Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ARID1B AT rich interactive domain 1B (SWI1-like) [Homo sapiens (human)]

Gene Symbol ARID1B
Entrez Gene ID 57492
Full Name AT rich interactive domain 1B (SWI1-like)
Synonyms 6A3-5, BAF250B, BRIGHT, DAN15, ELD/OSA1, MRD12, OSA2, P250R
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu70525 XM_005267069 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu70526 XM_011535984 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu70527 XM_011535985 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu70528 XM_011535986 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu70529 XM_011535987 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu70530 XM_011535988 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu21347 NM_017519 Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu20605 NM_020732 Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu70525D
Sequence Information ORF Nucleotide Sequence (Length: 6870bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AT-rich interactive domain-containing protein 1B isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578812871. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)2130..>2330(+)
Misc Feature(2)3357..3632(+)
Misc Feature(3)5973..6743(+)
Position Chain Variation Link
9 9 c, t dbSNP:765521754
49 49 -, cgcgggcgc dbSNP:777784233
58 58 c, t dbSNP:753014356
107 107 a, g dbSNP:533182720
120 120 a, g dbSNP:777781316
135 135 a, g dbSNP:371680791
140 140 -, tcc, tcctcc dbSNP:770512547
141 141 -, tcc dbSNP:746971833
142 142 c, t dbSNP:747481125
148 148 c, t dbSNP:757718031
161 161 -, gcggcggca dbSNP:775061368
162 162 -, gcggcggca dbSNP:769480864
173 173 g, t dbSNP:781571296
180 180 a, t dbSNP:746200189
184 184 a, c, t dbSNP:375486386
185 185 c, t dbSNP:569712058
186 186 -, tcc dbSNP:763238673
188 188 c, g dbSNP:747865443
193 193 c, t dbSNP:537376978
197 197 c, g dbSNP:771546243
206 206 c, g dbSNP:555625059
210 210 a, g dbSNP:772615576
216 216 a, g dbSNP:760615443
221 221 a, g dbSNP:369887127
229 229 c, t dbSNP:567535199
235 235 a, g dbSNP:776745618
260 260 a, g dbSNP:759380745
269 269 c, t dbSNP:765178250
271 271 c, t dbSNP:752961325
278 278 -, ccaccagcagca dbSNP:764476277
281 281 c, t dbSNP:763270155
287 287 -, cac dbSNP:762287165
288 288 -, cac dbSNP:752012879
290 290 c, g dbSNP:372726215
295 295 a, g dbSNP:535189355
303 303 c, t dbSNP:751612160
304 304 a, c dbSNP:757399076
307 307 -, ccacca dbSNP:780268024
308 308 -, ccacca dbSNP:754114025
308 308 -, cca dbSNP:756208522
316 316 a, t dbSNP:587779741
324 324 a, c dbSNP:374989034
331 331 a, g dbSNP:552796500
332 332 c, g dbSNP:756468465
356 356 a, c dbSNP:577625187
377 377 -, cag, cagcag, cagcagcag, cagcagcagcag dbSNP:770869529
378 378 -, cagcagcag dbSNP:777729182
378 378 -, cag dbSNP:746846909
379 379 a, g dbSNP:747743024
380 380 -, cagcagcagcagcagcagcaa dbSNP:762617219
381 381 -, cagcagcagcagcagcagcaa dbSNP:775084783
384 384 -, cagcagcagcagcagcaa dbSNP:768349133
386 386 -, cagcagcagcagcaa dbSNP:762234415
387 387 -, cagcagcagcagcaa dbSNP:774668010
392 392 a, g dbSNP:544767610
393 393 -, cagcagcaa dbSNP:768057996
395 395 -, cagcaa dbSNP:750911844
396 396 -, cagcaa dbSNP:760745125
398 398 -, caa dbSNP:754060642
399 399 -, caa dbSNP:766396838
400 400 -, gc, gca dbSNP:587779743
401 401 a, g dbSNP:78253128
402 402 -, cagcagcag dbSNP:745824983
402 402 -, cag dbSNP:765595527
404 404 -, cagcagcagcagcagcagcaa dbSNP:755601970
405 405 -, cagcagcagcagcagcagcaa dbSNP:779519347
407 407 a, g dbSNP:771649817
419 419 -, cagcaa dbSNP:748838689
419 419 c, g dbSNP:777300641
424 424 -, gcagca dbSNP:587779744
425 425 -, cagcagcagcagcagcag dbSNP:768296283
425 425 a, g dbSNP:746466458
427 427 a, g dbSNP:575289192
430 430 -, gcagcagc, gcagcagcagc dbSNP:748491093
431 431 a, g dbSNP:770519975
434 434 -, tcccattt dbSNP:773725916
437 437 c, g dbSNP:542974447
439 439 c, t dbSNP:776694458
442 442 c, g dbSNP:759611608
445 445 a, g dbSNP:769645555
446 446 c, g dbSNP:775436632
448 448 a, g dbSNP:763184406
451 451 a, g dbSNP:561130072
463 463 a, g dbSNP:751856926
482 482 g, t dbSNP:370106545
492 492 c, g dbSNP:528280784
503 503 a, c, g dbSNP:200808642
507 507 c, g dbSNP:780352077
519 519 c, g dbSNP:540385524
530 530 c, t dbSNP:754236989
542 542 a, c dbSNP:755407106
641 641 a, g dbSNP:564924707
713 713 c, g dbSNP:113758011
717 717 c, g dbSNP:777266582
718 718 c, t dbSNP:746730857
720 720 a, c dbSNP:770339919
737 737 c, t dbSNP:780851634
743 743 c, t dbSNP:745740327
752 752 c, t dbSNP:533517668
769 769 c, g dbSNP:775385239
774 774 a, g dbSNP:375160616
778 778 c, g dbSNP:768554794
844 844 c, t dbSNP:774432900
846 846 -, ccg dbSNP:776819042
847 847 -, ccg dbSNP:766956053
847 847 c, g dbSNP:762100979
864 864 a, g dbSNP:767529376
899 899 c, g dbSNP:773305123
904 904 a, g dbSNP:761134074
907 907 a, c dbSNP:766844503
911 911 a, c dbSNP:754413384
913 913 a, c dbSNP:755281397
938 938 a, c dbSNP:569750806
948 948 c, g dbSNP:765697199
956 956 -, ggc, ggcggc dbSNP:759755695
957 957 -, ggcggcggcggc dbSNP:750281468
957 957 -, ggcggcggc dbSNP:757008446
957 957 -, ggcggc dbSNP:767238602
957 957 -, ggc dbSNP:752981400
959 959 a, c dbSNP:751102826
977 977 -, cggcgg dbSNP:587779747
979 979 c, g dbSNP:756982067
980 980 -, gga dbSNP:748785872
980 980 a, c dbSNP:184815562
981 981 -, gga dbSNP:780034760
983 983 a, c dbSNP:112474841
992 992 -, agg dbSNP:587779748
996 996 a, g dbSNP:201842850
998 998 -, gga dbSNP:778474813
999 999 -, ggaggagga dbSNP:772429143
999 999 -, ggagga dbSNP:747790383
999 999 -, gga dbSNP:754500538
1018 1018 -, aggagc dbSNP:747438636
1020 1020 a, g dbSNP:780126064
1022 1022 a, g dbSNP:189230752
1024 1024 -, aggagcagg dbSNP:771557031
1025 1025 -, aggagcagg dbSNP:777332927
1027 1027 c, g dbSNP:749315126
1052 1052 -, gtggcg dbSNP:759630370
1055 1055 -, ggc dbSNP:765410747
1056 1056 -, gcggcggcggcc dbSNP:763063242
1063 1063 c, t dbSNP:768271181
1068 1068 -, gcg dbSNP:764418312
1069 1069 c, t dbSNP:530780611
1092 1092 -, ggc dbSNP:542021607
1094 1094 -, ggc dbSNP:555730413
1126 1126 c, t dbSNP:748273011
1151 1151 c, t dbSNP:549289491
1208 1208 c, t dbSNP:772315737
1221 1221 a, g dbSNP:773467188
1225 1225 c, g dbSNP:760718156
1234 1234 c, t dbSNP:766500898
1249 1249 c, g dbSNP:776996949
1262 1262 a, c, g dbSNP:760090226
1271 1271 c, g, t dbSNP:753125848
1281 1281 g, t dbSNP:767247521
1283 1283 c, t dbSNP:750158289
1286 1286 c, t dbSNP:755682475
1289 1289 c, g dbSNP:779622340
1292 1292 c, g dbSNP:753662365
1295 1295 c, t dbSNP:754967908
1297 1297 a, g dbSNP:778536440
1307 1307 c, t dbSNP:747947340
1312 1312 c, t dbSNP:771908741
1323 1323 a, g dbSNP:199948752
1334 1334 c, t dbSNP:747295062
1337 1337 c, t dbSNP:770927920
1338 1338 c, g dbSNP:776783024
1341 1341 a, g dbSNP:759909326
1345 1345 a, c, g dbSNP:770362902
1350 1350 c, g dbSNP:763387163
1352 1352 c, g dbSNP:764620171
1356 1356 c, t dbSNP:750031315
1367 1367 c, t dbSNP:760419444
1371 1371 -, cgc, cgccgc dbSNP:572236007
1372 1372 -, cgccgc dbSNP:754447727
1372 1372 -, cgc dbSNP:766249098
1376 1376 a, g dbSNP:765760904
1380 1380 c, t dbSNP:753422144
1382 1382 a, g dbSNP:754489682
1383 1383 -, cgccgt dbSNP:778413404
1384 1384 a, c dbSNP:778891019
1385 1385 -, gccgtcgca dbSNP:752295930
1386 1386 -, cgc dbSNP:587779738
1386 1386 a, c dbSNP:752684703
1388 1388 -, ccg dbSNP:587779739
1406 1406 -, ggcggc dbSNP:757953295
1406 1406 -, ggc dbSNP:777545000
1413 1413 a, g dbSNP:587779740
1435 1435 g, t dbSNP:758181047
1456 1456 -, tgggct dbSNP:747320636
1465 1465 c, g dbSNP:777545755
1472 1472 c, t dbSNP:747174363
1477 1477 a, g dbSNP:771204934
1479 1479 a, g dbSNP:781091058
1487 1487 c, t dbSNP:745929521
1488 1488 c, g dbSNP:769813347
1494 1494 a, g dbSNP:776060836
1495 1495 a, c dbSNP:763559359
1501 1501 c, g dbSNP:769085274
1502 1502 a, g dbSNP:774880058
1503 1503 g, t dbSNP:760366486
1505 1505 a, c dbSNP:766027272
1513 1513 c, t dbSNP:753486869
1524 1524 -, agg dbSNP:771434224
1526 1526 c, g dbSNP:759078059
1528 1528 a, c, g dbSNP:764716697
1530 1530 c, t dbSNP:758342480
1531 1531 a, c dbSNP:763825843
1534 1534 c, g dbSNP:751389585
1535 1535 a, g dbSNP:757043988
1537 1537 a, c dbSNP:781454908
1547 1547 c, t dbSNP:746135430
1560 1560 c, t dbSNP:200682868
1566 1566 a, g dbSNP:780293502
1568 1568 a, g dbSNP:749761849
1569 1569 g, t dbSNP:769316078
1570 1570 g, t dbSNP:775035352
1571 1571 c, t dbSNP:748498440
1590 1590 a, g dbSNP:145785954
1591 1591 c, t dbSNP:775164729
1593 1593 a, g dbSNP:762428637
1597 1597 a, c dbSNP:763652332
1599 1599 a, g dbSNP:147794292
1611 1611 a, c dbSNP:761668764
1613 1613 a, g dbSNP:267600875
1614 1614 a, c dbSNP:767293145
1627 1627 a, g dbSNP:750214622
1630 1630 c, t dbSNP:141260832
1636 1636 a, g dbSNP:147088160
1659 1659 a, c dbSNP:754167205
1663 1663 a, g dbSNP:539811282
1669 1669 c, t dbSNP:779142775
1670 1670 a, g, t dbSNP:142939952
1673 1673 c, t dbSNP:758854488
1680 1680 a, g dbSNP:778162933
1686 1686 c, t dbSNP:747306459
1687 1687 a, g dbSNP:570309056
1688 1688 c, t dbSNP:779668926
1707 1707 c, t dbSNP:749006707
1708 1708 a, g dbSNP:768096043
1709 1709 c, g dbSNP:773754437
1716 1716 a, g dbSNP:17318151
1717 1717 c, t dbSNP:756050584
1720 1720 c, g dbSNP:773247445
1731 1731 a, c, t dbSNP:143370913
1732 1732 a, g dbSNP:754042537
1739 1739 c, t dbSNP:759855548
1740 1740 a, g dbSNP:765362265
1743 1743 g, t dbSNP:201244213
1751 1751 c, t dbSNP:752755002
1752 1752 a, g dbSNP:151093357
1755 1755 a, g dbSNP:778121932
1760 1760 a, g dbSNP:752168831
1783 1783 c, t dbSNP:148382861
1801 1801 a, g dbSNP:761867629
1805 1805 a, g dbSNP:772203422
1814 1814 c, t dbSNP:773640553
1824 1824 a, g dbSNP:571695301
1829 1829 -, c dbSNP:138196985
1835 1835 a, c, g dbSNP:766599882
1836 1836 c, t dbSNP:141395733
1843 1843 a, g dbSNP:763818779
1852 1852 -, gca dbSNP:746407600
1857 1857 c, t dbSNP:751317747
1858 1858 c, t dbSNP:779239519
1861 1861 a, c, t dbSNP:199949701
1862 1862 a, g dbSNP:370068335
1863 1863 c, t dbSNP:372781930
1869 1869 c, t dbSNP:201038527
1871 1871 a, g dbSNP:756099753
1873 1873 c, g, t dbSNP:779895443
1880 1880 a, c, g dbSNP:146312104
1884 1884 c, t dbSNP:751320376
1887 1887 c, t dbSNP:748370897
1891 1891 c, t dbSNP:772078777
1892 1892 a, g dbSNP:376964478
1895 1895 c, t dbSNP:761043177
1898 1898 c, g dbSNP:771442003
1901 1901 c, t dbSNP:139595304
1902 1902 c, t dbSNP:387907142
1906 1906 a, g dbSNP:538689102
1912 1912 a, c, t dbSNP:759934770
1913 1913 c, t dbSNP:751192841
1917 1917 c, t dbSNP:372690657
1918 1918 c, t dbSNP:558155146
1919 1919 a, g, t dbSNP:374876774
1930 1930 c, t dbSNP:767255855
1931 1931 a, g dbSNP:142897795
1945 1945 a, g dbSNP:749173157
1963 1963 c, g dbSNP:765810222
1969 1969 a, t dbSNP:753748958
1972 1972 c, t dbSNP:376595068
1975 1975 c, g dbSNP:764967238
1976 1976 c, t dbSNP:146240413
1977 1977 a, g dbSNP:573836252
1978 1978 a, g dbSNP:778044758
1984 1984 c, g dbSNP:778362623
1994 1994 a, t dbSNP:139125255
1997 1997 c, t dbSNP:149931590
2007 2007 a, g dbSNP:781146492
2008 2008 c, t dbSNP:746327988
2010 2010 a, c dbSNP:770455355
2014 2014 a, g dbSNP:776187102
2019 2019 a, g dbSNP:749657274
2035 2035 c, t dbSNP:559304585
2042 2042 a, g dbSNP:761710707
2053 2053 c, t dbSNP:767620420
2054 2054 a, t dbSNP:750738896
2066 2066 c, g dbSNP:756195424
2068 2068 c, t dbSNP:373508866
2069 2069 a, g dbSNP:201290874
2075 2075 a, g dbSNP:6912981
2086 2086 c, t dbSNP:779512205
2096 2096 a, c dbSNP:376143843
2102 2102 g, t dbSNP:772549124
2103 2103 a, g dbSNP:780820426
2105 2105 a, g dbSNP:745528262
2108 2108 c, t dbSNP:148700132
2109 2109 a, g dbSNP:775004900
2116 2116 c, t dbSNP:762908553
2117 2117 a, g dbSNP:370910542
2129 2129 c, g dbSNP:774397054
2130 2130 a, g dbSNP:374648940
2134 2134 a, g dbSNP:368202669
2137 2137 a, g dbSNP:762401544
2144 2144 a, g dbSNP:750615874
2146 2146 c, t dbSNP:774701560
2147 2147 a, g dbSNP:551597753
2148 2148 a, c dbSNP:753933273
2150 2150 c, g dbSNP:755131525
2152 2152 c, t dbSNP:779271100
2153 2153 a, g dbSNP:753317592
2167 2167 a, g dbSNP:758625736
2168 2168 c, t dbSNP:370364530
2170 2170 c, t dbSNP:563771544
2171 2171 a, g dbSNP:3734441
2182 2182 g, t dbSNP:779724084
2186 2186 c, t dbSNP:549352027
2193 2193 c, g dbSNP:768277043
2195 2195 a, g dbSNP:374696557
2196 2196 a, g dbSNP:748129248
2197 2197 c, g dbSNP:367698478
2198 2198 a, g dbSNP:780611617
2200 2200 a, c, g dbSNP:567668222
2208 2208 c, t dbSNP:534990481
2219 2219 a, t dbSNP:766684321
2222 2222 c, t dbSNP:776967149
2226 2226 c, t dbSNP:759533117
2229 2229 a, g dbSNP:765365713
2235 2235 a, g dbSNP:753092220
2239 2239 a, g dbSNP:763191352
2248 2248 a, g dbSNP:764402992
2266 2266 c, t dbSNP:751891035
2268 2268 a, g dbSNP:757669934
2270 2270 a, g dbSNP:779669164
2274 2274 a, g dbSNP:748973290
2276 2276 a, c dbSNP:546849919
2283 2283 a, t dbSNP:372730587
2292 2292 c, t dbSNP:757549352
2296 2296 c, t dbSNP:754080772
2297 2297 a, g dbSNP:190653632
2306 2306 c, t dbSNP:541757080
2311 2311 a, g dbSNP:778467052
2329 2329 c, g, t dbSNP:762229592
2331 2331 a, c dbSNP:758038225
2334 2334 c, t dbSNP:777845775
2336 2336 c, t dbSNP:746951045
2337 2337 a, g dbSNP:147784000
2342 2342 a, g dbSNP:781067022
2348 2348 a, g dbSNP:368362137
2356 2356 c, t dbSNP:770027363
2371 2371 a, g dbSNP:780321051
2377 2377 g, t dbSNP:141219657
2384 2384 c, g, t dbSNP:768672743
2392 2392 a, g dbSNP:761921020
2396 2396 a, c dbSNP:772604684
2397 2397 c, g dbSNP:773646023
2398 2398 c, t dbSNP:201156721
2404 2404 c, t dbSNP:761093701
2408 2408 c, t dbSNP:766654973
2410 2410 a, g dbSNP:752341983
2411 2411 c, g dbSNP:778702667
2413 2413 a, g dbSNP:762721043
2418 2418 c, t dbSNP:114201726
2427 2427 a, g dbSNP:556939212
2436 2436 c, t dbSNP:756767804
2442 2442 c, t dbSNP:767477226
2443 2443 c, t dbSNP:150140314
2444 2444 a, g dbSNP:374691223
2449 2449 a, g dbSNP:779733858
2462 2462 a, g dbSNP:749470868
2465 2465 c, g dbSNP:755160504
2485 2485 c, g dbSNP:779154161
2488 2488 a, g dbSNP:748209235
2492 2492 c, t dbSNP:546767328
2508 2508 a, c, g dbSNP:772107512
2515 2515 c, t dbSNP:141030037
2518 2518 a, g, t dbSNP:771280525
2519 2519 c, t dbSNP:760022925
2520 2520 a, g dbSNP:150249745
2521 2521 a, g dbSNP:774205020
2524 2524 c, t dbSNP:527698870
2525 2525 a, g dbSNP:368988882
2536 2536 a, g dbSNP:766942261
2539 2539 a, g dbSNP:750324294
2540 2540 c, t dbSNP:756036121
2542 2542 g, t dbSNP:138934947
2544 2544 a, c dbSNP:753607638
2565 2565 c, t dbSNP:572020611
2566 2566 a, c dbSNP:761388338
2572 2572 c, t dbSNP:749077422
2573 2573 a, g dbSNP:772564622
2581 2581 a, g dbSNP:760280267
2603 2603 c, t dbSNP:766290096
2604 2604 a, g dbSNP:145635490
2615 2615 c, t dbSNP:528889230
2616 2616 a, g dbSNP:542660265
2618 2618 c, t dbSNP:752913095
2637 2637 a, g dbSNP:564110998
2639 2639 a, c dbSNP:778099902
2645 2645 g, t dbSNP:376497842
2655 2655 a, g dbSNP:757473942
2661 2661 a, t dbSNP:781763581
2664 2664 c, g dbSNP:138254872
2671 2671 a, g dbSNP:770228055
2674 2674 a, g dbSNP:780312215
2684 2684 -, gtg dbSNP:201979665
2694 2694 a, t dbSNP:749701314
2707 2707 g, t dbSNP:771600870
2715 2715 a, t dbSNP:772975321
2724 2724 c, t dbSNP:760095080
2726 2726 g, t dbSNP:770428988
2738 2738 a, g dbSNP:751177927
2747 2747 c, g dbSNP:146077641
2750 2750 c, t dbSNP:764978487
2767 2767 c, t dbSNP:752405476
2791 2791 g, t dbSNP:762855776
2795 2795 a, g dbSNP:764210072
2798 2798 a, g dbSNP:587779742
2802 2802 a, g, t dbSNP:531418921
2810 2810 c, t dbSNP:750914446
2818 2818 a, c, g dbSNP:756655213
2837 2837 c, t dbSNP:374572368
2838 2838 a, g dbSNP:377633743
2851 2851 a, c dbSNP:549928918
2853 2853 g, t dbSNP:746676470
2859 2859 a, g dbSNP:770377920
2861 2861 c, g dbSNP:148749268
2889 2889 g, t dbSNP:773631262
2892 2892 a, c dbSNP:760765281
2894 2894 c, t dbSNP:144894118
2895 2895 a, g dbSNP:34786733
2896 2896 a, g dbSNP:755539131
2917 2917 c, t dbSNP:370071892
2933 2933 a, c dbSNP:373256784
2953 2953 a, g dbSNP:550604212
2959 2959 c, g dbSNP:780818465
2970 2970 a, c dbSNP:745524201
2975 2975 c, g dbSNP:755525381
2977 2977 a, t dbSNP:139620600
2980 2980 c, t dbSNP:377351099
2981 2981 a, g dbSNP:144558683
2982 2982 c, g dbSNP:779048797
2983 2983 c, t dbSNP:370190261
2984 2984 a, g dbSNP:537901478
2991 2991 a, c dbSNP:773510355
2994 2994 a, c dbSNP:760973888
2996 2996 a, g dbSNP:566567531
2998 2998 c, t dbSNP:750810656
2999 2999 a, g dbSNP:560450902
3002 3002 c, t dbSNP:765720893
3003 3003 a, g dbSNP:527731946
3005 3005 a, c dbSNP:763236835
3006 3006 a, g dbSNP:764460073
3011 3011 a, g dbSNP:758749885
3020 3020 a, g dbSNP:750032487
3033 3033 a, g dbSNP:758377419
3037 3037 c, t dbSNP:777905171
3045 3045 -, atg dbSNP:762047886
3046 3046 c, t dbSNP:746808513
3049 3049 c, t dbSNP:371523255
3055 3055 c, t dbSNP:540277176
3073 3073 c, t dbSNP:746092285
3074 3074 c, t dbSNP:769820008
3075 3075 c, t dbSNP:775582196
3086 3086 -, agc dbSNP:772325958
3086 3086 a, g dbSNP:749413486
3087 3087 a, g dbSNP:769132694
3089 3089 a, g dbSNP:774783574
3092 3092 c, t dbSNP:147853607
3093 3093 a, g dbSNP:375023508
3098 3098 a, t dbSNP:776294122
3117 3117 a, c, t dbSNP:368880015
3119 3119 c, t dbSNP:752231248
3120 3120 a, g dbSNP:570798143
3138 3138 a, g dbSNP:763525655
3140 3140 c, g dbSNP:751465997
3141 3141 a, t dbSNP:757176899
3145 3145 a, g dbSNP:139407686
3151 3151 a, g dbSNP:750198878
3158 3158 a, t dbSNP:534113119
3171 3171 a, c dbSNP:755963909
3181 3181 a, c dbSNP:780181329
3227 3227 c, t dbSNP:754071347
3246 3246 a, g dbSNP:754998837
3296 3296 a, g dbSNP:373653398
3319 3319 g, t dbSNP:779243569
3332 3332 a, g dbSNP:752704102
3341 3341 c, t dbSNP:758570139
3344 3344 a, g dbSNP:373641381
3347 3347 a, g dbSNP:747533804
3349 3349 a, g dbSNP:771373121
3353 3353 c, t dbSNP:781714598
3358 3358 c, t dbSNP:746278639
3368 3368 a, g dbSNP:568095755
3377 3377 c, t dbSNP:371828409
3378 3378 a, g dbSNP:761227259
3381 3381 c, t dbSNP:387907144
3387 3387 c, t dbSNP:779598699
3390 3390 a, t dbSNP:771621841
3391 3391 a, c dbSNP:773082217
3396 3396 a, c dbSNP:760633180
3402 3402 c, g dbSNP:766340916
3406 3406 a, g dbSNP:753607488
3408 3408 a, g dbSNP:759432635
3410 3410 c, g dbSNP:765371275
3415 3415 c, t dbSNP:377588212
3417 3417 a, g dbSNP:758353662
3423 3423 a, g dbSNP:774855592
3425 3425 c, t dbSNP:752073815
3426 3426 a, c dbSNP:757809298
3428 3428 g, t dbSNP:781777822
3434 3434 c, t dbSNP:746210543
3435 3435 a, g dbSNP:370283707
3437 3437 a, g dbSNP:778366844
3446 3446 a, g, t dbSNP:374705142
3447 3447 c, t dbSNP:746686035
3452 3452 a, g dbSNP:376995038
3462 3462 c, t dbSNP:387907141
3463 3463 a, g dbSNP:746567959
3467 3467 c, g, t dbSNP:111368751
3468 3468 c, t dbSNP:759186918
3470 3470 c, t dbSNP:61736269
3471 3471 a, g dbSNP:775526039
3476 3476 c, t dbSNP:763270294
3481 3481 a, g dbSNP:764452515
3484 3484 a, g dbSNP:751670059
3487 3487 g, t dbSNP:375581771
3488 3488 c, t dbSNP:181686951
3497 3497 g, t dbSNP:750948289
3548 3548 c, t dbSNP:771166112
3549 3549 a, g dbSNP:756707971
3557 3557 c, t dbSNP:142391292
3569 3569 a, g dbSNP:745412510
3581 3581 a, g dbSNP:769749724
3599 3599 c, g dbSNP:779917726
3605 3605 g, t dbSNP:545017957
3617 3617 a, g dbSNP:61745451
3626 3626 c, t dbSNP:774661225
3631 3631 a, g dbSNP:762153671
3632 3632 a, t dbSNP:772220023
3646 3646 c, t dbSNP:773317331
3647 3647 a, g dbSNP:760721516
3648 3648 c, t dbSNP:766902947
3649 3649 c, t dbSNP:754303482
3650 3650 a, g dbSNP:759836095
3652 3652 a, c dbSNP:765612283
3665 3665 c, t dbSNP:369218715
3666 3666 a, g dbSNP:756872796
3684 3684 c, g dbSNP:780758224
3698 3698 a, g dbSNP:749937918
3716 3716 a, g dbSNP:776425168
3733 3733 c, t dbSNP:759056899
3740 3740 c, t dbSNP:764861177
3741 3741 c, t dbSNP:752639283
3746 3746 a, g dbSNP:762767858
3750 3750 a, g dbSNP:552938708
3752 3752 c, t dbSNP:372186962
3757 3757 a, g dbSNP:145857100
3774 3774 c, g dbSNP:781326777
3786 3786 c, g dbSNP:138482029
3790 3790 a, g dbSNP:756141390
3797 3797 a, t dbSNP:780142651
3800 3800 c, t dbSNP:749430350
3801 3801 c, g dbSNP:547596526
3818 3818 c, t dbSNP:771632801
3819 3819 a, g dbSNP:779536790
3824 3824 g, t dbSNP:748391706
3834 3834 a, g, t dbSNP:141190049
3835 3835 c, t dbSNP:376806897
3839 3839 a, g dbSNP:769609140
3850 3850 a, g dbSNP:574296429
3851 3851 c, t dbSNP:369035728
3865 3865 c, t dbSNP:138218716
3869 3869 c, t dbSNP:373881952
3872 3872 c, t dbSNP:748681838
3875 3875 a, g dbSNP:768227723
3884 3884 c, t dbSNP:559706338
3885 3885 a, g dbSNP:773649998
3890 3890 c, t dbSNP:767486423
3895 3895 c, t dbSNP:772973856
3898 3898 c, t dbSNP:533211077
3904 3904 c, t dbSNP:150196933
3905 3905 a, g dbSNP:766441730
3909 3909 c, t dbSNP:754100748
3910 3910 a, g dbSNP:754960836
3918 3918 a, g dbSNP:138784762
3924 3924 c, t dbSNP:752863054
3928 3928 a, g dbSNP:376071880
3929 3929 c, t dbSNP:370523060
3930 3930 a, g dbSNP:747374301
3932 3932 c, t dbSNP:757646876
3934 3934 c, t dbSNP:779516798
3935 3935 a, c dbSNP:748995523
3943 3943 a, c dbSNP:768013849
3954 3954 a, g dbSNP:773883674
3957 3957 a, c dbSNP:747709980
3959 3959 c, t dbSNP:771988661
3960 3960 a, g dbSNP:773135175
3963 3963 a, g, t dbSNP:760402063
3964 3964 c, t dbSNP:776675533
3974 3974 a, g dbSNP:530602758
3979 3979 c, t dbSNP:759771283
3980 3980 c, t dbSNP:765425489
3982 3982 a, g dbSNP:752811689
3988 3988 c, g dbSNP:374517532
4003 4003 c, t dbSNP:764630192
4009 4009 a, g dbSNP:149389876
4019 4019 a, g dbSNP:200230777
4035 4035 a, g dbSNP:752398721
4036 4036 a, g dbSNP:763740758
4043 4043 c, t dbSNP:368341224
4044 4044 a, g dbSNP:753381410
4048 4048 c, t dbSNP:371538726
4049 4049 a, c, g, t dbSNP:374823620
4055 4055 a, c dbSNP:769769342
4059 4059 a, g, t dbSNP:144029881
4067 4067 c, t dbSNP:769028104
4069 4069 a, g dbSNP:774520303
4074 4074 a, g dbSNP:761809331
4077 4077 c, t dbSNP:387907140
4094 4094 a, g dbSNP:367653751
4103 4103 c, t dbSNP:371872657
4104 4104 a, g dbSNP:199674889
4109 4109 a, g dbSNP:766772916
4110 4110 a, g dbSNP:754234955
4112 4112 a, g dbSNP:757999037
4114 4114 c, g dbSNP:763750480
4120 4120 c, t dbSNP:751015296
4121 4121 a, g dbSNP:756784391
4123 4123 g, t dbSNP:781175942
4128 4128 c, g dbSNP:745841288
4130 4130 a, g dbSNP:755940737
4134 4134 c, t dbSNP:138785718
4135 4135 a, g dbSNP:370064281
4141 4141 a, g dbSNP:768938099
4159 4159 a, g dbSNP:142808724
4163 4163 c, t dbSNP:372767127
4164 4164 a, g dbSNP:772095737
4167 4167 a, c dbSNP:773740590
4168 4168 a, g dbSNP:761133847
4172 4172 a, g dbSNP:779177994
4175 4175 g, t dbSNP:565147002
4196 4196 c, t dbSNP:748363079
4225 4225 c, t dbSNP:577211667
4228 4228 c, t dbSNP:773119970
4229 4229 a, g dbSNP:374835455
4238 4238 a, g dbSNP:147424506
4241 4241 c, t dbSNP:56139133
4248 4248 a, g dbSNP:151115781
4260 4260 c, t dbSNP:587779745
4264 4264 a, g dbSNP:765570329
4267 4267 c, t dbSNP:367809905
4276 4276 a, g dbSNP:778062751
4278 4278 c, t dbSNP:747088591
4279 4279 a, g dbSNP:771056710
4289 4289 c, t dbSNP:139785288
4290 4290 a, g, t dbSNP:746412839
4294 4294 c, t dbSNP:145012943
4295 4295 a, g dbSNP:763386213
4298 4298 c, t dbSNP:377021700
4302 4302 c, t dbSNP:773062339
4314 4314 c, t dbSNP:760245781
4316 4316 c, t dbSNP:369640779
4323 4323 a, g dbSNP:766030463
4326 4326 a, g dbSNP:753434703
4328 4328 c, t dbSNP:150516641
4329 4329 a, g dbSNP:777513652
4330 4330 c, t dbSNP:759345151
4331 4331 a, g dbSNP:765236859
4360 4360 -, agg dbSNP:755476506
4364 4364 a, g dbSNP:139512931
4369 4369 a, g dbSNP:372833448
4375 4375 a, g dbSNP:534466124
4383 4383 a, g dbSNP:149702962
4388 4388 c, g, t dbSNP:777844769
4392 4392 g, t dbSNP:145516400
4393 4393 c, t dbSNP:781209005
4394 4394 a, g dbSNP:745968347
4398 4398 c, g dbSNP:140639463
4399 4399 c, t dbSNP:530430137
4400 4400 a, g dbSNP:749608995
4402 4402 a, g dbSNP:769118968
4404 4404 c, t dbSNP:772972321
4405 4405 a, g dbSNP:144424476
4409 4409 a, g dbSNP:770732982
4413 4413 a, c, g dbSNP:376225642
4415 4415 c, g dbSNP:368993084
4418 4418 a, g dbSNP:759092517
4419 4419 a, g dbSNP:765083250
4428 4428 a, c dbSNP:775556116
4430 4430 a, c, g dbSNP:146625434
4435 4435 c, t dbSNP:751387548
4452 4452 a, g dbSNP:745566888
4457 4457 a, g dbSNP:767739514
4463 4463 a, c, g dbSNP:566865279
4470 4470 a, g dbSNP:780408339
4475 4475 a, g dbSNP:527711444
4480 4480 a, t dbSNP:755473951
4482 4482 a, g dbSNP:779375711
4487 4487 a, c dbSNP:748539331
4489 4489 c, t dbSNP:770643408
4490 4490 a, g dbSNP:373191607
4499 4499 c, g dbSNP:745359242
4503 4503 a, g dbSNP:141461351
4505 4505 c, t dbSNP:143236717
4506 4506 a, g dbSNP:376207220
4510 4510 c, t dbSNP:370889837
4511 4511 a, g dbSNP:774071774
4512 4512 a, c dbSNP:761599931
4520 4520 a, g dbSNP:61745210
4521 4521 c, t dbSNP:750713205
4526 4526 c, t dbSNP:756120841
4535 4535 c, g dbSNP:766446706
4535 4535 -, g dbSNP:587779746
4541 4541 a, g dbSNP:753891391
4544 4544 g, t dbSNP:755486688
4546 4546 a, g dbSNP:779570779
4547 4547 c, t dbSNP:549950885
4560 4560 c, t dbSNP:758892744
4561 4561 a, g dbSNP:780970034
4563 4563 a, c dbSNP:745575926
4565 4565 c, t dbSNP:769362465
4566 4566 g, t dbSNP:775015868
4567 4567 a, t dbSNP:748759595
4582 4582 a, g dbSNP:373500669
4586 4586 a, g dbSNP:774335434
4589 4589 c, t dbSNP:568203974
4598 4598 c, t dbSNP:139903653
4601 4601 c, g, t dbSNP:141783755
4603 4603 c, g dbSNP:760906582
4604 4604 c, t dbSNP:571692142
4618 4618 c, t dbSNP:370838091
4619 4619 a, g dbSNP:759759957
4620 4620 c, t dbSNP:765827636
4622 4622 c, g dbSNP:138412834
4627 4627 a, g dbSNP:758804576
4630 4630 c, t dbSNP:778160923
4635 4635 a, g dbSNP:142788313
4649 4649 c, t dbSNP:755734669
4653 4653 a, t dbSNP:34870395
4654 4654 c, t dbSNP:138181857
4659 4659 a, g, t dbSNP:768210321
4664 4664 c, t dbSNP:748119553
4682 4682 c, t dbSNP:61747988
4685 4685 a, g dbSNP:773006123
4691 4691 a, g dbSNP:373910693
4696 4696 -, ctt dbSNP:779460018
4703 4703 c, t dbSNP:182287119
4704 4704 a, g dbSNP:567836947
4724 4724 c, t dbSNP:776777663
4730 4730 a, g dbSNP:368163089
4739 4739 c, g dbSNP:563086310
4743 4743 a, g dbSNP:752856754
4754 4754 c, t dbSNP:150010654
4757 4757 a, g dbSNP:764521196
4758 4758 c, t dbSNP:542516057
4771 4771 c, t dbSNP:757628046
4772 4772 a, c, g dbSNP:779739760
4778 4778 c, t dbSNP:2068129
4783 4783 a, c, t dbSNP:570186838
4784 4784 a, g dbSNP:527651886
4790 4790 a, g dbSNP:61738955
4794 4794 c, t dbSNP:113347228
4806 4806 a, g dbSNP:370174322
4814 4814 a, g dbSNP:746810545
4816 4816 c, t dbSNP:762698567
4817 4817 a, g dbSNP:776881575
4818 4818 c, t dbSNP:746048984
4820 4820 c, t dbSNP:770164775
4828 4828 c, t dbSNP:758724418
4829 4829 a, g dbSNP:374125873
4850 4850 a, g dbSNP:556299458
4852 4852 a, g dbSNP:367764610
4854 4854 c, t dbSNP:774777278
4855 4855 a, g dbSNP:762211408
4857 4857 a, c dbSNP:767808574
4866 4866 a, g dbSNP:750814930
4875 4875 c, g dbSNP:754572827
4886 4886 a, g dbSNP:764877126
4890 4890 a, g dbSNP:139214813
4913 4913 c, t dbSNP:757908002
4915 4915 c, t dbSNP:777745107
4916 4916 a, g dbSNP:746960777
4919 4919 a, c dbSNP:757252042
4921 4921 c, g dbSNP:781086610
4937 4937 c, t dbSNP:745670548
4954 4954 a, c dbSNP:770072973
4956 4956 c, t dbSNP:775920998
4963 4963 c, t dbSNP:766639614
4988 4988 c, t dbSNP:749373437
4990 4990 g, t dbSNP:3210165
5006 5006 a, g dbSNP:768663672
5012 5012 a, g dbSNP:371430687
5029 5029 a, g dbSNP:762183842
5046 5046 c, g dbSNP:375949587
5051 5051 c, t dbSNP:550054527
5054 5054 c, t dbSNP:768949418
5058 5058 -, c dbSNP:747262317
5066 5066 a, g dbSNP:778806657
5071 5071 a, g dbSNP:544895806
5093 5093 a, g dbSNP:772566253
5099 5099 c, t dbSNP:372621575
5114 5114 a, g, t dbSNP:146620657
5134 5134 a, g dbSNP:777085838
5144 5144 a, g dbSNP:753890440
5152 5152 a, c dbSNP:762465807
5163 5163 a, g dbSNP:763822415
5164 5164 c, g dbSNP:750965814
5171 5171 c, g dbSNP:761451340
5173 5173 a, g dbSNP:140177120
5179 5179 c, t dbSNP:190027529
5186 5186 a, g dbSNP:760636496
5198 5198 c, t dbSNP:766430210
5210 5210 c, t dbSNP:753507388
5231 5231 a, c, g dbSNP:754864354
5233 5233 c, t dbSNP:541564441
5234 5234 a, t dbSNP:753008910
5238 5238 a, g dbSNP:758650746
5247 5247 a, g, t dbSNP:777781055
5253 5253 a, g dbSNP:369339813
5257 5257 a, g dbSNP:149841055
5260 5260 a, g dbSNP:746202741
5265 5265 a, g dbSNP:770242254
5266 5266 c, t dbSNP:773843930
5271 5271 g, t dbSNP:747758337
5276 5276 c, t dbSNP:771869774
5277 5277 a, g dbSNP:772787830
5288 5288 a, g dbSNP:760264273
5293 5293 a, g dbSNP:528688757
5297 5297 c, t dbSNP:776682804
5299 5299 a, g dbSNP:759224463
5300 5300 c, t dbSNP:145867693
5301 5301 a, c, g dbSNP:546855765
5309 5309 a, g dbSNP:764306695
5314 5314 a, g dbSNP:751635758
5317 5317 a, c dbSNP:757383409
5332 5332 c, t dbSNP:781527504
5333 5333 a, c dbSNP:148922487
5334 5334 a, g dbSNP:756610931
5336 5336 a, c, t dbSNP:189662115
5337 5337 a, g dbSNP:771781497
5344 5344 a, c, g dbSNP:138020626
5352 5352 a, g dbSNP:746497588
5365 5365 a, c dbSNP:149518409
5368 5368 a, g dbSNP:569199026
5372 5372 -, tga dbSNP:771741082
5376 5376 -, gac dbSNP:374755339
5378 5378 c, t dbSNP:759473238
5379 5379 a, g dbSNP:765101364
5381 5381 -, cga dbSNP:113820273
5381 5381 c, t dbSNP:775201232
5382 5382 a, g dbSNP:374680141
5390 5390 c, t dbSNP:368980689
5391 5391 a, g dbSNP:528801298
5403 5403 a, g dbSNP:751827621
5412 5412 a, c dbSNP:147690017
5414 5414 c, t dbSNP:144279763
5415 5415 a, g dbSNP:376495346
5429 5429 c, t dbSNP:555132244
5430 5430 a, g dbSNP:370789207
5435 5435 a, g dbSNP:754248704
5438 5438 a, g dbSNP:755445588
5447 5447 c, t dbSNP:533990759
5458 5458 c, t dbSNP:777539420
5460 5460 c, g dbSNP:558541490
5461 5461 c, t dbSNP:142466273
5462 5462 a, g dbSNP:577067899
5465 5465 c, t dbSNP:537400492
5466 5466 a, g dbSNP:769767772
5467 5467 c, t dbSNP:201137071
5468 5468 c, t dbSNP:146982427
5469 5469 a, g dbSNP:768478175
5487 5487 a, t dbSNP:387907143
5489 5489 c, g dbSNP:774161575
5490 5490 c, g dbSNP:762046160
5491 5491 c, t dbSNP:767643077
5496 5496 a, c dbSNP:750447037
5510 5510 c, t dbSNP:760729997
5511 5511 a, g dbSNP:766977678
5515 5515 a, g dbSNP:574141489
5522 5522 a, g dbSNP:374294418
5534 5534 a, c dbSNP:779375614
5536 5536 a, g dbSNP:753020972
5556 5556 g, t dbSNP:138149494
5563 5563 a, g dbSNP:751043203
5580 5580 c, t dbSNP:745372243
5581 5581 a, g dbSNP:376758952
5583 5583 a, g dbSNP:779934605
5589 5589 c, g dbSNP:749183221
5595 5595 a, g dbSNP:768603214
5596 5596 a, g dbSNP:139181534
5604 5604 a, c dbSNP:754572535
5606 5606 g, t dbSNP:761515014
5618 5618 c, g dbSNP:772330993
5619 5619 c, t dbSNP:773361750
5621 5621 c, t dbSNP:760779848
5630 5630 g, t dbSNP:766529307
5639 5639 c, t dbSNP:753997383
5663 5663 a, g dbSNP:760066210
5665 5665 a, g dbSNP:765843970
5682 5682 c, t dbSNP:753101362
5686 5686 a, g dbSNP:758748419
5691 5691 c, t dbSNP:766931727
5692 5692 a, g dbSNP:374035954
5700 5700 c, g dbSNP:755793592
5703 5703 c, g dbSNP:779490460
5704 5704 a, c, g dbSNP:202194222
5705 5705 -, c dbSNP:35441529
5705 5705 c, g, t dbSNP:141738728
5714 5714 a, c, t dbSNP:150153898
5715 5715 a, c, g dbSNP:183921218
5722 5722 c, g dbSNP:771295398
5734 5734 a, g dbSNP:776790365
5738 5738 a, g dbSNP:759757755
5744 5744 a, g dbSNP:138658149
5747 5747 c, t dbSNP:755801421
5748 5748 a, g dbSNP:200305796
5751 5751 c, t dbSNP:764324632
5753 5753 g, t dbSNP:565400330
5763 5763 c, g dbSNP:751973216
5773 5773 a, g dbSNP:755701702
5775 5775 a, t dbSNP:766023993
5778 5778 a, g dbSNP:753341293
5786 5786 c, t dbSNP:754539925
5789 5789 c, t dbSNP:146192623
5792 5792 c, t dbSNP:747997398
5794 5794 a, g dbSNP:758385169
5795 5795 c, t dbSNP:532832962
5796 5796 a, g dbSNP:551038862
5803 5803 c, g dbSNP:113818462
5804 5804 a, t dbSNP:777054816
5809 5809 a, g dbSNP:745924035
5810 5810 g, t dbSNP:770037041
5813 5813 a, c dbSNP:775668266
5831 5831 c, t dbSNP:562880858
5832 5832 a, g dbSNP:764671385
5838 5838 c, t dbSNP:774509236
5841 5841 g, t dbSNP:762232098
5852 5852 c, t dbSNP:376113162
5854 5854 a, c dbSNP:753537321
5867 5867 g, t dbSNP:759014168
5868 5868 c, t dbSNP:764604817
5876 5876 c, t dbSNP:752265365
5881 5881 a, g dbSNP:368646411
5890 5890 a, g dbSNP:758204258
5898 5898 c, t dbSNP:530153456
5899 5899 a, g dbSNP:751391187
5901 5901 a, c dbSNP:757171511
5912 5912 g, t dbSNP:778300670
5921 5921 c, g, t dbSNP:139174766
5935 5935 a, g dbSNP:747819482
5939 5939 c, g dbSNP:779936373
5940 5940 a, g dbSNP:749387520
5946 5946 c, t dbSNP:772262995
5953 5953 a, g dbSNP:769039505
5956 5956 c, g dbSNP:774896570
5958 5958 a, c dbSNP:548670876
5960 5960 c, t dbSNP:142499766
5961 5961 a, g dbSNP:772464386
5963 5963 a, g, t dbSNP:372334858
5978 5978 a, g, t dbSNP:145972566
6007 6007 a, g dbSNP:762587131
6011 6011 c, t dbSNP:533926238
6029 6029 c, t dbSNP:376317262
6030 6030 a, g dbSNP:751590307
6043 6043 a, g dbSNP:757294414
6047 6047 c, g dbSNP:781082506
6056 6056 a, c dbSNP:750254264
6058 6058 a, g dbSNP:756220726
6079 6079 c, t dbSNP:780386457
6080 6080 c, t dbSNP:112703040
6085 6085 a, g dbSNP:768828821
6086 6086 a, g dbSNP:779360395
6092 6092 a, g dbSNP:748612113
6102 6102 c, t dbSNP:772582709
6104 6104 c, t dbSNP:551034452
6107 6107 c, t dbSNP:142416998
6108 6108 -, c dbSNP:754221406
6108 6108 g, t dbSNP:786205584
6113 6113 -, tcc dbSNP:759872393
6118 6118 -, a dbSNP:765671814
6120 6120 -, aggat dbSNP:753203999
6123 6123 a, c dbSNP:769317884
6124 6124 a, c dbSNP:775265871
6127 6127 -, gag dbSNP:758430867
6127 6127 a, g dbSNP:762342896
6130 6130 c, t dbSNP:763660892
6131 6131 -, gt dbSNP:777850626
6131 6131 a, t dbSNP:570594202
6133 6133 -, ttg dbSNP:751638731
6133 6133 c, t dbSNP:368420323
6134 6134 a, g dbSNP:151317970
6139 6139 -, gatt dbSNP:757497248
6139 6139 c, g dbSNP:750234084
6141 6141 -, ta dbSNP:781327420
6145 6145 a, g dbSNP:755994912
6149 6149 a, g dbSNP:556211395
6157 6157 a, g dbSNP:754129097
6161 6161 a, g dbSNP:755185300
6163 6163 a, g dbSNP:574079611
6165 6165 a, g dbSNP:748232008
6167 6167 a, g dbSNP:535102895
6167 6167 -, g dbSNP:749055122
6175 6175 c, t dbSNP:778311119
6177 6177 c, t dbSNP:747316819
6209 6209 c, t dbSNP:771370514
6210 6210 a, g dbSNP:776894668
6212 6212 a, g dbSNP:748924215
6213 6213 a, g dbSNP:768433749
6219 6219 a, c dbSNP:773929325
6220 6220 a, g dbSNP:761473119
6223 6223 a, g dbSNP:767544238
6229 6229 c, t dbSNP:139429265
6230 6230 a, g dbSNP:371980859
6231 6231 c, t dbSNP:766156282
6239 6239 a, g dbSNP:753595827
6240 6240 c, t dbSNP:755163871
6245 6245 c, g dbSNP:147444658
6254 6254 c, t dbSNP:752762142
6272 6272 c, t dbSNP:758522825
6273 6273 c, g dbSNP:778225695
6280 6280 c, t dbSNP:375017809
6281 6281 a, g dbSNP:757730301
6284 6284 a, g dbSNP:571819028
6285 6285 a, g dbSNP:746220769
6290 6290 c, g dbSNP:768415267
6296 6296 c, g dbSNP:778762659
6314 6314 a, g dbSNP:369259342
6315 6315 c, t dbSNP:747638224
6327 6327 a, g, t dbSNP:771748834
6328 6328 g, t dbSNP:760611211
6329 6329 a, g dbSNP:770779367
6335 6335 a, g dbSNP:776483400
6374 6374 c, t dbSNP:545622588
6379 6379 c, t dbSNP:149978361
6380 6380 a, g dbSNP:373301793
6386 6386 a, g dbSNP:763197178
6389 6389 a, c, g dbSNP:3812233
6407 6407 a, g dbSNP:757712554
6478 6478 a, g dbSNP:781613431
6492 6492 g, t dbSNP:750782638
6500 6500 a, g dbSNP:147679171
6504 6504 c, g, t dbSNP:191761610
6508 6508 c, g dbSNP:747762304
6513 6513 a, g dbSNP:771871664
6518 6518 c, g dbSNP:768818067
6541 6541 a, g dbSNP:777278111
6552 6552 a, g dbSNP:563193596
6566 6566 a, g dbSNP:770890026
6584 6584 c, t dbSNP:773023212
6585 6585 a, g dbSNP:530084903
6586 6586 c, t dbSNP:769541604
6596 6596 a, g dbSNP:775289925
6617 6617 a, c dbSNP:763106833
6622 6622 c, g dbSNP:764230499
6640 6640 a, g dbSNP:751652188
6653 6653 c, t dbSNP:761854448
6654 6654 g, t dbSNP:548603375
6662 6662 a, c, g dbSNP:377350616
6667 6667 c, t dbSNP:756720427
6679 6679 a, g dbSNP:780516083
6680 6680 a, g dbSNP:527775865
6684 6684 a, c dbSNP:758120346
6687 6687 c, t dbSNP:777350143
6689 6689 c, t dbSNP:746506227
6693 6693 a, c, g dbSNP:766875935
6696 6696 a, g dbSNP:745761087
6710 6710 c, g dbSNP:769738505
6712 6712 c, t dbSNP:775203171
6713 6713 a, g dbSNP:142956583
6716 6716 a, c dbSNP:768906544
6717 6717 c, t dbSNP:774480576
6726 6726 c, g, t dbSNP:761917637
6731 6731 c, t dbSNP:773447338
6732 6732 a, g dbSNP:761204913
6739 6739 c, t dbSNP:766996279
6752 6752 a, g dbSNP:754242891
6771 6771 a, t dbSNP:150698489
6778 6778 c, g dbSNP:763772159
6785 6785 c, t dbSNP:368868154
6786 6786 a, g dbSNP:756960968
6792 6792 c, t dbSNP:371461578
6793 6793 a, g dbSNP:146468586
6797 6797 a, g dbSNP:745389580
6800 6800 a, g dbSNP:756043689
6801 6801 c, t dbSNP:780022429
6804 6804 a, c dbSNP:529165553
6808 6808 c, t dbSNP:375389356
6809 6809 a, g dbSNP:749057713
6812 6812 c, t dbSNP:183572405
6824 6824 a, g dbSNP:774231619
6837 6837 a, g dbSNP:748269099
6839 6839 a, g dbSNP:772351256
6842 6842 a, g dbSNP:550015240
6847 6847 c, t dbSNP:760896148
6855 6855 a, t dbSNP:766971912
6860 6860 g, t dbSNP:777318343
6869 6869 c, t dbSNP:760120788
6872 6872 c, g dbSNP:568017425
6884 6884 a, c dbSNP:753123473
6909 6909 c, t dbSNP:756796465
6911 6911 c, t dbSNP:367616374
6949 6949 a, g dbSNP:749918218
6955 6955 a, g dbSNP:535044026
6956 6956 c, t dbSNP:779930852
6957 6957 a, g dbSNP:753674523
6991 6991 a, g dbSNP:777151757
7013 7013 a, c dbSNP:570884566
7055 7055 -, aaag dbSNP:567421133
7102 7102 c, g dbSNP:774413188
7108 7108 a, g dbSNP:188107152
7126 7126 -, t dbSNP:370046956
7127 7127 g, t dbSNP:565384835
7136 7136 -, t dbSNP:376411414
7178 7178 a, g dbSNP:767184498
7179 7179 c, t dbSNP:539499874
7191 7191 c, t dbSNP:573082485
7199 7199 a, g dbSNP:535701795
7210 7210 a, g dbSNP:760431796
7229 7229 c, t dbSNP:763769394
7240 7240 a, g dbSNP:190173514
7267 7267 a, g dbSNP:577336040
7275 7275 c, t dbSNP:754164564
7325 7325 a, g dbSNP:544504579
7345 7345 c, t dbSNP:556846733
7420 7420 a, g dbSNP:757700329
7448 7448 c, g dbSNP:779144270
7454 7454 c, g dbSNP:575217434
7525 7525 a, g dbSNP:139857885
7541 7541 a, g dbSNP:531525517
7549 7549 -, a dbSNP:759558356
7559 7559 c, t dbSNP:758813647
7578 7578 c, t dbSNP:550131581
7587 7587 c, t dbSNP:575277747
7603 7603 a, g dbSNP:527713858
7611 7611 a, g dbSNP:149835997
7620 7620 a, g dbSNP:146453054
7675 7675 a, g dbSNP:182437712
7682 7682 a, g dbSNP:7765775
7683 7683 c, t dbSNP:377406756
7713 7713 a, g dbSNP:549575132
7732 7732 c, t dbSNP:139366986
7769 7769 c, t dbSNP:371782923
7882 7882 -, a dbSNP:770195764
7890 7890 a, g dbSNP:186673230
7895 7895 -, aaaa dbSNP:749328123
7895 7895 -, a dbSNP:200471587
7977 7977 c, t dbSNP:768872927
7998 7998 a, g dbSNP:781449234
8002 8002 c, t dbSNP:748312179
8038 8038 c, t dbSNP:529147371
8041 8041 a, t dbSNP:11858
8058 8058 -, a dbSNP:557239005
8118 8118 a, g dbSNP:565319277
8146 8146 -, aaaaaaa dbSNP:545023901
8153 8153 a, g dbSNP:191127408
8155 8155 a, g dbSNP:557803073
8169 8169 -, tt dbSNP:774742301
8186 8186 c, t dbSNP:148830183
8210 8210 a, g dbSNP:538397336
8250 8250 g, t dbSNP:556787824
8261 8261 c, t dbSNP:759536456

Target ORF information:

RefSeq Version XM_005267069
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu70526D
Sequence Information ORF Nucleotide Sequence (Length: 5949bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AT-rich interactive domain-containing protein 1B isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1138..>1338(+)
Misc Feature(2)2494..2769(+)
Misc Feature(3)5110..5880(+)
Position Chain Variation Link
19 19 -, ggc dbSNP:542021607
21 21 -, ggc dbSNP:555730413
53 53 c, t dbSNP:748273011
78 78 c, t dbSNP:549289491
135 135 c, t dbSNP:772315737
148 148 a, g dbSNP:773467188
152 152 c, g dbSNP:760718156
161 161 c, t dbSNP:766500898
176 176 c, g dbSNP:776996949
189 189 a, c, g dbSNP:760090226
198 198 c, g, t dbSNP:753125848
208 208 g, t dbSNP:767247521
210 210 c, t dbSNP:750158289
213 213 c, t dbSNP:755682475
216 216 c, g dbSNP:779622340
219 219 c, g dbSNP:753662365
222 222 c, t dbSNP:754967908
224 224 a, g dbSNP:778536440
234 234 c, t dbSNP:747947340
239 239 c, t dbSNP:771908741
250 250 a, g dbSNP:199948752
261 261 c, t dbSNP:747295062
264 264 c, t dbSNP:770927920
265 265 c, g dbSNP:776783024
268 268 a, g dbSNP:759909326
272 272 a, c, g dbSNP:770362902
277 277 c, g dbSNP:763387163
279 279 c, g dbSNP:764620171
283 283 c, t dbSNP:750031315
294 294 c, t dbSNP:760419444
298 298 -, cgc, cgccgc dbSNP:572236007
299 299 -, cgccgc dbSNP:754447727
299 299 -, cgc dbSNP:766249098
303 303 a, g dbSNP:765760904
307 307 c, t dbSNP:753422144
309 309 a, g dbSNP:754489682
310 310 -, cgccgt dbSNP:778413404
311 311 a, c dbSNP:778891019
312 312 -, gccgtcgca dbSNP:752295930
313 313 -, cgc dbSNP:587779738
313 313 a, c dbSNP:752684703
315 315 -, ccg dbSNP:587779739
333 333 -, ggcggc dbSNP:757953295
333 333 -, ggc dbSNP:777545000
340 340 a, g dbSNP:587779740
362 362 g, t dbSNP:758181047
383 383 -, tgggct dbSNP:747320636
392 392 c, g dbSNP:777545755
399 399 c, t dbSNP:747174363
404 404 a, g dbSNP:771204934
406 406 a, g dbSNP:781091058
414 414 c, t dbSNP:745929521
415 415 c, g dbSNP:769813347
421 421 a, g dbSNP:776060836
422 422 a, c dbSNP:763559359
428 428 c, g dbSNP:769085274
429 429 a, g dbSNP:774880058
430 430 g, t dbSNP:760366486
432 432 a, c dbSNP:766027272
440 440 c, t dbSNP:753486869
451 451 -, agg dbSNP:771434224
453 453 c, g dbSNP:759078059
455 455 a, c, g dbSNP:764716697
457 457 c, t dbSNP:758342480
458 458 a, c dbSNP:763825843
461 461 c, g dbSNP:751389585
462 462 a, g dbSNP:757043988
464 464 a, c dbSNP:781454908
474 474 c, t dbSNP:746135430
487 487 c, t dbSNP:200682868
493 493 a, g dbSNP:780293502
495 495 a, g dbSNP:749761849
496 496 g, t dbSNP:769316078
497 497 g, t dbSNP:775035352
498 498 c, t dbSNP:748498440
517 517 a, g dbSNP:145785954
518 518 c, t dbSNP:775164729
520 520 a, g dbSNP:762428637
524 524 a, c dbSNP:763652332
526 526 a, g dbSNP:147794292
538 538 a, c dbSNP:761668764
540 540 a, g dbSNP:267600875
541 541 a, c dbSNP:767293145
554 554 a, g dbSNP:750214622
557 557 c, t dbSNP:141260832
563 563 a, g dbSNP:147088160
586 586 a, c dbSNP:754167205
590 590 a, g dbSNP:539811282
596 596 c, t dbSNP:779142775
597 597 a, g, t dbSNP:142939952
600 600 c, t dbSNP:758854488
607 607 a, g dbSNP:778162933
613 613 c, t dbSNP:747306459
614 614 a, g dbSNP:570309056
615 615 c, t dbSNP:779668926
634 634 c, t dbSNP:749006707
635 635 a, g dbSNP:768096043
636 636 c, g dbSNP:773754437
643 643 a, g dbSNP:17318151
644 644 c, t dbSNP:756050584
647 647 c, g dbSNP:773247445
658 658 a, c, t dbSNP:143370913
659 659 a, g dbSNP:754042537
666 666 c, t dbSNP:759855548
667 667 a, g dbSNP:765362265
670 670 g, t dbSNP:201244213
678 678 c, t dbSNP:752755002
679 679 a, g dbSNP:151093357
682 682 a, g dbSNP:778121932
687 687 a, g dbSNP:752168831
705 705 c, t dbSNP:751379874
716 716 c, g dbSNP:750753615
720 720 a, g dbSNP:754892486
724 724 a, g dbSNP:756517736
726 726 a, g dbSNP:778414103
727 727 g, t dbSNP:201653711
735 735 c, t dbSNP:372248435
749 749 c, t dbSNP:148382861
767 767 a, g dbSNP:761867629
771 771 a, g dbSNP:772203422
780 780 c, t dbSNP:773640553
790 790 a, g dbSNP:571695301
795 795 -, c dbSNP:138196985
801 801 a, c, g dbSNP:766599882
802 802 c, t dbSNP:141395733
809 809 a, g dbSNP:763818779
818 818 -, gca dbSNP:746407600
823 823 c, t dbSNP:751317747
824 824 c, t dbSNP:779239519
827 827 a, c, t dbSNP:199949701
828 828 a, g dbSNP:370068335
829 829 c, t dbSNP:372781930
835 835 c, t dbSNP:201038527
837 837 a, g dbSNP:756099753
839 839 c, g, t dbSNP:779895443
846 846 a, c, g dbSNP:146312104
850 850 c, t dbSNP:751320376
853 853 c, t dbSNP:748370897
857 857 c, t dbSNP:772078777
858 858 a, g dbSNP:376964478
861 861 c, t dbSNP:761043177
864 864 c, g dbSNP:771442003
867 867 c, t dbSNP:139595304
868 868 c, t dbSNP:387907142
872 872 a, g dbSNP:538689102
878 878 a, c, t dbSNP:759934770
879 879 c, t dbSNP:751192841
883 883 c, t dbSNP:372690657
884 884 c, t dbSNP:558155146
885 885 a, g, t dbSNP:374876774
896 896 c, t dbSNP:767255855
897 897 a, g dbSNP:142897795
911 911 a, g dbSNP:749173157
929 929 c, g dbSNP:765810222
935 935 a, t dbSNP:753748958
938 938 c, t dbSNP:376595068
941 941 c, g dbSNP:764967238
942 942 c, t dbSNP:146240413
943 943 a, g dbSNP:573836252
944 944 a, g dbSNP:778044758
950 950 c, g dbSNP:778362623
960 960 a, t dbSNP:139125255
963 963 c, t dbSNP:149931590
973 973 a, g dbSNP:781146492
974 974 c, t dbSNP:746327988
976 976 a, c dbSNP:770455355
980 980 a, g dbSNP:776187102
985 985 a, g dbSNP:749657274
1001 1001 c, t dbSNP:559304585
1019 1019 c, t dbSNP:751748335
1029 1029 a, g dbSNP:757443510
1031 1031 a, c dbSNP:781293616
1041 1041 c, g dbSNP:745913690
1050 1050 a, g dbSNP:761710707
1061 1061 c, t dbSNP:767620420
1062 1062 a, t dbSNP:750738896
1074 1074 c, g dbSNP:756195424
1076 1076 c, t dbSNP:373508866
1077 1077 a, g dbSNP:201290874
1083 1083 a, g dbSNP:6912981
1094 1094 c, t dbSNP:779512205
1104 1104 a, c dbSNP:376143843
1110 1110 g, t dbSNP:772549124
1111 1111 a, g dbSNP:780820426
1113 1113 a, g dbSNP:745528262
1116 1116 c, t dbSNP:148700132
1117 1117 a, g dbSNP:775004900
1124 1124 c, t dbSNP:762908553
1125 1125 a, g dbSNP:370910542
1137 1137 c, g dbSNP:774397054
1138 1138 a, g dbSNP:374648940
1142 1142 a, g dbSNP:368202669
1145 1145 a, g dbSNP:762401544
1152 1152 a, g dbSNP:750615874
1154 1154 c, t dbSNP:774701560
1155 1155 a, g dbSNP:551597753
1156 1156 a, c dbSNP:753933273
1158 1158 c, g dbSNP:755131525
1160 1160 c, t dbSNP:779271100
1161 1161 a, g dbSNP:753317592
1175 1175 a, g dbSNP:758625736
1176 1176 c, t dbSNP:370364530
1178 1178 c, t dbSNP:563771544
1179 1179 a, g dbSNP:3734441
1190 1190 g, t dbSNP:779724084
1194 1194 c, t dbSNP:549352027
1201 1201 c, g dbSNP:768277043
1203 1203 a, g dbSNP:374696557
1204 1204 a, g dbSNP:748129248
1205 1205 c, g dbSNP:367698478
1206 1206 a, g dbSNP:780611617
1208 1208 a, c, g dbSNP:567668222
1216 1216 c, t dbSNP:534990481
1227 1227 a, t dbSNP:766684321
1230 1230 c, t dbSNP:776967149
1234 1234 c, t dbSNP:759533117
1237 1237 a, g dbSNP:765365713
1243 1243 a, g dbSNP:753092220
1247 1247 a, g dbSNP:763191352
1256 1256 a, g dbSNP:764402992
1274 1274 c, t dbSNP:751891035
1276 1276 a, g dbSNP:757669934
1278 1278 a, g dbSNP:779669164
1282 1282 a, g dbSNP:748973290
1284 1284 a, c dbSNP:546849919
1291 1291 a, t dbSNP:372730587
1300 1300 c, t dbSNP:757549352
1304 1304 c, t dbSNP:754080772
1305 1305 a, g dbSNP:190653632
1314 1314 c, t dbSNP:541757080
1319 1319 a, g dbSNP:778467052
1337 1337 c, g, t dbSNP:762229592
1339 1339 a, c dbSNP:758038225
1342 1342 c, t dbSNP:777845775
1344 1344 c, t dbSNP:746951045
1345 1345 a, g dbSNP:147784000
1350 1350 a, g dbSNP:781067022
1356 1356 a, g dbSNP:368362137
1364 1364 c, t dbSNP:770027363
1379 1379 a, g dbSNP:780321051
1385 1385 g, t dbSNP:141219657
1392 1392 c, g, t dbSNP:768672743
1400 1400 a, g dbSNP:761921020
1404 1404 a, c dbSNP:772604684
1405 1405 c, g dbSNP:773646023
1406 1406 c, t dbSNP:201156721
1412 1412 c, t dbSNP:761093701
1416 1416 c, t dbSNP:766654973
1418 1418 a, g dbSNP:752341983
1419 1419 c, g dbSNP:778702667
1421 1421 a, g dbSNP:762721043
1426 1426 c, t dbSNP:114201726
1435 1435 a, g dbSNP:556939212
1444 1444 c, t dbSNP:756767804
1450 1450 c, t dbSNP:767477226
1451 1451 c, t dbSNP:150140314
1452 1452 a, g dbSNP:374691223
1457 1457 a, g dbSNP:779733858
1470 1470 a, g dbSNP:749470868
1473 1473 c, g dbSNP:755160504
1493 1493 c, g dbSNP:779154161
1496 1496 a, g dbSNP:748209235
1500 1500 c, t dbSNP:546767328
1516 1516 a, c, g dbSNP:772107512
1523 1523 c, t dbSNP:141030037
1526 1526 a, g, t dbSNP:771280525
1527 1527 c, t dbSNP:760022925
1528 1528 a, g dbSNP:150249745
1529 1529 a, g dbSNP:774205020
1532 1532 c, t dbSNP:527698870
1533 1533 a, g dbSNP:368988882
1544 1544 a, g dbSNP:766942261
1547 1547 a, g dbSNP:750324294
1548 1548 c, t dbSNP:756036121
1550 1550 g, t dbSNP:138934947
1552 1552 a, c dbSNP:753607638
1573 1573 c, t dbSNP:572020611
1574 1574 a, c dbSNP:761388338
1580 1580 c, t dbSNP:749077422
1581 1581 a, g dbSNP:772564622
1589 1589 a, g dbSNP:760280267
1611 1611 c, t dbSNP:766290096
1612 1612 a, g dbSNP:145635490
1623 1623 c, t dbSNP:528889230
1624 1624 a, g dbSNP:542660265
1626 1626 c, t dbSNP:752913095
1645 1645 a, g dbSNP:564110998
1647 1647 a, c dbSNP:778099902
1653 1653 g, t dbSNP:376497842
1663 1663 a, g dbSNP:757473942
1669 1669 a, t dbSNP:781763581
1672 1672 c, g dbSNP:138254872
1679 1679 a, g dbSNP:770228055
1682 1682 a, g dbSNP:780312215
1692 1692 -, gtg dbSNP:201979665
1702 1702 a, t dbSNP:749701314
1715 1715 g, t dbSNP:771600870
1723 1723 a, t dbSNP:772975321
1732 1732 c, t dbSNP:760095080
1734 1734 g, t dbSNP:770428988
1746 1746 a, g dbSNP:751177927
1755 1755 c, g dbSNP:146077641
1758 1758 c, t dbSNP:764978487
1775 1775 c, t dbSNP:752405476
1799 1799 g, t dbSNP:762855776
1803 1803 a, g dbSNP:764210072
1806 1806 a, g dbSNP:587779742
1810 1810 a, g, t dbSNP:531418921
1818 1818 c, t dbSNP:750914446
1826 1826 a, c, g dbSNP:756655213
1845 1845 c, t dbSNP:374572368
1846 1846 a, g dbSNP:377633743
1859 1859 a, c dbSNP:549928918
1861 1861 g, t dbSNP:746676470
1867 1867 a, g dbSNP:770377920
1869 1869 c, g dbSNP:148749268
1897 1897 a, g dbSNP:558990663
1904 1904 c, t dbSNP:556334402
1936 1936 a, g dbSNP:536981558
1939 1939 c, t dbSNP:371061369
1940 1940 a, g dbSNP:751699597
1981 1981 c, g dbSNP:759590636
1998 1998 c, t dbSNP:190378545
2026 2026 g, t dbSNP:773631262
2029 2029 a, c dbSNP:760765281
2031 2031 c, t dbSNP:144894118
2032 2032 a, g dbSNP:34786733
2033 2033 a, g dbSNP:755539131
2054 2054 c, t dbSNP:370071892
2070 2070 a, c dbSNP:373256784
2090 2090 a, g dbSNP:550604212
2096 2096 c, g dbSNP:780818465
2107 2107 a, c dbSNP:745524201
2112 2112 c, g dbSNP:755525381
2114 2114 a, t dbSNP:139620600
2117 2117 c, t dbSNP:377351099
2118 2118 a, g dbSNP:144558683
2119 2119 c, g dbSNP:779048797
2120 2120 c, t dbSNP:370190261
2121 2121 a, g dbSNP:537901478
2128 2128 a, c dbSNP:773510355
2131 2131 a, c dbSNP:760973888
2133 2133 a, g dbSNP:566567531
2135 2135 c, t dbSNP:750810656
2136 2136 a, g dbSNP:560450902
2139 2139 c, t dbSNP:765720893
2140 2140 a, g dbSNP:527731946
2142 2142 a, c dbSNP:763236835
2143 2143 a, g dbSNP:764460073
2148 2148 a, g dbSNP:758749885
2157 2157 a, g dbSNP:750032487
2170 2170 a, g dbSNP:758377419
2174 2174 c, t dbSNP:777905171
2182 2182 -, atg dbSNP:762047886
2183 2183 c, t dbSNP:746808513
2186 2186 c, t dbSNP:371523255
2192 2192 c, t dbSNP:540277176
2210 2210 c, t dbSNP:746092285
2211 2211 c, t dbSNP:769820008
2212 2212 c, t dbSNP:775582196
2223 2223 -, agc dbSNP:772325958
2223 2223 a, g dbSNP:749413486
2224 2224 a, g dbSNP:769132694
2226 2226 a, g dbSNP:774783574
2229 2229 c, t dbSNP:147853607
2230 2230 a, g dbSNP:375023508
2235 2235 a, t dbSNP:776294122
2254 2254 a, c, t dbSNP:368880015
2256 2256 c, t dbSNP:752231248
2257 2257 a, g dbSNP:570798143
2275 2275 a, g dbSNP:763525655
2277 2277 c, g dbSNP:751465997
2278 2278 a, t dbSNP:757176899
2282 2282 a, g dbSNP:139407686
2288 2288 a, g dbSNP:750198878
2295 2295 a, t dbSNP:534113119
2308 2308 a, c dbSNP:755963909
2318 2318 a, c dbSNP:780181329
2364 2364 c, t dbSNP:754071347
2383 2383 a, g dbSNP:754998837
2433 2433 a, g dbSNP:373653398
2456 2456 g, t dbSNP:779243569
2469 2469 a, g dbSNP:752704102
2478 2478 c, t dbSNP:758570139
2481 2481 a, g dbSNP:373641381
2484 2484 a, g dbSNP:747533804
2486 2486 a, g dbSNP:771373121
2490 2490 c, t dbSNP:781714598
2495 2495 c, t dbSNP:746278639
2505 2505 a, g dbSNP:568095755
2514 2514 c, t dbSNP:371828409
2515 2515 a, g dbSNP:761227259
2518 2518 c, t dbSNP:387907144
2524 2524 c, t dbSNP:779598699
2527 2527 a, t dbSNP:771621841
2528 2528 a, c dbSNP:773082217
2533 2533 a, c dbSNP:760633180
2539 2539 c, g dbSNP:766340916
2543 2543 a, g dbSNP:753607488
2545 2545 a, g dbSNP:759432635
2547 2547 c, g dbSNP:765371275
2552 2552 c, t dbSNP:377588212
2554 2554 a, g dbSNP:758353662
2560 2560 a, g dbSNP:774855592
2562 2562 c, t dbSNP:752073815
2563 2563 a, c dbSNP:757809298
2565 2565 g, t dbSNP:781777822
2571 2571 c, t dbSNP:746210543
2572 2572 a, g dbSNP:370283707
2574 2574 a, g dbSNP:778366844
2583 2583 a, g, t dbSNP:374705142
2584 2584 c, t dbSNP:746686035
2589 2589 a, g dbSNP:376995038
2599 2599 c, t dbSNP:387907141
2600 2600 a, g dbSNP:746567959
2604 2604 c, g, t dbSNP:111368751
2605 2605 c, t dbSNP:759186918
2607 2607 c, t dbSNP:61736269
2608 2608 a, g dbSNP:775526039
2613 2613 c, t dbSNP:763270294
2618 2618 a, g dbSNP:764452515
2621 2621 a, g dbSNP:751670059
2624 2624 g, t dbSNP:375581771
2625 2625 c, t dbSNP:181686951
2634 2634 g, t dbSNP:750948289
2685 2685 c, t dbSNP:771166112
2686 2686 a, g dbSNP:756707971
2694 2694 c, t dbSNP:142391292
2706 2706 a, g dbSNP:745412510
2718 2718 a, g dbSNP:769749724
2736 2736 c, g dbSNP:779917726
2742 2742 g, t dbSNP:545017957
2754 2754 a, g dbSNP:61745451
2763 2763 c, t dbSNP:774661225
2768 2768 a, g dbSNP:762153671
2769 2769 a, t dbSNP:772220023
2783 2783 c, t dbSNP:773317331
2784 2784 a, g dbSNP:760721516
2785 2785 c, t dbSNP:766902947
2786 2786 c, t dbSNP:754303482
2787 2787 a, g dbSNP:759836095
2789 2789 a, c dbSNP:765612283
2802 2802 c, t dbSNP:369218715
2803 2803 a, g dbSNP:756872796
2821 2821 c, g dbSNP:780758224
2835 2835 a, g dbSNP:749937918
2853 2853 a, g dbSNP:776425168
2870 2870 c, t dbSNP:759056899
2877 2877 c, t dbSNP:764861177
2878 2878 c, t dbSNP:752639283
2883 2883 a, g dbSNP:762767858
2887 2887 a, g dbSNP:552938708
2889 2889 c, t dbSNP:372186962
2894 2894 a, g dbSNP:145857100
2911 2911 c, g dbSNP:781326777
2923 2923 c, g dbSNP:138482029
2927 2927 a, g dbSNP:756141390
2934 2934 a, t dbSNP:780142651
2937 2937 c, t dbSNP:749430350
2938 2938 c, g dbSNP:547596526
2955 2955 c, t dbSNP:771632801
2956 2956 a, g dbSNP:779536790
2961 2961 g, t dbSNP:748391706
2971 2971 a, g, t dbSNP:141190049
2972 2972 c, t dbSNP:376806897
2976 2976 a, g dbSNP:769609140
2987 2987 a, g dbSNP:574296429
2988 2988 c, t dbSNP:369035728
3002 3002 c, t dbSNP:138218716
3006 3006 c, t dbSNP:373881952
3009 3009 c, t dbSNP:748681838
3012 3012 a, g dbSNP:768227723
3021 3021 c, t dbSNP:559706338
3022 3022 a, g dbSNP:773649998
3027 3027 c, t dbSNP:767486423
3032 3032 c, t dbSNP:772973856
3035 3035 c, t dbSNP:533211077
3041 3041 c, t dbSNP:150196933
3042 3042 a, g dbSNP:766441730
3046 3046 c, t dbSNP:754100748
3047 3047 a, g dbSNP:754960836
3055 3055 a, g dbSNP:138784762
3061 3061 c, t dbSNP:752863054
3065 3065 a, g dbSNP:376071880
3066 3066 c, t dbSNP:370523060
3067 3067 a, g dbSNP:747374301
3069 3069 c, t dbSNP:757646876
3071 3071 c, t dbSNP:779516798
3072 3072 a, c dbSNP:748995523
3080 3080 a, c dbSNP:768013849
3091 3091 a, g dbSNP:773883674
3094 3094 a, c dbSNP:747709980
3096 3096 c, t dbSNP:771988661
3097 3097 a, g dbSNP:773135175
3100 3100 a, g, t dbSNP:760402063
3101 3101 c, t dbSNP:776675533
3111 3111 a, g dbSNP:530602758
3116 3116 c, t dbSNP:759771283
3117 3117 c, t dbSNP:765425489
3119 3119 a, g dbSNP:752811689
3125 3125 c, g dbSNP:374517532
3140 3140 c, t dbSNP:764630192
3146 3146 a, g dbSNP:149389876
3156 3156 a, g dbSNP:200230777
3172 3172 a, g dbSNP:752398721
3173 3173 a, g dbSNP:763740758
3180 3180 c, t dbSNP:368341224
3181 3181 a, g dbSNP:753381410
3185 3185 c, t dbSNP:371538726
3186 3186 a, c, g, t dbSNP:374823620
3192 3192 a, c dbSNP:769769342
3196 3196 a, g, t dbSNP:144029881
3204 3204 c, t dbSNP:769028104
3206 3206 a, g dbSNP:774520303
3211 3211 a, g dbSNP:761809331
3214 3214 c, t dbSNP:387907140
3231 3231 a, g dbSNP:367653751
3240 3240 c, t dbSNP:371872657
3241 3241 a, g dbSNP:199674889
3246 3246 a, g dbSNP:766772916
3247 3247 a, g dbSNP:754234955
3249 3249 a, g dbSNP:757999037
3251 3251 c, g dbSNP:763750480
3257 3257 c, t dbSNP:751015296
3258 3258 a, g dbSNP:756784391
3260 3260 g, t dbSNP:781175942
3265 3265 c, g dbSNP:745841288
3267 3267 a, g dbSNP:755940737
3271 3271 c, t dbSNP:138785718
3272 3272 a, g dbSNP:370064281
3278 3278 a, g dbSNP:768938099
3296 3296 a, g dbSNP:142808724
3300 3300 c, t dbSNP:372767127
3301 3301 a, g dbSNP:772095737
3304 3304 a, c dbSNP:773740590
3305 3305 a, g dbSNP:761133847
3309 3309 a, g dbSNP:779177994
3312 3312 g, t dbSNP:565147002
3333 3333 c, t dbSNP:748363079
3362 3362 c, t dbSNP:577211667
3365 3365 c, t dbSNP:773119970
3366 3366 a, g dbSNP:374835455
3375 3375 a, g dbSNP:147424506
3378 3378 c, t dbSNP:56139133
3385 3385 a, g dbSNP:151115781
3397 3397 c, t dbSNP:587779745
3401 3401 a, g dbSNP:765570329
3404 3404 c, t dbSNP:367809905
3413 3413 a, g dbSNP:778062751
3415 3415 c, t dbSNP:747088591
3416 3416 a, g dbSNP:771056710
3426 3426 c, t dbSNP:139785288
3427 3427 a, g, t dbSNP:746412839
3431 3431 c, t dbSNP:145012943
3432 3432 a, g dbSNP:763386213
3435 3435 c, t dbSNP:377021700
3439 3439 c, t dbSNP:773062339
3451 3451 c, t dbSNP:760245781
3453 3453 c, t dbSNP:369640779
3460 3460 a, g dbSNP:766030463
3463 3463 a, g dbSNP:753434703
3465 3465 c, t dbSNP:150516641
3466 3466 a, g dbSNP:777513652
3467 3467 c, t dbSNP:759345151
3468 3468 a, g dbSNP:765236859
3497 3497 -, agg dbSNP:755476506
3501 3501 a, g dbSNP:139512931
3506 3506 a, g dbSNP:372833448
3512 3512 a, g dbSNP:534466124
3520 3520 a, g dbSNP:149702962
3525 3525 c, g, t dbSNP:777844769
3529 3529 g, t dbSNP:145516400
3530 3530 c, t dbSNP:781209005
3531 3531 a, g dbSNP:745968347
3535 3535 c, g dbSNP:140639463
3536 3536 c, t dbSNP:530430137
3537 3537 a, g dbSNP:749608995
3539 3539 a, g dbSNP:769118968
3541 3541 c, t dbSNP:772972321
3542 3542 a, g dbSNP:144424476
3546 3546 a, g dbSNP:770732982
3550 3550 a, c, g dbSNP:376225642
3552 3552 c, g dbSNP:368993084
3555 3555 a, g dbSNP:759092517
3556 3556 a, g dbSNP:765083250
3565 3565 a, c dbSNP:775556116
3567 3567 a, c, g dbSNP:146625434
3572 3572 c, t dbSNP:751387548
3589 3589 a, g dbSNP:745566888
3594 3594 a, g dbSNP:767739514
3600 3600 a, c, g dbSNP:566865279
3607 3607 a, g dbSNP:780408339
3612 3612 a, g dbSNP:527711444
3617 3617 a, t dbSNP:755473951
3619 3619 a, g dbSNP:779375711
3624 3624 a, c dbSNP:748539331
3626 3626 c, t dbSNP:770643408
3627 3627 a, g dbSNP:373191607
3636 3636 c, g dbSNP:745359242
3640 3640 a, g dbSNP:141461351
3642 3642 c, t dbSNP:143236717
3643 3643 a, g dbSNP:376207220
3647 3647 c, t dbSNP:370889837
3648 3648 a, g dbSNP:774071774
3649 3649 a, c dbSNP:761599931
3657 3657 a, g dbSNP:61745210
3658 3658 c, t dbSNP:750713205
3663 3663 c, t dbSNP:756120841
3672 3672 c, g dbSNP:766446706
3672 3672 -, g dbSNP:587779746
3678 3678 a, g dbSNP:753891391
3681 3681 g, t dbSNP:755486688
3683 3683 a, g dbSNP:779570779
3684 3684 c, t dbSNP:549950885
3697 3697 c, t dbSNP:758892744
3698 3698 a, g dbSNP:780970034
3700 3700 a, c dbSNP:745575926
3702 3702 c, t dbSNP:769362465
3703 3703 g, t dbSNP:775015868
3704 3704 a, t dbSNP:748759595
3719 3719 a, g dbSNP:373500669
3723 3723 a, g dbSNP:774335434
3726 3726 c, t dbSNP:568203974
3735 3735 c, t dbSNP:139903653
3738 3738 c, g, t dbSNP:141783755
3740 3740 c, g dbSNP:760906582
3741 3741 c, t dbSNP:571692142
3755 3755 c, t dbSNP:370838091
3756 3756 a, g dbSNP:759759957
3757 3757 c, t dbSNP:765827636
3759 3759 c, g dbSNP:138412834
3764 3764 a, g dbSNP:758804576
3767 3767 c, t dbSNP:778160923
3772 3772 a, g dbSNP:142788313
3786 3786 c, t dbSNP:755734669
3790 3790 a, t dbSNP:34870395
3791 3791 c, t dbSNP:138181857
3796 3796 a, g, t dbSNP:768210321
3801 3801 c, t dbSNP:748119553
3819 3819 c, t dbSNP:61747988
3822 3822 a, g dbSNP:773006123
3828 3828 a, g dbSNP:373910693
3833 3833 -, ctt dbSNP:779460018
3840 3840 c, t dbSNP:182287119
3841 3841 a, g dbSNP:567836947
3861 3861 c, t dbSNP:776777663
3867 3867 a, g dbSNP:368163089
3876 3876 c, g dbSNP:563086310
3880 3880 a, g dbSNP:752856754
3891 3891 c, t dbSNP:150010654
3894 3894 a, g dbSNP:764521196
3895 3895 c, t dbSNP:542516057
3908 3908 c, t dbSNP:757628046
3909 3909 a, c, g dbSNP:779739760
3915 3915 c, t dbSNP:2068129
3920 3920 a, c, t dbSNP:570186838
3921 3921 a, g dbSNP:527651886
3927 3927 a, g dbSNP:61738955
3931 3931 c, t dbSNP:113347228
3943 3943 a, g dbSNP:370174322
3951 3951 a, g dbSNP:746810545
3953 3953 c, t dbSNP:762698567
3954 3954 a, g dbSNP:776881575
3955 3955 c, t dbSNP:746048984
3957 3957 c, t dbSNP:770164775
3965 3965 c, t dbSNP:758724418
3966 3966 a, g dbSNP:374125873
3987 3987 a, g dbSNP:556299458
3989 3989 a, g dbSNP:367764610
3991 3991 c, t dbSNP:774777278
3992 3992 a, g dbSNP:762211408
3994 3994 a, c dbSNP:767808574
4003 4003 a, g dbSNP:750814930
4012 4012 c, g dbSNP:754572827
4023 4023 a, g dbSNP:764877126
4027 4027 a, g dbSNP:139214813
4050 4050 c, t dbSNP:757908002
4052 4052 c, t dbSNP:777745107
4053 4053 a, g dbSNP:746960777
4056 4056 a, c dbSNP:757252042
4058 4058 c, g dbSNP:781086610
4074 4074 c, t dbSNP:745670548
4091 4091 a, c dbSNP:770072973
4093 4093 c, t dbSNP:775920998
4100 4100 c, t dbSNP:766639614
4125 4125 c, t dbSNP:749373437
4127 4127 g, t dbSNP:3210165
4143 4143 a, g dbSNP:768663672
4149 4149 a, g dbSNP:371430687
4166 4166 a, g dbSNP:762183842
4183 4183 c, g dbSNP:375949587
4188 4188 c, t dbSNP:550054527
4191 4191 c, t dbSNP:768949418
4195 4195 -, c dbSNP:747262317
4203 4203 a, g dbSNP:778806657
4208 4208 a, g dbSNP:544895806
4230 4230 a, g dbSNP:772566253
4236 4236 c, t dbSNP:372621575
4251 4251 a, g, t dbSNP:146620657
4271 4271 a, g dbSNP:777085838
4281 4281 a, g dbSNP:753890440
4289 4289 a, c dbSNP:762465807
4300 4300 a, g dbSNP:763822415
4301 4301 c, g dbSNP:750965814
4308 4308 c, g dbSNP:761451340
4310 4310 a, g dbSNP:140177120
4316 4316 c, t dbSNP:190027529
4323 4323 a, g dbSNP:760636496
4335 4335 c, t dbSNP:766430210
4347 4347 c, t dbSNP:753507388
4368 4368 a, c, g dbSNP:754864354
4370 4370 c, t dbSNP:541564441
4371 4371 a, t dbSNP:753008910
4375 4375 a, g dbSNP:758650746
4384 4384 a, g, t dbSNP:777781055
4390 4390 a, g dbSNP:369339813
4394 4394 a, g dbSNP:149841055
4397 4397 a, g dbSNP:746202741
4402 4402 a, g dbSNP:770242254
4403 4403 c, t dbSNP:773843930
4408 4408 g, t dbSNP:747758337
4413 4413 c, t dbSNP:771869774
4414 4414 a, g dbSNP:772787830
4425 4425 a, g dbSNP:760264273
4430 4430 a, g dbSNP:528688757
4434 4434 c, t dbSNP:776682804
4436 4436 a, g dbSNP:759224463
4437 4437 c, t dbSNP:145867693
4438 4438 a, c, g dbSNP:546855765
4446 4446 a, g dbSNP:764306695
4451 4451 a, g dbSNP:751635758
4454 4454 a, c dbSNP:757383409
4469 4469 c, t dbSNP:781527504
4470 4470 a, c dbSNP:148922487
4471 4471 a, g dbSNP:756610931
4473 4473 a, c, t dbSNP:189662115
4474 4474 a, g dbSNP:771781497
4481 4481 a, c, g dbSNP:138020626
4489 4489 a, g dbSNP:746497588
4502 4502 a, c dbSNP:149518409
4505 4505 a, g dbSNP:569199026
4509 4509 -, tga dbSNP:771741082
4513 4513 -, gac dbSNP:374755339
4515 4515 c, t dbSNP:759473238
4516 4516 a, g dbSNP:765101364
4518 4518 -, cga dbSNP:113820273
4518 4518 c, t dbSNP:775201232
4519 4519 a, g dbSNP:374680141
4527 4527 c, t dbSNP:368980689
4528 4528 a, g dbSNP:528801298
4540 4540 a, g dbSNP:751827621
4549 4549 a, c dbSNP:147690017
4551 4551 c, t dbSNP:144279763
4552 4552 a, g dbSNP:376495346
4566 4566 c, t dbSNP:555132244
4567 4567 a, g dbSNP:370789207
4572 4572 a, g dbSNP:754248704
4575 4575 a, g dbSNP:755445588
4584 4584 c, t dbSNP:533990759
4595 4595 c, t dbSNP:777539420
4597 4597 c, g dbSNP:558541490
4598 4598 c, t dbSNP:142466273
4599 4599 a, g dbSNP:577067899
4602 4602 c, t dbSNP:537400492
4603 4603 a, g dbSNP:769767772
4604 4604 c, t dbSNP:201137071
4605 4605 c, t dbSNP:146982427
4606 4606 a, g dbSNP:768478175
4624 4624 a, t dbSNP:387907143
4626 4626 c, g dbSNP:774161575
4627 4627 c, g dbSNP:762046160
4628 4628 c, t dbSNP:767643077
4633 4633 a, c dbSNP:750447037
4647 4647 c, t dbSNP:760729997
4648 4648 a, g dbSNP:766977678
4652 4652 a, g dbSNP:574141489
4659 4659 a, g dbSNP:374294418
4671 4671 a, c dbSNP:779375614
4673 4673 a, g dbSNP:753020972
4693 4693 g, t dbSNP:138149494
4700 4700 a, g dbSNP:751043203
4717 4717 c, t dbSNP:745372243
4718 4718 a, g dbSNP:376758952
4720 4720 a, g dbSNP:779934605
4726 4726 c, g dbSNP:749183221
4732 4732 a, g dbSNP:768603214
4733 4733 a, g dbSNP:139181534
4741 4741 a, c dbSNP:754572535
4743 4743 g, t dbSNP:761515014
4755 4755 c, g dbSNP:772330993
4756 4756 c, t dbSNP:773361750
4758 4758 c, t dbSNP:760779848
4767 4767 g, t dbSNP:766529307
4776 4776 c, t dbSNP:753997383
4800 4800 a, g dbSNP:760066210
4802 4802 a, g dbSNP:765843970
4819 4819 c, t dbSNP:753101362
4823 4823 a, g dbSNP:758748419
4828 4828 c, t dbSNP:766931727
4829 4829 a, g dbSNP:374035954
4837 4837 c, g dbSNP:755793592
4840 4840 c, g dbSNP:779490460
4841 4841 a, c, g dbSNP:202194222
4842 4842 -, c dbSNP:35441529
4842 4842 c, g, t dbSNP:141738728
4851 4851 a, c, t dbSNP:150153898
4852 4852 a, c, g dbSNP:183921218
4859 4859 c, g dbSNP:771295398
4871 4871 a, g dbSNP:776790365
4875 4875 a, g dbSNP:759757755
4881 4881 a, g dbSNP:138658149
4884 4884 c, t dbSNP:755801421
4885 4885 a, g dbSNP:200305796
4888 4888 c, t dbSNP:764324632
4890 4890 g, t dbSNP:565400330
4900 4900 c, g dbSNP:751973216
4910 4910 a, g dbSNP:755701702
4912 4912 a, t dbSNP:766023993
4915 4915 a, g dbSNP:753341293
4923 4923 c, t dbSNP:754539925
4926 4926 c, t dbSNP:146192623
4929 4929 c, t dbSNP:747997398
4931 4931 a, g dbSNP:758385169
4932 4932 c, t dbSNP:532832962
4933 4933 a, g dbSNP:551038862
4940 4940 c, g dbSNP:113818462
4941 4941 a, t dbSNP:777054816
4946 4946 a, g dbSNP:745924035
4947 4947 g, t dbSNP:770037041
4950 4950 a, c dbSNP:775668266
4968 4968 c, t dbSNP:562880858
4969 4969 a, g dbSNP:764671385
4975 4975 c, t dbSNP:774509236
4978 4978 g, t dbSNP:762232098
4989 4989 c, t dbSNP:376113162
4991 4991 a, c dbSNP:753537321
5004 5004 g, t dbSNP:759014168
5005 5005 c, t dbSNP:764604817
5013 5013 c, t dbSNP:752265365
5018 5018 a, g dbSNP:368646411
5027 5027 a, g dbSNP:758204258
5035 5035 c, t dbSNP:530153456
5036 5036 a, g dbSNP:751391187
5038 5038 a, c dbSNP:757171511
5049 5049 g, t dbSNP:778300670
5058 5058 c, g, t dbSNP:139174766
5072 5072 a, g dbSNP:747819482
5076 5076 c, g dbSNP:779936373
5077 5077 a, g dbSNP:749387520
5083 5083 c, t dbSNP:772262995
5090 5090 a, g dbSNP:769039505
5093 5093 c, g dbSNP:774896570
5095 5095 a, c dbSNP:548670876
5097 5097 c, t dbSNP:142499766
5098 5098 a, g dbSNP:772464386
5100 5100 a, g, t dbSNP:372334858
5115 5115 a, g, t dbSNP:145972566
5144 5144 a, g dbSNP:762587131
5148 5148 c, t dbSNP:533926238
5166 5166 c, t dbSNP:376317262
5167 5167 a, g dbSNP:751590307
5180 5180 a, g dbSNP:757294414
5184 5184 c, g dbSNP:781082506
5193 5193 a, c dbSNP:750254264
5195 5195 a, g dbSNP:756220726
5216 5216 c, t dbSNP:780386457
5217 5217 c, t dbSNP:112703040
5222 5222 a, g dbSNP:768828821
5223 5223 a, g dbSNP:779360395
5229 5229 a, g dbSNP:748612113
5239 5239 c, t dbSNP:772582709
5241 5241 c, t dbSNP:551034452
5244 5244 c, t dbSNP:142416998
5245 5245 -, c dbSNP:754221406
5245 5245 g, t dbSNP:786205584
5250 5250 -, tcc dbSNP:759872393
5255 5255 -, a dbSNP:765671814
5257 5257 -, aggat dbSNP:753203999
5260 5260 a, c dbSNP:769317884
5261 5261 a, c dbSNP:775265871
5264 5264 -, gag dbSNP:758430867
5264 5264 a, g dbSNP:762342896
5267 5267 c, t dbSNP:763660892
5268 5268 -, gt dbSNP:777850626
5268 5268 a, t dbSNP:570594202
5270 5270 -, ttg dbSNP:751638731
5270 5270 c, t dbSNP:368420323
5271 5271 a, g dbSNP:151317970
5276 5276 -, gatt dbSNP:757497248
5276 5276 c, g dbSNP:750234084
5278 5278 -, ta dbSNP:781327420
5282 5282 a, g dbSNP:755994912
5286 5286 a, g dbSNP:556211395
5294 5294 a, g dbSNP:754129097
5298 5298 a, g dbSNP:755185300
5300 5300 a, g dbSNP:574079611
5302 5302 a, g dbSNP:748232008
5304 5304 a, g dbSNP:535102895
5304 5304 -, g dbSNP:749055122
5312 5312 c, t dbSNP:778311119
5314 5314 c, t dbSNP:747316819
5346 5346 c, t dbSNP:771370514
5347 5347 a, g dbSNP:776894668
5349 5349 a, g dbSNP:748924215
5350 5350 a, g dbSNP:768433749
5356 5356 a, c dbSNP:773929325
5357 5357 a, g dbSNP:761473119
5360 5360 a, g dbSNP:767544238
5366 5366 c, t dbSNP:139429265
5367 5367 a, g dbSNP:371980859
5368 5368 c, t dbSNP:766156282
5376 5376 a, g dbSNP:753595827
5377 5377 c, t dbSNP:755163871
5382 5382 c, g dbSNP:147444658
5391 5391 c, t dbSNP:752762142
5409 5409 c, t dbSNP:758522825
5410 5410 c, g dbSNP:778225695
5417 5417 c, t dbSNP:375017809
5418 5418 a, g dbSNP:757730301
5421 5421 a, g dbSNP:571819028
5422 5422 a, g dbSNP:746220769
5427 5427 c, g dbSNP:768415267
5433 5433 c, g dbSNP:778762659
5451 5451 a, g dbSNP:369259342
5452 5452 c, t dbSNP:747638224
5464 5464 a, g, t dbSNP:771748834
5465 5465 g, t dbSNP:760611211
5466 5466 a, g dbSNP:770779367
5472 5472 a, g dbSNP:776483400
5511 5511 c, t dbSNP:545622588
5516 5516 c, t dbSNP:149978361
5517 5517 a, g dbSNP:373301793
5523 5523 a, g dbSNP:763197178
5526 5526 a, c, g dbSNP:3812233
5544 5544 a, g dbSNP:757712554
5615 5615 a, g dbSNP:781613431
5629 5629 g, t dbSNP:750782638
5637 5637 a, g dbSNP:147679171
5641 5641 c, g, t dbSNP:191761610
5645 5645 c, g dbSNP:747762304
5650 5650 a, g dbSNP:771871664
5655 5655 c, g dbSNP:768818067
5678 5678 a, g dbSNP:777278111
5689 5689 a, g dbSNP:563193596
5703 5703 a, g dbSNP:770890026
5721 5721 c, t dbSNP:773023212
5722 5722 a, g dbSNP:530084903
5723 5723 c, t dbSNP:769541604
5733 5733 a, g dbSNP:775289925
5754 5754 a, c dbSNP:763106833
5759 5759 c, g dbSNP:764230499
5777 5777 a, g dbSNP:751652188
5790 5790 c, t dbSNP:761854448
5791 5791 g, t dbSNP:548603375
5799 5799 a, c, g dbSNP:377350616
5804 5804 c, t dbSNP:756720427
5816 5816 a, g dbSNP:780516083
5817 5817 a, g dbSNP:527775865
5821 5821 a, c dbSNP:758120346
5824 5824 c, t dbSNP:777350143
5826 5826 c, t dbSNP:746506227
5830 5830 a, c, g dbSNP:766875935
5833 5833 a, g dbSNP:745761087
5847 5847 c, g dbSNP:769738505
5849 5849 c, t dbSNP:775203171
5850 5850 a, g dbSNP:142956583
5853 5853 a, c dbSNP:768906544
5854 5854 c, t dbSNP:774480576
5863 5863 c, g, t dbSNP:761917637
5868 5868 c, t dbSNP:773447338
5869 5869 a, g dbSNP:761204913
5876 5876 c, t dbSNP:766996279