Email to GenScript

RET ret proto-oncogene [Homo sapiens (human)]

Gene Symbol RET
Entrez Gene ID 5979
Full Name ret proto-oncogene
Synonyms CDHF12, CDHR16, HSCR1, MEN2A, MEN2B, MTC1, PTC, RET-ELE1, RET51
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Multiple endocrine neoplasia IIA, 171400 (3); Medullary thyroid

The following RET gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the RET gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu60238 XM_011540027 PREDICTED: Homo sapiens ret proto-oncogene (RET), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu27214 NM_020975 Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu27273 NM_020630 Homo sapiens ret proto-oncogene (RET), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu60238
Accession Version XM_011540027.1
Sequence Information ORF Nucleotide Sequence (Length: 3345bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product proto-oncogene tyrosine-protein kinase receptor Ret isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_030059.14) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)749..1033(+)
Misc Feature(2)764..1033(+)
Misc Feature(3)2399..3268(+)
Misc Feature(4)2402..3247(+)
Misc Feature(5)2420..3103(+)
Misc Feature(6)2420..2908(+)
Misc Feature(7)2852..3103(+)
Misc Feature(8)2903..2980(+)
Position Chain Variation Link
3 3 -, gcccc dbSNP:386134265
7 7 c, t dbSNP:540926474
11 11 a, t dbSNP:373375997
17 17 g, t dbSNP:559327425
26 26 g, t dbSNP:532775686
32 32 c, t dbSNP:551321384
33 33 a, g dbSNP:10900296
37 37 a, c dbSNP:10900297
49 49 a, g dbSNP:112715174
72 72 a, c dbSNP:548774475
73 73 g, t dbSNP:567112195
165 165 c, t dbSNP:3128725
182 182 c, t dbSNP:765384640
196 196 c, g dbSNP:751005619
263 263 c, g dbSNP:587780812
275 275 -, tgctgctgc dbSNP:768132465
276 276 -, tgc dbSNP:778434166
311 311 c, t dbSNP:377160777
313 313 a, g dbSNP:369519655
314 314 a, g dbSNP:779905135
327 327 c, t dbSNP:76764689
328 328 a, g dbSNP:139821724
331 331 a, g dbSNP:768485233
341 341 c, t dbSNP:777042445
346 346 a, g dbSNP:762096025
350 350 c, t dbSNP:373420806
357 357 c, t dbSNP:773375434
366 366 c, t dbSNP:763526874
367 367 a, g dbSNP:1800858
371 371 a, g dbSNP:529018971
376 376 a, g dbSNP:759872307
389 389 a, g dbSNP:547308774
391 391 c, t dbSNP:753523209
393 393 a, g dbSNP:756858300
397 397 c, g dbSNP:778409475
398 398 a, c, t dbSNP:145633958
402 402 a, g dbSNP:779915615
406 406 c, t dbSNP:746943314
407 407 a, g dbSNP:376565365
409 409 a, c dbSNP:370622218
410 410 c, t dbSNP:748402485
419 419 g, t dbSNP:770081020
421 421 a, g dbSNP:773428442
423 423 c, t dbSNP:77596424
431 431 c, t dbSNP:749390385
432 432 a, g dbSNP:192489011
433 433 a, c, t dbSNP:200328158
436 436 a, g, t dbSNP:148874112
451 451 c, t dbSNP:761460588
452 452 a, g dbSNP:764938319
456 456 c, t dbSNP:142641173
457 457 a, g dbSNP:151267865
462 462 a, g dbSNP:570176656
463 463 a, c dbSNP:3123654
467 467 c, t dbSNP:537523906
484 484 c, g dbSNP:754912942
494 494 a, c, g dbSNP:141679950
502 502 a, g dbSNP:755967110
505 505 c, t dbSNP:761325339
528 528 a, g dbSNP:749500174
536 536 a, g dbSNP:201244749
540 540 a, g dbSNP:375390467
544 544 c, t dbSNP:746378333
554 554 a, c dbSNP:567877611
556 556 c, g dbSNP:775974393
559 559 c, g dbSNP:761086815
561 561 a, g dbSNP:764421264
565 565 c, g dbSNP:772779267
566 566 c, t dbSNP:762626209
567 567 a, g dbSNP:587780814
572 572 c, t dbSNP:747483905
573 573 a, g dbSNP:76397662
574 574 c, t dbSNP:143083395
582 582 a, c dbSNP:763295929
583 583 c, t dbSNP:267602487
587 587 c, g dbSNP:764496948
593 593 a, g dbSNP:770548816
603 603 a, t dbSNP:773868504
607 607 a, c dbSNP:1800859
623 623 c, t dbSNP:375576038
630 630 a, g dbSNP:138265837
637 637 c, t dbSNP:142345108
638 638 a, g, t dbSNP:79014735
653 653 a, g dbSNP:749190212
654 654 a, g dbSNP:770840152
663 663 a, g dbSNP:551142665
664 664 c, t dbSNP:756999107
676 676 -, ctt dbSNP:776989694
684 684 a, g dbSNP:150261092
688 688 a, c dbSNP:750621402
700 700 c, t dbSNP:141290380
705 705 a, g dbSNP:780067540
710 710 c, t dbSNP:747536732
719 719 a, c dbSNP:371153966
720 720 a, g dbSNP:149403911
734 734 c, t dbSNP:748609507
737 737 a, g dbSNP:374514956
741 741 c, t dbSNP:200547906
750 750 c, t dbSNP:368431125
756 756 a, g dbSNP:774097284
760 760 g, t dbSNP:556686338
761 761 c, t dbSNP:765654609
762 762 a, g dbSNP:759229505
770 770 c, t dbSNP:76449634
771 771 a, g dbSNP:370736139
776 776 c, t dbSNP:775086466
780 780 a, g dbSNP:144801580
782 782 a, c dbSNP:753301491
793 793 a, g dbSNP:764162555
798 798 a, g dbSNP:753707182
814 814 a, g dbSNP:368116579
823 823 c, t dbSNP:764910706
824 824 a, c dbSNP:76736111
825 825 c, g dbSNP:750675926
829 829 c, t dbSNP:55810667
835 835 c, t dbSNP:780120451
836 836 a, g dbSNP:751572082
839 839 a, g dbSNP:755007607
856 856 g, t dbSNP:781750106
876 876 a, g, t dbSNP:748128929
886 886 a, g dbSNP:137928436
899 899 a, g dbSNP:587780815
905 905 a, c dbSNP:766136271
906 906 c, t dbSNP:774670305
910 910 c, t dbSNP:142421698
914 914 c, g, t dbSNP:760813493
918 918 c, t dbSNP:767654905
924 924 a, g dbSNP:79661516
925 925 c, t dbSNP:576806329
931 931 a, g dbSNP:786203642
933 933 g, t dbSNP:756216318
934 934 g, t dbSNP:764759271
950 950 a, c, g dbSNP:375120544
952 952 a, g dbSNP:779382077
955 955 c, t dbSNP:544252468
958 958 a, g dbSNP:377193354
959 959 a, t dbSNP:112448213
963 963 c, t dbSNP:145970248
968 968 a, c, g dbSNP:780756440
970 970 c, t dbSNP:769279838
972 972 a, c, t dbSNP:61843232
973 973 c, t dbSNP:777733752
975 975 c, g dbSNP:749189193
983 983 a, g dbSNP:562449603
989 989 a, g dbSNP:587780816
992 992 a, g dbSNP:554862459
995 995 a, t dbSNP:770741709
1001 1001 a, c dbSNP:773964804
1008 1008 a, c, t dbSNP:759812068
1012 1012 a, g dbSNP:764749007
1016 1016 a, g dbSNP:775772444
1017 1017 c, t dbSNP:139790943
1035 1035 c, g dbSNP:764239646
1048 1048 c, t dbSNP:754428451
1053 1053 a, c dbSNP:762363830
1056 1056 g, t dbSNP:143209223
1057 1057 c, t dbSNP:150797149
1058 1058 a, g, t dbSNP:139213499
1064 1064 a, g dbSNP:541929171
1065 1065 a, c dbSNP:35118262
1066 1066 c, t dbSNP:41306550
1067 1067 a, g dbSNP:777221273
1070 1070 a, c dbSNP:749244375
1074 1074 c, g dbSNP:745642574
1075 1075 c, t dbSNP:770794801
1087 1087 c, g dbSNP:778909045
1089 1089 a, c dbSNP:745710576
1100 1100 -, g dbSNP:36008607
1106 1106 a, g dbSNP:34682185
1110 1110 c, t dbSNP:745790708
1116 1116 c, t dbSNP:758159521
1120 1120 c, g dbSNP:779849973
1129 1129 c, t dbSNP:529153319
1138 1138 c, t dbSNP:768934031
1147 1147 c, t dbSNP:776987390
1153 1153 a, g dbSNP:748294306
1157 1157 c, g dbSNP:769894584
1160 1160 a, c dbSNP:773631693
1162 1162 c, g dbSNP:763473665
1170 1170 a, g dbSNP:77702891
1175 1175 a, c dbSNP:774637214
1182 1182 c, t dbSNP:760322514
1183 1183 g, t dbSNP:375812189
1189 1189 a, c dbSNP:149926238
1192 1192 a, c, t dbSNP:756761746
1193 1193 a, g dbSNP:377767388
1204 1204 c, g dbSNP:758298916
1205 1205 a, g dbSNP:779719517
1206 1206 c, t dbSNP:746865459
1207 1207 c, t dbSNP:754806583
1214 1214 a, g dbSNP:781613821
1221 1221 a, g dbSNP:80236571
1225 1225 a, g dbSNP:377200874
1230 1230 a, c dbSNP:769791074
1240 1240 c, g, t dbSNP:144981275
1245 1245 a, c, t dbSNP:377767433
1248 1248 c, t dbSNP:774829203
1249 1249 a, g dbSNP:369810881
1250 1250 g, t dbSNP:367737920
1260 1260 a, c, g dbSNP:776300640
1261 1261 c, t dbSNP:764668178
1262 1262 a, g dbSNP:749883001
1263 1263 a, g dbSNP:762367597
1265 1265 a, g dbSNP:766480138
1272 1272 c, t dbSNP:200641186
1275 1275 a, g dbSNP:751518221
1278 1278 c, g, t dbSNP:754859905
1279 1279 a, g dbSNP:373208682
1281 1281 c, t dbSNP:587778660
1282 1282 c, t dbSNP:142188675
1283 1283 a, g dbSNP:777716061
1284 1284 a, t dbSNP:749449032
1295 1295 a, g, t dbSNP:145402131
1311 1311 a, g dbSNP:762472027
1315 1315 a, c dbSNP:770587835
1316 1316 a, c dbSNP:773935854
1320 1320 c, g dbSNP:766881522
1324 1324 c, t dbSNP:759548155
1326 1326 c, t dbSNP:763670106
1327 1327 a, g dbSNP:201992974
1329 1329 a, g dbSNP:760560422
1332 1332 a, g dbSNP:763759702
1334 1334 c, t dbSNP:754116867
1335 1335 a, g dbSNP:199529397
1342 1342 a, g dbSNP:765305476
1348 1348 c, g dbSNP:750569981
1350 1350 c, t dbSNP:546866208
1351 1351 a, g dbSNP:113931414
1356 1356 a, t dbSNP:142338976
1367 1367 -, cag dbSNP:763559646
1371 1371 a, c dbSNP:755400887
1373 1373 c, t dbSNP:781362020
1374 1374 g, t dbSNP:139813765
1378 1378 a, g dbSNP:770637118
1380 1380 a, g dbSNP:774139424
1382 1382 c, g dbSNP:536298339
1383 1383 c, g dbSNP:771679592
1389 1389 c, t dbSNP:115272158
1390 1390 a, g dbSNP:373540097
1393 1393 c, t dbSNP:763967472
1394 1394 a, g dbSNP:776223166
1395 1395 c, t dbSNP:751939820
1405 1405 c, g dbSNP:757868491
1411 1411 a, c dbSNP:78098482
1414 1414 c, t dbSNP:376465385
1419 1419 c, t dbSNP:781646869
1420 1420 a, g dbSNP:758510657
1421 1421 a, g dbSNP:183729115
1429 1429 a, g dbSNP:148371113
1433 1433 a, t dbSNP:140638866
1435 1435 c, t dbSNP:781623106
1447 1447 c, t dbSNP:748588678
1448 1448 a, g dbSNP:756532455
1454 1454 a, t dbSNP:778754580
1456 1456 c, t dbSNP:745479264
1458 1458 c, g dbSNP:771636042
1465 1465 c, t dbSNP:779374978
1466 1466 a, g dbSNP:746970700
1480 1480 c, t dbSNP:768547052
1482 1482 a, g dbSNP:201030628
1485 1485 a, c, g dbSNP:371731991
1490 1490 a, g dbSNP:769548635
1496 1496 a, g dbSNP:749107291
1498 1498 c, t dbSNP:759582152
1499 1499 a, g, t dbSNP:767601598
1504 1504 a, c dbSNP:761207209
1505 1505 c, g dbSNP:764558748
1507 1507 c, g dbSNP:200458714
1516 1516 a, g dbSNP:757632555
1517 1517 a, g dbSNP:779625196
1522 1522 c, g dbSNP:202053997
1524 1524 a, g dbSNP:754481151
1526 1526 g, t dbSNP:780630024
1527 1527 ca, tg dbSNP:386743165
1527 1527 a, c, t dbSNP:552057730
1528 1528 a, g dbSNP:1800860
1537 1537 c, t dbSNP:749093977
1538 1538 a, g dbSNP:770736612
1544 1544 a, g dbSNP:774474422
1558 1558 a, g dbSNP:746055866
1559 1559 c, t dbSNP:772292843
1568 1568 c, g dbSNP:115423919
1575 1575 a, c dbSNP:760832715
1576 1576 c, g dbSNP:549907428
1584 1584 c, t dbSNP:774092678
1585 1585 a, g, t dbSNP:201568301
1586 1586 a, c dbSNP:151148041
1589 1589 a, g dbSNP:754598663
1594 1594 a, g dbSNP:35717926
1595 1595 a, g dbSNP:145966037
1596 1596 c, t dbSNP:752267460
1603 1603 a, t dbSNP:376464605
1606 1606 c, t dbSNP:190750926
1607 1607 a, c, g dbSNP:539995816
1608 1608 a, t dbSNP:757031867
1618 1618 a, g dbSNP:587780807
1631 1631 c, g dbSNP:200334340
1637 1637 a, c, g dbSNP:772489699
1652 1652 c, t dbSNP:775842917
1653 1653 a, g dbSNP:747139265
1655 1655 c, t dbSNP:746512075
1656 1656 a, g dbSNP:138624658
1659 1659 c, t dbSNP:762335805
1669 1669 c, t dbSNP:576806356
1670 1670 a, g dbSNP:537874538
1672 1672 a, t dbSNP:763296134
1673 1673 c, g dbSNP:767210575
1680 1680 a, g dbSNP:752322996
1682 1682 a, t dbSNP:755660496
1683 1683 c, t dbSNP:763617146
1694 1694 a, t dbSNP:753733901
1697 1697 a, g dbSNP:9282834
1699 1699 a, c dbSNP:372648203
1701 1701 a, g dbSNP:750291418
1708 1708 c, g dbSNP:758249079
1709 1709 c, t dbSNP:780467203
1714 1714 a, g dbSNP:200088863
1720 1720 c, t dbSNP:747196645
1725 1725 c, t dbSNP:375677628
1728 1728 a, g dbSNP:781272120
1733 1733 c, g dbSNP:199572076
1736 1736 a, g dbSNP:770395347
1742 1742 a, g dbSNP:773576143
1748 1748 c, g dbSNP:763356763
1750 1750 g, t dbSNP:771254720
1754 1754 c, t dbSNP:775152474
1761 1761 c, t dbSNP:201745826
1762 1762 c, t dbSNP:553492964
1763 1763 a, g dbSNP:201553718
1770 1770 c, g dbSNP:149238501
1771 1771 a, g dbSNP:761430718
1776 1776 ct, gc dbSNP:377767389
1781 1781 c, g dbSNP:764616982
1783 1783 a, g dbSNP:750411593
1790 1790 a, g dbSNP:762930066
1799 1799 a, c dbSNP:766278774
1801 1801 a, g dbSNP:751464792
1805 1805 c, g, t dbSNP:545625150
1806 1806 a, g dbSNP:752830820
1809 1809 c, t dbSNP:756248937
1821 1821 a, g dbSNP:777778956
1823 1823 c, t dbSNP:377767390
1825 1825 -, gaggagtgt dbSNP:377767434
1826 1826 -, aggagtgtg dbSNP:672601328
1828 1828 c, t dbSNP:144460361
1829 1829 a, g, t dbSNP:75873440
1832 1832 c, t dbSNP:779380912
1844 1844 a, g dbSNP:746279995
1845 1845 c, g dbSNP:148406803
1850 1850 a, g dbSNP:543376293
1852 1852 c, g dbSNP:776381183
1873 1873 c, t dbSNP:747710595
1874 1874 a, g dbSNP:374461212
1879 1879 a, c dbSNP:772784061
1881 1881 a, g dbSNP:747844360
1893 1893 a, g dbSNP:200047805
1897 1897 c, t dbSNP:761815073
1900 1900 c, g dbSNP:141771814
1910 1910 c, t dbSNP:748852160
1913 1913 a, c, t dbSNP:201972250
1916 1916 a, t dbSNP:759342879
1918 1918 c, t dbSNP:767502292
1927 1927 c, t dbSNP:775079681
1930 1930 c, t dbSNP:760507059
1931 1931 a, g dbSNP:147219360
1933 1933 c, t dbSNP:201209972
1934 1934 a, g dbSNP:140464432
1938 1938 a, g dbSNP:765256156
1942 1942 a, c dbSNP:144015580
1943 1943 a, g dbSNP:750958377
1949 1949 a, g dbSNP:758766818
1956 1956 c, t dbSNP:587780808
1957 1957 c, g dbSNP:780609440
1969 1969 c, g dbSNP:144455821
1987 1987 c, t dbSNP:755369964
1988 1988 c, t dbSNP:777604634
1991 1991 c, t dbSNP:748905470
1996 1996 a, c dbSNP:753557244
1997 1997 a, c dbSNP:786202597
2003 2003 a, g dbSNP:776013456
2005 2005 c, t dbSNP:756902570
2012 2012 c, t dbSNP:778622905
2030 2030 c, t dbSNP:745418960
2031 2031 a, g dbSNP:377767393
2035 2035 g, t dbSNP:779889311
2039 2039 a, c dbSNP:377767394
2042 2042 a, g dbSNP:746901176
2048 2048 c, t dbSNP:199921511
2049 2049 a, g dbSNP:377767395
2056 2056 a, c dbSNP:776346079
2057 2057 a, c, g, t dbSNP:77558292
2058 2058 a, c, g, t dbSNP:77939446
2059 2059 c, g dbSNP:377767396
2063 2063 a, c, g, t dbSNP:377767391
2064 2064 at, ct, gc, tt dbSNP:377767398
2064 2064 a, c, g, t dbSNP:377767397
2065 2065 c, g dbSNP:80069458
2066 2066 -, ttccctgaggaggagaagtgcttctgc dbSNP:121913313
2070 2070 c, t dbSNP:761596036
2072 2072 -, gag dbSNP:750189678
2072 2072 a, g dbSNP:769971379
2078 2078 -, gag dbSNP:377767399
2084 2084 a, c, g, t dbSNP:76262710
2085 2085 a, c, g, t dbSNP:79781594
2086 2086 c, g dbSNP:377767400
2089 2089 c, t dbSNP:377767401
2090 2090 a, c, g, t dbSNP:77316810
2091 2091 a, c, g, t dbSNP:77503355
2092 2092 c, g, t dbSNP:79890926
2095 2095 a, g dbSNP:766438951
2098 2098 c, g, t dbSNP:201979255
2099 2099 a, g dbSNP:377767402
2110 2110 a, g dbSNP:147692872
2114 2114 c, t dbSNP:754466051
2116 2116 a, t dbSNP:786202671
2120 2120 c, t dbSNP:377767404
2121 2121 a, c, g, t dbSNP:377767405
2122 2122 c, t dbSNP:781145070
2123 2123 -, gac dbSNP:377767435
2123 2123 a, g, t dbSNP:377767406
2124 2124 a, c, g, t dbSNP:121913308
2125 2125 -, cgagct dbSNP:121913307
2125 2125 a, c, t dbSNP:55846256
2126 2126 -, gagctg dbSNP:121913312
2126 2126 a, g dbSNP:377767407
2127 2127 agctgtgccgcacggtgatcgcag, tgcggc dbSNP:121913310
2127 2127 -, agc dbSNP:121913311
2128 2128 cgtgc, gctgt dbSNP:377767408
2128 2128 cg, gc dbSNP:267607009
2128 2128 c, g dbSNP:387906531
2129 2129 c, g dbSNP:267607010
2132 2132 a, c, g, t dbSNP:75076352
2133 2133 gc, tg dbSNP:377767409
2133 2133 a, c, g, t dbSNP:75996173
2134 2134 c, g dbSNP:77709286
2135 2135 -, acgagctgtgcc dbSNP:377767436
2135 2135 c, g, t dbSNP:377767410
2136 2136 a, g dbSNP:776164321
2138 2138 a, gacctgtgccgcc dbSNP:377767438
2140 2140 -, tgccgcacg dbSNP:377767437
2143 2143 g, t dbSNP:761187737
2146 2146 c, t dbSNP:375041479
2147 2147 a, g, t dbSNP:777122776
2151 2151 c, g dbSNP:78935588
2152 2152 c, t dbSNP:149768519
2153 2153 a, g, t dbSNP:377767411
2156 2156 c, g dbSNP:759073728
2158 2158 c, g dbSNP:766962871
2173 2173 c, t dbSNP:75225191
2174 2174 a, g dbSNP:77711105
2178 2178 c, t dbSNP:148935214
2179 2179 a, g dbSNP:377767412
2190 2190 c, g dbSNP:753724503
2195 2195 c, t dbSNP:756978792
2206 2206 c, g dbSNP:779310191
2227 2227 c, g dbSNP:377767413
2228 2228 a, c, g dbSNP:143795581
2229 2229 a, c, t dbSNP:377767439
2230 2230 c, g, t dbSNP:146646971
2230 2230 g, ttct dbSNP:377767440
2233 2233 a, t dbSNP:563316790
2237 2237 a, g, t dbSNP:776986585
2249 2249 a, g dbSNP:3026759
2250 2250 a, c dbSNP:770100231
2262 2262 a, g dbSNP:536038262
2269 2269 c, t dbSNP:55862116
2270 2270 a, g dbSNP:184498773
2273 2273 c, g dbSNP:567241943
2282 2282 c, t dbSNP:141347316
2283 2283 c, t dbSNP:760088950
2284 2284 a, g dbSNP:145122337
2285 2285 a, g dbSNP:753686782
2290 2290 c, t dbSNP:757141171
2292 2292 a, g dbSNP:778793244
2294 2294 c, t dbSNP:750681372
2302 2302 c, t dbSNP:201550433
2303 2303 a, g dbSNP:1799939
2311 2311 c, g dbSNP:747166722
2312 2312 c, t dbSNP:193922700
2313 2313 a, g dbSNP:141185224
2317 2317 c, t dbSNP:571603831
2320 2320 a, g dbSNP:150329150
2330 2330 a, t dbSNP:377767441
2343 2343 a, t dbSNP:770155054
2348 2348 a, g dbSNP:137855422
2356 2356 c, t dbSNP:749646777
2357 2357 c, t dbSNP:771768140
2360 2360 a, g dbSNP:3026760
2361 2361 a, g dbSNP:774983492
2367 2367 c, t dbSNP:760272063
2371 2371 a, g dbSNP:149460492
2377 2377 -, a dbSNP:66858251
2398 2398 g, t dbSNP:527726480
2414 2414 a, g dbSNP:147216744
2422 2422 a, g dbSNP:377616279
2431 2431 c, t dbSNP:587780809
2441 2441 a, c dbSNP:768217520
2446 2446 a, g dbSNP:776073471
2454 2454 c, g dbSNP:761397627
2456 2456 a, g dbSNP:552131086
2457 2457 c, t dbSNP:773256580
2458 2458 a, g dbSNP:762876946
2464 2464 c, g dbSNP:766035127
2466 2466 a, g, t dbSNP:534094626
2469 2469 -, g dbSNP:35938496
2469 2469 c, t dbSNP:755085530
2478 2478 c, g dbSNP:34288963
2481 2481 c, g dbSNP:752830000
2483 2483 g, t dbSNP:756163867
2484 2484 a, g dbSNP:778292678
2490 2490 c, t dbSNP:749755131
2493 2493 c, t dbSNP:181856591
2494 2494 a, g dbSNP:779080598
2500 2500 c, t dbSNP:370791179
2520 2520 a, t dbSNP:199882293
2521 2521 c, t dbSNP:777349208
2522 2522 a, g dbSNP:748799148
2525 2525 c, t dbSNP:75075748
2530 2530 a, g, t dbSNP:140658743
2536 2536 a, c, g, t dbSNP:78014899
2537 2537 c, t dbSNP:142793711
2539 2539 a, g, t dbSNP:1800861
2540 2540 c, t dbSNP:775711017
2541 2541 a, g dbSNP:377767414
2554 2554 a, g dbSNP:760821097
2562 2562 a, g dbSNP:377767415
2563 2563 c, t dbSNP:753977221
2564 2564 a, g dbSNP:75686697
2574 2574 a, g dbSNP:377767416
2580 2580 a, c, g dbSNP:587778656
2590 2590 c, t dbSNP:758715544
2600 2600 c, t dbSNP:780512298
2601 2601 g, t dbSNP:149148794
2602 2602 c, g, t dbSNP:75030001
2603 2603 a, t dbSNP:377767417
2604 2604 a, t dbSNP:77724903
2608 2608 a, g dbSNP:756758769
2629 2629 a, g dbSNP:776737136
2638 2638 c, t dbSNP:748339853
2641 2641 c, t dbSNP:535051804
2642 2642 a, c, g, t dbSNP:79658334
2644 2644 a, g dbSNP:767045208
2645 2645 a, g dbSNP:377767418
2649 2649 a, g dbSNP:377767419
2650 2650 c, t dbSNP:553418132
2651 2651 a, g dbSNP:760012685
2655 2655 a, c dbSNP:767945255
2656 2656 a, c dbSNP:753446269
2659 2659 c, t dbSNP:577929869
2660 2660 a, g dbSNP:764784013
2662 2662 c, g dbSNP:749997455
2664 2664 c, g dbSNP:587778657
2668 2668 a, g dbSNP:757872133
2669 2669 c, t dbSNP:779996040
2677 2677 c, g dbSNP:751447014
2680 2680 a, c dbSNP:368500000
2681 2681 c, t dbSNP:142318626
2683 2683 a, c, t dbSNP:747894751
2684 2684 a, g dbSNP:377767420
2688 2688 g, t dbSNP:377767421
2689 2689 c, t dbSNP:375322585
2693 2693 a, g dbSNP:749421642
2699 2699 a, g dbSNP:138847998
2700 2700 a, g dbSNP:142779213
2709 2709 a, c dbSNP:34617196
2713 2713 a, g dbSNP:775022842
2717 2717 a, g dbSNP:113005278
2720 2720 a, g dbSNP:200127630
2723 2723 a, g dbSNP:775981129
2724 2724 g, t dbSNP:760924186
2728 2728 c, g dbSNP:764979358
2729 2729 c, t dbSNP:377767422
2730 2730 a, g dbSNP:587782636
2733 2733 a, c dbSNP:147433153
2740 2740 c, t dbSNP:1800862
2752 2752 c, t dbSNP:751498307
2754 2754 c, g, t dbSNP:149891333
2755 2755 a, g, t dbSNP:56195026
2759 2759 a, g dbSNP:755837568
2761 2761 g, t dbSNP:377767423
2762 2762 c, t dbSNP:377767424
2763 2763 a, g, t dbSNP:55947360
2767 2767 c, t dbSNP:377767425
2768 2768 c, g dbSNP:771150081
2770 2770 c, t dbSNP:201816539
2775 2775 a, c, t dbSNP:201101792
2776 2776 a, g dbSNP:772684105
2777 2777 c, g dbSNP:775828448
2778 2778 a, g dbSNP:761130672
2779 2779 c, t dbSNP:770674650
2780 2780 a, g dbSNP:772862503
2786 2786 a, g dbSNP:561276725
2788 2788 c, g dbSNP:377767426
2797 2797 c, t dbSNP:773912702
2815 2815 a, g dbSNP:146628741
2830 2830 c, t dbSNP:202029768
2831 2831 a, g dbSNP:758950128
2833 2833 g, t dbSNP:141459368
2842 2842 c, t dbSNP:575629307
2843 2843 a, g dbSNP:145170911
2873 2873 c, g dbSNP:377767427
2878 2878 agc, ttt dbSNP:121913306
2879 2879 gc, tt dbSNP:377767429
2879 2879 a, g dbSNP:377767428
2885 2885 a, g dbSNP:201487882
2888 2888 c, t dbSNP:146838520
2889 2889 a, g dbSNP:373594744
2893 2893 a, g dbSNP:771617878
2894 2894 a, g dbSNP:774930499
2903 2903 g, t dbSNP:75234356
2905 2905 a, g dbSNP:201620214
2908 2908 c, t dbSNP:768753935
2911 2911 c, t dbSNP:768188546
2915 2915 a, t dbSNP:761720362
2917 2917 g, t dbSNP:765065650
2922 2922 a, g dbSNP:76087194
2924 2924 -, gatgtttatgaa dbSNP:121913309
2924 2924 g, t dbSNP:587780810
2941 2941 a, t dbSNP:763149032
2943 2943 c, g, t dbSNP:267607011
2944 2944 a, c, g dbSNP:1800863
2947 2947 c, t dbSNP:755023496
2948 2948 a, g dbSNP:200627072
2951 2951 a, g dbSNP:377767430
2952 2952 a, t dbSNP:377767431
2955 2955 a, g dbSNP:753156691
2967 2967 a, c, g, t dbSNP:78347871
2969 2969 a, c dbSNP:759637689
2974 2974 a, g dbSNP:375963128
2984 2984 a, g dbSNP:377767442
2985 2985 c, t dbSNP:74799832
2986 2986 a, g dbSNP:753208054
2990 2990 a, g dbSNP:527787676
2991 2991 c, t dbSNP:778330709
2997 2997 a, c dbSNP:377767432
3008 3008 c, g, t dbSNP:774215008
3016 3016 c, t dbSNP:779594537
3019 3019 a, c dbSNP:747648232
3022 3022 a, g dbSNP:746599792
3050 3050 c, t dbSNP:780967888
3055 3055 a, g dbSNP:747696868
3064 3064 c, t dbSNP:755606269
3065 3065 a, g dbSNP:587780811
3076 3076 a, g dbSNP:749196396
3081 3081 a, t dbSNP:770639985
3107 3107 c, t dbSNP:587778658
3108 3108 a, g dbSNP:745650861
3117 3117 a, g dbSNP:369804828
3118 3118 c, t dbSNP:772329940
3122 3122 c, t dbSNP:533682776
3129 3129 c, t dbSNP:760765930
3130 3130 c, t dbSNP:373693875
3131 3131 a, g dbSNP:777007074
3134 3134 c, t dbSNP:762448300
3146 3146 a, g dbSNP:76534745
3163 3163 c, g, t dbSNP:375414982
3164 3164 a, g dbSNP:758800351
3166 3166 a, g dbSNP:767306671
3168 3168 a, g dbSNP:752352085
3175 3175 c, t dbSNP:147318495
3176 3176 c, t dbSNP:17158558
3177 3177 a, g, t dbSNP:368550200
3207 3207 c, t dbSNP:758191409
3208 3208 a, g dbSNP:528823385
3214 3214 a, c dbSNP:199718928
3220 3220 a, g dbSNP:145798106
3221 3221 c, g dbSNP:781236624
3228 3228 c, t dbSNP:748288493
3229 3229 a, g dbSNP:376487144
3236 3236 a, c dbSNP:773872326
3237 3237 a, g dbSNP:763489828
3238 3238 c, t dbSNP:370970483
3249 3249 -, aga dbSNP:775993413
3251 3251 a, g dbSNP:774840230
3252 3252 a, t dbSNP:759798237
3253 3253 g, t dbSNP:786204098
3258 3258 c, t dbSNP:375213011
3263 3263 a, g dbSNP:368345402
3265 3265 a, g dbSNP:547501933
3282 3282 a, g dbSNP:762414334
3284 3284 c, t dbSNP:766330880
3286 3286 -, g dbSNP:769302056
3289 3289 a, g dbSNP:369579749
3291 3291 c, g, t dbSNP:372191563
3292 3292 a, g dbSNP:767152839
3300 3300 c, t dbSNP:138912894
3303 3303 c, g dbSNP:752534928
3310 3310 c, t dbSNP:756466984
3322 3322 c, t dbSNP:142859395
3323 3323 a, g dbSNP:200989078
3325 3325 c, t dbSNP:369116900
3326 3326 a, g dbSNP:757373375
3335 3335 -, gag dbSNP:774509758
3344 3344 a, g dbSNP:201740483
3345 3345 c, t dbSNP:200021472
3348 3348 a, c, t dbSNP:79853121
3349 3349 a, g dbSNP:775773414
3355 3355 a, g dbSNP:147437610
3360 3360 a, g dbSNP:769476062
3363 3363 a, g dbSNP:772807570
3370 3370 a, c dbSNP:201576838
3371 3371 c, t dbSNP:369152977
3373 3373 c, t dbSNP:372673589
3374 3374 c, g, t dbSNP:774347808
3380 3380 c, g dbSNP:767479170
3381 3381 a, g dbSNP:200956659
3385 3385 a, c dbSNP:755946631
3388 3388 c, t dbSNP:191769748
3389 3389 a, c dbSNP:754066766
3397 3397 a, g dbSNP:200289472
3398 3398 c, t dbSNP:373423271
3401 3401 a, g dbSNP:750501039
3402 3402 c, t dbSNP:758877145
3405 3405 a, g, t dbSNP:780578577
3406 3406 a, c dbSNP:569004816
3408 3408 a, g dbSNP:772395752
3411 3411 a, g dbSNP:370756353
3414 3414 c, t dbSNP:536486113
3416 3416 c, t dbSNP:138010639
3417 3417 a, g dbSNP:587778659
3423 3423 c, t dbSNP:149513065
3424 3424 a, g dbSNP:144730090
3428 3428 a, c, g dbSNP:180700967
3431 3431 c, t dbSNP:775583354
3432 3432 c, t dbSNP:760625882
3436 3436 c, t dbSNP:768699100
3438 3438 c, g dbSNP:776615468
3449 3449 a, c dbSNP:763823142
3456 3456 c, t dbSNP:751191202
3463 3463 a, c, g dbSNP:765409417
3465 3465 c, t dbSNP:762952212
3466 3466 a, g dbSNP:766376008
3470 3470 a, g dbSNP:751631684
3473 3473 a, g dbSNP:745955777
3475 3475 c, t dbSNP:144192900
3480 3480 c, t dbSNP:753047418
3485 3485 a, g dbSNP:756465544
3488 3488 a, g dbSNP:778452896
3502 3502 c, t dbSNP:745469112
3507 3507 a, g dbSNP:757852794
3514 3514 c, t dbSNP:779779706
3518 3518 c, t dbSNP:746493433
3519 3519 a, g dbSNP:768752146
3522 3522 c, g dbSNP:776668647
3532 3532 c, g dbSNP:747917164
3534 3534 c, t dbSNP:769570496
3537 3537 c, t dbSNP:773306778
3546 3546 c, t dbSNP:532862288
3547 3547 a, g dbSNP:766572480
3555 3555 a, t dbSNP:774465548
3557 3557 a, g dbSNP:759584544
3558 3558 c, t dbSNP:587780813
3565 3565 a, g dbSNP:753203348
3567 3567 c, t dbSNP:756449491
3568 3568 c, t dbSNP:146049841
3584 3584 -, t dbSNP:767797283
3585 3585 c, t dbSNP:754150221
3593 3593 a, g dbSNP:552689504
3600 3600 a, t dbSNP:746810657
3605 3605 c, t dbSNP:535667130
3614 3614 c, t dbSNP:9971097
3619 3619 c, g dbSNP:147336674
3631 3631 -, g dbSNP:35856296
3642 3642 a, g dbSNP:761472636
3658 3658 a, g dbSNP:776277370
3670 3670 c, t dbSNP:555944246
3671 3671 c, t dbSNP:141016377
3679 3679 a, c, t dbSNP:745534552
3693 3693 a, g dbSNP:149252070
3726 3726 a, g dbSNP:115358030
3775 3775 a, g dbSNP:775114955
3787 3787 c, g dbSNP:762590499
3795 3795 a, g dbSNP:764691685
3800 3800 a, c dbSNP:3026784
3815 3815 a, g dbSNP:555071393
3822 3822 a, g dbSNP:148393331
3834 3834 a, g, t dbSNP:535080963
3851 3851 a, g dbSNP:2742241
3877 3877 c, g dbSNP:181388347
3900 3900 g, t dbSNP:762178593
3903 3903 a, c dbSNP:142572876
3914 3914 c, g dbSNP:186000190
3928 3928 a, g dbSNP:192065891
3936 3936 a, g dbSNP:76759170
3944 3944 a, g dbSNP:145954635
3959 3959 a, g dbSNP:756269717
3989 3989 c, g dbSNP:117119161
3996 3996 g, t dbSNP:753913049
3999 3999 a, g dbSNP:139925563
4027 4027 a, g dbSNP:544885679
4087 4087 a, g dbSNP:143369221
4094 4094 a, g dbSNP:755113276
4157 4157 a, c dbSNP:183817000
4215 4215 c, t dbSNP:146771196
4220 4220 -, c dbSNP:35911434
4234 4234 a, g dbSNP:746921948
4251 4251 c, t dbSNP:188882445
4306 4306 c, g dbSNP:763658875
4314 4314 c, t dbSNP:3026785
4384 4384 a, g dbSNP:191974370
4417 4417 a, g dbSNP:542427089

Target ORF information:

RefSeq Version XM_011540027
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ret proto-oncogene (RET), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27214
Accession Version NM_020975.4
Sequence Information ORF Nucleotide Sequence (Length: 3345bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product proto-oncogene tyrosine-protein kinase receptor Ret isoform a precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA100452.1, BC003072.2, BC004257.1, X12949.1, AC010864.11 and BM661773.1. This sequence is a reference standard in the RefSeqGene project. On Feb 27, 2007 this sequence version replaced gi:50593519. Summary: This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (a). This isoform is also known as Ret51. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)149..151(+)
Misc Feature(2)707..991(+)
Misc Feature(3)722..991(+)
Misc Feature(4)1949..1954(+)
Misc Feature(5)2096..2161(+)
Misc Feature(6)2249..2251(+)
Misc Feature(7)2276..2278(+)
Misc Feature(8)2309..2314(+)
Misc Feature(9)2324..2329(+)
Misc Feature(10)2357..3226(+)
Misc Feature(11)2360..3205(+)
Misc Feature(12)2378..3061(+)
Misc Feature(13)2378..2866(+)
Misc Feature(14)2603..2611(+)
Misc Feature(15)2606..2608(+)
Misc Feature(16)2606..2608(+)
Misc Feature(17)2615..2617(+)
Misc Feature(18)2615..2617(+)
Misc Feature(19)2666..2668(+)
Misc Feature(20)2810..3061(+)
Misc Feature(21)2861..2938(+)
Misc Feature(22)2888..2890(+)
Misc Feature(23)2888..2890(+)
Misc Feature(24)2903..2905(+)
Misc Feature(25)2903..2905(+)
Misc Feature(26)3131..3133(+)
Misc Feature(27)3131..3133(+)
Misc Feature(28)3233..3235(+)
Misc Feature(29)3233..3235(+)
Misc Feature(30)3239..3244(+)
Misc Feature(31)3275..3277(+)
Misc Feature(32)3374..3376(+)
Misc Feature(33)3374..3376(+)
Misc Feature(34)3458..3460(+)
Misc Feature(35)3458..3460(+)
Misc Feature(36)3476..3478(+)
Misc Feature(37)3476..3478(+)
Exon (1)1..263
Gene Synonym:
Exon (2)264..527
Gene Synonym:
Exon (3)528..815
Gene Synonym:
Exon (4)816..1057
Gene Synonym:
Exon (5)1058..1253
Gene Synonym:
Exon (6)1254..1453
Gene Synonym:
Exon (7)1454..1712
Gene Synonym:
Exon (8)1713..1838
Gene Synonym:
Exon (9)1839..1949
Gene Synonym:
Exon (10)1950..2069
Gene Synonym:
Exon (11)2070..2326
Gene Synonym:
Exon (12)2327..2474
Gene Synonym:
Exon (13)2475..2582
Gene Synonym:
Exon (14)2583..2797
Gene Synonym:
Exon (15)2798..2920
Gene Synonym:
Exon (16)2921..2991
Gene Synonym:
Exon (17)2992..3129
Gene Synonym:
Exon (18)3130..3229
Gene Synonym:
Exon (19)3230..3377
Gene Synonym:
Exon (20)3378..5617
Gene Synonym:
Position Chain Variation Link
7 7 a, g dbSNP:112715174
30 30 a, c dbSNP:548774475
31 31 g, t dbSNP:567112195
123 123 c, t dbSNP:3128725
140 140 c, t dbSNP:765384640
154 154 c, g dbSNP:751005619
221 221 c, g dbSNP:587780812
233 233 -, tgctgctgc dbSNP:768132465
234 234 -, tgc dbSNP:778434166
269 269 c, t dbSNP:377160777
271 271 a, g dbSNP:369519655
272 272 a, g dbSNP:779905135
285 285 c, t dbSNP:76764689
286 286 a, g dbSNP:139821724
289 289 a, g dbSNP:768485233
299 299 c, t dbSNP:777042445
304 304 a, g dbSNP:762096025
308 308 c, t dbSNP:373420806
315 315 c, t dbSNP:773375434
324 324 c, t dbSNP:763526874
325 325 a, g dbSNP:1800858
329 329 a, g dbSNP:529018971
334 334 a, g dbSNP:759872307
347 347 a, g dbSNP:547308774
349 349 c, t dbSNP:753523209
351 351 a, g dbSNP:756858300
355 355 c, g dbSNP:778409475
356 356 a, c, t dbSNP:145633958
360 360 a, g dbSNP:779915615
364 364 c, t dbSNP:746943314
365 365 a, g dbSNP:376565365
367 367 a, c dbSNP:370622218
368 368 c, t dbSNP:748402485
377 377 g, t dbSNP:770081020
379 379 a, g dbSNP:773428442
381 381 c, t dbSNP:77596424
389 389 c, t dbSNP:749390385
390 390 a, g dbSNP:192489011
391 391 a, c, t dbSNP:200328158
394 394 a, g, t dbSNP:148874112
409 409 c, t dbSNP:761460588
410 410 a, g dbSNP:764938319
414 414 c, t dbSNP:142641173
415 415 a, g dbSNP:151267865
420 420 a, g dbSNP:570176656
421 421 a, c dbSNP:3123654
425 425 c, t dbSNP:537523906
442 442 c, g dbSNP:754912942
452 452 a, c, g dbSNP:141679950
460 460 a, g dbSNP:755967110
463 463 c, t dbSNP:761325339
486 486 a, g dbSNP:749500174
494 494 a, g dbSNP:201244749
498 498 a, g dbSNP:375390467
502 502 c, t dbSNP:746378333
512 512 a, c dbSNP:567877611
514 514 c, g dbSNP:775974393
517 517 c, g dbSNP:761086815
519 519 a, g dbSNP:764421264
523 523 c, g dbSNP:772779267
524 524 c, t dbSNP:762626209
525 525 a, g dbSNP:587780814
530 530 c, t dbSNP:747483905
531 531 a, g dbSNP:76397662
532 532 c, t dbSNP:143083395
540 540 a, c dbSNP:763295929
541 541 c, t dbSNP:267602487
545 545 c, g dbSNP:764496948
551 551 a, g dbSNP:770548816
561 561 a, t dbSNP:773868504
565 565 a, c dbSNP:1800859
581 581 c, t dbSNP:375576038
588 588 a, g dbSNP:138265837
595 595 c, t dbSNP:142345108
596 596 a, g, t dbSNP:79014735
611 611 a, g dbSNP:749190212
612 612 a, g dbSNP:770840152
621 621 a, g dbSNP:551142665
622 622 c, t dbSNP:756999107
634 634 -, ctt dbSNP:776989694
642 642 a, g dbSNP:150261092
646 646 a, c dbSNP:750621402
658 658 c, t dbSNP:141290380
663 663 a, g dbSNP:780067540
668 668 c, t dbSNP:747536732
677 677 a, c dbSNP:371153966
678 678 a, g dbSNP:149403911
692 692 c, t dbSNP:748609507
695 695 a, g dbSNP:374514956
699 699 c, t dbSNP:200547906
708 708 c, t dbSNP:368431125
714 714 a, g dbSNP:774097284
718 718 g, t dbSNP:556686338
719 719 c, t dbSNP:765654609
720 720 a, g dbSNP:759229505
728 728 c, t dbSNP:76449634
729 729 a, g dbSNP:370736139
734 734 c, t dbSNP:775086466
738 738 a, g dbSNP:144801580
740 740 a, c dbSNP:753301491
751 751 a, g dbSNP:764162555
756 756 a, g dbSNP:753707182
772 772 a, g dbSNP:368116579
781 781 c, t dbSNP:764910706
782 782 a, c dbSNP:76736111
783 783 c, g dbSNP:750675926
787 787 c, t dbSNP:55810667
793 793 c, t dbSNP:780120451
794 794 a, g dbSNP:751572082
797 797 a, g dbSNP:755007607
814 814 g, t dbSNP:781750106
834 834 a, g, t dbSNP:748128929
844 844 a, g dbSNP:137928436
857 857 a, g dbSNP:587780815
863 863 a, c dbSNP:766136271
864 864 c, t dbSNP:774670305
868 868 c, t dbSNP:142421698
872 872 c, g, t dbSNP:760813493
876 876 c, t dbSNP:767654905
882 882 a, g dbSNP:79661516
883 883 c, t dbSNP:576806329
889 889 a, g dbSNP:786203642
891 891 g, t dbSNP:756216318
892 892 g, t dbSNP:764759271
908 908 a, c, g dbSNP:375120544
910 910 a, g dbSNP:779382077
913 913 c, t dbSNP:544252468
916 916 a, g dbSNP:377193354
917 917 a, t dbSNP:112448213
921 921 c, t dbSNP:145970248
926 926 a, c, g dbSNP:780756440
928 928 c, t dbSNP:769279838
930 930 a, c, t dbSNP:61843232
931 931 c, t dbSNP:777733752
933 933 c, g dbSNP:749189193
941 941 a, g dbSNP:562449603
947 947 a, g dbSNP:587780816
950 950 a, g dbSNP:554862459
953 953 a, t dbSNP:770741709
959 959 a, c dbSNP:773964804
966 966 a, c, t dbSNP:759812068
970 970 a, g dbSNP:764749007
974 974 a, g dbSNP:775772444
975 975 c, t dbSNP:139790943
993 993 c, g dbSNP:764239646
1006 1006 c, t dbSNP:754428451
1011 1011 a, c dbSNP:762363830
1014 1014 g, t dbSNP:143209223
1015 1015 c, t dbSNP:150797149
1016 1016 a, g, t dbSNP:139213499
1022 1022 a, g dbSNP:541929171
1023 1023 a, c dbSNP:35118262
1024 1024 c, t dbSNP:41306550
1025 1025 a, g dbSNP:777221273
1028 1028 a, c dbSNP:749244375
1032 1032 c, g dbSNP:745642574
1033 1033 c, t dbSNP:770794801
1045 1045 c, g dbSNP:778909045
1047 1047 a, c dbSNP:745710576
1058 1058 -, g dbSNP:36008607
1064 1064 a, g dbSNP:34682185
1068 1068 c, t dbSNP:745790708
1074 1074 c, t dbSNP:758159521
1078 1078 c, g dbSNP:779849973
1087 1087 c, t dbSNP:529153319
1096 1096 c, t dbSNP:768934031
1105 1105 c, t dbSNP:776987390
1111 1111 a, g dbSNP:748294306
1115 1115 c, g dbSNP:769894584
1118 1118 a, c dbSNP:773631693
1120 1120 c, g dbSNP:763473665
1128 1128 a, g dbSNP:77702891
1133 1133 a, c dbSNP:774637214
1140 1140 c, t dbSNP:760322514
1141 1141 g, t dbSNP:375812189
1147 1147 a, c dbSNP:149926238
1150 1150 a, c, t dbSNP:756761746
1151 1151 a, g dbSNP:377767388
1162 1162 c, g dbSNP:758298916
1163 1163 a, g dbSNP:779719517
1164 1164 c, t dbSNP:746865459
1165 1165 c, t dbSNP:754806583
1172 1172 a, g dbSNP:781613821
1179 1179 a, g dbSNP:80236571
1183 1183 a, g dbSNP:377200874
1188 1188 a, c dbSNP:769791074
1198 1198 c, g, t dbSNP:144981275
1203 1203 a, c, t dbSNP:377767433
1206 1206 c, t dbSNP:774829203
1207 1207 a, g dbSNP:369810881
1208 1208 g, t dbSNP:367737920
1218 1218 a, c, g dbSNP:776300640
1219 1219 c, t dbSNP:764668178
1220 1220 a, g dbSNP:749883001
1221 1221 a, g dbSNP:762367597
1223 1223 a, g dbSNP:766480138
1230 1230 c, t dbSNP:200641186
1233 1233 a, g dbSNP:751518221
1236 1236 c, g, t dbSNP:754859905
1237 1237 a, g dbSNP:373208682
1239 1239 c, t dbSNP:587778660
1240 1240 c, t dbSNP:142188675
1241 1241 a, g dbSNP:777716061
1242 1242 a, t dbSNP:749449032
1253 1253 a, g, t dbSNP:145402131
1269 1269 a, g dbSNP:762472027
1273 1273 a, c dbSNP:770587835
1274 1274 a, c dbSNP:773935854
1278 1278 c, g dbSNP:766881522
1282 1282 c, t dbSNP:759548155
1284 1284 c, t dbSNP:763670106
1285 1285 a, g dbSNP:201992974
1287 1287 a, g dbSNP:760560422
1290 1290 a, g dbSNP:763759702
1292 1292 c, t dbSNP:754116867
1293 1293 a, g dbSNP:199529397
1300 1300 a, g dbSNP:765305476
1306 1306 c, g dbSNP:750569981
1308 1308 c, t dbSNP:546866208
1309 1309 a, g dbSNP:113931414
1314 1314 a, t dbSNP:142338976
1325 1325 -, cag dbSNP:763559646
1329 1329 a, c dbSNP:755400887
1331 1331 c, t dbSNP:781362020
1332 1332 g, t dbSNP:139813765
1336 1336 a, g dbSNP:770637118
1338 1338 a, g dbSNP:774139424
1340 1340 c, g dbSNP:536298339
1341 1341 c, g dbSNP:771679592
1347 1347 c, t dbSNP:115272158
1348 1348 a, g dbSNP:373540097
1351 1351 c, t dbSNP:763967472
1352 1352 a, g dbSNP:776223166
1353 1353 c, t dbSNP:751939820
1363 1363 c, g dbSNP:757868491
1369 1369 a, c dbSNP:78098482
1372 1372 c, t dbSNP:376465385
1377 1377 c, t dbSNP:781646869
1378 1378 a, g dbSNP:758510657
1379 1379 a, g dbSNP:183729115
1387 1387 a, g dbSNP:148371113
1391 1391 a, t dbSNP:140638866
1393 1393 c, t dbSNP:781623106
1405 1405 c, t dbSNP:748588678
1406 1406 a, g dbSNP:756532455
1412 1412 a, t dbSNP:778754580
1414 1414 c, t dbSNP:745479264
1416 1416 c, g dbSNP:771636042
1423 1423 c, t dbSNP:779374978
1424 1424 a, g dbSNP:746970700
1438 1438 c, t dbSNP:768547052
1440 1440 a, g dbSNP:201030628
1443 1443 a, c, g dbSNP:371731991
1448 1448 a, g dbSNP:769548635
1454 1454 a, g dbSNP:749107291
1456 1456 c, t dbSNP:759582152
1457 1457 a, g, t dbSNP:767601598
1462 1462 a, c dbSNP:761207209
1463 1463 c, g dbSNP:764558748
1465 1465 c, g dbSNP:200458714
1474 1474 a, g dbSNP:757632555
1475 1475 a, g dbSNP:779625196
1480 1480 c, g dbSNP:202053997
1482 1482 a, g dbSNP:754481151
1484 1484 g, t dbSNP:780630024
1485 1485 ca, tg dbSNP:386743165
1485 1485 a, c, t dbSNP:552057730
1486 1486 a, g dbSNP:1800860
1495 1495 c, t dbSNP:749093977
1496 1496 a, g dbSNP:770736612
1502 1502 a, g dbSNP:774474422
1516 1516 a, g dbSNP:746055866
1517 1517 c, t dbSNP:772292843
1526 1526 c, g dbSNP:115423919
1533 1533 a, c dbSNP:760832715
1534 1534 c, g dbSNP:549907428
1542 1542 c, t dbSNP:774092678
1543 1543 a, g, t dbSNP:201568301
1544 1544 a, c dbSNP:151148041
1547 1547 a, g dbSNP:754598663
1552 1552 a, g dbSNP:35717926
1553 1553 a, g dbSNP:145966037
1554 1554 c, t dbSNP:752267460
1561 1561 a, t dbSNP:376464605
1564 1564 c, t dbSNP:190750926
1565 1565 a, c, g dbSNP:539995816
1566 1566 a, t dbSNP:757031867
1576 1576 a, g dbSNP:587780807
1589 1589 c, g dbSNP:200334340
1595 1595 a, c, g dbSNP:772489699
1610 1610 c, t dbSNP:775842917
1611 1611 a, g dbSNP:747139265
1613 1613 c, t dbSNP:746512075
1614 1614 a, g dbSNP:138624658
1617 1617 c, t dbSNP:762335805
1627 1627 c, t dbSNP:576806356
1628 1628 a, g dbSNP:537874538
1630 1630 a, t dbSNP:763296134
1631 1631 c, g dbSNP:767210575
1638 1638 a, g dbSNP:752322996
1640 1640 a, t dbSNP:755660496
1641 1641 c, t dbSNP:763617146
1652 1652 a, t dbSNP:753733901
1655 1655 a, g dbSNP:9282834
1657 1657 a, c dbSNP:372648203
1659 1659 a, g dbSNP:750291418
1666 1666 c, g dbSNP:758249079
1667 1667 c, t dbSNP:780467203
1672 1672 a, g dbSNP:200088863
1678 1678 c, t dbSNP:747196645
1683 1683 c, t dbSNP:375677628
1686 1686 a, g dbSNP:781272120
1691 1691 c, g dbSNP:199572076
1694 1694 a, g dbSNP:770395347
1700 1700 a, g dbSNP:773576143
1706 1706 c, g dbSNP:763356763
1708 1708 g, t dbSNP:771254720
1712 1712 c, t dbSNP:775152474
1719 1719 c, t dbSNP:201745826
1720 1720 c, t dbSNP:553492964
1721 1721 a, g dbSNP:201553718
1728 1728 c, g dbSNP:149238501
1729 1729 a, g dbSNP:761430718
1734 1734 ct, gc dbSNP:377767389
1739 1739 c, g dbSNP:764616982
1741 1741 a, g dbSNP:750411593
1748 1748 a, g dbSNP:762930066
1757 1757 a, c dbSNP:766278774
1759 1759 a, g dbSNP:751464792
1763 1763 c, g, t dbSNP:545625150
1764 1764 a, g dbSNP:752830820
1767 1767 c, t dbSNP:756248937
1779 1779 a, g dbSNP:777778956
1781 1781 c, t dbSNP:377767390
1783 1783 -, gaggagtgt dbSNP:377767434
1784 1784 -, aggagtgtg dbSNP:672601328
1786 1786 c, t dbSNP:144460361
1787 1787 a, g, t dbSNP:75873440
1790 1790 c, t dbSNP:779380912
1802 1802 a, g dbSNP:746279995
1803 1803 c, g dbSNP:148406803
1808 1808 a, g dbSNP:543376293
1810 1810 c, g dbSNP:776381183
1831 1831 c, t dbSNP:747710595
1832 1832 a, g dbSNP:374461212
1837 1837 a, c dbSNP:772784061
1839 1839 a, g dbSNP:747844360
1851 1851 a, g dbSNP:200047805
1855 1855 c, t dbSNP:761815073
1858 1858 c, g dbSNP:141771814
1868 1868 c, t dbSNP:748852160
1871 1871 a, c, t dbSNP:201972250
1874 1874 a, t dbSNP:759342879
1876 1876 c, t dbSNP:767502292
1885 1885 c, t dbSNP:775079681
1888 1888 c, t dbSNP:760507059
1889 1889 a, g dbSNP:147219360
1891 1891 c, t dbSNP:201209972
1892 1892 a, g dbSNP:140464432
1896 1896 a, g dbSNP:765256156
1900 1900 a, c dbSNP:144015580
1901 1901 a, g dbSNP:750958377
1907 1907 a, g dbSNP:758766818
1914 1914 c, t dbSNP:587780808
1915 1915 c, g dbSNP:780609440
1927 1927 c, g dbSNP:144455821
1945 1945 c, t dbSNP:755369964
1946 1946 c, t dbSNP:777604634
1949 1949 c, t dbSNP:748905470
1954 1954 a, c dbSNP:753557244
1955 1955 a, c dbSNP:786202597
1961 1961 a, g dbSNP:776013456
1963 1963 c, t dbSNP:756902570
1970 1970 c, t dbSNP:778622905
1988 1988 c, t dbSNP:745418960
1989 1989 a, g dbSNP:377767393
1993 1993 g, t dbSNP:779889311
1997 1997 a, c dbSNP:377767394
2000 2000 a, g dbSNP:746901176
2006 2006 c, t dbSNP:199921511
2007 2007 a, g dbSNP:377767395
2014 2014 a, c dbSNP:776346079
2015 2015 a, c, g, t dbSNP:77558292
2016 2016 a, c, g, t dbSNP:77939446
2017 2017 c, g dbSNP:377767396
2021 2021 a, c, g, t dbSNP:377767391
2022 2022 at, ct, gc, tt dbSNP:377767398
2022 2022 a, c, g, t dbSNP:377767397
2023 2023 c, g dbSNP:80069458
2024 2024 -, ttccctgaggaggagaagtgcttctgc dbSNP:121913313
2028 2028 c, t dbSNP:761596036
2030 2030 -, gag dbSNP:750189678
2030 2030 a, g dbSNP:769971379
2036 2036 -, gag dbSNP:377767399
2042 2042 a, c, g, t dbSNP:76262710
2043 2043 a, c, g, t dbSNP:79781594
2044 2044 c, g dbSNP:377767400
2047 2047 c, t dbSNP:377767401
2048 2048 a, c, g, t dbSNP:77316810
2049 2049 a, c, g, t dbSNP:77503355
2050 2050 c, g, t dbSNP:79890926
2053 2053 a, g dbSNP:766438951
2056 2056 c, g, t dbSNP:201979255
2057 2057 a, g dbSNP:377767402
2068 2068 a, g dbSNP:147692872
2072 2072 c, t dbSNP:754466051
2074 2074 a, t dbSNP:786202671
2078 2078 c, t dbSNP:377767404
2079 2079 a, c, g, t dbSNP:377767405
2080 2080 c, t dbSNP:781145070
2081 2081 -, gac dbSNP:377767435
2081 2081 a, g, t dbSNP:377767406
2082 2082 a, c, g, t dbSNP:121913308
2083 2083 -, cgagct dbSNP:121913307
2083 2083 a, c, t dbSNP:55846256
2084 2084 -, gagctg dbSNP:121913312
2084 2084 a, g dbSNP:377767407
2085 2085 agctgtgccgcacggtgatcgcag, tgcggc dbSNP:121913310
2085 2085 -, agc dbSNP:121913311
2086 2086 cgtgc, gctgt dbSNP:377767408
2086 2086 cg, gc dbSNP:267607009
2086 2086 c, g dbSNP:387906531
2087 2087 c, g dbSNP:267607010
2090 2090 a, c, g, t dbSNP:75076352
2091 2091 gc, tg dbSNP:377767409
2091 2091 a, c, g, t dbSNP:75996173
2092 2092 c, g dbSNP:77709286
2093 2093 -, acgagctgtgcc dbSNP:377767436
2093 2093 c, g, t dbSNP:377767410
2094 2094 a, g dbSNP:776164321
2096 2096 a, gacctgtgccgcc dbSNP:377767438
2098 2098 -, tgccgcacg dbSNP:377767437
2101 2101 g, t dbSNP:761187737
2104 2104 c, t dbSNP:375041479
2105 2105 a, g, t dbSNP:777122776
2109 2109 c, g dbSNP:78935588
2110 2110 c, t dbSNP:149768519
2111 2111 a, g, t dbSNP:377767411
2114 2114 c, g dbSNP:759073728
2116 2116 c, g dbSNP:766962871
2131 2131 c, t dbSNP:75225191
2132 2132 a, g dbSNP:77711105
2136 2136 c, t dbSNP:148935214
2137 2137 a, g dbSNP:377767412
2148 2148 c, g dbSNP:753724503
2153 2153 c, t dbSNP:756978792
2164 2164 c, g dbSNP:779310191
2185 2185 c, g dbSNP:377767413
2186 2186 a, c, g dbSNP:143795581
2187 2187 a, c, t dbSNP:377767439
2188 2188 c, g, t dbSNP:146646971
2188 2188 g, ttct dbSNP:377767440
2191 2191 a, t dbSNP:563316790
2195 2195 a, g, t dbSNP:776986585
2207 2207 a, g dbSNP:3026759
2208 2208 a, c dbSNP:770100231
2220 2220 a, g dbSNP:536038262
2227 2227 c, t dbSNP:55862116
2228 2228 a, g dbSNP:184498773
2231 2231 c, g dbSNP:567241943
2240 2240 c, t dbSNP:141347316
2241 2241 c, t dbSNP:760088950
2242 2242 a, g dbSNP:145122337
2243 2243 a, g dbSNP:753686782
2248 2248 c, t dbSNP:757141171
2250 2250 a, g dbSNP:778793244
2252 2252 c, t dbSNP:750681372
2260 2260 c, t dbSNP:201550433
2261 2261 a, g dbSNP:1799939
2269 2269 c, g dbSNP:747166722
2270 2270 c, t dbSNP:193922700
2271 2271 a, g dbSNP:141185224
2275 2275 c, t dbSNP:571603831
2278 2278 a, g dbSNP:150329150
2288 2288 a, t dbSNP:377767441
2301 2301 a, t dbSNP:770155054
2306 2306 a, g dbSNP:137855422
2314 2314 c, t dbSNP:749646777
2315 2315 c, t dbSNP:771768140
2318 2318 a, g dbSNP:3026760
2319 2319 a, g dbSNP:774983492
2325 2325 c, t dbSNP:760272063
2329 2329 a, g dbSNP:149460492
2335 2335 -, a dbSNP:66858251
2356 2356 g, t dbSNP:527726480
2372 2372 a, g dbSNP:147216744
2380 2380 a, g dbSNP:377616279
2389 2389 c, t dbSNP:587780809
2399 2399 a, c dbSNP:768217520
2404 2404 a, g dbSNP:776073471
2412 2412 c, g dbSNP:761397627
2414 2414 a, g dbSNP:552131086
2415 2415 c, t dbSNP:773256580
2416 2416 a, g dbSNP:762876946
2422 2422 c, g dbSNP:766035127
2424 2424 a, g, t dbSNP:534094626
2427 2427 -, g dbSNP:35938496
2427 2427 c, t dbSNP:755085530
2436 2436 c, g dbSNP:34288963
2439 2439 c, g dbSNP:752830000
2441 2441 g, t dbSNP:756163867
2442 2442 a, g dbSNP:778292678
2448 2448 c, t dbSNP:749755131
2451 2451 c, t dbSNP:181856591
2452 2452 a, g dbSNP:779080598
2458 2458 c, t dbSNP:370791179
2478 2478 a, t dbSNP:199882293
2479 2479 c, t dbSNP:777349208
2480 2480 a, g dbSNP:748799148
2483 2483 c, t dbSNP:75075748
2488 2488 a, g, t dbSNP:140658743
2494 2494 a, c, g, t dbSNP:78014899
2495 2495 c, t dbSNP:142793711
2497 2497 a, g, t dbSNP:1800861
2498 2498 c, t dbSNP:775711017
2499 2499 a, g dbSNP:377767414
2512 2512 a, g dbSNP:760821097
2520 2520 a, g dbSNP:377767415
2521 2521 c, t dbSNP:753977221
2522 2522 a, g dbSNP:75686697
2532 2532 a, g dbSNP:377767416
2538 2538 a, c, g dbSNP:587778656
2548 2548 c, t dbSNP:758715544
2558 2558 c, t dbSNP:780512298
2559 2559 g, t dbSNP:149148794
2560 2560 c, g, t dbSNP:75030001
2561 2561 a, t dbSNP:377767417
2562 2562 a, t dbSNP:77724903
2566 2566 a, g dbSNP:756758769
2587 2587 a, g dbSNP:776737136
2596 2596 c, t dbSNP:748339853
2599 2599 c, t dbSNP:535051804
2600 2600 a, c, g, t dbSNP:79658334
2602 2602 a, g dbSNP:767045208
2603 2603 a, g dbSNP:377767418
2607 2607 a, g dbSNP:377767419
2608 2608 c, t dbSNP:553418132
2609 2609 a, g dbSNP:760012685
2613 2613 a, c dbSNP:767945255
2614 2614 a, c dbSNP:753446269
2617 2617 c, t dbSNP:577929869
2618 2618 a, g dbSNP:764784013
2620 2620 c, g dbSNP:749997455
2622 2622 c, g dbSNP:587778657
2626 2626 a, g dbSNP:757872133
2627 2627 c, t dbSNP:779996040
2635 2635 c, g dbSNP:751447014
2638 2638 a, c dbSNP:368500000
2639 2639 c, t dbSNP:142318626
2641 2641 a, c, t dbSNP:747894751
2642 2642 a, g dbSNP:377767420
2646 2646 g, t dbSNP:377767421
2647 2647 c, t dbSNP:375322585
2651 2651 a, g dbSNP:749421642
2657 2657 a, g dbSNP:138847998
2658 2658 a, g dbSNP:142779213
2667 2667 a, c dbSNP:34617196
2671 2671 a, g dbSNP:775022842
2675 2675 a, g dbSNP:113005278
2678 2678 a, g dbSNP:200127630
2681 2681 a, g dbSNP:775981129
2682 2682 g, t dbSNP:760924186
2686 2686 c, g dbSNP:764979358
2687 2687 c, t dbSNP:377767422
2688 2688 a, g dbSNP:587782636
2691 2691 a, c dbSNP:147433153
2698 2698 c, t dbSNP:1800862
2710 2710 c, t dbSNP:751498307
2712 2712 c, g, t dbSNP:149891333
2713 2713 a, g, t dbSNP:56195026
2717 2717 a, g dbSNP:755837568
2719 2719 g, t dbSNP:377767423
2720 2720 c, t dbSNP:377767424
2721 2721 a, g, t dbSNP:55947360
2725 2725 c, t dbSNP:377767425
2726 2726 c, g dbSNP:771150081
2728 2728 c, t dbSNP:201816539
2733 2733 a, c, t dbSNP:201101792
2734 2734 a, g dbSNP:772684105
2735 2735 c, g dbSNP:775828448
2736 2736 a, g dbSNP:761130672
2737 2737 c, t dbSNP:770674650
2738 2738 a, g dbSNP:772862503
2744 2744 a, g dbSNP:561276725
2746 2746 c, g dbSNP:377767426
2755 2755 c, t dbSNP:773912702
2773 2773 a, g dbSNP:146628741
2788 2788 c, t dbSNP:202029768
2789 2789 a, g dbSNP:758950128
2791 2791 g, t dbSNP:141459368
2800 2800 c, t dbSNP:575629307
2801 2801 a, g dbSNP:145170911
2831 2831 c, g dbSNP:377767427
2836 2836 agc, ttt dbSNP:121913306
2837 2837 gc, tt dbSNP:377767429
2837 2837 a, g dbSNP:377767428
2843 2843 a, g dbSNP:201487882
2846 2846 c, t dbSNP:146838520
2847 2847 a, g dbSNP:373594744
2851 2851 a, g dbSNP:771617878
2852 2852 a, g dbSNP:774930499
2861 2861 g, t dbSNP:75234356
2863 2863 a, g dbSNP:201620214
2866 2866 c, t dbSNP:768753935
2869 2869 c, t dbSNP:768188546
2873 2873 a, t dbSNP:761720362
2875 2875 g, t dbSNP:765065650
2880 2880 a, g dbSNP:76087194
2882 2882 -, gatgtttatgaa dbSNP:121913309
2882 2882 g, t dbSNP:587780810
2899 2899 a, t dbSNP:763149032
2901 2901 c, g, t dbSNP:267607011
2902 2902 a, c, g dbSNP:1800863
2905 2905 c, t dbSNP:755023496
2906 2906 a, g dbSNP:200627072
2909 2909 a, g dbSNP:377767430
2910 2910 a, t dbSNP:377767431
2913 2913 a, g dbSNP:753156691
2925 2925 a, c, g, t dbSNP:78347871
2927 2927 a, c dbSNP:759637689
2932 2932 a, g dbSNP:375963128
2942 2942 a, g dbSNP:377767442
2943 2943 c, t dbSNP:74799832
2944 2944 a, g dbSNP:753208054
2948 2948 a, g dbSNP:527787676
2949 2949 c, t dbSNP:778330709
2955 2955 a, c dbSNP:377767432
2966 2966 c, g, t dbSNP:774215008
2974 2974 c, t dbSNP:779594537
2977 2977 a, c dbSNP:747648232
2980 2980 a, g dbSNP:746599792
3008 3008 c, t dbSNP:780967888
3013 3013 a, g dbSNP:747696868
3022 3022 c, t dbSNP:755606269
3023 3023 a, g dbSNP:587780811
3034 3034 a, g dbSNP:749196396
3039 3039 a, t dbSNP:770639985
3065 3065 c, t dbSNP:587778658
3066 3066 a, g dbSNP:745650861
3075 3075 a, g dbSNP:369804828
3076 3076 c, t dbSNP:772329940
3080 3080 c, t dbSNP:533682776
3087 3087 c, t dbSNP:760765930
3088 3088 c, t dbSNP:373693875
3089 3089 a, g dbSNP:777007074
3092 3092 c, t dbSNP:762448300
3104 3104 a, g dbSNP:76534745
3121 3121 c, g, t dbSNP:375414982
3122 3122 a, g dbSNP:758800351
3124 3124 a, g dbSNP:767306671
3126 3126 a, g dbSNP:752352085
3133 3133 c, t dbSNP:147318495
3134 3134 c, t dbSNP:17158558
3135 3135 a, g, t dbSNP:368550200
3165 3165 c, t dbSNP:758191409
3166 3166 a, g dbSNP:528823385
3172 3172 a, c dbSNP:199718928
3178 3178 a, g dbSNP:145798106
3179 3179 c, g dbSNP:781236624
3186 3186 c, t dbSNP:748288493
3187 3187 a, g dbSNP:376487144
3194 3194 a, c dbSNP:773872326
3195 3195 a, g dbSNP:763489828
3196 3196 c, t dbSNP:370970483
3207 3207 -, aga dbSNP:775993413
3209 3209 a, g dbSNP:774840230
3210 3210 a, t dbSNP:759798237
3211 3211 g, t dbSNP:786204098
3216 3216 c, t dbSNP:375213011
3221 3221 a, g dbSNP:368345402
3223 3223 a, g dbSNP:547501933
3240 3240 a, g dbSNP:762414334
3242 3242 c, t dbSNP:766330880
3244 3244 -, g dbSNP:769302056
3247 3247 a, g dbSNP:369579749
3249 3249 c, g, t dbSNP:372191563
3250 3250 a, g dbSNP:767152839
3258 3258 c, t dbSNP:138912894
3261 3261 c, g dbSNP:752534928
3268 3268 c, t dbSNP:756466984
3280 3280 c, t dbSNP:142859395
3281 3281 a, g dbSNP:200989078
3283 3283 c, t dbSNP:369116900
3284 3284 a, g dbSNP:757373375
3293 3293 -, gag dbSNP:774509758
3302 3302 a, g dbSNP:201740483
3303 3303 c, t dbSNP:200021472
3306 3306 a, c, t dbSNP:79853121
3307 3307 a, g dbSNP:775773414
3313 3313 a, g dbSNP:147437610
3318 3318 a, g dbSNP:769476062
3321 3321 a, g dbSNP:772807570
3328 3328 a, c dbSNP:201576838
3329 3329 c, t dbSNP:369152977
3331 3331 c, t dbSNP:372673589
3332 3332 c, g, t dbSNP:774347808
3338 3338 c, g dbSNP:767479170
3339 3339 a, g dbSNP:200956659
3343 3343 a, c dbSNP:755946631
3346 3346 c, t dbSNP:191769748
3347 3347 a, c dbSNP:754066766
3355 3355 a, g dbSNP:200289472
3356 3356 c, t dbSNP:373423271
3359 3359 a, g dbSNP:750501039
3360 3360 c, t dbSNP:758877145
3363 3363 a, g, t dbSNP:780578577
3364 3364 a, c dbSNP:569004816
3366 3366 a, g dbSNP:772395752
3369 3369 a, g dbSNP:370756353
3372 3372 c, t dbSNP:536486113
3374 3374 c, t dbSNP:138010639
3375 3375 a, g dbSNP:587778659
3381 3381 c, t dbSNP:149513065
3382 3382 a, g dbSNP:144730090
3386 3386 a, c, g dbSNP:180700967
3389 3389 c, t dbSNP:775583354
3390 3390 c, t dbSNP:760625882
3394 3394 c, t dbSNP:768699100
3396 3396 c, g dbSNP:776615468
3407 3407 a, c dbSNP:763823142
3414 3414 c, t dbSNP:751191202
3421 3421 a, c, g dbSNP:765409417
3423 3423 c, t dbSNP:762952212
3424 3424 a, g dbSNP:766376008
3428 3428 a, g dbSNP:751631684
3431 3431 a, g dbSNP:745955777
3433 3433 c, t dbSNP:144192900
3438 3438 c, t dbSNP:753047418
3443 3443 a, g dbSNP:756465544
3446 3446 a, g dbSNP:778452896
3460 3460 c, t dbSNP:745469112
3465 3465 a, g dbSNP:757852794
3472 3472 c, t dbSNP:779779706
3476 3476 c, t dbSNP:746493433
3477 3477 a, g dbSNP:768752146
3480 3480 c, g dbSNP:776668647
3490 3490 c, g dbSNP:747917164
3492 3492 c, t dbSNP:769570496
3495 3495 c, t dbSNP:773306778
3504 3504 c, t dbSNP:532862288
3505 3505 a, g dbSNP:766572480
3513 3513 a, t dbSNP:774465548
3515 3515 a, g dbSNP:759584544
3516 3516 c, t dbSNP:587780813
3523 3523 a, g dbSNP:753203348
3525 3525 c, t dbSNP:756449491
3526 3526 c, t dbSNP:146049841
3542 3542 -, t dbSNP:767797283
3543 3543 c, t dbSNP:754150221
3551 3551 a, g dbSNP:552689504
3552 3552 a, g dbSNP:758171346
3564 3564 a, c dbSNP:199639914
3580 3580 a, g dbSNP:746548497
3583 3583 a, g dbSNP:554412445
3596 3596 c, t dbSNP:572882220
3601 3601 a, g dbSNP:528719922
3619 3619 a, g dbSNP:558718557
3623 3623 c, t dbSNP:576596502
3630 3630 c, t dbSNP:17028
3636 3636 a, g dbSNP:562423497
3637 3637 c, t dbSNP:771806847
3661 3661 a, c dbSNP:574541792
3662 3662 a, g dbSNP:542197260
3745 3745 a, g dbSNP:772972038
3770 3770 g, t dbSNP:750235070
3794 3794 c, t dbSNP:760430228
3865 3865 a, g dbSNP:141460872
3903 3903 g, t dbSNP:756051983
3909 3909 g, t dbSNP:74985876
3923 3923 a, g dbSNP:3026782
3953 3953 a, c dbSNP:776208853
3959 3959 c, t dbSNP:564684954
4015 4015 a, g dbSNP:112831036
4021 4021 a, g dbSNP:550523226
4026 4026 -, g dbSNP:201945709
4027 4027 c, g dbSNP:568766449
4029 4029 g, t dbSNP:759025154
4030 4030 c, g dbSNP:764840727
4033 4033 a, g dbSNP:771336993
4035 4035 c, t dbSNP:564665995
4042 4042 g, t dbSNP:548173921
4043 4043 c, t dbSNP:566296190
4103 4103 c, t dbSNP:533907181
4107 4107 a, g dbSNP:558217664
4110 4110 c, g dbSNP:576656916
4111 4111 a, g dbSNP:185408658
4135 4135 a, t dbSNP:2742240
4207 4207 a, g dbSNP:574402179
4217 4217 a, t dbSNP:764746553
4222 4222 a, g dbSNP:541713530
4263 4263 a, t dbSNP:3026783
4284 4284 c, g dbSNP:554160069
4306 4306 c, t dbSNP:572314050
4312 4312 c, t dbSNP:373663381
4313 4313 a, g dbSNP:751939293
4336 4336 a, g dbSNP:546311946
4379 4379 c, t dbSNP:190116296
4403 4403 c, t dbSNP:564549781
4416 4416 c, t dbSNP:531989073
4456 4456 c, t dbSNP:550170271
4477 4477 a, c dbSNP:757629939
4516 4516 g, t dbSNP:544018393
4553 4553 c, t dbSNP:138493014
4558 4558 a, g dbSNP:529592624
4581 4581 c, g dbSNP:143948954
4584 4584 c, g dbSNP:756179310
4651 4651 c, t dbSNP:2435355
4665 4665 a, g dbSNP:572936041
4726 4726 a, c dbSNP:758303610
4747 4747 c, t dbSNP:551902553
4759 4759 c, t dbSNP:570206266
4774 4774 g, t dbSNP:777756501
4790 4790 a, t dbSNP:746810657
4795 4795 c, t dbSNP:535667130
4804 4804 c, t dbSNP:9971097
4809 4809 c, g dbSNP:147336674
4821 4821 -, g dbSNP:35856296
4832 4832 a, g dbSNP:761472636
4848 4848 a, g dbSNP:776277370
4860 4860 c, t dbSNP:555944246
4861 4861 c, t dbSNP:141016377
4869 4869 a, c, t dbSNP:745534552
4883 4883 a, g dbSNP:149252070
4916 4916 a, g dbSNP:115358030
4965 4965 a, g dbSNP:775114955
4977 4977 c, g dbSNP:762590499
4985 4985 a, g dbSNP:764691685
4990 4990 a, c dbSNP:3026784
5005 5005 a, g dbSNP:555071393
5012 5012 a, g dbSNP:148393331
5024 5024 a, g, t dbSNP:535080963
5041 5041 a, g dbSNP:2742241
5067 5067 c, g dbSNP:181388347
5090 5090 g, t dbSNP:762178593
5093 5093 a, c dbSNP:142572876
5104 5104 c, g dbSNP:186000190
5118 5118 a, g dbSNP:192065891
5126 5126 a, g dbSNP:76759170
5134 5134 a, g dbSNP:145954635
5149 5149 a, g dbSNP:756269717
5179 5179 c, g dbSNP:117119161
5186 5186 g, t dbSNP:753913049
5189 5189 a, g dbSNP:139925563
5217 5217 a, g dbSNP:544885679
5277 5277 a, g dbSNP:143369221
5284 5284 a, g dbSNP:755113276
5347 5347 a, c dbSNP:183817000
5405 5405 c, t dbSNP:146771196
5410 5410 -, c dbSNP:35911434
5424 5424 a, g dbSNP:746921948
5441 5441 c, t dbSNP:188882445
5496 5496 c, g dbSNP:763658875
5504 5504 c, t dbSNP:3026785
5574 5574 a, g dbSNP:191974370
5607 5607 a, g dbSNP:542427089

Target ORF information:

RefSeq Version NM_020975
Organism Homo sapiens (human)
Definition Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27273
Accession Version NM_020630.4
Sequence Information ORF Nucleotide Sequence (Length: 3219bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product proto-oncogene tyrosine-protein kinase receptor Ret isoform c precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA100452.1, BC003072.2, BC004257.1, X12949.1, DA911581.1, BM703293.1, BE261914.1 and AI472270.1. This sequence is a reference standard in the RefSeqGene project. On Feb 27, 2007 this sequence version replaced gi:50593520. Summary: This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (4) differs in the 3' UTR and coding region compared to variant 2. The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a. This isoform is also known as Ret9. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC004257.1, AK291807.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)149..151(+)
Misc Feature(2)707..991(+)
Misc Feature(3)722..991(+)
Misc Feature(4)1949..1954(+)
Misc Feature(5)2096..2161(+)
Misc Feature(6)2249..2251(+)
Misc Feature(7)2276..2278(+)
Misc Feature(8)2309..2314(+)
Misc Feature(9)2324..2329(+)
Misc Feature(10)2357..3226(+)
Misc Feature(11)2360..3205(+)
Misc Feature(12)2378..3061(+)
Misc Feature(13)2378..2866(+)
Misc Feature(14)2603..2611(+)
Misc Feature(15)2606..2608(+)
Misc Feature(16)2606..2608(+)
Misc Feature(17)2615..2617(+)
Misc Feature(18)2615..2617(+)
Misc Feature(19)2666..2668(+)
Misc Feature(20)2810..3061(+)
Misc Feature(21)2861..2938(+)
Misc Feature(22)2888..2890(+)
Misc Feature(23)2888..2890(+)
Misc Feature(24)2903..2905(+)
Misc Feature(25)2903..2905(+)
Misc Feature(26)3131..3133(+)
Misc Feature(27)3131..3133(+)
Misc Feature(28)3233..3235(+)
Misc Feature(29)3233..3235(+)
Misc Feature(30)3239..3244(+)
Misc Feature(31)3275..3277(+)
Misc Feature(32)3374..3376(+)
Misc Feature(33)3374..3376(+)
Exon (1)1..263
Gene Synonym:
Exon (2)264..527
Gene Synonym:
Exon (3)528..815
Gene Synonym:
Exon (4)816..1057
Gene Synonym:
Exon (5)1058..1253
Gene Synonym:
Exon (6)1254..1453
Gene Synonym:
Exon (7)1454..1712
Gene Synonym:
Exon (8)1713..1838
Gene Synonym:
Exon (9)1839..1949
Gene Synonym:
Exon (10)1950..2069
Gene Synonym:
Exon (11)2070..2326
Gene Synonym:
Exon (12)2327..2474
Gene Synonym:
Exon (13)2475..2582
Gene Synonym:
Exon (14)2583..2797
Gene Synonym:
Exon (15)2798..2920
Gene Synonym:
Exon (16)2921..2991
Gene Synonym:
Exon (17)2992..3129
Gene Synonym:
Exon (18)3130..3229
Gene Synonym:
Exon (19)3230..4159
Gene Synonym:
Position Chain Variation Link
7 7 a, g dbSNP:112715174
30 30 a, c dbSNP:548774475
31 31 g, t dbSNP:567112195
123 123 c, t dbSNP:3128725
140 140 c, t dbSNP:765384640
154 154 c, g dbSNP:751005619
221 221 c, g dbSNP:587780812
233 233 -, tgctgctgc dbSNP:768132465
234 234 -, tgc dbSNP:778434166
269 269 c, t dbSNP:377160777
271 271 a, g dbSNP:369519655
272 272 a, g dbSNP:779905135
285 285 c, t dbSNP:76764689
286 286 a, g dbSNP:139821724
289 289 a, g dbSNP:768485233
299 299 c, t dbSNP:777042445
304 304 a, g dbSNP:762096025
308 308 c, t dbSNP:373420806
315 315 c, t dbSNP:773375434
324 324 c, t dbSNP:763526874
325 325 a, g dbSNP:1800858
329 329 a, g dbSNP:529018971
334 334 a, g dbSNP:759872307
347 347 a, g dbSNP:547308774
349 349 c, t dbSNP:753523209
351 351 a, g dbSNP:756858300
355 355 c, g dbSNP:778409475
356 356 a, c, t dbSNP:145633958
360 360 a, g dbSNP:779915615
364 364 c, t dbSNP:746943314
365 365 a, g dbSNP:376565365
367 367 a, c dbSNP:370622218
368 368 c, t dbSNP:748402485
377 377 g, t dbSNP:770081020
379 379 a, g dbSNP:773428442
381 381 c, t dbSNP:77596424
389 389 c, t dbSNP:749390385
390 390 a, g dbSNP:192489011
391 391 a, c, t dbSNP:200328158
394 394 a, g, t dbSNP:148874112
409 409 c, t dbSNP:761460588
410 410 a, g dbSNP:764938319
414 414 c, t dbSNP:142641173
415 415 a, g dbSNP:151267865
420 420 a, g dbSNP:570176656
421 421 a, c dbSNP:3123654
425 425 c, t dbSNP:537523906
442 442 c, g dbSNP:754912942
452 452 a, c, g dbSNP:141679950
460 460 a, g dbSNP:755967110
463 463 c, t dbSNP:761325339
486 486 a, g dbSNP:749500174
494 494 a, g dbSNP:201244749
498 498 a, g dbSNP:375390467
502 502 c, t dbSNP:746378333
512 512 a, c dbSNP:567877611
514 514 c, g dbSNP:775974393
517 517 c, g dbSNP:761086815
519 519 a, g dbSNP:764421264
523 523 c, g dbSNP:772779267
524 524 c, t dbSNP:762626209
525 525 a, g dbSNP:587780814
530 530 c, t dbSNP:747483905
531 531 a, g dbSNP:76397662
532 532 c, t dbSNP:143083395
540 540 a, c dbSNP:763295929
541 541 c, t dbSNP:267602487
545 545 c, g dbSNP:764496948
551 551 a, g dbSNP:770548816
561 561 a, t dbSNP:773868504
565 565 a, c dbSNP:1800859
581 581 c, t dbSNP:375576038
588 588 a, g dbSNP:138265837
595 595 c, t dbSNP:142345108
596 596 a, g, t dbSNP:79014735
611 611 a, g dbSNP:749190212
612 612 a, g dbSNP:770840152
621 621 a, g dbSNP:551142665
622 622 c, t dbSNP:756999107
634 634 -, ctt dbSNP:776989694
642 642 a, g dbSNP:150261092
646 646 a, c dbSNP:750621402
658 658 c, t dbSNP:141290380
663 663 a, g dbSNP:780067540
668 668 c, t dbSNP:747536732
677 677 a, c dbSNP:371153966
678 678 a, g dbSNP:149403911
692 692 c, t dbSNP:748609507
695 695 a, g dbSNP:374514956
699 699 c, t dbSNP:200547906
708 708 c, t dbSNP:368431125
714 714 a, g dbSNP:774097284
718 718 g, t dbSNP:556686338
719 719 c, t dbSNP:765654609
720 720 a, g dbSNP:759229505
728 728 c, t dbSNP:76449634
729 729 a, g dbSNP:370736139
734 734 c, t dbSNP:775086466
738 738 a, g dbSNP:144801580
740 740 a, c dbSNP:753301491
751 751 a, g dbSNP:764162555
756 756 a, g dbSNP:753707182
772 772 a, g dbSNP:368116579
781 781 c, t dbSNP:764910706
782 782 a, c dbSNP:76736111
783 783 c, g dbSNP:750675926
787 787 c, t dbSNP:55810667
793 793 c, t dbSNP:780120451
794 794 a, g dbSNP:751572082
797 797 a, g dbSNP:755007607
814 814 g, t dbSNP:781750106
834 834 a, g, t dbSNP:748128929
844 844 a, g dbSNP:137928436
857 857 a, g dbSNP:587780815
863 863 a, c dbSNP:766136271
864 864 c, t dbSNP:774670305
868 868 c, t dbSNP:142421698
872 872 c, g, t dbSNP:760813493
876 876 c, t dbSNP:767654905
882 882 a, g dbSNP:79661516
883 883 c, t dbSNP:576806329
889 889 a, g dbSNP:786203642
891 891 g, t dbSNP:756216318
892 892 g, t dbSNP:764759271
908 908 a, c, g dbSNP:375120544
910 910 a, g dbSNP:779382077
913 913 c, t dbSNP:544252468
916 916 a, g dbSNP:377193354
917 917 a, t dbSNP:112448213
921 921 c, t dbSNP:145970248
926 926 a, c, g dbSNP:780756440
928 928 c, t dbSNP:769279838
930 930 a, c, t dbSNP:61843232
931 931 c, t dbSNP:777733752
933 933 c, g dbSNP:749189193
941 941 a, g dbSNP:562449603
947 947 a, g dbSNP:587780816
950 950 a, g dbSNP:554862459
953 953 a, t dbSNP:770741709
959 959 a, c dbSNP:773964804
966 966 a, c, t dbSNP:759812068
970 970 a, g dbSNP:764749007
974 974 a, g dbSNP:775772444
975 975 c, t dbSNP:139790943
993 993 c, g dbSNP:764239646
1006 1006 c, t dbSNP:754428451
1011 1011 a, c dbSNP:762363830
1014 1014 g, t dbSNP:143209223
1015 1015 c, t dbSNP:150797149
1016 1016 a, g, t dbSNP:139213499
1022 1022 a, g dbSNP:541929171
1023 1023 a, c dbSNP:35118262
1024 1024 c, t dbSNP:41306550
1025 1025 a, g dbSNP:777221273
1028 1028 a, c dbSNP:749244375
1032 1032 c, g dbSNP:745642574
1033 1033 c, t dbSNP:770794801
1045 1045 c, g dbSNP:778909045
1047 1047 a, c dbSNP:745710576
1058 1058 -, g dbSNP:36008607
1064 1064 a, g dbSNP:34682185
1068 1068 c, t dbSNP:745790708
1074 1074 c, t dbSNP:758159521
1078 1078 c, g dbSNP:779849973
1087 1087 c, t dbSNP:529153319
1096 1096 c, t dbSNP:768934031
1105 1105 c, t dbSNP:776987390
1111 1111 a, g dbSNP:748294306
1115 1115 c, g dbSNP:769894584
1118 1118 a, c dbSNP:773631693
1120 1120 c, g dbSNP:763473665
1128 1128 a, g dbSNP:77702891
1133 1133 a, c dbSNP:774637214
1140 1140 c, t dbSNP:760322514
1141 1141 g, t dbSNP:375812189
1147 1147 a, c dbSNP:149926238
1150 1150 a, c, t dbSNP:756761746
1151 1151 a, g dbSNP:377767388
1162 1162 c, g dbSNP:758298916
1163 1163 a, g dbSNP:779719517
1164 1164 c, t dbSNP:746865459
1165 1165 c, t dbSNP:754806583
1172 1172 a, g dbSNP:781613821
1179 1179 a, g dbSNP:80236571
1183 1183 a, g dbSNP:377200874
1188 1188 a, c dbSNP:769791074
1198 1198 c, g, t dbSNP:144981275
1203 1203 a, c, t dbSNP:377767433
1206 1206 c, t dbSNP:774829203
1207 1207 a, g dbSNP:369810881
1208 1208 g, t dbSNP:367737920
1218 1218 a, c, g dbSNP:776300640
1219 1219 c, t dbSNP:764668178
1220 1220 a, g dbSNP:749883001
1221 1221 a, g dbSNP:762367597
1223 1223 a, g dbSNP:766480138
1230 1230 c, t dbSNP:200641186
1233 1233 a, g dbSNP:751518221
1236 1236 c, g, t dbSNP:754859905
1237 1237 a, g dbSNP:373208682
1239 1239 c, t dbSNP:587778660
1240 1240 c, t dbSNP:142188675
1241 1241 a, g dbSNP:777716061
1242 1242 a, t dbSNP:749449032
1253 1253 a, g, t dbSNP:145402131
1269 1269 a, g dbSNP:762472027
1273 1273 a, c dbSNP:770587835
1274 1274 a, c dbSNP:773935854
1278 1278 c, g dbSNP:766881522
1282 1282 c, t dbSNP:759548155
1284 1284 c, t dbSNP:763670106
1285 1285 a, g dbSNP:201992974
1287 1287 a, g dbSNP:760560422
1290 1290 a, g dbSNP:763759702
1292 1292 c, t dbSNP:754116867
1293 1293 a, g dbSNP:199529397
1300 1300 a, g dbSNP:765305476
1306 1306 c, g dbSNP:750569981
1308 1308 c, t dbSNP:546866208
1309 1309 a, g dbSNP:113931414
1314 1314 a, t dbSNP:142338976
1325 1325 -, cag dbSNP:763559646
1329 1329 a, c dbSNP:755400887
1331 1331 c, t dbSNP:781362020
1332 1332 g, t dbSNP:139813765
1336 1336 a, g dbSNP:770637118
1338 1338 a, g dbSNP:774139424
1340 1340 c, g dbSNP:536298339
1341 1341 c, g dbSNP:771679592
1347 1347 c, t dbSNP:115272158
1348 1348 a, g dbSNP:373540097
1351 1351 c, t dbSNP:763967472
1352 1352 a, g dbSNP:776223166
1353 1353 c, t dbSNP:751939820
1363 1363 c, g dbSNP:757868491
1369 1369 a, c dbSNP:78098482
1372 1372 c, t dbSNP:376465385
1377 1377 c, t dbSNP:781646869
1378 1378 a, g dbSNP:758510657
1379 1379 a, g dbSNP:183729115
1387 1387 a, g dbSNP:148371113
1391 1391 a, t dbSNP:140638866
1393 1393 c, t dbSNP:781623106
1405 1405 c, t dbSNP:748588678
1406 1406 a, g dbSNP:756532455
1412 1412 a, t dbSNP:778754580
1414 1414 c, t dbSNP:745479264
1416 1416 c, g dbSNP:771636042
1423 1423 c, t dbSNP:779374978
1424 1424 a, g dbSNP:746970700
1438 1438 c, t dbSNP:768547052
1440 1440 a, g dbSNP:201030628
1443 1443 a, c, g dbSNP:371731991
1448 1448 a, g dbSNP:769548635
1454 1454 a, g dbSNP:749107291
1456 1456 c, t dbSNP:759582152
1457 1457 a, g, t dbSNP:767601598
1462 1462 a, c dbSNP:761207209
1463 1463 c, g dbSNP:764558748
1465 1465 c, g dbSNP:200458714
1474 1474 a, g dbSNP:757632555
1475 1475 a, g dbSNP:779625196
1480 1480 c, g dbSNP:202053997
1482 1482 a, g dbSNP:754481151
1484 1484 g, t dbSNP:780630024
1485 1485 ca, tg dbSNP:386743165
1485 1485 a, c, t dbSNP:552057730
1486 1486 a, g dbSNP:1800860
1495 1495 c, t dbSNP:749093977
1496 1496 a, g dbSNP:770736612
1502 1502 a, g dbSNP:774474422
1516 1516 a, g dbSNP:746055866
1517 1517 c, t dbSNP:772292843
1526 1526 c, g dbSNP:115423919
1533 1533 a, c dbSNP:760832715
1534 1534 c, g dbSNP:549907428
1542 1542 c, t dbSNP:774092678
1543 1543 a, g, t dbSNP:201568301
1544 1544 a, c dbSNP:151148041
1547 1547 a, g dbSNP:754598663
1552 1552 a, g dbSNP:35717926
1553 1553 a, g dbSNP:145966037
1554 1554 c, t dbSNP:752267460
1561 1561 a, t dbSNP:376464605
1564 1564 c, t dbSNP:190750926
1565 1565 a, c, g dbSNP:539995816
1566 1566 a, t dbSNP:757031867
1576 1576 a, g dbSNP:587780807
1589 1589 c, g dbSNP:200334340
1595 1595 a, c, g dbSNP:772489699
1610 1610 c, t dbSNP:775842917
1611 1611 a, g dbSNP:747139265
1613 1613 c, t dbSNP:746512075
1614 1614 a, g dbSNP:138624658
1617 1617 c, t dbSNP:762335805
1627 1627 c, t dbSNP:576806356
1628 1628 a, g dbSNP:537874538
1630 1630 a, t dbSNP:763296134
1631 1631 c, g dbSNP:767210575
1638 1638 a, g dbSNP:752322996
1640 1640 a, t dbSNP:755660496
1641 1641 c, t dbSNP:763617146
1652 1652 a, t dbSNP:753733901