
ARID1B cDNA ORF clone, Homo sapiens (human)

Gene Symbol ARID1B
Entrez Gene ID 57492
Full Name AT rich interactive domain 1B (SWI1-like)
Synonyms 6A3-5, BAF250B, BRIGHT, DAN15, ELD/OSA1, MRD12, OSA2, P250R
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
XM_005267069 XP_005267126 AT-rich interactive domain-containing protein 1B isoform X1
XM_011535984 XP_011534286 AT-rich interactive domain-containing protein 1B isoform X2
XM_011535985 XP_011534287 AT-rich interactive domain-containing protein 1B isoform X3
XM_011535986 XP_011534288 AT-rich interactive domain-containing protein 1B isoform X4
XM_011535987 XP_011534289 AT-rich interactive domain-containing protein 1B isoform X5
XM_011535988 XP_011534290 AT-rich interactive domain-containing protein 1B isoform X6
NM_017519 NP_059989 AT-rich interactive domain-containing protein 1B isoform 1
NM_020732 NP_065783 AT-rich interactive domain-containing protein 1B isoform 2

R-HSA-4839726 Chromatin organization
R-HSA-3247509 Chromatin modifying enzymes
R-HSA-3214858 RMTs methylate histone arginines
WP2263 Prostate Cancer

Homo sapiens (human) ARID1B NP_065783.3
Macaca mulatta (Rhesus monkey) ARID1B XP_001096831.2
Canis lupus familiaris (dog) ARID1B XP_005615750.1
Bos taurus (cattle) ARID1B XP_002690406.3
Mus musculus (house mouse) Arid1b NP_001078824.1
Rattus norvegicus (Norway rat) Arid1b XP_006227967.1
Gallus gallus (chicken) ARID1B XP_001232096.3
Danio rerio (zebrafish) arid1b XP_698079.4
Xenopus (Silurana) tropicalis (western clawed frog) arid1b XP_004914686.1


ID Name Evidence
GO:0005622 intracellular IEA
GO:0005634 nucleus IDA
GO:0005730 nucleolus IDA
GO:0016514 SWI/SNF complex IDA
GO:0043231 intracellular membrane-bounded organelle IDA


ID Name Evidence
GO:0003677 DNA binding IEA
GO:0003713 transcription coactivator activity NAS
GO:0005515 protein binding IPI


ID Name Evidence
GO:0006355 regulation of transcription, DNA-dependent IEA
GO:0007399 nervous system development IEA
GO:0016568 chromatin modification IEA
GO:0048096 chromatin-mediated maintenance of transcription NAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ARID1B gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ARID1B cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu70525 XM_005267069 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu70526 XM_011535984 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu70527 XM_011535985 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu70528 XM_011535986 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu70529 XM_011535987 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu70530 XM_011535988 PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu21347 NM_017519 Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu20605 NM_020732 Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu70525
Accession Version XM_005267069.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 6870bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AT-rich interactive domain-containing protein 1B isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578812871. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)2130..>2330(+)
Misc Feature(2)3357..3632(+)
Misc Feature(3)5973..6743(+)
Position Chain Variation Link
9 9 c, t dbSNP:765521754
49 49 -, cgcgggcgc dbSNP:777784233
58 58 c, t dbSNP:753014356
107 107 a, g dbSNP:533182720
120 120 a, g dbSNP:777781316
135 135 a, g dbSNP:371680791
140 140 -, tcc, tcctcc dbSNP:770512547
141 141 -, tcc dbSNP:746971833
142 142 c, t dbSNP:747481125
148 148 c, t dbSNP:757718031
161 161 -, gcggcggca dbSNP:775061368
162 162 -, gcggcggca dbSNP:769480864
173 173 g, t dbSNP:781571296
180 180 a, t dbSNP:746200189
184 184 a, c, t dbSNP:375486386
185 185 c, t dbSNP:569712058
186 186 -, tcc dbSNP:763238673
188 188 c, g dbSNP:747865443
193 193 c, t dbSNP:537376978
197 197 c, g dbSNP:771546243
206 206 c, g dbSNP:555625059
210 210 a, g dbSNP:772615576
216 216 a, g dbSNP:760615443
221 221 a, g dbSNP:369887127
229 229 c, t dbSNP:567535199
235 235 a, g dbSNP:776745618
260 260 a, g dbSNP:759380745
269 269 c, t dbSNP:765178250
271 271 c, t dbSNP:752961325
278 278 -, ccaccagcagca dbSNP:764476277
281 281 c, t dbSNP:763270155
287 287 -, cac dbSNP:762287165
288 288 -, cac dbSNP:752012879
290 290 c, g dbSNP:372726215
295 295 a, g dbSNP:535189355
303 303 c, t dbSNP:751612160
304 304 a, c dbSNP:757399076
307 307 -, ccacca dbSNP:780268024
308 308 -, ccacca dbSNP:754114025
308 308 -, cca dbSNP:756208522
316 316 a, t dbSNP:587779741
324 324 a, c dbSNP:374989034
331 331 a, g dbSNP:552796500
332 332 c, g dbSNP:756468465
356 356 a, c dbSNP:577625187
377 377 -, cag, cagcag, cagcagcag, cagcagcagcag dbSNP:770869529
378 378 -, cagcagcag dbSNP:777729182
378 378 -, cag dbSNP:746846909
379 379 a, g dbSNP:747743024
380 380 -, cagcagcagcagcagcagcaa dbSNP:762617219
381 381 -, cagcagcagcagcagcagcaa dbSNP:775084783
384 384 -, cagcagcagcagcagcaa dbSNP:768349133
386 386 -, cagcagcagcagcaa dbSNP:762234415
387 387 -, cagcagcagcagcaa dbSNP:774668010
392 392 a, g dbSNP:544767610
393 393 -, cagcagcaa dbSNP:768057996
395 395 -, cagcaa dbSNP:750911844
396 396 -, cagcaa dbSNP:760745125
398 398 -, caa dbSNP:754060642
399 399 -, caa dbSNP:766396838
400 400 -, gc, gca dbSNP:587779743
401 401 a, g dbSNP:78253128
402 402 -, cagcagcag dbSNP:745824983
402 402 -, cag dbSNP:765595527
404 404 -, cagcagcagcagcagcagcaa dbSNP:755601970
405 405 -, cagcagcagcagcagcagcaa dbSNP:779519347
407 407 a, g dbSNP:771649817
419 419 -, cagcaa dbSNP:748838689
419 419 c, g dbSNP:777300641
424 424 -, gcagca dbSNP:587779744
425 425 -, cagcagcagcagcagcag dbSNP:768296283
425 425 a, g dbSNP:746466458
427 427 a, g dbSNP:575289192
430 430 -, gcagcagc, gcagcagcagc dbSNP:748491093
431 431 a, g dbSNP:770519975
434 434 -, tcccattt dbSNP:773725916
437 437 c, g dbSNP:542974447
439 439 c, t dbSNP:776694458
442 442 c, g dbSNP:759611608
445 445 a, g dbSNP:769645555
446 446 c, g dbSNP:775436632
448 448 a, g dbSNP:763184406
451 451 a, g dbSNP:561130072
463 463 a, g dbSNP:751856926
482 482 g, t dbSNP:370106545
492 492 c, g dbSNP:528280784
503 503 a, c, g dbSNP:200808642
507 507 c, g dbSNP:780352077
519 519 c, g dbSNP:540385524
530 530 c, t dbSNP:754236989
542 542 a, c dbSNP:755407106
641 641 a, g dbSNP:564924707
713 713 c, g dbSNP:113758011
717 717 c, g dbSNP:777266582
718 718 c, t dbSNP:746730857
720 720 a, c dbSNP:770339919
737 737 c, t dbSNP:780851634
743 743 c, t dbSNP:745740327
752 752 c, t dbSNP:533517668
769 769 c, g dbSNP:775385239
774 774 a, g dbSNP:375160616
778 778 c, g dbSNP:768554794
844 844 c, t dbSNP:774432900
846 846 -, ccg dbSNP:776819042
847 847 -, ccg dbSNP:766956053
847 847 c, g dbSNP:762100979
864 864 a, g dbSNP:767529376
899 899 c, g dbSNP:773305123
904 904 a, g dbSNP:761134074
907 907 a, c dbSNP:766844503
911 911 a, c dbSNP:754413384
913 913 a, c dbSNP:755281397
938 938 a, c dbSNP:569750806
948 948 c, g dbSNP:765697199
956 956 -, ggc, ggcggc dbSNP:759755695
957 957 -, ggcggcggcggc dbSNP:750281468
957 957 -, ggcggcggc dbSNP:757008446
957 957 -, ggcggc dbSNP:767238602
957 957 -, ggc dbSNP:752981400
959 959 a, c dbSNP:751102826
977 977 -, cggcgg dbSNP:587779747
979 979 c, g dbSNP:756982067
980 980 -, gga dbSNP:748785872
980 980 a, c dbSNP:184815562
981 981 -, gga dbSNP:780034760
983 983 a, c dbSNP:112474841
992 992 -, agg dbSNP:587779748
996 996 a, g dbSNP:201842850
998 998 -, gga dbSNP:778474813
999 999 -, ggaggagga dbSNP:772429143
999 999 -, ggagga dbSNP:747790383
999 999 -, gga dbSNP:754500538
1018 1018 -, aggagc dbSNP:747438636
1020 1020 a, g dbSNP:780126064
1022 1022 a, g dbSNP:189230752
1024 1024 -, aggagcagg dbSNP:771557031
1025 1025 -, aggagcagg dbSNP:777332927
1027 1027 c, g dbSNP:749315126
1052 1052 -, gtggcg dbSNP:759630370
1055 1055 -, ggc dbSNP:765410747
1056 1056 -, gcggcggcggcc dbSNP:763063242
1063 1063 c, t dbSNP:768271181
1068 1068 -, gcg dbSNP:764418312
1069 1069 c, t dbSNP:530780611
1092 1092 -, ggc dbSNP:542021607
1094 1094 -, ggc dbSNP:555730413
1126 1126 c, t dbSNP:748273011
1151 1151 c, t dbSNP:549289491
1208 1208 c, t dbSNP:772315737
1221 1221 a, g dbSNP:773467188
1225 1225 c, g dbSNP:760718156
1234 1234 c, t dbSNP:766500898
1249 1249 c, g dbSNP:776996949
1262 1262 a, c, g dbSNP:760090226
1271 1271 c, g, t dbSNP:753125848
1281 1281 g, t dbSNP:767247521
1283 1283 c, t dbSNP:750158289
1286 1286 c, t dbSNP:755682475
1289 1289 c, g dbSNP:779622340
1292 1292 c, g dbSNP:753662365
1295 1295 c, t dbSNP:754967908
1297 1297 a, g dbSNP:778536440
1307 1307 c, t dbSNP:747947340
1312 1312 c, t dbSNP:771908741
1323 1323 a, g dbSNP:199948752
1334 1334 c, t dbSNP:747295062
1337 1337 c, t dbSNP:770927920
1338 1338 c, g dbSNP:776783024
1341 1341 a, g dbSNP:759909326
1345 1345 a, c, g dbSNP:770362902
1350 1350 c, g dbSNP:763387163
1352 1352 c, g dbSNP:764620171
1356 1356 c, t dbSNP:750031315
1367 1367 c, t dbSNP:760419444
1371 1371 -, cgc, cgccgc dbSNP:572236007
1372 1372 -, cgccgc dbSNP:754447727
1372 1372 -, cgc dbSNP:766249098
1376 1376 a, g dbSNP:765760904
1380 1380 c, t dbSNP:753422144
1382 1382 a, g dbSNP:754489682
1383 1383 -, cgccgt dbSNP:778413404
1384 1384 a, c dbSNP:778891019
1385 1385 -, gccgtcgca dbSNP:752295930
1386 1386 -, cgc dbSNP:587779738
1386 1386 a, c dbSNP:752684703
1388 1388 -, ccg dbSNP:587779739
1406 1406 -, ggcggc dbSNP:757953295
1406 1406 -, ggc dbSNP:777545000
1413 1413 a, g dbSNP:587779740
1435 1435 g, t dbSNP:758181047
1456 1456 -, tgggct dbSNP:747320636
1465 1465 c, g dbSNP:777545755
1472 1472 c, t dbSNP:747174363
1477 1477 a, g dbSNP:771204934
1479 1479 a, g dbSNP:781091058
1487 1487 c, t dbSNP:745929521
1488 1488 c, g dbSNP:769813347
1494 1494 a, g dbSNP:776060836
1495 1495 a, c dbSNP:763559359
1501 1501 c, g dbSNP:769085274
1502 1502 a, g dbSNP:774880058
1503 1503 g, t dbSNP:760366486
1505 1505 a, c dbSNP:766027272
1513 1513 c, t dbSNP:753486869
1524 1524 -, agg dbSNP:771434224
1526 1526 c, g dbSNP:759078059
1528 1528 a, c, g dbSNP:764716697
1530 1530 c, t dbSNP:758342480
1531 1531 a, c dbSNP:763825843
1534 1534 c, g dbSNP:751389585
1535 1535 a, g dbSNP:757043988
1537 1537 a, c dbSNP:781454908
1547 1547 c, t dbSNP:746135430
1560 1560 c, t dbSNP:200682868
1566 1566 a, g dbSNP:780293502
1568 1568 a, g dbSNP:749761849
1569 1569 g, t dbSNP:769316078
1570 1570 g, t dbSNP:775035352
1571 1571 c, t dbSNP:748498440
1590 1590 a, g dbSNP:145785954
1591 1591 c, t dbSNP:775164729
1593 1593 a, g dbSNP:762428637
1597 1597 a, c dbSNP:763652332
1599 1599 a, g dbSNP:147794292
1611 1611 a, c dbSNP:761668764
1613 1613 a, g dbSNP:267600875
1614 1614 a, c dbSNP:767293145
1627 1627 a, g dbSNP:750214622
1630 1630 c, t dbSNP:141260832
1636 1636 a, g dbSNP:147088160
1659 1659 a, c dbSNP:754167205
1663 1663 a, g dbSNP:539811282
1669 1669 c, t dbSNP:779142775
1670 1670 a, g, t dbSNP:142939952
1673 1673 c, t dbSNP:758854488
1680 1680 a, g dbSNP:778162933
1686 1686 c, t dbSNP:747306459
1687 1687 a, g dbSNP:570309056
1688 1688 c, t dbSNP:779668926
1707 1707 c, t dbSNP:749006707
1708 1708 a, g dbSNP:768096043
1709 1709 c, g dbSNP:773754437
1716 1716 a, g dbSNP:17318151
1717 1717 c, t dbSNP:756050584
1720 1720 c, g dbSNP:773247445
1731 1731 a, c, t dbSNP:143370913
1732 1732 a, g dbSNP:754042537
1739 1739 c, t dbSNP:759855548
1740 1740 a, g dbSNP:765362265
1743 1743 g, t dbSNP:201244213
1751 1751 c, t dbSNP:752755002
1752 1752 a, g dbSNP:151093357
1755 1755 a, g dbSNP:778121932
1760 1760 a, g dbSNP:752168831
1783 1783 c, t dbSNP:148382861
1801 1801 a, g dbSNP:761867629
1805 1805 a, g dbSNP:772203422
1814 1814 c, t dbSNP:773640553
1824 1824 a, g dbSNP:571695301
1829 1829 -, c dbSNP:138196985
1835 1835 a, c, g dbSNP:766599882
1836 1836 c, t dbSNP:141395733
1843 1843 a, g dbSNP:763818779
1852 1852 -, gca dbSNP:746407600
1857 1857 c, t dbSNP:751317747
1858 1858 c, t dbSNP:779239519
1861 1861 a, c, t dbSNP:199949701
1862 1862 a, g dbSNP:370068335
1863 1863 c, t dbSNP:372781930
1869 1869 c, t dbSNP:201038527
1871 1871 a, g dbSNP:756099753
1873 1873 c, g, t dbSNP:779895443
1880 1880 a, c, g dbSNP:146312104
1884 1884 c, t dbSNP:751320376
1887 1887 c, t dbSNP:748370897
1891 1891 c, t dbSNP:772078777
1892 1892 a, g dbSNP:376964478
1895 1895 c, t dbSNP:761043177
1898 1898 c, g dbSNP:771442003
1901 1901 c, t dbSNP:139595304
1902 1902 c, t dbSNP:387907142
1906 1906 a, g dbSNP:538689102
1912 1912 a, c, t dbSNP:759934770
1913 1913 c, t dbSNP:751192841
1917 1917 c, t dbSNP:372690657
1918 1918 c, t dbSNP:558155146
1919 1919 a, g, t dbSNP:374876774
1930 1930 c, t dbSNP:767255855
1931 1931 a, g dbSNP:142897795
1945 1945 a, g dbSNP:749173157
1963 1963 c, g dbSNP:765810222
1969 1969 a, t dbSNP:753748958
1972 1972 c, t dbSNP:376595068
1975 1975 c, g dbSNP:764967238
1976 1976 c, t dbSNP:146240413
1977 1977 a, g dbSNP:573836252
1978 1978 a, g dbSNP:778044758
1984 1984 c, g dbSNP:778362623
1994 1994 a, t dbSNP:139125255
1997 1997 c, t dbSNP:149931590
2007 2007 a, g dbSNP:781146492
2008 2008 c, t dbSNP:746327988
2010 2010 a, c dbSNP:770455355
2014 2014 a, g dbSNP:776187102
2019 2019 a, g dbSNP:749657274
2035 2035 c, t dbSNP:559304585
2042 2042 a, g dbSNP:761710707
2053 2053 c, t dbSNP:767620420
2054 2054 a, t dbSNP:750738896
2066 2066 c, g dbSNP:756195424
2068 2068 c, t dbSNP:373508866
2069 2069 a, g dbSNP:201290874
2075 2075 a, g dbSNP:6912981
2086 2086 c, t dbSNP:779512205
2096 2096 a, c dbSNP:376143843
2102 2102 g, t dbSNP:772549124
2103 2103 a, g dbSNP:780820426
2105 2105 a, g dbSNP:745528262
2108 2108 c, t dbSNP:148700132
2109 2109 a, g dbSNP:775004900
2116 2116 c, t dbSNP:762908553
2117 2117 a, g dbSNP:370910542
2129 2129 c, g dbSNP:774397054
2130 2130 a, g dbSNP:374648940
2134 2134 a, g dbSNP:368202669
2137 2137 a, g dbSNP:762401544
2144 2144 a, g dbSNP:750615874
2146 2146 c, t dbSNP:774701560
2147 2147 a, g dbSNP:551597753
2148 2148 a, c dbSNP:753933273
2150 2150 c, g dbSNP:755131525
2152 2152 c, t dbSNP:779271100
2153 2153 a, g dbSNP:753317592
2167 2167 a, g dbSNP:758625736
2168 2168 c, t dbSNP:370364530
2170 2170 c, t dbSNP:563771544
2171 2171 a, g dbSNP:3734441
2182 2182 g, t dbSNP:779724084
2186 2186 c, t dbSNP:549352027
2193 2193 c, g dbSNP:768277043
2195 2195 a, g dbSNP:374696557
2196 2196 a, g dbSNP:748129248
2197 2197 c, g dbSNP:367698478
2198 2198 a, g dbSNP:780611617
2200 2200 a, c, g dbSNP:567668222
2208 2208 c, t dbSNP:534990481
2219 2219 a, t dbSNP:766684321
2222 2222 c, t dbSNP:776967149
2226 2226 c, t dbSNP:759533117
2229 2229 a, g dbSNP:765365713
2235 2235 a, g dbSNP:753092220
2239 2239 a, g dbSNP:763191352
2248 2248 a, g dbSNP:764402992
2266 2266 c, t dbSNP:751891035
2268 2268 a, g dbSNP:757669934
2270 2270 a, g dbSNP:779669164
2274 2274 a, g dbSNP:748973290
2276 2276 a, c dbSNP:546849919
2283 2283 a, t dbSNP:372730587
2292 2292 c, t dbSNP:757549352
2296 2296 c, t dbSNP:754080772
2297 2297 a, g dbSNP:190653632
2306 2306 c, t dbSNP:541757080
2311 2311 a, g dbSNP:778467052
2329 2329 c, g, t dbSNP:762229592
2331 2331 a, c dbSNP:758038225
2334 2334 c, t dbSNP:777845775
2336 2336 c, t dbSNP:746951045
2337 2337 a, g dbSNP:147784000
2342 2342 a, g dbSNP:781067022
2348 2348 a, g dbSNP:368362137
2356 2356 c, t dbSNP:770027363
2371 2371 a, g dbSNP:780321051
2377 2377 g, t dbSNP:141219657
2384 2384 c, g, t dbSNP:768672743
2392 2392 a, g dbSNP:761921020
2396 2396 a, c dbSNP:772604684
2397 2397 c, g dbSNP:773646023
2398 2398 c, t dbSNP:201156721
2404 2404 c, t dbSNP:761093701
2408 2408 c, t dbSNP:766654973
2410 2410 a, g dbSNP:752341983
2411 2411 c, g dbSNP:778702667
2413 2413 a, g dbSNP:762721043
2418 2418 c, t dbSNP:114201726
2427 2427 a, g dbSNP:556939212
2436 2436 c, t dbSNP:756767804
2442 2442 c, t dbSNP:767477226
2443 2443 c, t dbSNP:150140314
2444 2444 a, g dbSNP:374691223
2449 2449 a, g dbSNP:779733858
2462 2462 a, g dbSNP:749470868
2465 2465 c, g dbSNP:755160504
2485 2485 c, g dbSNP:779154161
2488 2488 a, g dbSNP:748209235
2492 2492 c, t dbSNP:546767328
2508 2508 a, c, g dbSNP:772107512
2515 2515 c, t dbSNP:141030037
2518 2518 a, g, t dbSNP:771280525
2519 2519 c, t dbSNP:760022925
2520 2520 a, g dbSNP:150249745
2521 2521 a, g dbSNP:774205020
2524 2524 c, t dbSNP:527698870
2525 2525 a, g dbSNP:368988882
2536 2536 a, g dbSNP:766942261
2539 2539 a, g dbSNP:750324294
2540 2540 c, t dbSNP:756036121
2542 2542 g, t dbSNP:138934947
2544 2544 a, c dbSNP:753607638
2565 2565 c, t dbSNP:572020611
2566 2566 a, c dbSNP:761388338
2572 2572 c, t dbSNP:749077422
2573 2573 a, g dbSNP:772564622
2581 2581 a, g dbSNP:760280267
2603 2603 c, t dbSNP:766290096
2604 2604 a, g dbSNP:145635490
2615 2615 c, t dbSNP:528889230
2616 2616 a, g dbSNP:542660265
2618 2618 c, t dbSNP:752913095
2637 2637 a, g dbSNP:564110998
2639 2639 a, c dbSNP:778099902
2645 2645 g, t dbSNP:376497842
2655 2655 a, g dbSNP:757473942
2661 2661 a, t dbSNP:781763581
2664 2664 c, g dbSNP:138254872
2671 2671 a, g dbSNP:770228055
2674 2674 a, g dbSNP:780312215
2684 2684 -, gtg dbSNP:201979665
2694 2694 a, t dbSNP:749701314
2707 2707 g, t dbSNP:771600870
2715 2715 a, t dbSNP:772975321
2724 2724 c, t dbSNP:760095080
2726 2726 g, t dbSNP:770428988
2738 2738 a, g dbSNP:751177927
2747 2747 c, g dbSNP:146077641
2750 2750 c, t dbSNP:764978487
2767 2767 c, t dbSNP:752405476
2791 2791 g, t dbSNP:762855776
2795 2795 a, g dbSNP:764210072
2798 2798 a, g dbSNP:587779742
2802 2802 a, g, t dbSNP:531418921
2810 2810 c, t dbSNP:750914446
2818 2818 a, c, g dbSNP:756655213
2837 2837 c, t dbSNP:374572368
2838 2838 a, g dbSNP:377633743
2851 2851 a, c dbSNP:549928918
2853 2853 g, t dbSNP:746676470
2859 2859 a, g dbSNP:770377920
2861 2861 c, g dbSNP:148749268
2889 2889 g, t dbSNP:773631262
2892 2892 a, c dbSNP:760765281
2894 2894 c, t dbSNP:144894118
2895 2895 a, g dbSNP:34786733
2896 2896 a, g dbSNP:755539131
2917 2917 c, t dbSNP:370071892
2933 2933 a, c dbSNP:373256784
2953 2953 a, g dbSNP:550604212
2959 2959 c, g dbSNP:780818465
2970 2970 a, c dbSNP:745524201
2975 2975 c, g dbSNP:755525381
2977 2977 a, t dbSNP:139620600
2980 2980 c, t dbSNP:377351099
2981 2981 a, g dbSNP:144558683
2982 2982 c, g dbSNP:779048797
2983 2983 c, t dbSNP:370190261
2984 2984 a, g dbSNP:537901478
2991 2991 a, c dbSNP:773510355
2994 2994 a, c dbSNP:760973888
2996 2996 a, g dbSNP:566567531
2998 2998 c, t dbSNP:750810656
2999 2999 a, g dbSNP:560450902
3002 3002 c, t dbSNP:765720893
3003 3003 a, g dbSNP:527731946
3005 3005 a, c dbSNP:763236835
3006 3006 a, g dbSNP:764460073
3011 3011 a, g dbSNP:758749885
3020 3020 a, g dbSNP:750032487
3033 3033 a, g dbSNP:758377419
3037 3037 c, t dbSNP:777905171
3045 3045 -, atg dbSNP:762047886
3046 3046 c, t dbSNP:746808513
3049 3049 c, t dbSNP:371523255
3055 3055 c, t dbSNP:540277176
3073 3073 c, t dbSNP:746092285
3074 3074 c, t dbSNP:769820008
3075 3075 c, t dbSNP:775582196
3086 3086 -, agc dbSNP:772325958
3086 3086 a, g dbSNP:749413486
3087 3087 a, g dbSNP:769132694
3089 3089 a, g dbSNP:774783574
3092 3092 c, t dbSNP:147853607
3093 3093 a, g dbSNP:375023508
3098 3098 a, t dbSNP:776294122
3117 3117 a, c, t dbSNP:368880015
3119 3119 c, t dbSNP:752231248
3120 3120 a, g dbSNP:570798143
3138 3138 a, g dbSNP:763525655
3140 3140 c, g dbSNP:751465997
3141 3141 a, t dbSNP:757176899
3145 3145 a, g dbSNP:139407686
3151 3151 a, g dbSNP:750198878
3158 3158 a, t dbSNP:534113119
3171 3171 a, c dbSNP:755963909
3181 3181 a, c dbSNP:780181329
3227 3227 c, t dbSNP:754071347
3246 3246 a, g dbSNP:754998837
3296 3296 a, g dbSNP:373653398
3319 3319 g, t dbSNP:779243569
3332 3332 a, g dbSNP:752704102
3341 3341 c, t dbSNP:758570139
3344 3344 a, g dbSNP:373641381
3347 3347 a, g dbSNP:747533804
3349 3349 a, g dbSNP:771373121
3353 3353 c, t dbSNP:781714598
3358 3358 c, t dbSNP:746278639
3368 3368 a, g dbSNP:568095755
3377 3377 c, t dbSNP:371828409
3378 3378 a, g dbSNP:761227259
3381 3381 c, t dbSNP:387907144
3387 3387 c, t dbSNP:779598699
3390 3390 a, t dbSNP:771621841
3391 3391 a, c dbSNP:773082217
3396 3396 a, c dbSNP:760633180
3402 3402 c, g dbSNP:766340916
3406 3406 a, g dbSNP:753607488
3408 3408 a, g dbSNP:759432635
3410 3410 c, g dbSNP:765371275
3415 3415 c, t dbSNP:377588212
3417 3417 a, g dbSNP:758353662
3423 3423 a, g dbSNP:774855592
3425 3425 c, t dbSNP:752073815
3426 3426 a, c dbSNP:757809298
3428 3428 g, t dbSNP:781777822
3434 3434 c, t dbSNP:746210543
3435 3435 a, g dbSNP:370283707
3437 3437 a, g dbSNP:778366844
3446 3446 a, g, t dbSNP:374705142
3447 3447 c, t dbSNP:746686035
3452 3452 a, g dbSNP:376995038
3462 3462 c, t dbSNP:387907141
3463 3463 a, g dbSNP:746567959
3467 3467 c, g, t dbSNP:111368751
3468 3468 c, t dbSNP:759186918
3470 3470 c, t dbSNP:61736269
3471 3471 a, g dbSNP:775526039
3476 3476 c, t dbSNP:763270294
3481 3481 a, g dbSNP:764452515
3484 3484 a, g dbSNP:751670059
3487 3487 g, t dbSNP:375581771
3488 3488 c, t dbSNP:181686951
3497 3497 g, t dbSNP:750948289
3548 3548 c, t dbSNP:771166112
3549 3549 a, g dbSNP:756707971
3557 3557 c, t dbSNP:142391292
3569 3569 a, g dbSNP:745412510
3581 3581 a, g dbSNP:769749724
3599 3599 c, g dbSNP:779917726
3605 3605 g, t dbSNP:545017957
3617 3617 a, g dbSNP:61745451
3626 3626 c, t dbSNP:774661225
3631 3631 a, g dbSNP:762153671
3632 3632 a, t dbSNP:772220023
3646 3646 c, t dbSNP:773317331
3647 3647 a, g dbSNP:760721516
3648 3648 c, t dbSNP:766902947
3649 3649 c, t dbSNP:754303482
3650 3650 a, g dbSNP:759836095
3652 3652 a, c dbSNP:765612283
3665 3665 c, t dbSNP:369218715
3666 3666 a, g dbSNP:756872796
3684 3684 c, g dbSNP:780758224
3698 3698 a, g dbSNP:749937918
3716 3716 a, g dbSNP:776425168
3733 3733 c, t dbSNP:759056899
3740 3740 c, t dbSNP:764861177
3741 3741 c, t dbSNP:752639283
3746 3746 a, g dbSNP:762767858
3750 3750 a, g dbSNP:552938708
3752 3752 c, t dbSNP:372186962
3757 3757 a, g dbSNP:145857100
3774 3774 c, g dbSNP:781326777
3786 3786 c, g dbSNP:138482029
3790 3790 a, g dbSNP:756141390
3797 3797 a, t dbSNP:780142651
3800 3800 c, t dbSNP:749430350
3801 3801 c, g dbSNP:547596526
3818 3818 c, t dbSNP:771632801
3819 3819 a, g dbSNP:779536790
3824 3824 g, t dbSNP:748391706
3834 3834 a, g, t dbSNP:141190049
3835 3835 c, t dbSNP:376806897
3839 3839 a, g dbSNP:769609140
3850 3850 a, g dbSNP:574296429
3851 3851 c, t dbSNP:369035728
3865 3865 c, t dbSNP:138218716
3869 3869 c, t dbSNP:373881952
3872 3872 c, t dbSNP:748681838
3875 3875 a, g dbSNP:768227723
3884 3884 c, t dbSNP:559706338
3885 3885 a, g dbSNP:773649998
3890 3890 c, t dbSNP:767486423
3895 3895 c, t dbSNP:772973856
3898 3898 c, t dbSNP:533211077
3904 3904 c, t dbSNP:150196933
3905 3905 a, g dbSNP:766441730
3909 3909 c, t dbSNP:754100748
3910 3910 a, g dbSNP:754960836
3918 3918 a, g dbSNP:138784762
3924 3924 c, t dbSNP:752863054
3928 3928 a, g dbSNP:376071880
3929 3929 c, t dbSNP:370523060
3930 3930 a, g dbSNP:747374301
3932 3932 c, t dbSNP:757646876
3934 3934 c, t dbSNP:779516798
3935 3935 a, c dbSNP:748995523
3943 3943 a, c dbSNP:768013849
3954 3954 a, g dbSNP:773883674
3957 3957 a, c dbSNP:747709980
3959 3959 c, t dbSNP:771988661
3960 3960 a, g dbSNP:773135175
3963 3963 a, g, t dbSNP:760402063
3964 3964 c, t dbSNP:776675533
3974 3974 a, g dbSNP:530602758
3979 3979 c, t dbSNP:759771283
3980 3980 c, t dbSNP:765425489
3982 3982 a, g dbSNP:752811689
3988 3988 c, g dbSNP:374517532
4003 4003 c, t dbSNP:764630192
4009 4009 a, g dbSNP:149389876
4019 4019 a, g dbSNP:200230777
4035 4035 a, g dbSNP:752398721
4036 4036 a, g dbSNP:763740758
4043 4043 c, t dbSNP:368341224
4044 4044 a, g dbSNP:753381410
4048 4048 c, t dbSNP:371538726
4049 4049 a, c, g, t dbSNP:374823620
4055 4055 a, c dbSNP:769769342
4059 4059 a, g, t dbSNP:144029881
4067 4067 c, t dbSNP:769028104
4069 4069 a, g dbSNP:774520303
4074 4074 a, g dbSNP:761809331
4077 4077 c, t dbSNP:387907140
4094 4094 a, g dbSNP:367653751
4103 4103 c, t dbSNP:371872657
4104 4104 a, g dbSNP:199674889
4109 4109 a, g dbSNP:766772916
4110 4110 a, g dbSNP:754234955
4112 4112 a, g dbSNP:757999037
4114 4114 c, g dbSNP:763750480
4120 4120 c, t dbSNP:751015296
4121 4121 a, g dbSNP:756784391
4123 4123 g, t dbSNP:781175942
4128 4128 c, g dbSNP:745841288
4130 4130 a, g dbSNP:755940737
4134 4134 c, t dbSNP:138785718
4135 4135 a, g dbSNP:370064281
4141 4141 a, g dbSNP:768938099
4159 4159 a, g dbSNP:142808724
4163 4163 c, t dbSNP:372767127
4164 4164 a, g dbSNP:772095737
4167 4167 a, c dbSNP:773740590
4168 4168 a, g dbSNP:761133847
4172 4172 a, g dbSNP:779177994
4175 4175 g, t dbSNP:565147002
4196 4196 c, t dbSNP:748363079
4225 4225 c, t dbSNP:577211667
4228 4228 c, t dbSNP:773119970
4229 4229 a, g dbSNP:374835455
4238 4238 a, g dbSNP:147424506
4241 4241 c, t dbSNP:56139133
4248 4248 a, g dbSNP:151115781
4260 4260 c, t dbSNP:587779745
4264 4264 a, g dbSNP:765570329
4267 4267 c, t dbSNP:367809905
4276 4276 a, g dbSNP:778062751
4278 4278 c, t dbSNP:747088591
4279 4279 a, g dbSNP:771056710
4289 4289 c, t dbSNP:139785288
4290 4290 a, g, t dbSNP:746412839
4294 4294 c, t dbSNP:145012943
4295 4295 a, g dbSNP:763386213
4298 4298 c, t dbSNP:377021700
4302 4302 c, t dbSNP:773062339
4314 4314 c, t dbSNP:760245781
4316 4316 c, t dbSNP:369640779
4323 4323 a, g dbSNP:766030463
4326 4326 a, g dbSNP:753434703
4328 4328 c, t dbSNP:150516641
4329 4329 a, g dbSNP:777513652
4330 4330 c, t dbSNP:759345151
4331 4331 a, g dbSNP:765236859
4360 4360 -, agg dbSNP:755476506
4364 4364 a, g dbSNP:139512931
4369 4369 a, g dbSNP:372833448
4375 4375 a, g dbSNP:534466124
4383 4383 a, g dbSNP:149702962
4388 4388 c, g, t dbSNP:777844769
4392 4392 g, t dbSNP:145516400
4393 4393 c, t dbSNP:781209005
4394 4394 a, g dbSNP:745968347
4398 4398 c, g dbSNP:140639463
4399 4399 c, t dbSNP:530430137
4400 4400 a, g dbSNP:749608995
4402 4402 a, g dbSNP:769118968
4404 4404 c, t dbSNP:772972321
4405 4405 a, g dbSNP:144424476
4409 4409 a, g dbSNP:770732982
4413 4413 a, c, g dbSNP:376225642
4415 4415 c, g dbSNP:368993084
4418 4418 a, g dbSNP:759092517
4419 4419 a, g dbSNP:765083250
4428 4428 a, c dbSNP:775556116
4430 4430 a, c, g dbSNP:146625434
4435 4435 c, t dbSNP:751387548
4452 4452 a, g dbSNP:745566888
4457 4457 a, g dbSNP:767739514
4463 4463 a, c, g dbSNP:566865279
4470 4470 a, g dbSNP:780408339
4475 4475 a, g dbSNP:527711444
4480 4480 a, t dbSNP:755473951
4482 4482 a, g dbSNP:779375711
4487 4487 a, c dbSNP:748539331
4489 4489 c, t dbSNP:770643408
4490 4490 a, g dbSNP:373191607
4499 4499 c, g dbSNP:745359242
4503 4503 a, g dbSNP:141461351
4505 4505 c, t dbSNP:143236717
4506 4506 a, g dbSNP:376207220
4510 4510 c, t dbSNP:370889837
4511 4511 a, g dbSNP:774071774
4512 4512 a, c dbSNP:761599931
4520 4520 a, g dbSNP:61745210
4521 4521 c, t dbSNP:750713205
4526 4526 c, t dbSNP:756120841
4535 4535 c, g dbSNP:766446706
4535 4535 -, g dbSNP:587779746
4541 4541 a, g dbSNP:753891391
4544 4544 g, t dbSNP:755486688
4546 4546 a, g dbSNP:779570779
4547 4547 c, t dbSNP:549950885
4560 4560 c, t dbSNP:758892744
4561 4561 a, g dbSNP:780970034
4563 4563 a, c dbSNP:745575926
4565 4565 c, t dbSNP:769362465
4566 4566 g, t dbSNP:775015868
4567 4567 a, t dbSNP:748759595
4582 4582 a, g dbSNP:373500669
4586 4586 a, g dbSNP:774335434
4589 4589 c, t dbSNP:568203974
4598 4598 c, t dbSNP:139903653
4601 4601 c, g, t dbSNP:141783755
4603 4603 c, g dbSNP:760906582
4604 4604 c, t dbSNP:571692142
4618 4618 c, t dbSNP:370838091
4619 4619 a, g dbSNP:759759957
4620 4620 c, t dbSNP:765827636
4622 4622 c, g dbSNP:138412834
4627 4627 a, g dbSNP:758804576
4630 4630 c, t dbSNP:778160923
4635 4635 a, g dbSNP:142788313
4649 4649 c, t dbSNP:755734669
4653 4653 a, t dbSNP:34870395
4654 4654 c, t dbSNP:138181857
4659 4659 a, g, t dbSNP:768210321
4664 4664 c, t dbSNP:748119553
4682 4682 c, t dbSNP:61747988
4685 4685 a, g dbSNP:773006123
4691 4691 a, g dbSNP:373910693
4696 4696 -, ctt dbSNP:779460018
4703 4703 c, t dbSNP:182287119
4704 4704 a, g dbSNP:567836947
4724 4724 c, t dbSNP:776777663
4730 4730 a, g dbSNP:368163089
4739 4739 c, g dbSNP:563086310
4743 4743 a, g dbSNP:752856754
4754 4754 c, t dbSNP:150010654
4757 4757 a, g dbSNP:764521196
4758 4758 c, t dbSNP:542516057
4771 4771 c, t dbSNP:757628046
4772 4772 a, c, g dbSNP:779739760
4778 4778 c, t dbSNP:2068129
4783 4783 a, c, t dbSNP:570186838
4784 4784 a, g dbSNP:527651886
4790 4790 a, g dbSNP:61738955
4794 4794 c, t dbSNP:113347228
4806 4806 a, g dbSNP:370174322
4814 4814 a, g dbSNP:746810545
4816 4816 c, t dbSNP:762698567
4817 4817 a, g dbSNP:776881575
4818 4818 c, t dbSNP:746048984
4820 4820 c, t dbSNP:770164775
4828 4828 c, t dbSNP:758724418
4829 4829 a, g dbSNP:374125873
4850 4850 a, g dbSNP:556299458
4852 4852 a, g dbSNP:367764610
4854 4854 c, t dbSNP:774777278
4855 4855 a, g dbSNP:762211408
4857 4857 a, c dbSNP:767808574
4866 4866 a, g dbSNP:750814930
4875 4875 c, g dbSNP:754572827
4886 4886 a, g dbSNP:764877126
4890 4890 a, g dbSNP:139214813
4913 4913 c, t dbSNP:757908002
4915 4915 c, t dbSNP:777745107
4916 4916 a, g dbSNP:746960777
4919 4919 a, c dbSNP:757252042
4921 4921 c, g dbSNP:781086610
4937 4937 c, t dbSNP:745670548
4954 4954 a, c dbSNP:770072973
4956 4956 c, t dbSNP:775920998
4963 4963 c, t dbSNP:766639614
4988 4988 c, t dbSNP:749373437
4990 4990 g, t dbSNP:3210165
5006 5006 a, g dbSNP:768663672
5012 5012 a, g dbSNP:371430687
5029 5029 a, g dbSNP:762183842
5046 5046 c, g dbSNP:375949587
5051 5051 c, t dbSNP:550054527
5054 5054 c, t dbSNP:768949418
5058 5058 -, c dbSNP:747262317
5066 5066 a, g dbSNP:778806657
5071 5071 a, g dbSNP:544895806
5093 5093 a, g dbSNP:772566253
5099 5099 c, t dbSNP:372621575
5114 5114 a, g, t dbSNP:146620657
5134 5134 a, g dbSNP:777085838
5144 5144 a, g dbSNP:753890440
5152 5152 a, c dbSNP:762465807
5163 5163 a, g dbSNP:763822415
5164 5164 c, g dbSNP:750965814
5171 5171 c, g dbSNP:761451340
5173 5173 a, g dbSNP:140177120
5179 5179 c, t dbSNP:190027529
5186 5186 a, g dbSNP:760636496
5198 5198 c, t dbSNP:766430210
5210 5210 c, t dbSNP:753507388
5231 5231 a, c, g dbSNP:754864354
5233 5233 c, t dbSNP:541564441
5234 5234 a, t dbSNP:753008910
5238 5238 a, g dbSNP:758650746
5247 5247 a, g, t dbSNP:777781055
5253 5253 a, g dbSNP:369339813
5257 5257 a, g dbSNP:149841055
5260 5260 a, g dbSNP:746202741
5265 5265 a, g dbSNP:770242254
5266 5266 c, t dbSNP:773843930
5271 5271 g, t dbSNP:747758337
5276 5276 c, t dbSNP:771869774
5277 5277 a, g dbSNP:772787830
5288 5288 a, g dbSNP:760264273
5293 5293 a, g dbSNP:528688757
5297 5297 c, t dbSNP:776682804
5299 5299 a, g dbSNP:759224463
5300 5300 c, t dbSNP:145867693
5301 5301 a, c, g dbSNP:546855765
5309 5309 a, g dbSNP:764306695
5314 5314 a, g dbSNP:751635758
5317 5317 a, c dbSNP:757383409
5332 5332 c, t dbSNP:781527504
5333 5333 a, c dbSNP:148922487
5334 5334 a, g dbSNP:756610931
5336 5336 a, c, t dbSNP:189662115
5337 5337 a, g dbSNP:771781497
5344 5344 a, c, g dbSNP:138020626
5352 5352 a, g dbSNP:746497588
5365 5365 a, c dbSNP:149518409
5368 5368 a, g dbSNP:569199026
5372 5372 -, tga dbSNP:771741082
5376 5376 -, gac dbSNP:374755339
5378 5378 c, t dbSNP:759473238
5379 5379 a, g dbSNP:765101364
5381 5381 -, cga dbSNP:113820273
5381 5381 c, t dbSNP:775201232
5382 5382 a, g dbSNP:374680141
5390 5390 c, t dbSNP:368980689
5391 5391 a, g dbSNP:528801298
5403 5403 a, g dbSNP:751827621
5412 5412 a, c dbSNP:147690017
5414 5414 c, t dbSNP:144279763
5415 5415 a, g dbSNP:376495346
5429 5429 c, t dbSNP:555132244
5430 5430 a, g dbSNP:370789207
5435 5435 a, g dbSNP:754248704
5438 5438 a, g dbSNP:755445588
5447 5447 c, t dbSNP:533990759
5458 5458 c, t dbSNP:777539420
5460 5460 c, g dbSNP:558541490
5461 5461 c, t dbSNP:142466273
5462 5462 a, g dbSNP:577067899
5465 5465 c, t dbSNP:537400492
5466 5466 a, g dbSNP:769767772
5467 5467 c, t dbSNP:201137071
5468 5468 c, t dbSNP:146982427
5469 5469 a, g dbSNP:768478175
5487 5487 a, t dbSNP:387907143
5489 5489 c, g dbSNP:774161575
5490 5490 c, g dbSNP:762046160
5491 5491 c, t dbSNP:767643077
5496 5496 a, c dbSNP:750447037
5510 5510 c, t dbSNP:760729997
5511 5511 a, g dbSNP:766977678
5515 5515 a, g dbSNP:574141489
5522 5522 a, g dbSNP:374294418
5534 5534 a, c dbSNP:779375614
5536 5536 a, g dbSNP:753020972
5556 5556 g, t dbSNP:138149494
5563 5563 a, g dbSNP:751043203
5580 5580 c, t dbSNP:745372243
5581 5581 a, g dbSNP:376758952
5583 5583 a, g dbSNP:779934605
5589 5589 c, g dbSNP:749183221
5595 5595 a, g dbSNP:768603214
5596 5596 a, g dbSNP:139181534
5604 5604 a, c dbSNP:754572535
5606 5606 g, t dbSNP:761515014
5618 5618 c, g dbSNP:772330993
5619 5619 c, t dbSNP:773361750
5621 5621 c, t dbSNP:760779848
5630 5630 g, t dbSNP:766529307
5639 5639 c, t dbSNP:753997383
5663 5663 a, g dbSNP:760066210
5665 5665 a, g dbSNP:765843970
5682 5682 c, t dbSNP:753101362
5686 5686 a, g dbSNP:758748419
5691 5691 c, t dbSNP:766931727
5692 5692 a, g dbSNP:374035954
5700 5700 c, g dbSNP:755793592
5703 5703 c, g dbSNP:779490460
5704 5704 a, c, g dbSNP:202194222
5705 5705 -, c dbSNP:35441529
5705 5705 c, g, t dbSNP:141738728
5714 5714 a, c, t dbSNP:150153898
5715 5715 a, c, g dbSNP:183921218
5722 5722 c, g dbSNP:771295398
5734 5734 a, g dbSNP:776790365
5738 5738 a, g dbSNP:759757755
5744 5744 a, g dbSNP:138658149
5747 5747 c, t dbSNP:755801421
5748 5748 a, g dbSNP:200305796
5751 5751 c, t dbSNP:764324632
5753 5753 g, t dbSNP:565400330
5763 5763 c, g dbSNP:751973216
5773 5773 a, g dbSNP:755701702
5775 5775 a, t dbSNP:766023993
5778 5778 a, g dbSNP:753341293
5786 5786 c, t dbSNP:754539925
5789 5789 c, t dbSNP:146192623
5792 5792 c, t dbSNP:747997398
5794 5794 a, g dbSNP:758385169
5795 5795 c, t dbSNP:532832962
5796 5796 a, g dbSNP:551038862
5803 5803 c, g dbSNP:113818462
5804 5804 a, t dbSNP:777054816
5809 5809 a, g dbSNP:745924035
5810 5810 g, t dbSNP:770037041
5813 5813 a, c dbSNP:775668266
5831 5831 c, t dbSNP:562880858
5832 5832 a, g dbSNP:764671385
5838 5838 c, t dbSNP:774509236
5841 5841 g, t dbSNP:762232098
5852 5852 c, t dbSNP:376113162
5854 5854 a, c dbSNP:753537321
5867 5867 g, t dbSNP:759014168
5868 5868 c, t dbSNP:764604817
5876 5876 c, t dbSNP:752265365
5881 5881 a, g dbSNP:368646411
5890 5890 a, g dbSNP:758204258
5898 5898 c, t dbSNP:530153456
5899 5899 a, g dbSNP:751391187
5901 5901 a, c dbSNP:757171511
5912 5912 g, t dbSNP:778300670
5921 5921 c, g, t dbSNP:139174766
5935 5935 a, g dbSNP:747819482
5939 5939 c, g dbSNP:779936373
5940 5940 a, g dbSNP:749387520
5946 5946 c, t dbSNP:772262995
5953 5953 a, g dbSNP:769039505
5956 5956 c, g dbSNP:774896570
5958 5958 a, c dbSNP:548670876
5960 5960 c, t dbSNP:142499766
5961 5961 a, g dbSNP:772464386
5963 5963 a, g, t dbSNP:372334858
5978 5978 a, g, t dbSNP:145972566
6007 6007 a, g dbSNP:762587131
6011 6011 c, t dbSNP:533926238
6029 6029 c, t dbSNP:376317262
6030 6030 a, g dbSNP:751590307
6043 6043 a, g dbSNP:757294414
6047 6047 c, g dbSNP:781082506
6056 6056 a, c dbSNP:750254264
6058 6058 a, g dbSNP:756220726
6079 6079 c, t dbSNP:780386457
6080 6080 c, t dbSNP:112703040
6085 6085 a, g dbSNP:768828821
6086 6086 a, g dbSNP:779360395
6092 6092 a, g dbSNP:748612113
6102 6102 c, t dbSNP:772582709
6104 6104 c, t dbSNP:551034452
6107 6107 c, t dbSNP:142416998
6108 6108 -, c dbSNP:754221406
6108 6108 g, t dbSNP:786205584
6113 6113 -, tcc dbSNP:759872393
6118 6118 -, a dbSNP:765671814
6120 6120 -, aggat dbSNP:753203999
6123 6123 a, c dbSNP:769317884
6124 6124 a, c dbSNP:775265871
6127 6127 -, gag dbSNP:758430867
6127 6127 a, g dbSNP:762342896
6130 6130 c, t dbSNP:763660892
6131 6131 -, gt dbSNP:777850626
6131 6131 a, t dbSNP:570594202
6133 6133 -, ttg dbSNP:751638731
6133 6133 c, t dbSNP:368420323
6134 6134 a, g dbSNP:151317970
6139 6139 -, gatt dbSNP:757497248
6139 6139 c, g dbSNP:750234084
6141 6141 -, ta dbSNP:781327420
6145 6145 a, g dbSNP:755994912
6149 6149 a, g dbSNP:556211395
6157 6157 a, g dbSNP:754129097
6161 6161 a, g dbSNP:755185300
6163 6163 a, g dbSNP:574079611
6165 6165 a, g dbSNP:748232008
6167 6167 a, g dbSNP:535102895
6167 6167 -, g dbSNP:749055122
6175 6175 c, t dbSNP:778311119
6177 6177 c, t dbSNP:747316819
6209 6209 c, t dbSNP:771370514
6210 6210 a, g dbSNP:776894668
6212 6212 a, g dbSNP:748924215
6213 6213 a, g dbSNP:768433749
6219 6219 a, c dbSNP:773929325
6220 6220 a, g dbSNP:761473119
6223 6223 a, g dbSNP:767544238
6229 6229 c, t dbSNP:139429265
6230 6230 a, g dbSNP:371980859
6231 6231 c, t dbSNP:766156282
6239 6239 a, g dbSNP:753595827
6240 6240 c, t dbSNP:755163871
6245 6245 c, g dbSNP:147444658
6254 6254 c, t dbSNP:752762142
6272 6272 c, t dbSNP:758522825
6273 6273 c, g dbSNP:778225695
6280 6280 c, t dbSNP:375017809
6281 6281 a, g dbSNP:757730301
6284 6284 a, g dbSNP:571819028
6285 6285 a, g dbSNP:746220769
6290 6290 c, g dbSNP:768415267
6296 6296 c, g dbSNP:778762659
6314 6314 a, g dbSNP:369259342
6315 6315 c, t dbSNP:747638224
6327 6327 a, g, t dbSNP:771748834
6328 6328 g, t dbSNP:760611211
6329 6329 a, g dbSNP:770779367
6335 6335 a, g dbSNP:776483400
6374 6374 c, t dbSNP:545622588
6379 6379 c, t dbSNP:149978361
6380 6380 a, g dbSNP:373301793
6386 6386 a, g dbSNP:763197178
6389 6389 a, c, g dbSNP:3812233
6407 6407 a, g dbSNP:757712554
6478 6478 a, g dbSNP:781613431
6492 6492 g, t dbSNP:750782638
6500 6500 a, g dbSNP:147679171
6504 6504 c, g, t dbSNP:191761610
6508 6508 c, g dbSNP:747762304
6513 6513 a, g dbSNP:771871664
6518 6518 c, g dbSNP:768818067
6541 6541 a, g dbSNP:777278111
6552 6552 a, g dbSNP:563193596
6566 6566 a, g dbSNP:770890026
6584 6584 c, t dbSNP:773023212
6585 6585 a, g dbSNP:530084903
6586 6586 c, t dbSNP:769541604
6596 6596 a, g dbSNP:775289925
6617 6617 a, c dbSNP:763106833
6622 6622 c, g dbSNP:764230499
6640 6640 a, g dbSNP:751652188
6653 6653 c, t dbSNP:761854448
6654 6654 g, t dbSNP:548603375
6662 6662 a, c, g dbSNP:377350616
6667 6667 c, t dbSNP:756720427
6679 6679 a, g dbSNP:780516083
6680 6680 a, g dbSNP:527775865
6684 6684 a, c dbSNP:758120346
6687 6687 c, t dbSNP:777350143
6689 6689 c, t dbSNP:746506227
6693 6693 a, c, g dbSNP:766875935
6696 6696 a, g dbSNP:745761087
6710 6710 c, g dbSNP:769738505
6712 6712 c, t dbSNP:775203171
6713 6713 a, g dbSNP:142956583
6716 6716 a, c dbSNP:768906544
6717 6717 c, t dbSNP:774480576
6726 6726 c, g, t dbSNP:761917637
6731 6731 c, t dbSNP:773447338
6732 6732 a, g dbSNP:761204913
6739 6739 c, t dbSNP:766996279
6752 6752 a, g dbSNP:754242891
6771 6771 a, t dbSNP:150698489
6778 6778 c, g dbSNP:763772159
6785 6785 c, t dbSNP:368868154
6786 6786 a, g dbSNP:756960968
6792 6792 c, t dbSNP:371461578
6793 6793 a, g dbSNP:146468586
6797 6797 a, g dbSNP:745389580
6800 6800 a, g dbSNP:756043689
6801 6801 c, t dbSNP:780022429
6804 6804 a, c dbSNP:529165553
6808 6808 c, t dbSNP:375389356
6809 6809 a, g dbSNP:749057713
6812 6812 c, t dbSNP:183572405
6824 6824 a, g dbSNP:774231619
6837 6837 a, g dbSNP:748269099
6839 6839 a, g dbSNP:772351256
6842 6842 a, g dbSNP:550015240
6847 6847 c, t dbSNP:760896148
6855 6855 a, t dbSNP:766971912
6860 6860 g, t dbSNP:777318343
6869 6869 c, t dbSNP:760120788
6872 6872 c, g dbSNP:568017425
6884 6884 a, c dbSNP:753123473
6909 6909 c, t dbSNP:756796465
6911 6911 c, t dbSNP:367616374
6949 6949 a, g dbSNP:749918218
6955 6955 a, g dbSNP:535044026
6956 6956 c, t dbSNP:779930852
6957 6957 a, g dbSNP:753674523
6991 6991 a, g dbSNP:777151757
7013 7013 a, c dbSNP:570884566
7055 7055 -, aaag dbSNP:567421133
7102 7102 c, g dbSNP:774413188
7108 7108 a, g dbSNP:188107152
7126 7126 -, t dbSNP:370046956
7127 7127 g, t dbSNP:565384835
7136 7136 -, t dbSNP:376411414
7178 7178 a, g dbSNP:767184498
7179 7179 c, t dbSNP:539499874
7191 7191 c, t dbSNP:573082485
7199 7199 a, g dbSNP:535701795
7210 7210 a, g dbSNP:760431796
7229 7229 c, t dbSNP:763769394
7240 7240 a, g dbSNP:190173514
7267 7267 a, g dbSNP:577336040
7275 7275 c, t dbSNP:754164564
7325 7325 a, g dbSNP:544504579
7345 7345 c, t dbSNP:556846733
7420 7420 a, g dbSNP:757700329
7448 7448 c, g dbSNP:779144270
7454 7454 c, g dbSNP:575217434
7525 7525 a, g dbSNP:139857885
7541 7541 a, g dbSNP:531525517
7549 7549 -, a dbSNP:759558356
7559 7559 c, t dbSNP:758813647
7578 7578 c, t dbSNP:550131581
7587 7587 c, t dbSNP:575277747
7603 7603 a, g dbSNP:527713858
7611 7611 a, g dbSNP:149835997
7620 7620 a, g dbSNP:146453054
7675 7675 a, g dbSNP:182437712
7682 7682 a, g dbSNP:7765775
7683 7683 c, t dbSNP:377406756
7713 7713 a, g dbSNP:549575132
7732 7732 c, t dbSNP:139366986
7769 7769 c, t dbSNP:371782923
7882 7882 -, a dbSNP:770195764
7890 7890 a, g dbSNP:186673230
7895 7895 -, aaaa dbSNP:749328123
7895 7895 -, a dbSNP:200471587
7977 7977 c, t dbSNP:768872927
7998 7998 a, g dbSNP:781449234
8002 8002 c, t dbSNP:748312179
8038 8038 c, t dbSNP:529147371
8041 8041 a, t dbSNP:11858
8058 8058 -, a dbSNP:557239005
8118 8118 a, g dbSNP:565319277
8146 8146 -, aaaaaaa dbSNP:545023901
8153 8153 a, g dbSNP:191127408
8155 8155 a, g dbSNP:557803073
8169 8169 -, tt dbSNP:774742301
8186 8186 c, t dbSNP:148830183
8210 8210 a, g dbSNP:538397336
8250 8250 g, t dbSNP:556787824
8261 8261 c, t dbSNP:759536456

Target ORF information:

RefSeq Version XM_005267069
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu70526
Accession Version XM_011535984.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5949bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AT-rich interactive domain-containing protein 1B isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1138..>1338(+)
Misc Feature(2)2494..2769(+)
Misc Feature(3)5110..5880(+)
Position Chain Variation Link
19 19 -, ggc dbSNP:542021607
21 21 -, ggc dbSNP:555730413
53 53 c, t dbSNP:748273011
78 78 c, t dbSNP:549289491
135 135 c, t dbSNP:772315737
148 148 a, g dbSNP:773467188
152 152 c, g dbSNP:760718156
161 161 c, t dbSNP:766500898
176 176 c, g dbSNP:776996949
189 189 a, c, g dbSNP:760090226
198 198 c, g, t dbSNP:753125848
208 208 g, t dbSNP:767247521
210 210 c, t dbSNP:750158289
213 213 c, t dbSNP:755682475
216 216 c, g dbSNP:779622340
219 219 c, g dbSNP:753662365
222 222 c, t dbSNP:754967908
224 224 a, g dbSNP:778536440
234 234 c, t dbSNP:747947340
239 239 c, t dbSNP:771908741
250 250 a, g dbSNP:199948752
261 261 c, t dbSNP:747295062
264 264 c, t dbSNP:770927920
265 265 c, g dbSNP:776783024
268 268 a, g dbSNP:759909326
272 272 a, c, g dbSNP:770362902
277 277 c, g dbSNP:763387163
279 279 c, g dbSNP:764620171
283 283 c, t dbSNP:750031315
294 294 c, t dbSNP:760419444
298 298 -, cgc, cgccgc dbSNP:572236007
299 299 -, cgccgc dbSNP:754447727
299 299 -, cgc dbSNP:766249098
303 303 a, g dbSNP:765760904
307 307 c, t dbSNP:753422144
309 309 a, g dbSNP:754489682
310 310 -, cgccgt dbSNP:778413404
311 311 a, c dbSNP:778891019
312 312 -, gccgtcgca dbSNP:752295930
313 313 -, cgc dbSNP:587779738
313 313 a, c dbSNP:752684703
315 315 -, ccg dbSNP:587779739
333 333 -, ggcggc dbSNP:757953295
333 333 -, ggc dbSNP:777545000
340 340 a, g dbSNP:587779740
362 362 g, t dbSNP:758181047
383 383 -, tgggct dbSNP:747320636
392 392 c, g dbSNP:777545755
399 399 c, t dbSNP:747174363
404 404 a, g dbSNP:771204934
406 406 a, g dbSNP:781091058
414 414 c, t dbSNP:745929521
415 415 c, g dbSNP:769813347
421 421 a, g dbSNP:776060836
422 422 a, c dbSNP:763559359
428 428 c, g dbSNP:769085274
429 429 a, g dbSNP:774880058
430 430 g, t dbSNP:760366486
432 432 a, c dbSNP:766027272
440 440 c, t dbSNP:753486869
451 451 -, agg dbSNP:771434224
453 453 c, g dbSNP:759078059
455 455 a, c, g dbSNP:764716697
457 457 c, t dbSNP:758342480
458 458 a, c dbSNP:763825843
461 461 c, g dbSNP:751389585
462 462 a, g dbSNP:757043988
464 464 a, c dbSNP:781454908
474 474 c, t dbSNP:746135430
487 487 c, t dbSNP:200682868
493 493 a, g dbSNP:780293502
495 495 a, g dbSNP:749761849
496 496 g, t dbSNP:769316078
497 497 g, t dbSNP:775035352
498 498 c, t dbSNP:748498440
517 517 a, g dbSNP:145785954
518 518 c, t dbSNP:775164729
520 520 a, g dbSNP:762428637
524 524 a, c dbSNP:763652332
526 526 a, g dbSNP:147794292
538 538 a, c dbSNP:761668764
540 540 a, g dbSNP:267600875
541 541 a, c dbSNP:767293145
554 554 a, g dbSNP:750214622
557 557 c, t dbSNP:141260832
563 563 a, g dbSNP:147088160
586 586 a, c dbSNP:754167205
590 590 a, g dbSNP:539811282
596 596 c, t dbSNP:779142775
597 597 a, g, t dbSNP:142939952
600 600 c, t dbSNP:758854488
607 607 a, g dbSNP:778162933
613 613 c, t dbSNP:747306459
614 614 a, g dbSNP:570309056
615 615 c, t dbSNP:779668926
634 634 c, t dbSNP:749006707
635 635 a, g dbSNP:768096043
636 636 c, g dbSNP:773754437
643 643 a, g dbSNP:17318151
644 644 c, t dbSNP:756050584
647 647 c, g dbSNP:773247445
658 658 a, c, t dbSNP:143370913
659 659 a, g dbSNP:754042537
666 666 c, t dbSNP:759855548
667 667 a, g dbSNP:765362265
670 670 g, t dbSNP:201244213
678 678 c, t dbSNP:752755002
679 679 a, g dbSNP:151093357
682 682 a, g dbSNP:778121932
687 687 a, g dbSNP:752168831
705 705 c, t dbSNP:751379874
716 716 c, g dbSNP:750753615
720 720 a, g dbSNP:754892486
724 724 a, g dbSNP:756517736
726 726 a, g dbSNP:778414103
727 727 g, t dbSNP:201653711
735 735 c, t dbSNP:372248435
749 749 c, t dbSNP:148382861
767 767 a, g dbSNP:761867629
771 771 a, g dbSNP:772203422
780 780 c, t dbSNP:773640553
790 790 a, g dbSNP:571695301
795 795 -, c dbSNP:138196985
801 801 a, c, g dbSNP:766599882
802 802 c, t dbSNP:141395733
809 809 a, g dbSNP:763818779
818 818 -, gca dbSNP:746407600
823 823 c, t dbSNP:751317747
824 824 c, t dbSNP:779239519
827 827 a, c, t dbSNP:199949701
828 828 a, g dbSNP:370068335
829 829 c, t dbSNP:372781930
835 835 c, t dbSNP:201038527
837 837 a, g dbSNP:756099753
839 839 c, g, t dbSNP:779895443
846 846 a, c, g dbSNP:146312104
850 850 c, t dbSNP:751320376
853 853 c, t dbSNP:748370897
857 857 c, t dbSNP:772078777
858 858 a, g dbSNP:376964478
861 861 c, t dbSNP:761043177
864 864 c, g dbSNP:771442003
867 867 c, t dbSNP:139595304
868 868 c, t dbSNP:387907142
872 872 a, g dbSNP:538689102
878 878 a, c, t dbSNP:759934770
879 879 c, t dbSNP:751192841
883 883 c, t dbSNP:372690657
884 884 c, t dbSNP:558155146
885 885 a, g, t dbSNP:374876774
896 896 c, t dbSNP:767255855
897 897 a, g dbSNP:142897795
911 911 a, g dbSNP:749173157
929 929 c, g dbSNP:765810222
935 935 a, t dbSNP:753748958
938 938 c, t dbSNP:376595068
941 941 c, g dbSNP:764967238
942 942 c, t dbSNP:146240413
943 943 a, g dbSNP:573836252
944 944 a, g dbSNP:778044758
950 950 c, g dbSNP:778362623
960 960 a, t dbSNP:139125255
963 963 c, t dbSNP:149931590
973 973 a, g dbSNP:781146492
974 974 c, t dbSNP:746327988
976 976 a, c dbSNP:770455355
980 980 a, g dbSNP:776187102
985 985 a, g dbSNP:749657274
1001 1001 c, t dbSNP:559304585
1019 1019 c, t dbSNP:751748335
1029 1029 a, g dbSNP:757443510
1031 1031 a, c dbSNP:781293616
1041 1041 c, g dbSNP:745913690
1050 1050 a, g dbSNP:761710707
1061 1061 c, t dbSNP:767620420
1062 1062 a, t dbSNP:750738896
1074 1074 c, g dbSNP:756195424
1076 1076 c, t dbSNP:373508866
1077 1077 a, g dbSNP:201290874
1083 1083 a, g dbSNP:6912981
1094 1094 c, t dbSNP:779512205
1104 1104 a, c dbSNP:376143843
1110 1110 g, t dbSNP:772549124
1111 1111 a, g dbSNP:780820426
1113 1113 a, g dbSNP:745528262
1116 1116 c, t dbSNP:148700132
1117 1117 a, g dbSNP:775004900
1124 1124 c, t dbSNP:762908553
1125 1125 a, g dbSNP:370910542
1137 1137 c, g dbSNP:774397054
1138 1138 a, g dbSNP:374648940
1142 1142 a, g dbSNP:368202669
1145 1145 a, g dbSNP:762401544
1152 1152 a, g dbSNP:750615874
1154 1154 c, t dbSNP:774701560
1155 1155 a, g dbSNP:551597753
1156 1156 a, c dbSNP:753933273
1158 1158 c, g dbSNP:755131525
1160 1160 c, t dbSNP:779271100
1161 1161 a, g dbSNP:753317592
1175 1175 a, g dbSNP:758625736
1176 1176 c, t dbSNP:370364530
1178 1178 c, t dbSNP:563771544
1179 1179 a, g dbSNP:3734441
1190 1190 g, t dbSNP:779724084
1194 1194 c, t dbSNP:549352027
1201 1201 c, g dbSNP:768277043
1203 1203 a, g dbSNP:374696557
1204 1204 a, g dbSNP:748129248
1205 1205 c, g dbSNP:367698478
1206 1206 a, g dbSNP:780611617
1208 1208 a, c, g dbSNP:567668222
1216 1216 c, t dbSNP:534990481
1227 1227 a, t dbSNP:766684321
1230 1230 c, t dbSNP:776967149
1234 1234 c, t dbSNP:759533117
1237 1237 a, g dbSNP:765365713
1243 1243 a, g dbSNP:753092220
1247 1247 a, g dbSNP:763191352
1256 1256 a, g dbSNP:764402992
1274 1274 c, t dbSNP:751891035
1276 1276 a, g dbSNP:757669934
1278 1278 a, g dbSNP:779669164
1282 1282 a, g dbSNP:748973290
1284 1284 a, c dbSNP:546849919
1291 1291 a, t dbSNP:372730587
1300 1300 c, t dbSNP:757549352
1304 1304 c, t dbSNP:754080772
1305 1305 a, g dbSNP:190653632
1314 1314 c, t dbSNP:541757080
1319 1319 a, g dbSNP:778467052
1337 1337 c, g, t dbSNP:762229592
1339 1339 a, c dbSNP:758038225
1342 1342 c, t dbSNP:777845775
1344 1344 c, t dbSNP:746951045
1345 1345 a, g dbSNP:147784000
1350 1350 a, g dbSNP:781067022
1356 1356 a, g dbSNP:368362137
1364 1364 c, t dbSNP:770027363
1379 1379 a, g dbSNP:780321051
1385 1385 g, t dbSNP:141219657
1392 1392 c, g, t dbSNP:768672743
1400 1400 a, g dbSNP:761921020
1404 1404 a, c dbSNP:772604684
1405 1405 c, g dbSNP:773646023
1406 1406 c, t dbSNP:201156721
1412 1412 c, t dbSNP:761093701
1416 1416 c, t dbSNP:766654973
1418 1418 a, g dbSNP:752341983
1419 1419 c, g dbSNP:778702667
1421 1421 a, g dbSNP:762721043
1426 1426 c, t dbSNP:114201726
1435 1435 a, g dbSNP:556939212
1444 1444 c, t dbSNP:756767804
1450 1450 c, t dbSNP:767477226
1451 1451 c, t dbSNP:150140314
1452 1452 a, g dbSNP:374691223
1457 1457 a, g dbSNP:779733858
1470 1470 a, g dbSNP:749470868
1473 1473 c, g dbSNP:755160504
1493 1493 c, g dbSNP:779154161
1496 1496 a, g dbSNP:748209235
1500 1500 c, t dbSNP:546767328
1516 1516 a, c, g dbSNP:772107512
1523 1523 c, t dbSNP:141030037
1526 1526 a, g, t dbSNP:771280525
1527 1527 c, t dbSNP:760022925
1528 1528 a, g dbSNP:150249745
1529 1529 a, g dbSNP:774205020
1532 1532 c, t dbSNP:527698870
1533 1533 a, g dbSNP:368988882
1544 1544 a, g dbSNP:766942261
1547 1547 a, g dbSNP:750324294
1548 1548 c, t dbSNP:756036121
1550 1550 g, t dbSNP:138934947
1552 1552 a, c dbSNP:753607638
1573 1573 c, t dbSNP:572020611
1574 1574 a, c dbSNP:761388338
1580 1580 c, t dbSNP:749077422
1581 1581 a, g dbSNP:772564622
1589 1589 a, g dbSNP:760280267
1611 1611 c, t dbSNP:766290096
1612 1612 a, g dbSNP:145635490
1623 1623 c, t dbSNP:528889230
1624 1624 a, g dbSNP:542660265
1626 1626 c, t dbSNP:752913095
1645 1645 a, g dbSNP:564110998
1647 1647 a, c dbSNP:778099902
1653 1653 g, t dbSNP:376497842
1663 1663 a, g dbSNP:757473942
1669 1669 a, t dbSNP:781763581
1672 1672 c, g dbSNP:138254872
1679 1679 a, g dbSNP:770228055
1682 1682 a, g dbSNP:780312215
1692 1692 -, gtg dbSNP:201979665
1702 1702 a, t dbSNP:749701314
1715 1715 g, t dbSNP:771600870
1723 1723 a, t dbSNP:772975321
1732 1732 c, t dbSNP:760095080
1734 1734 g, t dbSNP:770428988
1746 1746 a, g dbSNP:751177927
1755 1755 c, g dbSNP:146077641
1758 1758 c, t dbSNP:764978487
1775 1775 c, t dbSNP:752405476
1799 1799 g, t dbSNP:762855776
1803 1803 a, g dbSNP:764210072
1806 1806 a, g dbSNP:587779742
1810 1810 a, g, t dbSNP:531418921
1818 1818 c, t dbSNP:750914446
1826 1826 a, c, g dbSNP:756655213
1845 1845 c, t dbSNP:374572368
1846 1846 a, g dbSNP:377633743
1859 1859 a, c dbSNP:549928918
1861 1861 g, t dbSNP:746676470
1867 1867 a, g dbSNP:770377920
1869 1869 c, g dbSNP:148749268
1897 1897 a, g dbSNP:558990663
1904 1904 c, t dbSNP:556334402
1936 1936 a, g dbSNP:536981558
1939 1939 c, t dbSNP:371061369
1940 1940 a, g dbSNP:751699597
1981 1981 c, g dbSNP:759590636
1998 1998 c, t dbSNP:190378545
2026 2026 g, t dbSNP:773631262
2029 2029 a, c dbSNP:760765281
2031 2031 c, t dbSNP:144894118
2032 2032 a, g dbSNP:34786733
2033 2033 a, g dbSNP:755539131
2054 2054 c, t dbSNP:370071892
2070 2070 a, c dbSNP:373256784
2090 2090 a, g dbSNP:550604212
2096 2096 c, g dbSNP:780818465
2107 2107 a, c dbSNP:745524201
2112 2112 c, g dbSNP:755525381
2114 2114 a, t dbSNP:139620600
2117 2117 c, t dbSNP:377351099
2118 2118 a, g dbSNP:144558683
2119 2119 c, g dbSNP:779048797
2120 2120 c, t dbSNP:370190261
2121 2121 a, g dbSNP:537901478
2128 2128 a, c dbSNP:773510355
2131 2131 a, c dbSNP:760973888
2133 2133 a, g dbSNP:566567531
2135 2135 c, t dbSNP:750810656
2136 2136 a, g dbSNP:560450902
2139 2139 c, t dbSNP:765720893
2140 2140 a, g dbSNP:527731946
2142 2142 a, c dbSNP:763236835
2143 2143 a, g dbSNP:764460073
2148 2148 a, g dbSNP:758749885
2157 2157 a, g dbSNP:750032487
2170 2170 a, g dbSNP:758377419
2174 2174 c, t dbSNP:777905171
2182 2182 -, atg dbSNP:762047886
2183 2183 c, t dbSNP:746808513
2186 2186 c, t dbSNP:371523255
2192 2192 c, t dbSNP:540277176
2210 2210 c, t dbSNP:746092285
2211 2211 c, t dbSNP:769820008
2212 2212 c, t dbSNP:775582196
2223 2223 -, agc dbSNP:772325958
2223 2223 a, g dbSNP:749413486
2224 2224 a, g dbSNP:769132694
2226 2226 a, g dbSNP:774783574
2229 2229 c, t dbSNP:147853607
2230 2230 a, g dbSNP:375023508
2235 2235 a, t dbSNP:776294122
2254 2254 a, c, t dbSNP:368880015
2256 2256 c, t dbSNP:752231248
2257 2257 a, g dbSNP:570798143
2275 2275 a, g dbSNP:763525655
2277 2277 c, g dbSNP:751465997
2278 2278 a, t dbSNP:757176899
2282 2282 a, g dbSNP:139407686
2288 2288 a, g dbSNP:750198878
2295 2295 a, t dbSNP:534113119
2308 2308 a, c dbSNP:755963909
2318 2318 a, c dbSNP:780181329
2364 2364 c, t dbSNP:754071347
2383 2383 a, g dbSNP:754998837
2433 2433 a, g dbSNP:373653398
2456 2456 g, t dbSNP:779243569
2469 2469 a, g dbSNP:752704102
2478 2478 c, t dbSNP:758570139
2481 2481 a, g dbSNP:373641381
2484 2484 a, g dbSNP:747533804
2486 2486 a, g dbSNP:771373121
2490 2490 c, t dbSNP:781714598
2495 2495 c, t dbSNP:746278639
2505 2505 a, g dbSNP:568095755
2514 2514 c, t dbSNP:371828409
2515 2515 a, g dbSNP:761227259
2518 2518 c, t dbSNP:387907144
2524 2524 c, t dbSNP:779598699
2527 2527 a, t dbSNP:771621841
2528 2528 a, c dbSNP:773082217
2533 2533 a, c dbSNP:760633180
2539 2539 c, g dbSNP:766340916
2543 2543 a, g dbSNP:753607488
2545 2545 a, g dbSNP:759432635
2547 2547 c, g dbSNP:765371275
2552 2552 c, t dbSNP:377588212
2554 2554 a, g dbSNP:758353662
2560 2560 a, g dbSNP:774855592
2562 2562 c, t dbSNP:752073815
2563 2563 a, c dbSNP:757809298
2565 2565 g, t dbSNP:781777822
2571 2571 c, t dbSNP:746210543
2572 2572 a, g dbSNP:370283707
2574 2574 a, g dbSNP:778366844
2583 2583 a, g, t dbSNP:374705142
2584 2584 c, t dbSNP:746686035
2589 2589 a, g dbSNP:376995038
2599 2599 c, t dbSNP:387907141
2600 2600 a, g dbSNP:746567959
2604 2604 c, g, t dbSNP:111368751
2605 2605 c, t dbSNP:759186918
2607 2607 c, t dbSNP:61736269
2608 2608 a, g dbSNP:775526039
2613 2613 c, t dbSNP:763270294
2618 2618 a, g dbSNP:764452515
2621 2621 a, g dbSNP:751670059
2624 2624 g, t dbSNP:375581771
2625 2625 c, t dbSNP:181686951
2634 2634 g, t dbSNP:750948289
2685 2685 c, t dbSNP:771166112
2686 2686 a, g dbSNP:756707971
2694 2694 c, t dbSNP:142391292
2706 2706 a, g dbSNP:745412510
2718 2718 a, g dbSNP:769749724
2736 2736 c, g dbSNP:779917726
2742 2742 g, t dbSNP:545017957
2754 2754 a, g dbSNP:61745451
2763 2763 c, t dbSNP:774661225
2768 2768 a, g dbSNP:762153671
2769 2769 a, t dbSNP:772220023
2783 2783 c, t dbSNP:773317331
2784 2784 a, g dbSNP:760721516
2785 2785 c, t dbSNP:766902947
2786 2786 c, t dbSNP:754303482
2787 2787 a, g dbSNP:759836095
2789 2789 a, c dbSNP:765612283
2802 2802 c, t dbSNP:369218715
2803 2803 a, g dbSNP:756872796
2821 2821 c, g dbSNP:780758224
2835 2835 a, g dbSNP:749937918
2853 2853 a, g dbSNP:776425168
2870 2870 c, t dbSNP:759056899
2877 2877 c, t dbSNP:764861177
2878 2878 c, t dbSNP:752639283
2883 2883 a, g dbSNP:762767858
2887 2887 a, g dbSNP:552938708
2889 2889 c, t dbSNP:372186962
2894 2894 a, g dbSNP:145857100
2911 2911 c, g dbSNP:781326777
2923 2923 c, g dbSNP:138482029
2927 2927 a, g dbSNP:756141390
2934 2934 a, t dbSNP:780142651
2937 2937 c, t dbSNP:749430350
2938 2938 c, g dbSNP:547596526
2955 2955 c, t dbSNP:771632801
2956 2956 a, g dbSNP:779536790
2961 2961 g, t dbSNP:748391706
2971 2971 a, g, t dbSNP:141190049
2972 2972 c, t dbSNP:376806897
2976 2976 a, g dbSNP:769609140
2987 2987 a, g dbSNP:574296429
2988 2988 c, t dbSNP:369035728
3002 3002 c, t dbSNP:138218716
3006 3006 c, t dbSNP:373881952
3009 3009 c, t dbSNP:748681838
3012 3012 a, g dbSNP:768227723
3021 3021 c, t dbSNP:559706338
3022 3022 a, g dbSNP:773649998
3027 3027 c, t dbSNP:767486423
3032 3032 c, t dbSNP:772973856
3035 3035 c, t dbSNP:533211077
3041 3041 c, t dbSNP:150196933
3042 3042 a, g dbSNP:766441730
3046 3046 c, t dbSNP:754100748
3047 3047 a, g dbSNP:754960836
3055 3055 a, g dbSNP:138784762
3061 3061 c, t dbSNP:752863054
3065 3065 a, g dbSNP:376071880
3066 3066 c, t dbSNP:370523060
3067 3067 a, g dbSNP:747374301
3069 3069 c, t dbSNP:757646876
3071 3071 c, t dbSNP:779516798
3072 3072 a, c dbSNP:748995523
3080 3080 a, c dbSNP:768013849
3091 3091 a, g dbSNP:773883674
3094 3094 a, c dbSNP:747709980
3096 3096 c, t dbSNP:771988661
3097 3097 a, g dbSNP:773135175
3100 3100 a, g, t dbSNP:760402063
3101 3101 c, t dbSNP:776675533
3111 3111 a, g dbSNP:530602758
3116 3116 c, t dbSNP:759771283
3117 3117 c, t dbSNP:765425489
3119 3119 a, g dbSNP:752811689
3125 3125 c, g dbSNP:374517532
3140 3140 c, t dbSNP:764630192
3146 3146 a, g dbSNP:149389876
3156 3156 a, g dbSNP:200230777
3172 3172 a, g dbSNP:752398721
3173 3173 a, g dbSNP:763740758
3180 3180 c, t dbSNP:368341224
3181 3181 a, g dbSNP:753381410
3185 3185 c, t dbSNP:371538726
3186 3186 a, c, g, t dbSNP:374823620
3192 3192 a, c dbSNP:769769342
3196 3196 a, g, t dbSNP:144029881
3204 3204 c, t dbSNP:769028104
3206 3206 a, g dbSNP:774520303
3211 3211 a, g dbSNP:761809331
3214 3214 c, t dbSNP:387907140
3231 3231 a, g dbSNP:367653751
3240 3240 c, t dbSNP:371872657
3241 3241 a, g dbSNP:199674889
3246 3246 a, g dbSNP:766772916
3247 3247 a, g dbSNP:754234955
3249 3249 a, g dbSNP:757999037
3251 3251 c, g dbSNP:763750480
3257 3257 c, t dbSNP:751015296
3258 3258 a, g dbSNP:756784391
3260 3260 g, t dbSNP:781175942
3265 3265 c, g dbSNP:745841288
3267 3267 a, g dbSNP:755940737
3271 3271 c, t dbSNP:138785718
3272 3272 a, g dbSNP:370064281
3278 3278 a, g dbSNP:768938099
3296 3296 a, g dbSNP:142808724
3300 3300 c, t dbSNP:372767127
3301 3301 a, g dbSNP:772095737
3304 3304 a, c dbSNP:773740590
3305 3305 a, g dbSNP:761133847
3309 3309 a, g dbSNP:779177994
3312 3312 g, t dbSNP:565147002
3333 3333 c, t dbSNP:748363079
3362 3362 c, t dbSNP:577211667
3365 3365 c, t dbSNP:773119970
3366 3366 a, g dbSNP:374835455
3375 3375 a, g dbSNP:147424506
3378 3378 c, t dbSNP:56139133
3385 3385 a, g dbSNP:151115781
3397 3397 c, t dbSNP:587779745
3401 3401 a, g dbSNP:765570329
3404 3404 c, t dbSNP:367809905
3413 3413 a, g dbSNP:778062751
3415 3415 c, t dbSNP:747088591
3416 3416 a, g dbSNP:771056710
3426 3426 c, t dbSNP:139785288
3427 3427 a, g, t dbSNP:746412839
3431 3431 c, t dbSNP:145012943
3432 3432 a, g dbSNP:763386213
3435 3435 c, t dbSNP:377021700
3439 3439 c, t dbSNP:773062339
3451 3451 c, t dbSNP:760245781
3453 3453 c, t dbSNP:369640779
3460 3460 a, g dbSNP:766030463
3463 3463 a, g dbSNP:753434703
3465 3465 c, t dbSNP:150516641
3466 3466 a, g dbSNP:777513652
3467 3467 c, t dbSNP:759345151
3468 3468 a, g dbSNP:765236859
3497 3497 -, agg dbSNP:755476506
3501 3501 a, g dbSNP:139512931
3506 3506 a, g dbSNP:372833448
3512 3512 a, g dbSNP:534466124
3520 3520 a, g dbSNP:149702962
3525 3525 c, g, t dbSNP:777844769
3529 3529 g, t dbSNP:145516400
3530 3530 c, t dbSNP:781209005
3531 3531 a, g dbSNP:745968347
3535 3535 c, g dbSNP:140639463
3536 3536 c, t dbSNP:530430137
3537 3537 a, g dbSNP:749608995
3539 3539 a, g dbSNP:769118968
3541 3541 c, t dbSNP:772972321
3542 3542 a, g dbSNP:144424476
3546 3546 a, g dbSNP:770732982
3550 3550 a, c, g dbSNP:376225642
3552 3552 c, g dbSNP:368993084
3555 3555 a, g dbSNP:759092517
3556 3556 a, g dbSNP:765083250
3565 3565 a, c dbSNP:775556116
3567 3567 a, c, g dbSNP:146625434
3572 3572 c, t dbSNP:751387548
3589 3589 a, g dbSNP:745566888
3594 3594 a, g dbSNP:767739514
3600 3600 a, c, g dbSNP:566865279
3607 3607 a, g dbSNP:780408339
3612 3612 a, g dbSNP:527711444
3617 3617 a, t dbSNP:755473951
3619 3619 a, g dbSNP:779375711
3624 3624 a, c dbSNP:748539331
3626 3626 c, t dbSNP:770643408
3627 3627 a, g dbSNP:373191607
3636 3636 c, g dbSNP:745359242
3640 3640 a, g dbSNP:141461351
3642 3642 c, t dbSNP:143236717
3643 3643 a, g dbSNP:376207220
3647 3647 c, t dbSNP:370889837
3648 3648 a, g dbSNP:774071774
3649 3649 a, c dbSNP:761599931
3657 3657 a, g dbSNP:61745210
3658 3658 c, t dbSNP:750713205
3663 3663 c, t dbSNP:756120841
3672 3672 c, g dbSNP:766446706
3672 3672 -, g dbSNP:587779746
3678 3678 a, g dbSNP:753891391
3681 3681 g, t dbSNP:755486688
3683 3683 a, g dbSNP:779570779
3684 3684 c, t dbSNP:549950885
3697 3697 c, t dbSNP:758892744
3698 3698 a, g dbSNP:780970034
3700 3700 a, c dbSNP:745575926
3702 3702 c, t dbSNP:769362465
3703 3703 g, t dbSNP:775015868
3704 3704 a, t dbSNP:748759595
3719 3719 a, g dbSNP:373500669
3723 3723 a, g dbSNP:774335434
3726 3726 c, t dbSNP:568203974
3735 3735 c, t dbSNP:139903653
3738 3738 c, g, t dbSNP:141783755
3740 3740 c, g dbSNP:760906582
3741 3741 c, t dbSNP:571692142
3755 3755 c, t dbSNP:370838091
3756 3756 a, g dbSNP:759759957
3757 3757 c, t dbSNP:765827636
3759 3759 c, g dbSNP:138412834
3764 3764 a, g dbSNP:758804576
3767 3767 c, t dbSNP:778160923
3772 3772 a, g dbSNP:142788313
3786 3786 c, t dbSNP:755734669
3790 3790 a, t dbSNP:34870395
3791 3791 c, t dbSNP:138181857
3796 3796 a, g, t dbSNP:768210321
3801 3801 c, t dbSNP:748119553
3819 3819 c, t dbSNP:61747988
3822 3822 a, g dbSNP:773006123
3828 3828 a, g dbSNP:373910693
3833 3833 -, ctt dbSNP:779460018
3840 3840 c, t dbSNP:182287119
3841 3841 a, g dbSNP:567836947
3861 3861 c, t dbSNP:776777663
3867 3867 a, g dbSNP:368163089
3876 3876 c, g dbSNP:563086310
3880 3880 a, g dbSNP:752856754
3891 3891 c, t dbSNP:150010654
3894 3894 a, g dbSNP:764521196
3895 3895 c, t dbSNP:542516057
3908 3908 c, t dbSNP:757628046
3909 3909 a, c, g dbSNP:779739760
3915 3915 c, t dbSNP:2068129
3920 3920 a, c, t dbSNP:570186838
3921 3921 a, g dbSNP:527651886
3927 3927 a, g dbSNP:61738955
3931 3931 c, t dbSNP:113347228
3943 3943 a, g dbSNP:370174322
3951 3951 a, g dbSNP:746810545
3953 3953 c, t dbSNP:762698567
3954 3954 a, g dbSNP:776881575
3955 3955 c, t dbSNP:746048984
3957 3957 c, t dbSNP:770164775
3965 3965 c, t dbSNP:758724418
3966 3966 a, g dbSNP:374125873
3987 3987 a, g dbSNP:556299458
3989 3989 a, g dbSNP:367764610
3991 3991 c, t dbSNP:774777278
3992 3992 a, g dbSNP:762211408
3994 3994 a, c dbSNP:767808574
4003 4003 a, g dbSNP:750814930
4012 4012 c, g dbSNP:754572827
4023 4023 a, g dbSNP:764877126
4027 4027 a, g dbSNP:139214813
4050 4050 c, t dbSNP:757908002
4052 4052 c, t dbSNP:777745107
4053 4053 a, g dbSNP:746960777
4056 4056 a, c dbSNP:757252042
4058 4058 c, g dbSNP:781086610
4074 4074 c, t dbSNP:745670548
4091 4091 a, c dbSNP:770072973
4093 4093 c, t dbSNP:775920998
4100 4100 c, t dbSNP:766639614
4125 4125 c, t dbSNP:749373437
4127 4127 g, t dbSNP:3210165
4143 4143 a, g dbSNP:768663672
4149 4149 a, g dbSNP:371430687
4166 4166 a, g dbSNP:762183842
4183 4183 c, g dbSNP:375949587
4188 4188 c, t dbSNP:550054527
4191 4191 c, t dbSNP:768949418
4195 4195 -, c dbSNP:747262317
4203 4203 a, g dbSNP:778806657
4208 4208 a, g dbSNP:544895806
4230 4230 a, g dbSNP:772566253
4236 4236 c, t dbSNP:372621575
4251 4251 a, g, t dbSNP:146620657
4271 4271 a, g dbSNP:777085838
4281 4281 a, g dbSNP:753890440
4289 4289 a, c dbSNP:762465807
4300 4300 a, g dbSNP:763822415
4301 4301 c, g dbSNP:750965814
4308 4308 c, g dbSNP:761451340
4310 4310 a, g dbSNP:140177120
4316 4316 c, t dbSNP:190027529
4323 4323 a, g dbSNP:760636496
4335 4335 c, t dbSNP:766430210
4347 4347 c, t dbSNP:753507388
4368 4368 a, c, g dbSNP:754864354
4370 4370 c, t dbSNP:541564441
4371 4371 a, t dbSNP:753008910
4375 4375 a, g dbSNP:758650746
4384 4384 a, g, t dbSNP:777781055
4390 4390 a, g dbSNP:369339813
4394 4394 a, g dbSNP:149841055
4397 4397 a, g dbSNP:746202741
4402 4402 a, g dbSNP:770242254
4403 4403 c, t dbSNP:773843930
4408 4408 g, t dbSNP:747758337
4413 4413 c, t dbSNP:771869774
4414 4414 a, g dbSNP:772787830
4425 4425 a, g dbSNP:760264273
4430 4430 a, g dbSNP:528688757
4434 4434 c, t dbSNP:776682804
4436 4436 a, g dbSNP:759224463
4437 4437 c, t dbSNP:145867693
4438 4438 a, c, g dbSNP:546855765
4446 4446 a, g dbSNP:764306695
4451 4451 a, g dbSNP:751635758
4454 4454 a, c dbSNP:757383409
4469 4469 c, t dbSNP:781527504
4470 4470 a, c dbSNP:148922487
4471 4471 a, g dbSNP:756610931
4473 4473 a, c, t dbSNP:189662115
4474 4474 a, g dbSNP:771781497
4481 4481 a, c, g dbSNP:138020626
4489 4489 a, g dbSNP:746497588
4502 4502 a, c dbSNP:149518409
4505 4505 a, g dbSNP:569199026
4509 4509 -, tga dbSNP:771741082