNP:786204872
1467 1467 -, a dbSNP:121913289
1469 1469 -, g dbSNP:587776672
1471 1471 a, c dbSNP:398123328
1479 1479 c, t dbSNP:142420551
1488 1488 a, g dbSNP:786204875
1489 1489 a, g dbSNP:587782607
1497 1497 a, c, t dbSNP:398123329
1498 1498 a, g dbSNP:376886779
1508 1508 c, g dbSNP:750705904
1517 1517 g, t dbSNP:786202840
1522 1522 a, g dbSNP:751888926
1532 1532 a, g dbSNP:562015640
1535 1535 c, g dbSNP:35600253
1537 1537 a, g dbSNP:529155918
1542 1542 -, a dbSNP:786204905
1549 1549 g, t dbSNP:143335584
1550 1550 c, t dbSNP:756152824
1551 1551 -, tt dbSNP:587780006
1552 1552 a, g dbSNP:587780713
1553 1553 c, t dbSNP:786202207
1556 1556 g, t dbSNP:370064195
1557 1557 -, at dbSNP:267602610
1559 1559 -, c dbSNP:786204884
1559 1559 c, g, t dbSNP:371387815
1567 1567 c, t dbSNP:550122918
1568 1568 a, g dbSNP:758644748
1572 1572 a, g dbSNP:745638189
1575 1575 g, t dbSNP:772018727
1580 1580 a, g dbSNP:775461980
1581 1581 a, g dbSNP:587780007
1583 1583 a, g dbSNP:786203858
1586 1586 c, g, t dbSNP:746930141
1590 1590 a, g dbSNP:786201507
1595 1595 -, gtgca dbSNP:786204906
1604 1604 -, aagga dbSNP:764753843
1606 1606 a, g dbSNP:562164491
1613 1613 -, ctagtac dbSNP:775171435
1615 1615 a, g dbSNP:775997892
1622 1622 -, actt dbSNP:146650273
1622 1622 -, a dbSNP:786204892
1623 1623 -, cttt dbSNP:398123330
1623 1623 a, c, t dbSNP:761350690
1631 1631 a, t dbSNP:786202004
1633 1633 a, g dbSNP:786201392
1635 1635 -, a dbSNP:587783058
1635 1635 -, a dbSNP:121913291
1648 1648 a, g dbSNP:772872626
1651 1651 -, aaat dbSNP:587782304
1654 1654 -, taaa dbSNP:786204893
1670 1670 c, t dbSNP:121909231
1675 1675 c, t dbSNP:786201816
1685 1685 a, c, g dbSNP:759852661
1693 1693 c, g dbSNP:398123314
1707 1707 -, a dbSNP:398123315
1711 1711 a, g dbSNP:747606399
1717 1717 a, g dbSNP:769324650
1719 1719 -, tag dbSNP:587780003
1726 1726 a, g dbSNP:772784762
1728 1728 a, c, t dbSNP:375709098
1729 1729 a, g dbSNP:786202751
1733 1733 a, c, g, t dbSNP:587782345
1738 1738 a, g dbSNP:764488459
1745 1745 a, g dbSNP:587781273
1753 1753 a, g dbSNP:761948873
1754 1754 a, g dbSNP:765416558
1755 1755 a, c dbSNP:750585255
1760 1760 a, g dbSNP:758542021
1771 1771 a, c, t dbSNP:35979531
1772 1772 a, g dbSNP:587782224
1797 1797 a, t dbSNP:751286806
1838 1838 c, t dbSNP:786203911
1854 1854 a, g dbSNP:754821870
1855 1855 a, g dbSNP:786202062
1864 1864 a, g dbSNP:374684043
1880 1880 -, t dbSNP:756681683
1881 1881 -, t dbSNP:766924726
1887 1887 g, t dbSNP:727504115
1888 1888 g, t dbSNP:748082411
1889 1889 a, t dbSNP:769236743
1889 1889 -, t dbSNP:786204876
1902 1902 a, g dbSNP:777252107
1906 1906 a, c dbSNP:748897412
1908 1908 c, g dbSNP:770460423
1916 1916 a, c dbSNP:774105075
1917 1917 g, t dbSNP:760901642
1927 1927 c, t dbSNP:368984469
1930 1930 a, g dbSNP:769098710
1944 1944 c, t dbSNP:1044487
1954 1954 a, t dbSNP:74535369
1956 1956 a, t dbSNP:74489567
1962 1962 a, g dbSNP:537081967
1976 1976 -, a dbSNP:578049537
1999 1999 c, t dbSNP:774400345
2095 2095 a, g dbSNP:558365328
2104 2104 g, t dbSNP:3895069
2161 2161 a, g dbSNP:576872432
2199 2199 g, t dbSNP:3895070
2214 2214 a, t dbSNP:545229150
2232 2232 c, t dbSNP:181234898
2269 2269 c, t dbSNP:746867863
2300 2300 c, t dbSNP:141648241
2313 2313 c, g dbSNP:376860960
2343 2343 a, g dbSNP:2673835
2354 2354 c, t dbSNP:541039409
2373 2373 a, g dbSNP:560599448
2382 2382 c, g dbSNP:1044492
2427 2427 -, tg dbSNP:774674775
2432 2432 a, c dbSNP:561279008
2466 2466 c, t dbSNP:531589996
2469 2469 a, t dbSNP:183510626
2480 2480 a, g dbSNP:371547288
2485 2485 c, t dbSNP:532648593
2498 2498 g, t dbSNP:761682131
2513 2513 -, a dbSNP:530317615
2516 2516 a, t dbSNP:770650569
2525 2525 c, g dbSNP:776368591
2530 2530 g, t dbSNP:547244072
2533 2533 c, t dbSNP:540531969
2534 2534 a, g dbSNP:756513970
2536 2536 -, t dbSNP:543873570
2572 2572 a, g dbSNP:769858445
2667 2667 c, t dbSNP:138309082
2718 2718 a, g dbSNP:529945687
2729 2729 c, t dbSNP:548492439
2735 2735 c, t dbSNP:570010681
2739 2739 a, g dbSNP:759474309
2741 2741 a, g dbSNP:536995550
2781 2781 c, t dbSNP:749778496
2790 2790 c, t dbSNP:765100893
2808 2808 a, c dbSNP:558530548
2820 2820 c, t dbSNP:570416975
2836 2836 g, t dbSNP:2735347
2849 2849 a, c dbSNP:773513402
2853 2853 c, t dbSNP:532759542
2894 2894 c, t dbSNP:534737012
2907 2907 c, t dbSNP:775039992
2914 2914 g, t dbSNP:369992151
2998 2998 a, t dbSNP:376153776
3003 3003 -, t dbSNP:547262170
3012 3012 c, t dbSNP:2736630
3021 3021 g, t dbSNP:552819280
3031 3031 c, t dbSNP:552354954
3068 3068 c, t dbSNP:569316988
3116 3116 a, g dbSNP:547879223
3212 3212 a, g dbSNP:542854347
3224 3224 a, g dbSNP:188246270
3239 3239 a, g dbSNP:373943966
3248 3248 a, t dbSNP:576331425
3274 3274 a, c dbSNP:79395513
3309 3309 g, t dbSNP:35460383
3310 3310 -, ttttttttttttttt dbSNP:201131651
3312 3312 g, t dbSNP:762987781
3313 3313 -, ttg dbSNP:563751927
3318 3318 -, g dbSNP:764649748
3320 3320 g, t dbSNP:34885400
3337 3337 -, tt dbSNP:5786797
3339 3339 a, t dbSNP:35632884
3342 3342 -, ttt dbSNP:78439318
3344 3344 g, t dbSNP:11202606
3378 3378 c, t dbSNP:180953647
3392 3392 a, g dbSNP:775659811
3395 3395 c, t dbSNP:701848
3410 3410 -, a dbSNP:550961951
3417 3417 a, t dbSNP:541494941
3439 3439 a, c dbSNP:751151588
3444 3444 a, c, g dbSNP:34140758
3454 3454 g, t dbSNP:529908733
3462 3462 a, g dbSNP:548599209
3499 3499 c, t dbSNP:568474293
3510 3510 -, t dbSNP:201650436
3523 3523 a, g dbSNP:2142135
3557 3557 c, g dbSNP:569923405
3574 3574 a, c dbSNP:141857855
3576 3576 a, g dbSNP:35481105
3581 3581 a, g dbSNP:150265244
3592 3592 a, g dbSNP:754704111
3624 3624 a, g dbSNP:116248217
3677 3677 c, t dbSNP:546939869
3683 3683 -, a dbSNP:756887853
3684 3684 g, t dbSNP:768027159
3704 3704 a, g dbSNP:553022623
3712 3712 a, t dbSNP:772654487
3754 3754 c, t dbSNP:762499494
3772 3772 c, t dbSNP:750754949
3824 3824 a, g dbSNP:567800059
3833 3833 a, t dbSNP:35914322
3834 3834 a, t dbSNP:41284072
3836 3836 a, t dbSNP:576294635
3840 3840 c, t dbSNP:754624881
3862 3862 c, t dbSNP:138981406
3903 3903 g, t dbSNP:544118607
3929 3929 a, t dbSNP:559017397
3932 3932 a, c dbSNP:577156522
3944 3944 a, g dbSNP:192484947
3952 3952 g, t dbSNP:558501841
3988 3988 g, t dbSNP:754229502
3993 3993 a, g dbSNP:181468070
4041 4041 a, g dbSNP:574993688
4045 4045 c, t dbSNP:542009439
4052 4052 c, t dbSNP:186996550
4064 4064 c, t dbSNP:11202607
4067 4067 a, g dbSNP:754989049
4083 4083 a, t dbSNP:552431817
4102 4102 g, t dbSNP:745975387
4140 4140 -, tta dbSNP:775116816
4187 4187 g, t dbSNP:564263681
4192 4192 a, g dbSNP:780059644
4200 4200 a, g dbSNP:528086505
4294 4294 c, g dbSNP:34761252
4306 4306 a, t dbSNP:567776779
4311 4311 a, t dbSNP:190099872
4384 4384 c, t dbSNP:149401400
4386 4386 c, t dbSNP:548348131
4394 4394 a, g dbSNP:569895598
4430 4430 a, g dbSNP:537283839
4438 4438 -, tg dbSNP:745440689
4652 4652 -, aagtg dbSNP:763833268
4665 4665 c, t dbSNP:574096019
4695 4695 a, g dbSNP:368180514
4700 4700 -, agt dbSNP:776568434
4700 4700 a, t dbSNP:11591427
4706 4706 g, t dbSNP:182746814
4726 4726 a, t dbSNP:371289955
4777 4777 a, g dbSNP:540495271
4835 4835 a, g dbSNP:187266004
4849 4849 g, t dbSNP:574955389
4891 4891 c, t dbSNP:542319798
4910 4910 a, g dbSNP:563805612
4995 4995 a, g dbSNP:575385694
5029 5029 a, g dbSNP:545725183
5107 5107 c, t dbSNP:189780354
5171 5171 g, t dbSNP:747959604

Target ORF information:

RefSeq Version XM_006717926
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60000
Accession Version XM_011539981.1
Sequence Information ORF Nucleotide Sequence (Length: 1035bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_030059.14) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)986..1261(+)
Misc Feature(2)986..1105(+)
Misc Feature(3)1274..1738(+)
Position Chain Variation Link
12 12 a, g dbSNP:587779988
21 21 c, t dbSNP:587779987
27 27 a, g dbSNP:786204874
39 39 c, t dbSNP:557053666
40 40 c, t dbSNP:786204947
45 45 c, t dbSNP:786204948
46 46 a, g dbSNP:587779986
47 47 a, g dbSNP:553371022
50 50 -, gcagcggcggcg dbSNP:786204880
75 75 c, t dbSNP:574873281
120 120 a, g dbSNP:375557261
122 122 a, g dbSNP:35736544
135 135 c, t dbSNP:563629336
136 136 c, t dbSNP:575733984
164 164 -, gcg dbSNP:531157350
180 180 g, t dbSNP:545639327
181 181 -, ggc dbSNP:34413673
181 181 c, t dbSNP:564308116
199 199 c, g dbSNP:528340982
200 200 a, g dbSNP:546504608
202 202 a, g dbSNP:12573787
294 294 c, t dbSNP:528834090
346 346 -, t dbSNP:768523368
347 347 -, t dbSNP:71022512
369 369 a, c dbSNP:550595518
387 387 c, g dbSNP:2943772
406 406 a, c dbSNP:539526332
429 429 c, t dbSNP:552470098
433 433 c, t dbSNP:571072832
445 445 c, t dbSNP:11538382
448 448 a, g dbSNP:535269453
521 521 c, t dbSNP:553682570
548 548 c, g dbSNP:575260016
557 557 c, g dbSNP:535471450
561 561 a, g dbSNP:369849061
565 565 c, g dbSNP:575602488
602 602 a, g dbSNP:761148721
613 613 c, t dbSNP:546299914
622 622 c, t dbSNP:766830242
656 656 c, t dbSNP:572922017
662 662 c, t dbSNP:760696127
668 668 c, t dbSNP:763993091
679 679 -, ctc dbSNP:749497048
681 681 c, t dbSNP:376610243
684 684 c, t dbSNP:761265816
685 685 c, t dbSNP:764917503
687 687 c, t dbSNP:750098228
688 688 c, t dbSNP:786204909
699 699 a, c, g dbSNP:755295390
701 701 a, g dbSNP:753142719
702 702 a, g dbSNP:756632919
704 704 c, g dbSNP:11202592
705 705 c, t dbSNP:749356977
712 712 c, t dbSNP:770965327
729 729 -, aa dbSNP:121913290
733 733 -, gatcgttagcagaaaca dbSNP:786204882
733 733 -, ga dbSNP:786204881
740 740 a, g dbSNP:572685299
748 748 c, g dbSNP:587781957
752 752 -, a dbSNP:587776671
754 754 -, g dbSNP:786202786
756 756 g, t dbSNP:398123324
758 758 -, t dbSNP:786204883
760 760 a, t dbSNP:587782187
761 761 c, t dbSNP:786204910
762 762 -, aa dbSNP:587781912
767 767 a, g dbSNP:121909233
769 769 g, t dbSNP:540063602
778 778 c, t dbSNP:786201335
782 782 a, c, g, t dbSNP:786201995
785 785 g, t dbSNP:398123326
786 786 c, t dbSNP:786204912
787 787 a, g dbSNP:786201506
789 789 c, t dbSNP:786204853
790 790 c, t dbSNP:786201280
791 791 a, t dbSNP:746128825
793 793 -, ct dbSNP:786203477
797 797 -, tatc dbSNP:786204894
800 800 a, c dbSNP:794727243
811 811 c, t dbSNP:786201650
816 816 g, t dbSNP:121909225
817 817 ac, gg dbSNP:786202517
818 818 c, g dbSNP:786204854
824 824 c, t dbSNP:587780004
826 826 g, t dbSNP:748040144
829 829 -, a dbSNP:786204895
834 834 g, t dbSNP:794727244
840 840 -, tga dbSNP:786204896
844 844 a, c, t dbSNP:150651961
846 846 -, gcgt dbSNP:786202894
849 849 a, g dbSNP:786204915
851 851 a, g dbSNP:786204855
856 856 c, t dbSNP:762518389
870 870 a, t dbSNP:786203375
871 871 a, g dbSNP:189583426
872 872 a, g dbSNP:786204916
879 879 g, t dbSNP:748031178
882 882 g, t dbSNP:786202398
886 886 c, t dbSNP:769719835
893 893 c, g dbSNP:121909236
894 894 a, g, t dbSNP:398123316
902 902 c, t dbSNP:587781535
905 905 g, t dbSNP:587780005
914 914 a, c, t dbSNP:398123317
916 916 c, t dbSNP:773176120
918 918 a, g dbSNP:786204922
920 920 c, t dbSNP:794727480
921 921 c, t dbSNP:121909226
934 934 -, aaga dbSNP:786204898
934 934 a, g dbSNP:781542973
942 942 a, g dbSNP:747865777
943 943 c, t dbSNP:755953294
945 945 a, c dbSNP:777640028
946 946 c, t dbSNP:35917308
947 947 a, g dbSNP:202004587
950 950 a, c dbSNP:786204925
970 970 a, g dbSNP:587780710
973 973 a, g dbSNP:149772796
977 977 c, t dbSNP:587783059
988 988 a, c dbSNP:779530981
989 989 c, g dbSNP:786204927
990 990 a, g dbSNP:121909238
991 991 c, t dbSNP:145695240
996 996 c, t dbSNP:786204856
998 998 c, t dbSNP:398123320
1000 1000 a, g dbSNP:746661067
1001 1001 c, t dbSNP:786204928
1005 1005 g, t dbSNP:781647403
1006 1006 a, g dbSNP:770224289
1013 1013 a, t dbSNP:786204857
1016 1016 a, c dbSNP:786202944
1018 1018 -, aaa dbSNP:587782641
1026 1026 a, g dbSNP:587782343
1031 1031 a, g dbSNP:57374291
1032 1032 a, g dbSNP:786204858
1033 1033 c, t dbSNP:372876243
1033 1033 -, t dbSNP:786204899
1039 1039 c, t dbSNP:763477642
1042 1042 a, g dbSNP:786201929
1043 1043 c, t dbSNP:398123321
1047 1047 c, t dbSNP:121909230
1050 1050 g, t dbSNP:587781254
1055 1055 a, g dbSNP:145124907
1059 1059 -, acaat dbSNP:587776666
1061 1061 a, c dbSNP:771310592
1062 1062 a, g dbSNP:551221430
1067 1067 c, g dbSNP:139767111
1070 1070 a, g dbSNP:786204930
1072 1072 a, c dbSNP:759485888
1074 1074 c, g dbSNP:121909237
1076 1076 a, g dbSNP:786202740
1079 1079 c, t dbSNP:786204931
1080 1080 a, g dbSNP:121909222
1082 1082 c, g, t dbSNP:121909223
1091 1091 a, g dbSNP:587781255
1092 1092 g, t dbSNP:398123322
1097 1097 a, g dbSNP:786204929
1098 1098 a, g dbSNP:121909218
1100 1100 c, g, t dbSNP:121909224
1101 1101 a, c, g dbSNP:121909229
1101 1101 -, g dbSNP:121913292
1103 1103 a, t dbSNP:786204932
1104 1104 c, t dbSNP:397514560
1107 1107 a, g, t dbSNP:121909241
1115 1115 a, g dbSNP:587782360
1116 1116 c, t dbSNP:370795352
1117 1117 -, a dbSNP:398123323
1118 1118 c, t dbSNP:786201044
1119 1119 a, g dbSNP:786204859
1123 1123 a, g dbSNP:144545031
1136 1136 c, g, t dbSNP:746152219
1137 1137 a, g dbSNP:753630034
1140 1140 a, g dbSNP:786202047
1149 1149 a, t dbSNP:786204933
1152 1152 a, g dbSNP:757087471
1156 1156 a, c dbSNP:778663292
1159 1159 a, g dbSNP:750401982
1160 1160 g, t dbSNP:786204934
1162 1162 a, g dbSNP:757777398
1168 1168 a, g dbSNP:779626613
1169 1169 c, g dbSNP:9651492
1175 1175 a, t dbSNP:398123325
1181 1181 g, t dbSNP:121909220
1187 1187 a, g dbSNP:786202688
1192 1192 c, t dbSNP:746574957
1200 1200 a, g dbSNP:786202753
1203 1203 -, a dbSNP:786204900
1204 1204 a, c, g dbSNP:146629065
1205 1205 g, t dbSNP:587782603
1206 1206 g, t dbSNP:786204863
1208 1208 a, g dbSNP:780943695
1212 1212 a, c dbSNP:397514559
1219 1219 -, c dbSNP:587776673
1222 1222 a, t dbSNP:121909221
1223 1223 c, t dbSNP:786204864
1224 1224 a, g dbSNP:786204865
1229 1229 c, t dbSNP:121913293
1230 1230 a, c, g dbSNP:121913294
1232 1232 a, t dbSNP:587782316
1234 1234 c, t dbSNP:786201867
1238 1238 -, tat dbSNP:587780711
1239 1239 a, g dbSNP:757498880
1245 1245 a, g dbSNP:786204866
1246 1246 at, ta dbSNP:397515374
1246 1246 a, c, g, t dbSNP:104894184
1249 1249 c, t dbSNP:779349848
1250 1250 c, t dbSNP:746280047
1252 1252 c, g dbSNP:786202733
1257 1257 c, t dbSNP:794729664
1259 1259 aag, t dbSNP:786204890
1263 1263 a, t dbSNP:587781895
1267 1267 c, t dbSNP:757799618
1272 1272 a, g dbSNP:786204943
1276 1276 a, t dbSNP:606231170
1285 1285 a, g dbSNP:374478092
1289 1289 c, t dbSNP:772631069
1291 1291 a, g dbSNP:568851024
1297 1297 -, t dbSNP:786204901
1298 1298 -, c dbSNP:587776670
1306 1306 a, g dbSNP:747072478
1308 1308 c, t dbSNP:587781538
1310 1310 g, t dbSNP:587782473
1311 1311 c, t dbSNP:786204867
1316 1316 a, t dbSNP:786204944
1322 1322 c, g dbSNP:786204868
1324 1324 a, g dbSNP:539074063
1325 1325 a, g dbSNP:776763121
1330 1330 c, t dbSNP:786202773
1336 1336 c, t dbSNP:370162160
1337 1337 a, g dbSNP:765433422
1345 1345 a, c dbSNP:121909232
1352 1352 c, t dbSNP:121909227
1361 1361 a, g dbSNP:121909234
1371 1371 c, t dbSNP:141373793
1380 1380 a, t dbSNP:778528056
1384 1384 a, g dbSNP:786204946
1393 1393 c, g, t dbSNP:768662424
1395 1395 a, g dbSNP:748240670
1397 1397 a, t dbSNP:587781998
1408 1408 -, a dbSNP:587776669
1409 1409 c, t dbSNP:121909219
1410 1410 a, g dbSNP:770025422
1412 1412 c, t dbSNP:786201730
1413 1413 a, g dbSNP:121909235
1418 1418 -, g dbSNP:786202529
1423 1423 a, g dbSNP:773353820
1427 1427 a, g dbSNP:786201758
1428 1428 g, t dbSNP:786204871
1432 1432 c, t dbSNP:190070312
1434 1434 c, t dbSNP:121909240
1435 1435 c, t dbSNP:17849090
1445 1445 c, t dbSNP:786202918
1449 1449 c, t dbSNP:587782350
1450 1450 a, g dbSNP:774364894
1451 1451 -, at dbSNP:786204902
1453 1453 -, a dbSNP:587782341
1455 1455 c, g dbSNP:759560822
1456 1456 -, tg dbSNP:780264945
1462 1462 c, t dbSNP:767623493
1467 1467 a, g dbSNP:121909239
1470 1470 -, tcaa dbSNP:786204903
1471 1471 c, t dbSNP:752250585
1473 1473 -, aagta dbSNP:606231169
1478 1478 g, t dbSNP:121909228
1483 1483 -, ct dbSNP:786204904
1484 1484 -, tt dbSNP:587781354
1493 1493 c, t dbSNP:730882131
1495 1495 a, g dbSNP:760146269
1497 1497 a, g dbSNP:763784377
1505 1505 c, g dbSNP:786204872
1512 1512 -, a dbSNP:121913289
1514 1514 -, g dbSNP:587776672
1516 1516 a, c dbSNP:398123328
1524 1524 c, t dbSNP:142420551
1533 1533 a, g dbSNP:786204875
1534 1534 a, g dbSNP:587782607
1542 1542 a, c, t dbSNP:398123329
1543 1543 a, g dbSNP:376886779
1553 1553 c, g dbSNP:750705904
1562 1562 g, t dbSNP:786202840
1567 1567 a, g dbSNP:751888926
1577 1577 a, g dbSNP:562015640
1580 1580 c, g dbSNP:35600253
1582 1582 a, g dbSNP:529155918
1587 1587 -, a dbSNP:786204905
1594 1594 g, t dbSNP:143335584
1595 1595 c, t dbSNP:756152824
1596 1596 -, tt dbSNP:587780006
1597 1597 a, g dbSNP:587780713
1598 1598 c, t dbSNP:786202207
1601 1601 g, t dbSNP:370064195
1602 1602 -, at dbSNP:267602610
1604 1604 -, c dbSNP:786204884
1604 1604 c, g, t dbSNP:371387815
1612 1612 c, t dbSNP:550122918
1613 1613 a, g dbSNP:758644748
1617 1617 a, g dbSNP:745638189
1620 1620 g, t dbSNP:772018727
1625 1625 a, g dbSNP:775461980
1626 1626 a, g dbSNP:587780007
1628 1628 a, g dbSNP:786203858
1631 1631 c, g, t dbSNP:746930141
1635 1635 a, g dbSNP:786201507
1640 1640 -, gtgca dbSNP:786204906
1649 1649 -, aagga dbSNP:764753843
1651 1651 a, g dbSNP:562164491
1658 1658 -, ctagtac dbSNP:775171435
1660 1660 a, g dbSNP:775997892
1667 1667 -, actt dbSNP:146650273
1667 1667 -, a dbSNP:786204892
1668 1668 -, cttt dbSNP:398123330
1668 1668 a, c, t dbSNP:761350690
1676 1676 a, t dbSNP:786202004
1678 1678 a, g dbSNP:786201392
1680 1680 -, a dbSNP:587783058
1680 1680 -, a dbSNP:121913291
1693 1693 a, g dbSNP:772872626
1696 1696 -, aaat dbSNP:587782304
1699 1699 -, taaa dbSNP:786204893
1715 1715 c, t dbSNP:121909231
1720 1720 c, t dbSNP:786201816
1730 1730 a, c, g dbSNP:759852661
1738 1738 c, g dbSNP:398123314
1756 1756 a, g dbSNP:7091891
1773 1773 a, g dbSNP:774400334
1782 1782 a, g dbSNP:61310847
1806 1806 a, t dbSNP:7076477
1807 1807 a, g dbSNP:767232471
1818 1818 a, g dbSNP:752427020
1836 1836 c, g dbSNP:759419157
1838 1838 c, g dbSNP:139958313
1881 1881 a, g dbSNP:764758062
1891 1891 -, g dbSNP:769995153
1893 1893 g, t dbSNP:760674305
1929 1929 a, c dbSNP:764008086
1949 1949 c, t dbSNP:532678
2004 2004 c, t dbSNP:560879664
2028 2028 c, t dbSNP:184822582
2049 2049 -, gagaaggggtaataaa dbSNP:758082223
2059 2059 a, g dbSNP:778447286
2149 2149 a, t dbSNP:373061416
2204 2204 g, t dbSNP:763642794
2218 2218 a, c dbSNP:372392389
2329 2329 c, t dbSNP:548966524
2335 2335 c, t dbSNP:567380366
2367 2367 a, g dbSNP:79025454
2374 2374 c, t dbSNP:71477175
2386 2386 c, t dbSNP:71477176
2401 2401 c, t dbSNP:149750026
2422 2422 c, t dbSNP:571331965
2493 2493 a, c dbSNP:538861452
2511 2511 a, g dbSNP:781691792
2545 2545 a, g dbSNP:553775071
2547 2547 a, g dbSNP:572351840
2561 2561 a, g dbSNP:2673834
2614 2614 a, c dbSNP:748517073
2616 2616 c, g dbSNP:145664118

Target ORF information:

RefSeq Version XM_011539981
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens phosphatase and tensin homolog (PTEN), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60001
Accession Version XM_011539982.1
Sequence Information ORF Nucleotide Sequence (Length: 1116bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_030059.14) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)3958..4233(+)
Misc Feature(2)3958..4077(+)
Misc Feature(3)4246..4731(+)
Position Chain Variation Link
6 6 c, g dbSNP:754327953
8 8 c, t dbSNP:757323632
11 11 g, t dbSNP:368737733
42 42 a, g dbSNP:764048342
73 73 c, t dbSNP:34082073
82 82 a, g dbSNP:34220389
101 101 -, tg dbSNP:759711908
102 102 a, g dbSNP:765367816
117 117 g, t dbSNP:538598197
151 151 c, g dbSNP:562527229
166 166 a, c dbSNP:532856196
190 190 c, g dbSNP:750466526
209 209 c, g dbSNP:545695288
229 229 c, t dbSNP:780307131
282 282 a, g dbSNP:551444015
291 291 a, c dbSNP:376771654
296 296 a, g dbSNP:187088207
300 300 a, g dbSNP:528693893
324 324 a, g dbSNP:754870649
327 327 a, g dbSNP:145409477
329 329 a, g dbSNP:751856783
334 334 a, g dbSNP:748130964
341 341 a, t dbSNP:568732002
372 372 a, g dbSNP:138045437
401 401 c, t dbSNP:34370865
417 417 c, t dbSNP:117587034
423 423 c, t dbSNP:34308750
433 433 -, ttgt dbSNP:772239345
477 477 a, t dbSNP:770541023
538 538 a, g dbSNP:191896258
550 550 g, t dbSNP:573045901
578 578 a, t dbSNP:540027076
580 580 a, g dbSNP:182836099
589 589 c, g dbSNP:753701321
620 620 a, c, g dbSNP:774202755
631 631 a, g dbSNP:573827952
664 664 c, g dbSNP:377204292
685 685 c, g dbSNP:187600920
730 730 a, g dbSNP:368360285
765 765 c, g dbSNP:532922006
766 766 a, g dbSNP:754808978
771 771 a, g dbSNP:545071728
785 785 c, t dbSNP:575550829
797 797 a, g dbSNP:193213378
833 833 a, g dbSNP:776798335
884 884 c, t dbSNP:554789337
894 894 a, g dbSNP:34452287
901 901 c, t dbSNP:530145803
908 908 c, g dbSNP:540370315
928 928 c, t dbSNP:750910810
951 951 a, g dbSNP:568691431
958 958 c, t dbSNP:529525651
976 976 c, t dbSNP:185614677
1001 1001 c, t dbSNP:148541239
1036 1036 a, g dbSNP:766443557
1040 1040 g, t dbSNP:751813674
1117 1117 a, c dbSNP:755099432
1119 1119 g, t dbSNP:371893121
1144 1144 c, g dbSNP:767366939
1152 1152 a, t dbSNP:752395215
1156 1156 c, g dbSNP:539815260
1185 1185 c, g dbSNP:755906798
1190 1190 a, g dbSNP:781464341
1201 1201 c, t dbSNP:372810224
1207 1207 c, t dbSNP:143829097
1211 1211 g, t dbSNP:566583703
1242 1242 a, g dbSNP:35274268
1254 1254 c, t dbSNP:114634814
1262 1262 a, g dbSNP:573766044
1263 1263 a, g dbSNP:537675323
1309 1309 c, t dbSNP:749222754
1341 1341 c, t dbSNP:556423041
1366 1366 a, g dbSNP:370264790
1382 1382 -, aa dbSNP:36025175
1386 1386 -, aa dbSNP:397844451
1412 1412 a, g dbSNP:756892230
1447 1447 g, t dbSNP:778496727
1448 1448 a, g dbSNP:543703608
1456 1456 a, g dbSNP:542841208
1464 1464 g, t dbSNP:376197622
1470 1470 a, g dbSNP:369140657
1478 1478 c, t dbSNP:188818913
1536 1536 c, g dbSNP:368417328
1555 1555 a, t dbSNP:560194845
1592 1592 c, t dbSNP:775181436
1665 1665 c, g dbSNP:191987406
1691 1691 a, c dbSNP:530571794
1693 1693 a, c dbSNP:542759402
1713 1713 c, t dbSNP:748514384
1716 1716 a, t dbSNP:35930911
1746 1746 a, t dbSNP:1903859
1760 1760 a, t dbSNP:763385654
1776 1776 a, g dbSNP:567508017
1778 1778 g, t dbSNP:550938938
1822 1822 g, t dbSNP:375067011
1829 1829 a, c dbSNP:533453042
1850 1850 c, t dbSNP:536349902
1852 1852 c, t dbSNP:546746065
1880 1880 c, g dbSNP:551313721
1916 1916 -, a dbSNP:527649472
1933 1933 a, g dbSNP:373089501
1964 1964 a, c dbSNP:538645509
1966 1966 c, t dbSNP:12782009
1967 1967 a, t dbSNP:12776804
2007 2007 -, a dbSNP:765025426
2010 2010 -, g dbSNP:201952487
2018 2018 c, t dbSNP:774246835
2035 2035 -, c dbSNP:79540160
2037 2037 -, c dbSNP:397704885
2038 2038 -, c dbSNP:397701299
2045 2045 c, t dbSNP:566547148
2109 2109 c, g dbSNP:533967360
2139 2139 a, g dbSNP:140979097
2141 2141 a, g dbSNP:144930953
2159 2159 a, g dbSNP:746483745
2166 2166 -, g dbSNP:765673049
2170 2170 g, t dbSNP:532384642
2172 2172 a, c, t dbSNP:184451314
2379 2379 a, g dbSNP:767671823
2400 2400 a, c dbSNP:752939824
2406 2406 a, g dbSNP:147923172
2432 2432 a, g dbSNP:577822594
2489 2489 -, taac dbSNP:758298448
2505 2505 a, t dbSNP:41284070
2537 2537 g, t dbSNP:553766815
2552 2552 -, aaag dbSNP:758875570
2558 2558 a, g dbSNP:555138185
2581 2581 c, t dbSNP:757200152
2582 2582 c, t dbSNP:112148024
2623 2623 c, t dbSNP:745414502
2625 2625 c, t dbSNP:542671918
2629 2629 a, g dbSNP:759948717
2642 2642 a, g dbSNP:561034928
2687 2687 c, t dbSNP:770137025
2697 2697 c, t dbSNP:74146231
2704 2704 c, g dbSNP:188500397
2705 2705 -, ta dbSNP:547801894
2708 2708 a, g dbSNP:181359313
2737 2737 a, g dbSNP:533416368
2742 2742 c, g dbSNP:746671793
2753 2753 a, g dbSNP:150045420
2785 2785 -, tt dbSNP:754695336
2798 2798 a, g dbSNP:185905407
2815 2815 g, t dbSNP:527678985
2886 2886 a, g dbSNP:762726671
2887 2887 a, c dbSNP:187266148
2909 2909 a, c dbSNP:533521984
2922 2922 c, t dbSNP:192951251
2943 2943 c, t dbSNP:571522611
2980 2980 c, g dbSNP:375892210
3012 3012 c, t dbSNP:536484747
3020 3020 c, g dbSNP:571660658
3049 3049 a, t dbSNP:181373096
3051 3051 c, t dbSNP:748687655
3062 3062 a, g dbSNP:770330784
3066 3066 -, t dbSNP:79812451
3078 3078 a, g dbSNP:556454154
3107 3107 c, t dbSNP:773691632
3111 3111 c, t dbSNP:141690070
3123 3123 c, t dbSNP:143634224
3213 3213 c, t dbSNP:771039284
3243 3243 g, t dbSNP:558994730
3263 3263 a, g dbSNP:76331483
3270 3270 a, g dbSNP:541529658
3299 3299 a, g dbSNP:553220004
3300 3300 c, t dbSNP:575797002
3302 3302 c, t dbSNP:759783558
3308 3308 a, g dbSNP:765330146
3360 3360 c, t dbSNP:574573532
3405 3405 a, g dbSNP:541699283
3512 3512 c, g dbSNP:184927785
3525 3525 -, tt dbSNP:747096290
3545 3545 c, t dbSNP:61096197
3557 3557 c, t dbSNP:530719582
3576 3576 a, g dbSNP:761530387
3578 3578 g, t dbSNP:545369566
3584 3584 a, g dbSNP:189781818
3600 3600 -, att dbSNP:773758768
3626 3626 c, g dbSNP:528110817
3646 3646 a, g dbSNP:148088027
3702 3702 a, g dbSNP:753796943
3734 3734 a, g dbSNP:186676782
3739 3739 c, t dbSNP:746008730
3782 3782 a, t dbSNP:772265940
3787 3787 -, tt dbSNP:781356662
3788 3788 -, t dbSNP:200279952
3791 3791 -, t dbSNP:770727719
3807 3807 c, t dbSNP:557656653
3823 3823 c, t dbSNP:191337493
3851 3851 g, t dbSNP:748031178
3854 3854 g, t dbSNP:786202398
3858 3858 c, t dbSNP:769719835
3865 3865 c, g dbSNP:121909236
3866 3866 a, g, t dbSNP:398123316
3874 3874 c, t dbSNP:587781535
3877 3877 g, t dbSNP:587780005
3886 3886 a, c, t dbSNP:398123317
3888 3888 c, t dbSNP:773176120
3890 3890 a, g dbSNP:786204922
3892 3892 c, t dbSNP:794727480
3893 3893 c, t dbSNP:121909226
3906 3906 -, aaga dbSNP:786204898
3906 3906 a, g dbSNP:781542973
3914 3914 a, g dbSNP:747865777
3915 3915 c, t dbSNP:755953294
3917 3917 a, c dbSNP:777640028
3918 3918 c, t dbSNP:35917308
3919 3919 a, g dbSNP:202004587
3922 3922 a, c dbSNP:786204925
3942 3942 a, g dbSNP:587780710
3945 3945 a, g dbSNP:149772796
3949 3949 c, t dbSNP:587783059
3960 3960 a, c dbSNP:779530981
3961 3961 c, g dbSNP:786204927
3962 3962 a, g dbSNP:121909238
3963 3963 c, t dbSNP:145695240
3968 3968 c, t dbSNP:786204856
3970 3970 c, t dbSNP:398123320
3972 3972 a, g dbSNP:746661067
3973 3973 c, t dbSNP:786204928
3977 3977 g, t dbSNP:781647403
3978 3978 a, g dbSNP:770224289
3985 3985 a, t dbSNP:786204857
3988 3988 a, c dbSNP:786202944
3990 3990 -, aaa dbSNP:587782641
3998 3998 a, g dbSNP:587782343
4003 4003 a, g dbSNP:57374291
4004 4004 a, g dbSNP:786204858
4005 4005 c, t dbSNP:372876243
4005 4005 -, t dbSNP:786204899
4011 4011 c, t dbSNP:763477642
4014 4014 a, g dbSNP:786201929
4015 4015 c, t dbSNP:398123321
4019 4019 c, t dbSNP:121909230
4022 4022 g, t dbSNP:587781254
4027 4027 a, g dbSNP:145124907
4031 4031 -, acaat dbSNP:587776666
4033 4033 a, c dbSNP:771310592
4034 4034 a, g dbSNP:551221430
4039 4039 c, g dbSNP:139767111
4042 4042 a, g dbSNP:786204930
4044 4044 a, c dbSNP:759485888
4046 4046 c, g dbSNP:121909237
4048 4048 a, g dbSNP:786202740
4051 4051 c, t dbSNP:786204931
4052 4052 a, g dbSNP:121909222
4054 4054 c, g, t dbSNP:121909223
4063 4063 a, g dbSNP:587781255
4064 4064 g, t dbSNP:398123322
4069 4069 a, g dbSNP:786204929
4070 4070 a, g dbSNP:121909218
4072 4072 c, g, t dbSNP:121909224
4073 4073 a, c, g dbSNP:121909229
4073 4073 -, g dbSNP:121913292
4075 4075 a, t dbSNP:786204932
4076 4076 c, t dbSNP:397514560
4079 4079 a, g, t dbSNP:121909241
4087 4087 a, g dbSNP:587782360
4088 4088 c, t dbSNP:370795352
4089 4089 -, a dbSNP:398123323
4090 4090 c, t dbSNP:786201044
4091 4091 a, g dbSNP:786204859
4095 4095 a, g dbSNP:144545031
4108 4108 c, g, t dbSNP:746152219
4109 4109 a, g dbSNP:753630034
4112 4112 a, g dbSNP:786202047
4121 4121 a, t dbSNP:786204933
4124 4124 a, g dbSNP:757087471
4128 4128 a, c