
NYX cDNA ORF clone, Homo sapiens (human)

Gene Symbol NYX
Entrez Gene ID 60506
Full Name nyctalopin
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The product of this gene belongs to the small leucine-rich proteoglycan (SLRP) family of proteins. Defects in this gene are the cause of congenital stationary night blindness type 1 (CSNB1), also called X-linked congenital stationary night blindness (XLCSNB). CSNB1 is a rare inherited retinal disorder characterized by impaired scotopic vision, myopia, hyperopia, nystagmus and reduced visual acuity. The role of other SLRP proteins suggests that mutations in this gene disrupt developing retinal interconnections involving the ON-bipolar cells, leading to the visual losses seen in patients with complete CSNB. [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html: Night blindness, congenital stationary, type 1, 310500 (3)

The following NYX gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the NYX cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu19068 NM_022567 Homo sapiens nyctalopin (NYX), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu19068 XM_005272632 PREDICTED: Homo sapiens nyctalopin (NYX), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu19068
Accession Version NM_022567.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1446bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-MAY-2014
Organism Homo sapiens (human)
Product nyctalopin precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ278865.1. This sequence is a reference standard in the RefSeqGene project. On Sep 13, 2008 this sequence version replaced gi:12007645. Summary: The product of this gene belongs to the small leucine-rich proteoglycan (SLRP) family of proteins. Defects in this gene are the cause of congenital stationary night blindness type 1 (CSNB1), also called X-linked congenital stationary night blindness (XLCSNB). CSNB1 is a rare inherited retinal disorder characterized by impaired scotopic vision, myopia, hyperopia, nystagmus and reduced visual acuity. The role of other SLRP proteins suggests that mutations in this gene disrupt developing retinal interconnections involving the ON-bipolar cells, leading to the visual losses seen in patients with complete CSNB. [provided by RefSeq, Oct 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ278865.1, BC112242.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)416..418(+)
Misc Feature(2)617..682(+)
Misc Feature(3)632..691(+)
Misc Feature(4)647..1381(+)
Misc Feature(5)686..871(+)
Misc Feature(6)689..754(+)
Misc Feature(7)692..1381(+)
Misc Feature(8)692..763(+)
Misc Feature(9)713..1288(+)
Misc Feature(10)761..820(+)
Misc Feature(11)764..838(+)
Misc Feature(12)836..907(+)
Misc Feature(13)839..910(+)
Misc Feature(14)908..976(+)
Misc Feature(15)911..979(+)
Misc Feature(16)977..1156(+)
Misc Feature(17)977..1042(+)
Misc Feature(18)980..1051(+)
Misc Feature(19)1049..1114(+)
Misc Feature(20)1052..1123(+)
Misc Feature(21)1121..1186(+)
Misc Feature(22)1124..1300(+)
Misc Feature(23)1124..1195(+)
Misc Feature(24)1193..1258(+)
Misc Feature(25)1196..1267(+)
Misc Feature(26)1265..1330(+)
Misc Feature(27)1268..>1399(+)
Misc Feature(28)1268..1333(+)
Misc Feature(29)1337..1402(+)
Misc Feature(30)1436..>1540(+)
Exon (1)1..467
Gene Synonym:
Exon (2)468..2629
Gene Synonym:
Position Chain Variation Link
18 18 c, g dbSNP:748542613
56 56 c, t dbSNP:756417493
97 97 c, t dbSNP:761780912
103 103 c, t dbSNP:777981530
117 117 a, g dbSNP:3013121
136 136 a, g dbSNP:771051187
152 152 c, t dbSNP:3013122
200 200 a, c dbSNP:745908588
273 273 a, c dbSNP:150377105
286 286 a, g dbSNP:775520106
345 345 g, t dbSNP:755997910
383 383 c, t dbSNP:376864781
393 393 a, g dbSNP:761165028
399 399 c, g dbSNP:764681420
402 402 -, c dbSNP:746918711
402 402 c, t dbSNP:200043444
403 403 a, g dbSNP:762414962
409 409 a, g dbSNP:765366166
420 420 c, t dbSNP:370240640
423 423 c, g dbSNP:184823211
440 440 c, t dbSNP:371622974
445 445 g, t dbSNP:780392632
448 448 a, g dbSNP:751298914
479 479 a, g dbSNP:769075010
515 515 -, cgcgcttgtcccgccgcctgcgcc dbSNP:281865194
515 515 c, g dbSNP:777165066
522 522 c, g dbSNP:62637020
535 535 a, c dbSNP:62637021
564 564 c, t dbSNP:762359799
578 578 c, t dbSNP:765886362
586 586 c, t dbSNP:750467200
601 601 a, g dbSNP:763151399
629 629 a, g dbSNP:766384318
647 647 a, g dbSNP:751740576
652 652 a, g dbSNP:12013709
663 663 a, g dbSNP:774858268
669 669 a, g dbSNP:376550267
673 673 c, g dbSNP:756010939
677 677 a, g dbSNP:777830978
681 681 c, g dbSNP:748730836
687 687 c, t dbSNP:770413717
694 694 a, g dbSNP:778291121
696 696 a, g dbSNP:745492565
699 699 a, g dbSNP:771871698
711 711 c, g dbSNP:104894910
726 726 c, t dbSNP:777112148
732 732 c, t dbSNP:104894911
738 738 c, t dbSNP:762337198
752 752 a, g dbSNP:770414058
754 754 c, t dbSNP:773711712
758 758 c, t dbSNP:763376131
759 759 c, t dbSNP:766445016
762 762 a, g, t dbSNP:774318588
763 763 c, g dbSNP:767770362
764 764 c, g dbSNP:752480428
766 766 a, g dbSNP:755957370
767 767 g, t dbSNP:763806806
768 768 a, c dbSNP:753740968
770 770 -, gagctgcgcctggcg dbSNP:63749061
790 790 c, t dbSNP:565118594
791 791 g, t dbSNP:757170912
813 813 c, t dbSNP:778437203
815 815 c, t dbSNP:745419686
816 816 a, g dbSNP:758120241
823 823 c, t dbSNP:779910919
824 824 a, g dbSNP:746675282
825 825 a, c dbSNP:770131559
835 835 a, c dbSNP:773484241
851 851 a, g dbSNP:749756646
857 857 c, g dbSNP:62637023
867 867 a, g dbSNP:771394522
878 878 g, t dbSNP:774462401
881 881 c, t dbSNP:759676419
882 882 c, t dbSNP:62637024
883 883 c, g dbSNP:746357984
885 885 a, t dbSNP:775629196
887 887 c, t dbSNP:772547248
896 896 a, g dbSNP:763908216
908 908 a, g dbSNP:753595772
925 925 a, c dbSNP:775975888
928 928 c, t dbSNP:765126061
940 940 c, g dbSNP:749939803
944 944 c, t dbSNP:201799779
946 946 c, t dbSNP:757923916
954 954 c, g dbSNP:62637025
955 955 c, g dbSNP:779716726
959 959 a, g dbSNP:746621970
960 960 c, t dbSNP:754612225
967 967 c, t dbSNP:762946997
981 981 c, t dbSNP:62637026
989 989 aa, gc dbSNP:62637027
1007 1007 c, t dbSNP:749658239
1008 1008 g, t dbSNP:771468489
1009 1009 c, t dbSNP:774892814
1012 1012 a, c dbSNP:746383908
1013 1013 c, g dbSNP:772070483
1016 1016 a, g dbSNP:775575693
1056 1056 a, g dbSNP:760900596
1068 1068 a, t dbSNP:62637028
1077 1077 a, t dbSNP:62637029
1086 1086 a, g dbSNP:768808915
1125 1125 c, t dbSNP:62637030
1129 1129 c, g dbSNP:776454502
1151 1151 c, t dbSNP:761572356
1157 1157 -, gccgagctcccg dbSNP:63749062
1160 1160 c, g dbSNP:765093922
1165 1165 c, t dbSNP:750321603
1167 1167 c, g, t dbSNP:763017414
1168 1168 a, g, t dbSNP:751166456
1177 1177 c, t dbSNP:201072571
1181 1181 c, t dbSNP:527481596
1183 1183 c, t dbSNP:754213194
1190 1190 c, t dbSNP:188293278
1191 1191 a, g dbSNP:369485262
1194 1194 a, g dbSNP:541336990
1200 1200 a, g dbSNP:746330892
1203 1203 c, t dbSNP:180724602
1205 1205 c, g dbSNP:780083539
1222 1222 c, g dbSNP:62637032
1225 1225 g, t dbSNP:747098081
1232 1232 c, g, t dbSNP:375834225
1234 1234 c, t dbSNP:762100670
1241 1241 c, t dbSNP:369077278
1243 1243 c, g dbSNP:773164669
1245 1245 c, t dbSNP:762965024
1246 1246 a, c dbSNP:11798969
1264 1264 c, g dbSNP:766462613
1270 1270 c, g, t dbSNP:751115117
1273 1273 a, c, g dbSNP:3810733
1284 1284 c, t dbSNP:62637033
1285 1285 c, g dbSNP:755820494
1301 1301 a, g dbSNP:139601761
1303 1303 c, g dbSNP:750835128
1306 1306 c, t dbSNP:758871332
1307 1307 c, g dbSNP:372496317
1309 1309 a, g dbSNP:747565073
1323 1323 c, t dbSNP:62637034
1330 1330 a, c, t dbSNP:768551423
1331 1331 c, t dbSNP:748271017
1335 1335 c, t dbSNP:770193408
1339 1339 a, t dbSNP:773113302
1340 1340 c, g dbSNP:376514245
1345 1345 c, t dbSNP:560823176
1352 1352 c, g dbSNP:770982596
1359 1359 a, g dbSNP:774095317
1362 1362 g, t dbSNP:759518213
1365 1365 a, g dbSNP:62637035
1367 1367 c, t dbSNP:765226112
1373 1373 a, g dbSNP:766895013
1382 1382 c, g dbSNP:775085199
1388 1388 a, g dbSNP:760297861
1391 1391 g, t dbSNP:750428762
1394 1394 c, t dbSNP:750782142
1399 1399 a, g dbSNP:758820160
1403 1403 g, t dbSNP:766735978
1406 1406 c, t dbSNP:751972090
1414 1414 a, g dbSNP:755532922
1433 1433 c, t dbSNP:781111707
1451 1451 a, g dbSNP:748302686
1459 1459 g, t dbSNP:756403696
1465 1465 a, g dbSNP:143486101
1470 1470 c, t dbSNP:62637036
1472 1472 a, g dbSNP:749538074
1473 1473 a, g dbSNP:770778282
1476 1476 a, t dbSNP:758241490
1479 1479 a, g dbSNP:62637037
1481 1481 a, c dbSNP:745741032
1493 1493 a, g dbSNP:772093712
1496 1496 c, t dbSNP:774830136
1504 1504 c, t dbSNP:766199959
1508 1508 a, g dbSNP:763723615
1516 1516 c, t dbSNP:776200278
1521 1521 a, c, t dbSNP:761485619
1531 1531 c, t dbSNP:752006200
1539 1539 g, t dbSNP:62637038
1541 1541 c, t dbSNP:751312165
1569 1569 a, g dbSNP:768139938
1571 1571 c, t dbSNP:752815808
1577 1577 a, g dbSNP:756209419
1582 1582 c, t dbSNP:778001025
1584 1584 a, t dbSNP:749478506
1600 1600 c, g dbSNP:371445863
1610 1610 c, t dbSNP:146300620
1612 1612 c, t dbSNP:778548734
1616 1616 a, t dbSNP:374504146
1628 1628 a, g dbSNP:189924262
1631 1631 c, g dbSNP:780096336
1632 1632 c, g dbSNP:746961966
1633 1633 a, g dbSNP:139558261
1647 1647 c, g, t dbSNP:34169326
1648 1648 a, g dbSNP:769527831
1650 1650 c, t dbSNP:774576950
1657 1657 c, t dbSNP:187149252
1661 1661 a, g dbSNP:767790244
1669 1669 -, cag dbSNP:770813743
1671 1671 g, t dbSNP:753192239
1674 1674 a, g dbSNP:149170016
1675 1675 c, t dbSNP:764217347
1679 1679 c, g, t dbSNP:761357422
1681 1681 c, t dbSNP:151302286
1683 1683 c, g dbSNP:776029387
1693 1693 a, g dbSNP:750169676
1696 1696 c, t dbSNP:758153838
1699 1699 a, g dbSNP:779745958
1707 1707 a, c dbSNP:746901065
1708 1708 a, g dbSNP:768631690
1711 1711 a, g dbSNP:780650896
1728 1728 c, t dbSNP:747726317
1733 1733 c, g dbSNP:769321597
1746 1746 a, g dbSNP:370654546
1760 1760 c, g dbSNP:34181799
1767 1767 c, t dbSNP:762521065
1774 1774 c, t dbSNP:772437452
1775 1775 c, t dbSNP:776015071
1778 1778 c, g dbSNP:761237969
1784 1784 g, t dbSNP:764736358
1824 1824 g, t dbSNP:374968384
1827 1827 c, t dbSNP:762009375
1831 1831 a, g dbSNP:769001640
1838 1838 a, g dbSNP:750591219
1850 1850 a, g dbSNP:140602960
1887 1887 -, g dbSNP:762960396
1888 1888 g, t dbSNP:367952714
1896 1896 g, t dbSNP:779803836
1897 1897 g, t dbSNP:751397898
1913 1913 c, t dbSNP:754907887
1937 1937 a, t dbSNP:761926242
1939 1939 a, g dbSNP:767111588
1979 1979 a, g dbSNP:750048192
1983 1983 a, g dbSNP:187741852
1989 1989 a, c dbSNP:755307939
1991 1991 g, t dbSNP:531963566
2024 2024 -, ag dbSNP:753101555
2028 2028 a, g dbSNP:370733549
2076 2076 c, t dbSNP:765627273
2120 2120 c, t dbSNP:367599214
2148 2148 a, t dbSNP:753104188
2171 2171 c, t dbSNP:762976224
2175 2175 c, t dbSNP:550775335
2180 2180 c, t dbSNP:751371521
2195 2195 c, t dbSNP:371864261
2259 2259 g, t dbSNP:148699627
2264 2264 a, g dbSNP:767300031
2290 2290 c, t dbSNP:58930096
2385 2385 c, g dbSNP:3021319
2393 2393 a, g dbSNP:747097738
2468 2468 a, t dbSNP:777385685
2496 2496 c, t dbSNP:191505759
2537 2537 a, g dbSNP:781292304
2599 2599 -, a dbSNP:201620180
2599 2599 a, t dbSNP:748708637
2612 2612 c, g dbSNP:141612904
2620 2620 c, t dbSNP:780639009

Target ORF information:

RefSeq Version NM_022567
Organism Homo sapiens (human)
Definition Homo sapiens nyctalopin (NYX), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19068
Accession Version XM_005272632.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1446bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nyctalopin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530421506. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)370..429(+)
Misc Feature(2)385..1119(+)
Misc Feature(3)424..609(+)
Misc Feature(4)430..1119(+)
Misc Feature(5)430..501(+)
Misc Feature(6)451..1026(+)
Misc Feature(7)502..576(+)
Misc Feature(8)577..648(+)
Misc Feature(9)649..717(+)
Misc Feature(10)715..894(+)
Misc Feature(11)718..789(+)
Misc Feature(12)790..861(+)
Misc Feature(13)862..1038(+)
Misc Feature(14)862..933(+)
Misc Feature(15)934..1005(+)
Misc Feature(16)1006..>1137(+)
Misc Feature(17)1006..1071(+)
Misc Feature(18)1174..>1278(+)
Position Chain Variation Link
2 2 c, t dbSNP:777486161
9 9 c, g dbSNP:1794675
25 25 a, g dbSNP:139818142
30 30 a, c dbSNP:781261480
88 88 c, g dbSNP:748542613
126 126 c, t dbSNP:756417493
131 131 a, g dbSNP:761165028
137 137 c, g dbSNP:764681420
140 140 -, c dbSNP:746918711
140 140 c, t dbSNP:200043444
141 141 a, g dbSNP:762414962
147 147 a, g dbSNP:765366166
158 158 c, t dbSNP:370240640
161 161 c, g dbSNP:184823211
178 178 c, t dbSNP:371622974
183 183 g, t dbSNP:780392632
186 186 a, g dbSNP:751298914
217 217 a, g dbSNP:769075010
253 253 -, cgcgcttgtcccgccgcctgcgcc dbSNP:281865194
253 253 c, g dbSNP:777165066
260 260 c, g dbSNP:62637020
273 273 a, c dbSNP:62637021
302 302 c, t dbSNP:762359799
316 316 c, t dbSNP:765886362
324 324 c, t dbSNP:750467200
339 339 a, g dbSNP:763151399
367 367 a, g dbSNP:766384318
385 385 a, g dbSNP:751740576
390 390 a, g dbSNP:12013709
401 401 a, g dbSNP:774858268
407 407 a, g dbSNP:376550267
411 411 c, g dbSNP:756010939
415 415 a, g dbSNP:777830978
419 419 c, g dbSNP:748730836
425 425 c, t dbSNP:770413717
432 432 a, g dbSNP:778291121
434 434 a, g dbSNP:745492565
437 437 a, g dbSNP:771871698
449 449 c, g dbSNP:104894910
464 464 c, t dbSNP:777112148
470 470 c, t dbSNP:104894911
476 476 c, t dbSNP:762337198
490 490 a, g dbSNP:770414058
492 492 c, t dbSNP:773711712
496 496 c, t dbSNP:763376131
497 497 c, t dbSNP:766445016
500 500 a, g, t dbSNP:774318588
501 501 c, g dbSNP:767770362
502 502 c, g dbSNP:752480428
504 504 a, g dbSNP:755957370
505 505 g, t dbSNP:763806806
506 506 a, c dbSNP:753740968
508 508 -, gagctgcgcctggcg dbSNP:63749061
528 528 c, t dbSNP:565118594
529 529 g, t dbSNP:757170912
551 551 c, t dbSNP:778437203
553 553 c, t dbSNP:745419686
554 554 a, g dbSNP:758120241
561 561 c, t dbSNP:779910919
562 562 a, g dbSNP:746675282
563 563 a, c dbSNP:770131559
573 573 a, c dbSNP:773484241
589 589 a, g dbSNP:749756646
595 595 c, g dbSNP:62637023
605 605 a, g dbSNP:771394522
616 616 g, t dbSNP:774462401
619 619 c, t dbSNP:759676419
620 620 c, t dbSNP:62637024
621 621 c, g dbSNP:746357984
623 623 a, t dbSNP:775629196
625 625 c, t dbSNP:772547248
634 634 a, g dbSNP:763908216
646 646 a, g dbSNP:753595772
663 663 a, c dbSNP:775975888
666 666 c, t dbSNP:765126061
678 678 c, g dbSNP:749939803
682 682 c, t dbSNP:201799779
684 684 c, t dbSNP:757923916
692 692 c, g dbSNP:62637025
693 693 c, g dbSNP:779716726
697 697 a, g dbSNP:746621970
698 698 c, t dbSNP:754612225
705 705 c, t dbSNP:762946997
719 719 c, t dbSNP:62637026
727 727 aa, gc dbSNP:62637027
745 745 c, t dbSNP:749658239
746 746 g, t dbSNP:771468489
747 747 c, t dbSNP:774892814
750 750 a, c dbSNP:746383908
751 751 c, g dbSNP:772070483
754 754 a, g dbSNP:775575693
794 794 a, g dbSNP:760900596
806 806 a, t dbSNP:62637028
815 815 a, t dbSNP:62637029
824 824 a, g dbSNP:768808915
863 863 c, t dbSNP:62637030
867 867 c, g dbSNP:776454502
889 889 c, t dbSNP:761572356
895 895 -, gccgagctcccg dbSNP:63749062
898 898 c, g dbSNP:765093922
903 903 c, t dbSNP:750321603
905 905 c, g, t dbSNP:763017414
906 906 a, g, t dbSNP:751166456
915 915 c, t dbSNP:201072571
919 919 c, t dbSNP:527481596
921 921 c, t dbSNP:754213194
928 928 c, t dbSNP:188293278
929 929 a, g dbSNP:369485262
932 932 a, g dbSNP:541336990
938 938 a, g dbSNP:746330892
941 941 c, t dbSNP:180724602
943 943 c, g dbSNP:780083539
960 960 c, g dbSNP:62637032
963 963 g, t dbSNP:747098081
970 970 c, g, t dbSNP:375834225
972 972 c, t dbSNP:762100670
979 979 c, t dbSNP:369077278
981 981 c, g dbSNP:773164669
983 983 c, t dbSNP:762965024
984 984 a, c dbSNP:11798969
1002 1002 c, g dbSNP:766462613
1008 1008 c, g, t dbSNP:751115117
1011 1011 a, c, g dbSNP:3810733
1022 1022 c, t dbSNP:62637033
1023 1023 c, g dbSNP:755820494
1039 1039 a, g dbSNP:139601761
1041 1041 c, g dbSNP:750835128
1044 1044 c, t dbSNP:758871332
1045 1045 c, g dbSNP:372496317
1047 1047 a, g dbSNP:747565073
1061 1061 c, t dbSNP:62637034
1068 1068 a, c, t dbSNP:768551423
1069 1069 c, t dbSNP:748271017
1073 1073 c, t dbSNP:770193408
1077 1077 a, t dbSNP:773113302
1078 1078 c, g dbSNP:376514245
1083 1083 c, t dbSNP:560823176
1090 1090 c, g dbSNP:770982596
1097 1097 a, g dbSNP:774095317
1100 1100 g, t dbSNP:759518213
1103 1103 a, g dbSNP:62637035
1105 1105 c, t dbSNP:765226112
1111 1111 a, g dbSNP:766895013
1120 1120 c, g dbSNP:775085199
1126 1126 a, g dbSNP:760297861
1129 1129 g, t dbSNP:750428762
1132 1132 c, t dbSNP:750782142
1137 1137 a, g dbSNP:758820160
1141 1141 g, t dbSNP:766735978
1144 1144 c, t dbSNP:751972090
1152 1152 a, g dbSNP:755532922
1171 1171 c, t dbSNP:781111707
1189 1189 a, g dbSNP:748302686
1197 1197 g, t dbSNP:756403696
1203 1203 a, g dbSNP:143486101
1208 1208 c, t dbSNP:62637036
1210 1210 a, g dbSNP:749538074
1211 1211 a, g dbSNP:770778282
1214 1214 a, t dbSNP:758241490
1217 1217 a, g dbSNP:62637037
1219 1219 a, c dbSNP:745741032
1231 1231 a, g dbSNP:772093712
1234 1234 c, t dbSNP:774830136
1242 1242 c, t dbSNP:766199959
1246 1246 a, g dbSNP:763723615
1254 1254 c, t dbSNP:776200278
1259 1259 a, c, t dbSNP:761485619
1269 1269 c, t dbSNP:752006200
1277 1277 g, t dbSNP:62637038
1279 1279 c, t dbSNP:751312165
1307 1307 a, g dbSNP:768139938
1309 1309 c, t dbSNP:752815808
1315 1315 a, g dbSNP:756209419
1320 1320 c, t dbSNP:778001025
1322 1322 a, t dbSNP:749478506
1338 1338 c, g dbSNP:371445863
1348 1348 c, t dbSNP:146300620
1350 1350 c, t dbSNP:778548734
1354 1354 a, t dbSNP:374504146
1366 1366 a, g dbSNP:189924262
1369 1369 c, g dbSNP:780096336
1370 1370 c, g dbSNP:746961966
1371 1371 a, g dbSNP:139558261
1385 1385 c, g, t dbSNP:34169326
1386 1386 a, g dbSNP:769527831
1388 1388 c, t dbSNP:774576950
1395 1395 c, t dbSNP:187149252
1399 1399 a, g dbSNP:767790244
1407 1407 -, cag dbSNP:770813743
1409 1409 g, t dbSNP:753192239
1412 1412 a, g dbSNP:149170016
1413 1413 c, t dbSNP:764217347
1417 1417 c, g, t dbSNP:761357422
1419 1419 c, t dbSNP:151302286
1421 1421 c, g dbSNP:776029387
1431 1431 a, g dbSNP:750169676
1434 1434 c, t dbSNP:758153838
1437 1437 a, g dbSNP:779745958
1445 1445 a, c dbSNP:746901065
1446 1446 a, g dbSNP:768631690
1449 1449 a, g dbSNP:780650896
1466 1466 c, t dbSNP:747726317
1471 1471 c, g dbSNP:769321597
1484 1484 a, g dbSNP:370654546
1498 1498 c, g dbSNP:34181799
1505 1505 c, t dbSNP:762521065
1512 1512 c, t dbSNP:772437452
1513 1513 c, t dbSNP:776015071
1516 1516 c, g dbSNP:761237969
1522 1522 g, t dbSNP:764736358
1562 1562 g, t dbSNP:374968384
1565 1565 c, t dbSNP:762009375
1569 1569 a, g dbSNP:769001640
1576 1576 a, g dbSNP:750591219
1588 1588 a, g dbSNP:140602960
1625 1625 -, g dbSNP:762960396
1626 1626 g, t dbSNP:367952714
1634 1634 g, t dbSNP:779803836
1635 1635 g, t dbSNP:751397898
1651 1651 c, t dbSNP:754907887
1675 1675 a, t dbSNP:761926242
1677 1677 a, g dbSNP:767111588
1717 1717 a, g dbSNP:750048192
1721 1721 a, g dbSNP:187741852
1727 1727 a, c dbSNP:755307939
1729 1729 g, t dbSNP:531963566
1762 1762 -, ag dbSNP:753101555
1766 1766 a, g dbSNP:370733549
1814 1814 c, t dbSNP:765627273
1858 1858 c, t dbSNP:367599214
1886 1886 a, t dbSNP:753104188
1909 1909 c, t dbSNP:762976224
1913 1913 c, t dbSNP:550775335
1918 1918 c, t dbSNP:751371521
1933 1933 c, t dbSNP:371864261
1997 1997 g, t dbSNP:148699627
2002 2002 a, g dbSNP:767300031
2028 2028 c, t dbSNP:58930096
2123 2123 c, g dbSNP:3021319
2131 2131 a, g dbSNP:747097738
2206 2206 a, t dbSNP:777385685
2234 2234 c, t dbSNP:191505759
2275 2275 a, g dbSNP:781292304
2337 2337 -, a dbSNP:201620180
2337 2337 a, t dbSNP:748708637
2350 2350 c, g dbSNP:141612904
2358 2358 c, t dbSNP:780639009
2388 2388 c, g dbSNP:145454086
2412 2412 c, g dbSNP:182092478
2454 2454 g, t dbSNP:781670309
2484 2484 c, g dbSNP:147706112
2485 2485 -, g dbSNP:769865394
2485 2485 c, t dbSNP:769905108
2486 2486 c, g dbSNP:775322672
2526 2526 c, g dbSNP:749061819
2564 2564 c, t dbSNP:773360335
2589 2589 a, g dbSNP:768623513
2591 2591 a, g dbSNP:762886699
2650 2650 c, t dbSNP:774235071
2702 2702 c, t dbSNP:770862300
2745 2745 c, t dbSNP:187197276
2899 2899 a, g dbSNP:759459956
2920 2920 a, g dbSNP:192991775
2950 2950 g, t dbSNP:184748065
2962 2962 a, g dbSNP:760408833
2963 2963 a, t dbSNP:763606199
2980 2980 c, g dbSNP:142337342
3017 3017 a, g dbSNP:190343159
3037 3037 c, g dbSNP:778552228
3041 3041 a, g dbSNP:150202256
3096 3096 a, t dbSNP:760439702
3122 3122 g, t dbSNP:550505796

Target ORF information:

RefSeq Version XM_005272632
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nyctalopin (NYX), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
