Email to GenScript

ALX4 ALX homeobox 4 [Homo sapiens (human)]

Gene Symbol ALX4
Entrez Gene ID 60529
Full Name ALX homeobox 4
Synonyms CRS5, FND2
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:


Disorder Html: Parietal foramina 2, 609597 (3); Frontonasal dysplasia 2, 613451 (3)

The following ALX4 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ALX4 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu71087 XM_011520264 PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $199
OHu71088 XM_011520265 PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu71088 XM_011520266 PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu22706 NM_021926 Homo sapiens ALX homeobox 4 (ALX4), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu71087
Accession Version XM_011520264.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 807bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 4 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)772..>906(+)
Misc Feature(2)772..906(+)
Position Chain Variation Link
5 5 c, t dbSNP:779947973
12 12 g, t dbSNP:567317334
39 39 a, c dbSNP:116381450
70 70 a, g dbSNP:530695931
79 79 c, t dbSNP:764565331
85 85 c, g dbSNP:377130834
90 90 c, t dbSNP:551356786
93 93 a, c dbSNP:772303422
94 94 c, g dbSNP:533107251
98 98 g, t dbSNP:774417073
100 100 a, g, t dbSNP:748167884
110 110 a, g dbSNP:373304528
118 118 a, c dbSNP:370141684
119 119 g, t dbSNP:746807473
120 120 c, g dbSNP:779702556
126 126 a, g dbSNP:758130420
130 130 a, g dbSNP:749945782
134 134 a, g dbSNP:778621319
136 136 c, g dbSNP:559427156
145 145 -, t dbSNP:746479735
145 145 c, t dbSNP:754405082
146 146 -, g dbSNP:772754759
147 147 c, g dbSNP:764539399
148 148 g, t dbSNP:281865153
153 153 c, t dbSNP:755972714
159 159 a, c dbSNP:767658097
168 168 c, g, t dbSNP:774394460
173 173 a, c dbSNP:766486576
181 181 a, g dbSNP:762975194
191 191 a, g dbSNP:374650044
192 192 c, t dbSNP:61737298
196 196 c, t dbSNP:746753665
197 197 c, t dbSNP:775495740
198 198 c, g, t dbSNP:115968657
204 204 g, t dbSNP:778531428
211 211 a, c dbSNP:756783968
212 212 c, g dbSNP:748769921
218 218 a, g dbSNP:370055325
228 228 a, t dbSNP:375641880
233 233 c, g dbSNP:3824915
234 234 g, t dbSNP:753099218
238 238 c, t dbSNP:767919976
241 241 c, t dbSNP:755162732
243 243 a, c, t dbSNP:766611438
248 248 a, g dbSNP:763035360
249 249 c, t dbSNP:773173346
250 250 a, g dbSNP:373566188
255 255 g, t dbSNP:369346595
259 259 a, g dbSNP:775401450
270 270 c, t dbSNP:772029021
272 272 c, t dbSNP:745685096
275 275 c, t dbSNP:764877187
276 276 c, g dbSNP:770503138
277 277 a, g dbSNP:374868143
288 288 a, g dbSNP:777213803
293 293 a, g dbSNP:756623127
301 301 a, g dbSNP:748695888
304 304 g, t dbSNP:781687811
315 315 c, t dbSNP:371338431
316 316 a, c dbSNP:374839498
317 317 a, g dbSNP:372830230
346 346 c, t dbSNP:766525768
355 355 a, c dbSNP:79200219
381 381 a, g dbSNP:750505389
382 382 a, g dbSNP:765279140
409 409 c, t dbSNP:760627532
410 410 a, c dbSNP:752638029
420 420 a, g dbSNP:767580968
421 421 a, c dbSNP:759346076
423 423 g, t dbSNP:774293144
424 424 a, c dbSNP:770611828
425 425 a, c dbSNP:762569952
427 427 a, c dbSNP:772749428
428 428 a, g dbSNP:769148200
431 431 c, g dbSNP:747680014
433 433 c, t dbSNP:12421995
434 434 c, g, t dbSNP:747374643
439 439 c, g dbSNP:780343108
440 440 a, c dbSNP:758621060
443 443 -, cgcagccgcagc dbSNP:201777848
443 443 c, t dbSNP:750648485
444 444 a, c, g dbSNP:757359392
447 447 a, g dbSNP:753978747
449 449 -, cgcagc dbSNP:778909542
455 455 a, c dbSNP:767495097
458 458 -, agcagc dbSNP:780001000
461 461 a, c dbSNP:759611855
462 462 -, tcg dbSNP:749275971
464 464 a, c dbSNP:751385178
465 465 -, tcgccg dbSNP:756167646
465 465 g, t dbSNP:766129018
473 473 a, c dbSNP:762839322
476 476 a, c dbSNP:772691401
477 477 g, t dbSNP:769501075
480 480 c, t dbSNP:761250433
486 486 a, g dbSNP:538795114
488 488 c, t dbSNP:186600034
489 489 g, t dbSNP:199971294
513 513 a, c dbSNP:769140906
514 514 -, tgcaagacgc dbSNP:387906325
520 520 a, g dbSNP:747567353
521 521 a, c dbSNP:776145976
524 524 a, c dbSNP:534395095
532 532 a, g dbSNP:772281686
546 546 c, g dbSNP:746262802
547 547 c, t dbSNP:104894191
554 554 a, g dbSNP:778941350
558 558 c, t dbSNP:757556220
561 561 c, t dbSNP:200895706
569 569 a, g dbSNP:374726657
583 583 g, t dbSNP:754942746
589 589 a, t dbSNP:182274454
603 603 c, g dbSNP:553689111
616 616 g, t dbSNP:371740812
618 618 a, g dbSNP:147204958
623 623 a, t dbSNP:779790993
626 626 c, t dbSNP:758432138
631 631 c, t dbSNP:750173751
633 633 -, t dbSNP:587776614
647 647 c, t dbSNP:765070227
651 651 a, g dbSNP:774447144
653 653 g, t dbSNP:769556306
656 656 a, g dbSNP:756876669
657 657 c, g dbSNP:376287400
663 663 c, g dbSNP:763754428
666 666 c, t dbSNP:760043881
667 667 c, g dbSNP:775067051
676 676 a, g dbSNP:368396709
678 678 a, g dbSNP:760145254
690 690 g, t dbSNP:774556630
698 698 a, c, t dbSNP:143620051
706 706 c, t dbSNP:773510510
707 707 a, g dbSNP:201303900
710 710 a, c dbSNP:748173197
723 723 a, c dbSNP:61737295
725 725 c, t dbSNP:758249273
730 730 c, t dbSNP:745862299
734 734 g, t dbSNP:150424138
738 738 a, g dbSNP:756993500
742 742 g, t dbSNP:753642057
744 744 c, t dbSNP:777337755
745 745 a, g dbSNP:140457891
747 747 c, t dbSNP:180962051
749 749 a, c, t dbSNP:104894197
750 750 a, c, g dbSNP:10769028
756 756 a, c dbSNP:568863681
759 759 c, t dbSNP:763344358
760 760 a, g dbSNP:281865154
765 765 c, g dbSNP:773780472
772 772 c, t dbSNP:770130333
773 773 a, g dbSNP:370195126
775 775 c, g, t dbSNP:587777700
777 777 a, g dbSNP:550698378
781 781 a, c, t dbSNP:138094422
782 782 a, g dbSNP:104894193
792 792 c, t dbSNP:770858153
802 802 c, g dbSNP:587777701
805 805 c, t dbSNP:749075893
808 808 a, g dbSNP:376402455
809 809 a, g dbSNP:755698536
811 811 a, g dbSNP:201889959
813 813 a, g dbSNP:752434708
814 814 a, c dbSNP:780739319
830 830 a, c dbSNP:754454206
843 843 c, t dbSNP:751119502
849 849 c, t dbSNP:766990322
850 850 a, g, t dbSNP:750798110
857 857 c, t dbSNP:145166164
858 858 a, g dbSNP:11037928
865 865 c, t dbSNP:104894192
868 868 a, c dbSNP:776867365
870 870 c, g dbSNP:768770098
875 875 c, t dbSNP:760676423
885 885 c, t dbSNP:775610689
898 898 c, t dbSNP:528383817
899 899 a, g dbSNP:200419726
900 900 c, t dbSNP:146633975
901 901 a, g, t dbSNP:747909089
949 949 c, t dbSNP:55942358
950 950 a, g dbSNP:115937048
965 965 c, g dbSNP:775711986
986 986 a, g, t dbSNP:186632508
990 990 c, t dbSNP:148849490
991 991 a, g dbSNP:376316899
993 993 c, t dbSNP:759050321
1032 1032 -, a dbSNP:372463601
1043 1043 c, t dbSNP:182262432

Target ORF information:

RefSeq Version XM_011520264
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu71088
Accession Version XM_011520265.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 714bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 4 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)2598..2774(+)
Misc Feature(2)2598..2768(+)
Misc Feature(3)2604..2756(+)
Misc Feature(4)3114..3173(+)
Position Chain Variation Link
3 3 g, t dbSNP:772034378
55 55 a, c dbSNP:7480769
82 82 c, t dbSNP:532675088
93 93 c, t dbSNP:11037952
96 96 a, g dbSNP:545453824
110 110 -, a dbSNP:370525242
153 153 a, g dbSNP:1454075
156 156 g, t dbSNP:559819509
163 163 a, g dbSNP:541484128
176 176 a, g dbSNP:10838261
181 181 a, g dbSNP:556057838
188 188 g, t dbSNP:538173853
201 201 a, t dbSNP:72892156
221 221 c, t dbSNP:778088519
234 234 a, g dbSNP:185608733
252 252 g, t dbSNP:756541120
280 280 c, g dbSNP:557144599
292 292 c, t dbSNP:566830029
302 302 a, g dbSNP:767256291
319 319 c, t dbSNP:548713339
363 363 a, t dbSNP:754385339
405 405 a, c dbSNP:59900249
417 417 c, t dbSNP:576607769
428 428 a, g dbSNP:569461184
437 437 g, t dbSNP:766374982
442 442 c, t dbSNP:17530472
488 488 c, t dbSNP:532882594
544 544 a, t dbSNP:773326571
560 560 c, t dbSNP:558064184
565 565 g, t dbSNP:761729177
568 568 a, g dbSNP:112704604
570 570 -, a dbSNP:540757030
575 575 c, g dbSNP:775519687
606 606 g, t dbSNP:558142923
664 664 a, g dbSNP:111976087
686 686 c, t dbSNP:12796759
729 729 a, g dbSNP:759496203
756 756 c, t dbSNP:559686844
759 759 g, t dbSNP:541548010
760 760 c, g dbSNP:574433286
807 807 a, g dbSNP:562741497
841 841 c, g dbSNP:540180630
842 842 a, g dbSNP:114732536
844 844 a, c dbSNP:576922156
853 853 a, c dbSNP:558898013
884 884 c, t dbSNP:3845266
947 947 g, t dbSNP:573294035
948 948 g, t dbSNP:554978978
953 953 c, t dbSNP:536779068
954 954 g, t dbSNP:569244747
956 956 a, g dbSNP:557582579
964 964 a, g dbSNP:150145116
1023 1023 a, g dbSNP:181702922
1027 1027 c, g dbSNP:7479973
1030 1030 g, t dbSNP:528733714
1052 1052 a, c dbSNP:188924421
1099 1099 -, t dbSNP:781771639
1121 1121 g, t dbSNP:535157541
1151 1151 c, t dbSNP:185763756
1152 1152 a, c dbSNP:193025078
1192 1192 c, t dbSNP:562446810
1204 1204 a, g dbSNP:544255132
1248 1248 c, t dbSNP:751668764
1249 1249 a, g dbSNP:777787489
1287 1287 c, t dbSNP:758717085
1310 1310 c, t dbSNP:373454180
1330 1330 a, c, t dbSNP:550728840
1341 1341 a, g dbSNP:540560163
1373 1373 a, g dbSNP:573156990
1374 1374 -, c dbSNP:35205456
1403 1403 a, g dbSNP:143601771
1408 1408 g, t dbSNP:751060295
1448 1448 c, g dbSNP:542654812
1460 1460 a, g dbSNP:190609968
1479 1479 a, c, t dbSNP:4755810
1494 1494 a, g dbSNP:539089556
1514 1514 g, t dbSNP:571528614
1525 1525 a, t dbSNP:553129551
1533 1533 a, g dbSNP:569607917
1542 1542 c, t dbSNP:535024183
1565 1565 a, t dbSNP:567615049
1580 1580 g, t dbSNP:565164710
1589 1589 c, g dbSNP:750376945
1595 1595 a, g dbSNP:549218208
1663 1663 g, t dbSNP:138094354
1668 1668 a, g dbSNP:7107534
1720 1720 -, ctc dbSNP:369659568
1739 1739 a, g dbSNP:368225747
1751 1751 c, t dbSNP:372442005
1755 1755 c, g dbSNP:551783414
1783 1783 a, g dbSNP:565669117
1801 1801 g, t dbSNP:761451772
1888 1888 a, c dbSNP:532210864
1896 1896 c, t dbSNP:114598046
1903 1903 a, c dbSNP:12416729
1907 1907 g, t dbSNP:765068248
1926 1926 g, t dbSNP:540421007
1934 1934 a, g dbSNP:528444249
1988 1988 c, g dbSNP:147072013
1995 1995 a, t dbSNP:1840257
2012 2012 c, t dbSNP:371157260
2014 2014 a, g dbSNP:563671534
2061 2061 c, t dbSNP:184543222
2097 2097 c, g dbSNP:1840256
2123 2123 a, c dbSNP:553196784
2138 2138 a, g dbSNP:534890315
2145 2145 c, g dbSNP:573854997
2162 2162 c, t dbSNP:770993412
2169 2169 c, t dbSNP:555800901
2183 2183 a, c dbSNP:553811436
2190 2190 c, t dbSNP:568785866
2216 2216 a, t dbSNP:550532164
2227 2227 a, g dbSNP:766364910
2235 2235 c, t dbSNP:760046144
2237 2237 a, t dbSNP:367764629
2254 2254 c, g dbSNP:543008177
2255 2255 c, t dbSNP:191202221
2256 2256 c, t dbSNP:546673030
2323 2323 a, g dbSNP:528307009
2339 2339 a, c dbSNP:769140906
2340 2340 -, tgcaagacgc dbSNP:387906325
2346 2346 a, g dbSNP:747567353
2347 2347 a, c dbSNP:776145976
2350 2350 a, c dbSNP:534395095
2358 2358 a, g dbSNP:772281686
2372 2372 c, g dbSNP:746262802
2373 2373 c, t dbSNP:104894191
2380 2380 a, g dbSNP:778941350
2384 2384 c, t dbSNP:757556220
2387 2387 c, t dbSNP:200895706
2395 2395 a, g dbSNP:374726657
2409 2409 g, t dbSNP:754942746
2415 2415 a, t dbSNP:182274454
2429 2429 c, g dbSNP:553689111
2442 2442 g, t dbSNP:371740812
2444 2444 a, g dbSNP:147204958
2449 2449 a, t dbSNP:779790993
2452 2452 c, t dbSNP:758432138
2457 2457 c, t dbSNP:750173751
2459 2459 -, t dbSNP:587776614
2473 2473 c, t dbSNP:765070227
2477 2477 a, g dbSNP:774447144
2479 2479 g, t dbSNP:769556306
2482 2482 a, g dbSNP:756876669
2483 2483 c, g dbSNP:376287400
2489 2489 c, g dbSNP:763754428
2492 2492 c, t dbSNP:760043881
2493 2493 c, g dbSNP:775067051
2502 2502 a, g dbSNP:368396709
2504 2504 a, g dbSNP:760145254
2516 2516 g, t dbSNP:774556630
2524 2524 a, c, t dbSNP:143620051
2532 2532 c, t dbSNP:773510510
2533 2533 a, g dbSNP:201303900
2536 2536 a, c dbSNP:748173197
2549 2549 a, c dbSNP:61737295
2551 2551 c, t dbSNP:758249273
2556 2556 c, t dbSNP:745862299
2560 2560 g, t dbSNP:150424138
2564 2564 a, g dbSNP:756993500
2568 2568 g, t dbSNP:753642057
2570 2570 c, t dbSNP:777337755
2571 2571 a, g dbSNP:140457891
2573 2573 c, t dbSNP:180962051
2575 2575 a, c, t dbSNP:104894197
2576 2576 a, c, g dbSNP:10769028
2582 2582 a, c dbSNP:568863681
2585 2585 c, t dbSNP:763344358
2586 2586 a, g dbSNP:281865154
2591 2591 c, g dbSNP:773780472
2598 2598 c, t dbSNP:770130333
2599 2599 a, g dbSNP:370195126
2601 2601 c, g, t dbSNP:587777700
2603 2603 a, g dbSNP:550698378
2607 2607 a, c, t dbSNP:138094422
2608 2608 a, g dbSNP:104894193
2618 2618 c, t dbSNP:770858153
2628 2628 c, g dbSNP:587777701
2631 2631 c, t dbSNP:749075893
2634 2634 a, g dbSNP:376402455
2635 2635 a, g dbSNP:755698536
2637 2637 a, g dbSNP:201889959
2639 2639 a, g dbSNP:752434708
2640 2640 a, c dbSNP:780739319
2656 2656 a, c dbSNP:754454206
2669 2669 c, t dbSNP:751119502
2675 2675 c, t dbSNP:766990322
2676 2676 a, g, t dbSNP:750798110
2683 2683 c, t dbSNP:145166164
2684 2684 a, g dbSNP:11037928
2691 2691 c, t dbSNP:104894192
2694 2694 a, c dbSNP:776867365
2696 2696 c, g dbSNP:768770098
2701 2701 c, t dbSNP:760676423
2711 2711 c, t dbSNP:775610689
2724 2724 c, t dbSNP:528383817
2725 2725 a, g dbSNP:200419726
2726 2726 c, t dbSNP:146633975
2727 2727 a, g, t dbSNP:747909089
2735 2735 c, t dbSNP:767748164
2746 2746 a, g dbSNP:759545911
2747 2747 c, t dbSNP:375808395
2748 2748 c, t dbSNP:267606653
2749 2749 g, t dbSNP:765208460
2753 2753 a, g dbSNP:761707439
2770 2770 c, g dbSNP:104894196
2771 2771 a, g dbSNP:371742894
2774 2774 a, g dbSNP:768535130
2775 2775 c, t dbSNP:746826513
2776 2776 a, g dbSNP:368050443
2785 2785 -, a dbSNP:764486762
2786 2786 c, g dbSNP:530368100
2790 2790 a, c dbSNP:771851241
2798 2798 a, t dbSNP:745376185
2800 2800 a, g dbSNP:144440589
2803 2803 a, c dbSNP:771444101
2834 2834 c, t dbSNP:12419361
2837 2837 c, t dbSNP:778373738
2839 2839 c, g dbSNP:756421390
2841 2841 c, g dbSNP:753073089
2842 2842 a, g dbSNP:144961504
2855 2855 c, t dbSNP:373589363
2856 2856 a, g, t dbSNP:766411205
2870 2870 a, c dbSNP:748695742
2872 2872 c, t dbSNP:149897209
2873 2873 a, g dbSNP:145904583
2882 2882 c, t dbSNP:747416406
2883 2883 a, g dbSNP:780076792
2891 2891 c, t dbSNP:150706927
2894 2894 a, g, t dbSNP:541605039
2897 2897 c, t dbSNP:756084826
2902 2902 c, t dbSNP:752640074
2904 2904 c, t dbSNP:767511619
2914 2914 c, g dbSNP:754671277
2915 2915 c, t dbSNP:574187575
2918 2918 c, t dbSNP:561018820
2919 2919 a, g, t dbSNP:762716140
2927 2927 c, t dbSNP:542338601
2931 2931 ctaagatctcaacagagatggcaact, gacccggtgc dbSNP:587777702
2931 2931 a, g dbSNP:186244229
2935 2935 c, t dbSNP:372163762
2936 2936 a, g dbSNP:367915603
2956 2956 c, t dbSNP:760189256
2966 2966 a, c dbSNP:747334899
2967 2967 a, c dbSNP:144198846
2968 2968 c, g dbSNP:772158840
2970 2970 a, c, g, t dbSNP:757361317
2989 2989 a, g dbSNP:749390789
2990 2990 a, c, t dbSNP:140652481
2991 2991 a, g dbSNP:751290539
2996 2996 c, t dbSNP:766238204
2997 2997 a, g dbSNP:369033845
3007 3007 g, t dbSNP:750030599
3010 3010 -, tgt dbSNP:776002938
3011 3011 a, c, g dbSNP:147215488
3013 3013 c, t dbSNP:761250353
3017 3017 a, g dbSNP:776186258
3024 3024 a, g dbSNP:764490498
3029 3029 c, t dbSNP:3802805
3030 3030 a, g dbSNP:775689545
3037 3037 a, t dbSNP:772445432
3038 3038 a, g dbSNP:760004486
3039 3039 a, g dbSNP:774659166
3040 3040 c, t dbSNP:61737293
3041 3041 a, g, t dbSNP:201245023
3045 3045 a, g dbSNP:768446841
3050 3050 a, c dbSNP:369085844
3051 3051 a, t dbSNP:779876897
3053 3053 c, t dbSNP:758129706
3061 3061 a, g dbSNP:750221052
3067 3067 a, c dbSNP:778529834
3072 3072 c, t dbSNP:148027225
3075 3075 a, g dbSNP:753270187
3084 3084 c, t dbSNP:763704637
3088 3088 a, g dbSNP:144742417
3095 3095 c, t dbSNP:753201422
3096 3096 c, g dbSNP:768153687
3097 3097 a, g dbSNP:759914813
3098 3098 a, g dbSNP:774924693
3101 3101 c, t dbSNP:355697
3104 3104 c, t dbSNP:376675326
3105 3105 a, g dbSNP:763307132
3107 3107 c, t dbSNP:549463745
3108 3108 a, c, g dbSNP:748187496
3111 3111 c, g dbSNP:779972509
3113 3113 a, g, t dbSNP:372442372
3115 3115 a, g dbSNP:200431603
3117 3117 c, t dbSNP:778724337
3118 3118 a, g dbSNP:756876780
3128 3128 a, g dbSNP:753493510
3133 3133 a, t dbSNP:777315924
3134 3134 c, t dbSNP:755595641
3135 3135 a, g dbSNP:369740288
3136 3136 c, t dbSNP:774043649
3137 3137 a, g dbSNP:149365713
3140 3140 c, g dbSNP:751941183
3144 3144 c, t dbSNP:766809146
3145 3145 a, g dbSNP:763248407
3148 3148 g, t dbSNP:773423723
3161 3161 a, g dbSNP:375068808
3169 3169 a, c, g, t dbSNP:200122905
3170 3170 a, g dbSNP:770986777
3173 3173 c, t dbSNP:745849255
3182 3182 a, g dbSNP:774306730
3207 3207 c, t dbSNP:770666353
3209 3209 a, g dbSNP:749052167
3211 3211 c, g dbSNP:369302027
3214 3214 c, t dbSNP:755790488
3215 3215 a, g dbSNP:533211314
3216 3216 c, t dbSNP:780898515
3219 3219 a, c, t dbSNP:559981237
3220 3220 a, g dbSNP:749632326
3224 3224 a, c, t dbSNP:200498976
3227 3227 c, t dbSNP:750817902
3236 3236 c, t dbSNP:201804180
3237 3237 a, g dbSNP:72905941
3240 3240 c, t dbSNP:368986164
3260 3260 c, t dbSNP:542277168
3269 3269 -, tttcctaa dbSNP:780535907
3291 3291 g, t dbSNP:574989828
3327 3327 c, t dbSNP:563081740
3329 3329 c, t dbSNP:576693004
3346 3346 c, t dbSNP:544585965
3347 3347 a, g dbSNP:376658247
3367 3367 a, g dbSNP:750475916
3381 3381 -, t dbSNP:149189417
3387 3387 c, t dbSNP:189945537
3388 3388 -, c dbSNP:34142561
3419 3419 c, t dbSNP:4755798
3453 3453 a, g dbSNP:560751940
3457 3457 g, t dbSNP:60998360
3481 3481 c, t dbSNP:7128671
3506 3506 a, t dbSNP:761134482
3538 3538 a, c dbSNP:570155774
3542 3542 c, t dbSNP:775765158
3563 3563 a, g dbSNP:113482355
3588 3588 c, g dbSNP:558317757
3598 3598 a, g dbSNP:539799951
3615 3615 -, c dbSNP:113592690
3628 3628 c, t dbSNP:542591808
3708 3708 c, t dbSNP:4755797
3715 3715 c, t dbSNP:534068592
3734 3734 c, t dbSNP:568270311
3737 3737 c, t dbSNP:549951730
3738 3738 a, g dbSNP:4755796
3754 3754 c, t dbSNP:574340639
3764 3764 c, t dbSNP:554752826
3811 3811 c, t dbSNP:544795542
3846 3846 a, g dbSNP:532906858
3850 3850 c, t dbSNP:147563621
3904 3904 a, c, g, t dbSNP:410592
3905 3905 a, c, g dbSNP:454205
3929 3929 c, t dbSNP:747955576
3947 3947 a, t dbSNP:781008520
3973 3973 a, g dbSNP:373562733
3993 3993 -, aga dbSNP:373830863
3998 3998 -, aag dbSNP:149719812
4029 4029 c, t dbSNP:369798593
4046 4046 c, t dbSNP:573850141
4050 4050 a, c dbSNP:758619819
4058 4058 c, t dbSNP:746147000
4064 4064 c, t dbSNP:555740434
4090 4090 c, t dbSNP:543627488
4093 4093 a, g dbSNP:76229477
4104 4104 a, c dbSNP:763305324
4113 4113 g, t dbSNP:185632337
4114 4114 c, t dbSNP:181642223
4119 4119 a, t dbSNP:566027488
4135 4135 g, t dbSNP:188954464
4153 4153 c, t dbSNP:552527026
4154 4154 a, g dbSNP:140400459
4163 4163 c, t dbSNP:151214135
4164 4164 a, g dbSNP:117526668
4173 4173 a, c dbSNP:768051621
4181 4181 c, t dbSNP:184957641
4188 4188 c, g dbSNP:192668810
4194 4194 a, c dbSNP:776365654
4216 4216 c, t dbSNP:142207322
4238 4238 g, t dbSNP:759202883
4239 4239 c, t dbSNP:532888348
4240 4240 a, g dbSNP:190383779
4279 4279 a, g dbSNP:149094042
4291 4291 c, g dbSNP:765943711
4312 4312 c, t dbSNP:146483327
4322 4322 c, t dbSNP:10458913
4327 4327 a, g dbSNP:543762689
4338 4338 c, t dbSNP:576272082
4372 4372 c, t dbSNP:760091330
4397 4397 c, t dbSNP:761727621
4409 4409 c, t dbSNP:776401651
4410 4410 a, g dbSNP:564284430
4418 4418 a, g dbSNP:76501131
4482 4482 a, g dbSNP:768453519
4528 4528 a, c dbSNP:572446886
4535 4535 c, t dbSNP:546675090
4536 4536 a, g dbSNP:113781536
4537 4537 -, g dbSNP:544187857
4556 4556 a, c dbSNP:529798397
4562 4562 g, t dbSNP:556404097
4588 4588 a, g dbSNP:538156753
4638 4638 a, g dbSNP:11037920
4654 4654 c, g dbSNP:771684261
4657 4657 a, g dbSNP:552492615
4709 4709 a, g dbSNP:534446074
4715 4715 c, t dbSNP:565623792
4723 4723 a, g dbSNP:373805569
4753 4753 c, g dbSNP:111964563
4758 4758 -, g dbSNP:572968250
4776 4776 a, g dbSNP:777781257
4781 4781 a, g dbSNP:562110335
4790 4790 c, t dbSNP:561685019
4795 4795 a, g dbSNP:371745373
4809 4809 c, g dbSNP:550061337
4820 4820 c, t dbSNP:184605209
4831 4831 a, g dbSNP:564454698
4889 4889 c, t dbSNP:545661630
4890 4890 g, t dbSNP:7942612
4894 4894 a, g dbSNP:560354358
4904 4904 c, g dbSNP:76845793
4906 4906 a, g dbSNP:574449963
4928 4928 a, g dbSNP:556140195
4934 4934 a, g dbSNP:371942370
4941 4941 a, g dbSNP:537895424
4970 4970 a, g dbSNP:531847254
5062 5062 a, g dbSNP:577110812
5075 5075 c, t dbSNP:559237769
5087 5087 a, g dbSNP:55959427
5092 5092 a, g dbSNP:78007447
5094 5094 c, t dbSNP:547143560
5102 5102 a, g dbSNP:751205455
5104 5104 a, g dbSNP:189662898
5193 5193 -, c dbSNP:35568325
5203 5203 a, g dbSNP:192255899
5221 5221 -, g dbSNP:539395363
5262 5262 -, c dbSNP:748703603
5301 5301 a, g dbSNP:7105993
5319 5319 c, t dbSNP:531378094
5323 5323 a, g dbSNP:749948307
5327 5327 g, t dbSNP:144345241
5345 5345 a, t dbSNP:552464810
5377 5377 c, t dbSNP:764716559
5417 5417 a, g dbSNP:78607024
5425 5425 c, t dbSNP:188326744
5435 5435 a, g dbSNP:183882854
5475 5475 a, g dbSNP:768402292
5540 5540 a, c dbSNP:139570599
5541 5541 c, t dbSNP:562682705
5560 5560 a, g dbSNP:540283910
5584 5584 c, t dbSNP:775302113
5585 5585 a, g dbSNP:544184954
5606 5606 c, t dbSNP:577196862
5608 5608 -, a dbSNP:139529859
5630 5630 c, g dbSNP:370961774
5637 5637 c, g dbSNP:757829050
5654 5654 a, t dbSNP:192114163
5661 5661 a, g dbSNP:749529470
5669 5669 c, t dbSNP:187228888
5670 5670 c, t dbSNP:897004
5698 5698 a, g dbSNP:75369525
5749 5749 a, t dbSNP:536896010
5751 5751 a, c dbSNP:568154025
5756 5756 -, t dbSNP:376571868
5798 5798 c, t dbSNP:148576097
5836 5836 -, c dbSNP:752134665
5845 5845 a, g dbSNP:112232037
5863 5863 c, g dbSNP:370745972
5864 5864 a, t dbSNP:146304390
5873 5873 c, t dbSNP:897005
5909 5909 c, t dbSNP:570441911
5940 5940 c, t dbSNP:755590000
5941 5941 a, g dbSNP:372769669
5955 5955 c, t dbSNP:765560684
5959 5959 c, t dbSNP:747349734
5960 5960 a, g dbSNP:369226766
5997 5997 g, t dbSNP:566698169
6019 6019 c, t dbSNP:77015141
6023 6023 a, c dbSNP:1840254
6033 6033 c, t dbSNP:562621207
6036 6036 a, g dbSNP:182853569
6044 6044 c, g dbSNP:532370405
6052 6052 a, c dbSNP:192487688
6105 6105 c, t dbSNP:188675900
6106 6106 a, g dbSNP:573480816
6136 6136 a, g dbSNP:373283
6137 6137 a, g dbSNP:453267
6182 6182 a, g dbSNP:556132435
6195 6195 c, t dbSNP:543230713
6203 6203 c, g dbSNP:117877500
6235 6235 a, g dbSNP:149764792
6272 6272 c, t dbSNP:139681611
6298 6298 a, g dbSNP:4755239
6314 6314 a, g dbSNP:182987016
6325 6325 a, g dbSNP:766967309
6343 6343 a, g dbSNP:537495662
6357 6357 c, t dbSNP:7116335
6378 6378 a, c dbSNP:566743690
6413 6413 c, t dbSNP:548107538
6424 6424 c, t dbSNP:767228404
6430 6430 c, t dbSNP:190643475
6432 6432 c, g dbSNP:550434819
6440 6440 a, g dbSNP:568728928
6449 6449 c, t dbSNP:773333256
6492 6492 g, t dbSNP:550622242
6538 6538 a, c dbSNP:150701828
6572 6572 c, t dbSNP:531931217
6573 6573 a, g dbSNP:748214374
6576 6576 c, t dbSNP:142004753
6590 6590 a, c dbSNP:113734133
6596 6596 a, g, t dbSNP:7115841
6600 6600 a, g dbSNP:747580754
6604 6604 a, g dbSNP:780412869
6623 6623 c, t dbSNP:758694942
6630 6630 -, gt dbSNP:374150602
6657 6657 a, c dbSNP:778340814
6712 6712 c, g dbSNP:561534323
6718 6718 a, g dbSNP:185781739
6720 6720 a, c dbSNP:745494340
6722 6722 a, g dbSNP:575864402
6768 6768 c, t dbSNP:569151215
6787 6787 c, g dbSNP:11037919
6828 6828 c, t dbSNP:756954535
6854 6854 c, t dbSNP:576862101
6897 6897 a, g dbSNP:558403646
6914 6914 a, c dbSNP:753339429
6960 6960 c, t dbSNP:116662493
6964 6964 a, g dbSNP:114755169
6967 6967 c, g dbSNP:552414721
6971 6971 c, t dbSNP:771229047
6975 6975 a, c dbSNP:554409058
6983 6983 c, t dbSNP:147497663
6996 6996 a, g dbSNP:373307279
7003 7003 a, g dbSNP:143536201
7016 7016 c, g dbSNP:538499078
7033 7033 c, t dbSNP:571701553
7067 7067 c, t dbSNP:755986390
7073 7073 c, g dbSNP:546810144
7104 7104 a, g dbSNP:528449092
7133 7133 a, g dbSNP:532671795
7134 7134 a, g dbSNP:373059937
7178 7178 a, g dbSNP:752581342
7190 7190 c, t dbSNP:369328027
7231 7231 a, t dbSNP:767299156
7289 7289 a, g dbSNP:759267585
7296 7296 c, t dbSNP:560087261
7309 7309 -, t dbSNP:34557775
7325 7325 a, c dbSNP:531226738
7328 7328 -, a dbSNP:540638130
7342 7342 a, g dbSNP:765522183
7386 7386 a, g dbSNP:778437510
7418 7418 a, g dbSNP:564010958
7460 7460 c, t dbSNP:545567068
7466 7466 a, g dbSNP:578129939
7475 7475 c, g, t dbSNP:10734522
7485 7485 a, c dbSNP:768874612
7495 7495 a, g dbSNP:137974654
7519 7519 a, g dbSNP:558293622
7524 7524 c, t dbSNP:554149054
7535 7535 c, t dbSNP:115411752
7548 7548 c, t dbSNP:575179093
7553 7553 -, c dbSNP:779265170
7566 7566 g, t dbSNP:200760569
7570 7570 -, gtt dbSNP:548359569

Target ORF information:

RefSeq Version XM_011520265
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu71088
Accession Version XM_011520266.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 714bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 4 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)246..422(+)
Misc Feature(2)246..416(+)
Misc Feature(3)252..404(+)
Misc Feature(4)762..821(+)
Position Chain Variation Link
2 2 g, t dbSNP:574246023
3 3 a, g dbSNP:141914716
6 6 a, c dbSNP:2054029
27 27 a, g dbSNP:575277559
60 60 -, c dbSNP:141309099
68 68 a, c dbSNP:750788692
77 77 c, g dbSNP:553689111
90 90 g, t dbSNP:371740812
92 92 a, g dbSNP:147204958
97 97 a, t dbSNP:779790993
100 100 c, t dbSNP:758432138
105 105 c, t dbSNP:750173751
107 107 -, t dbSNP:587776614
121 121 c, t dbSNP:765070227
125 125 a, g dbSNP:774447144
127 127 g, t dbSNP:769556306
130 130 a, g dbSNP:756876669
131 131 c, g dbSNP:376287400
137 137 c, g dbSNP:763754428
140 140 c, t dbSNP:760043881
141 141 c, g dbSNP:775067051
150 150 a, g dbSNP:368396709
152 152 a, g dbSNP:760145254
164 164 g, t dbSNP:774556630
172 172 a, c, t dbSNP:143620051
180 180 c, t dbSNP:773510510
181 181 a, g dbSNP:201303900
184 184 a, c dbSNP:748173197
197 197 a, c dbSNP:61737295
199 199 c, t dbSNP:758249273
204 204 c, t dbSNP:745862299
208 208 g, t dbSNP:150424138
212 212 a, g dbSNP:756993500
216 216 g, t dbSNP:753642057
218 218 c, t dbSNP:777337755
219 219 a, g dbSNP:140457891
221 221 c, t dbSNP:180962051
223 223 a, c, t dbSNP:104894197
224 224 a, c, g dbSNP:10769028
230 230 a, c dbSNP:568863681
233 233 c, t dbSNP:763344358
234 234 a, g dbSNP:281865154
239 239 c, g dbSNP:773780472
246 246 c, t dbSNP:770130333
247 247 a, g dbSNP:370195126
249 249 c, g, t dbSNP:587777700
251 251 a, g dbSNP:550698378
255 255 a, c, t dbSNP:138094422
256 256 a, g dbSNP:104894193
266 266 c, t dbSNP:770858153
276 276 c, g dbSNP:587777701
279 279 c, t dbSNP:749075893
282 282 a, g dbSNP:376402455
283 283 a, g dbSNP:755698536
285 285 a, g dbSNP:201889959
287 287 a, g dbSNP:752434708
288 288 a, c dbSNP:780739319
304 304 a, c dbSNP:754454206
317 317 c, t dbSNP:751119502
323 323 c, t dbSNP:766990322
324 324 a, g, t dbSNP:750798110
331 331 c, t dbSNP:145166164
332 332 a, g dbSNP:11037928
339 339 c, t dbSNP:104894192
342 342 a, c dbSNP:776867365
344 344 c, g dbSNP:768770098
349 349 c, t dbSNP:760676423
359 359 c, t dbSNP:775610689
372 372 c, t dbSNP:528383817
373 373 a, g dbSNP:200419726
374 374 c, t dbSNP:146633975
375 375 a, g, t dbSNP:747909089
383 383 c, t dbSNP:767748164
394 394 a, g dbSNP:759545911
395 395 c, t dbSNP:375808395
396 396 c, t dbSNP:267606653
397 397 g, t dbSNP:765208460
401 401 a, g dbSNP:761707439
418 418 c, g dbSNP:104894196
419 419 a, g dbSNP:371742894
422 422 a, g dbSNP:768535130
423 423 c, t dbSNP:746826513
424 424 a, g dbSNP:368050443
433 433 -, a dbSNP:764486762
434 434 c, g dbSNP:530368100
438 438 a, c dbSNP:771851241
446 446 a, t dbSNP:745376185
448 448 a, g dbSNP:144440589
451 451 a, c dbSNP:771444101
482 482 c, t dbSNP:12419361
485 485 c, t dbSNP:778373738
487 487 c, g dbSNP:756421390
489 489 c, g dbSNP:753073089
490 490 a, g dbSNP:144961504
503 503 c, t dbSNP:373589363
504 504 a, g, t dbSNP:766411205
518 518 a, c dbSNP:748695742
520 520 c, t dbSNP:149897209
521 521 a, g dbSNP:145904583
530 530 c, t dbSNP:747416406
531 531 a, g dbSNP:780076792
539 539 c, t dbSNP:150706927
542 542 a, g, t dbSNP:541605039
545 545 c, t dbSNP:756084826
550 550 c, t dbSNP:752640074
552 552 c, t dbSNP:767511619
562 562 c, g dbSNP:754671277
563 563 c, t dbSNP:574187575
566 566 c, t dbSNP:561018820
567 567 a, g, t dbSNP:762716140
575 575 c, t dbSNP:542338601
579 579 ctaagatctcaacagagatggcaact, gacccggtgc dbSNP:587777702
579 579 a, g dbSNP:186244229
583 583 c, t dbSNP:372163762
584 584 a, g dbSNP:367915603
604 604 c, t dbSNP:760189256
614 614 a, c dbSNP:747334899
615 615 a, c dbSNP:144198846
616 616 c, g dbSNP:772158840
618 618 a, c, g, t dbSNP:757361317
637 637 a, g dbSNP:749390789
638 638 a, c, t dbSNP:140652481
639 639 a, g dbSNP:751290539
644 644 c, t dbSNP:766238204
645 645 a, g dbSNP:369033845
655 655 g, t dbSNP:750030599
658 658 -, tgt dbSNP:776002938
659 659 a, c, g dbSNP:147215488
661 661 c, t dbSNP:761250353
665 665 a, g dbSNP:776186258
672 672 a, g dbSNP:764490498
677 677 c, t dbSNP:3802805
678 678 a, g dbSNP:775689545
685 685 a, t dbSNP:772445432
686 686 a, g dbSNP:760004486
687 687 a, g dbSNP:774659166
688 688 c, t dbSNP:61737293
689 689 a, g, t dbSNP:201245023
693 693 a, g dbSNP:768446841
698 698 a, c dbSNP:369085844
699 699 a, t dbSNP:779876897
701 701 c, t dbSNP:758129706
709 709 a, g dbSNP:750221052
715 715 a, c dbSNP:778529834
720 720 c, t dbSNP:148027225
723 723 a, g dbSNP:753270187
732 732 c, t dbSNP:763704637
736 736 a, g dbSNP:144742417
743 743 c, t dbSNP:753201422
744 744 c, g dbSNP:768153687
745 745 a, g dbSNP:759914813
746 746 a, g dbSNP:774924693
749 749 c, t dbSNP:355697
752 752 c, t dbSNP:376675326
753 753 a, g dbSNP:763307132
755 755 c, t dbSNP:549463745
756 756 a, c, g dbSNP:748187496
759 759 c, g dbSNP:779972509
761 761 a, g, t dbSNP:372442372
763 763 a, g dbSNP:200431603
765 765 c, t dbSNP:778724337
766 766 a, g dbSNP:756876780
776 776 a, g dbSNP:753493510
781 781 a, t dbSNP:777315924
782 782 c, t dbSNP:755595641
783 783 a, g dbSNP:369740288
784 784 c, t dbSNP:774043649
785 785 a, g dbSNP:149365713
788 788 c, g dbSNP:751941183
792 792 c, t dbSNP:766809146
793 793 a, g dbSNP:763248407
796 796 g, t dbSNP:773423723
809 809 a, g dbSNP:375068808
817 817 a, c, g, t dbSNP:200122905
818 818 a, g dbSNP:770986777
821 821 c, t dbSNP:745849255
830 830 a, g dbSNP:774306730
855 855 c, t dbSNP:770666353
857 857 a, g dbSNP:749052167
859 859 c, g dbSNP:369302027
862 862 c, t dbSNP:755790488
863 863 a, g dbSNP:533211314
864 864 c, t dbSNP:780898515
867 867 a, c, t dbSNP:559981237
868 868 a, g dbSNP:749632326
872 872 a, c, t dbSNP:200498976
875 875 c, t dbSNP:750817902
884 884 c, t dbSNP:201804180
885 885 a, g dbSNP:72905941
888 888 c, t dbSNP:368986164
908 908 c, t dbSNP:542277168
917 917 -, tttcctaa dbSNP:780535907
939 939 g, t dbSNP:574989828
975 975 c, t dbSNP:563081740
977 977 c, t dbSNP:576693004
994 994 c, t dbSNP:544585965
995 995 a, g dbSNP:376658247
1015 1015 a, g dbSNP:750475916
1029 1029 -, t dbSNP:149189417
1035 1035 c, t dbSNP:189945537
1036 1036 -, c dbSNP:34142561
1067 1067 c, t dbSNP:4755798
1101 1101 a, g dbSNP:560751940
1105 1105 g, t dbSNP:60998360
1129 1129 c, t dbSNP:7128671
1154 1154 a, t dbSNP:761134482
1186 1186 a, c dbSNP:570155774
1190 1190 c, t dbSNP:775765158
1211 1211 a, g dbSNP:113482355
1236 1236 c, g dbSNP:558317757
1246 1246 a, g dbSNP:539799951
1263 1263 -, c dbSNP:113592690
1276 1276 c, t dbSNP:542591808
1356 1356 c, t dbSNP:4755797
1363 1363 c, t dbSNP:534068592
1382 1382 c, t dbSNP:568270311
1385 1385 c, t dbSNP:549951730
1386 1386 a, g dbSNP:4755796
1402 1402 c, t dbSNP:574340639
1412 1412 c, t dbSNP:554752826
1459 1459 c, t dbSNP:544795542
1494 1494 a, g dbSNP:532906858
1498 1498 c, t dbSNP:147563621
1552 1552 a, c, g, t dbSNP:410592
1553 1553 a, c, g dbSNP:454205
1577 1577 c, t dbSNP:747955576
1595 1595 a, t dbSNP:781008520
1621 1621 a, g dbSNP:373562733
1641 1641 -, aga dbSNP:373830863
1646 1646 -, aag dbSNP:149719812
1677 1677 c, t dbSNP:369798593
1694 1694 c, t dbSNP:573850141
1698 1698 a, c dbSNP:758619819
1706 1706 c, t dbSNP:746147000
1712 1712 c, t dbSNP:555740434
1738 1738 c, t dbSNP:543627488
1741 1741 a, g dbSNP:76229477
1752 1752 a, c dbSNP:763305324
1761 1761 g, t dbSNP:185632337
1762 1762 c, t dbSNP:181642223
1767 1767 a, t dbSNP:566027488
1783 1783 g, t dbSNP:188954464
1801 1801 c, t dbSNP:552527026
1802 1802 a, g dbSNP:140400459
1811 1811 c, t dbSNP:151214135
1812 1812 a, g dbSNP:117526668
1821 1821 a, c dbSNP:768051621
1829 1829 c, t dbSNP:184957641
1836 1836 c, g dbSNP:192668810
1842 1842 a, c dbSNP:776365654
1864 1864 c, t dbSNP:142207322
1886 1886 g, t dbSNP:759202883
1887 1887 c, t dbSNP:532888348
1888 1888 a, g dbSNP:190383779
1927 1927 a, g dbSNP:149094042
1939 1939 c, g dbSNP:765943711
1960 1960 c, t dbSNP:146483327
1970 1970 c, t dbSNP:10458913
1975 1975 a, g dbSNP:543762689
1986 1986 c, t dbSNP:576272082
2020 2020 c, t dbSNP:760091330
2045 2045 c, t dbSNP:761727621
2057 2057 c, t dbSNP:776401651
2058 2058 a, g dbSNP:564284430
2066 2066 a, g dbSNP:76501131
2130 2130 a, g dbSNP:768453519
2176 2176 a, c dbSNP:572446886
2183 2183 c, t dbSNP:546675090
2184 2184 a, g dbSNP:113781536
2185 2185 -, g dbSNP:544187857
2204 2204 a, c dbSNP:529798397
2210 2210 g, t dbSNP:556404097
2236 2236 a, g dbSNP:538156753
2286 2286 a, g dbSNP:11037920
2302 2302 c, g dbSNP:771684261
2305 2305 a, g dbSNP:552492615
2357 2357 a, g dbSNP:534446074
2363 2363 c, t dbSNP:565623792
2371 2371 a, g dbSNP:373805569
2401 2401 c, g dbSNP:111964563
2406 2406 -, g dbSNP:572968250
2424 2424 a, g dbSNP:777781257
2429 2429 a, g dbSNP:562110335
2438 2438 c, t dbSNP:561685019
2443 2443 a, g dbSNP:371745373
2457 2457 c, g dbSNP:550061337
2468 2468 c, t dbSNP:184605209
2479 2479 a, g dbSNP:564454698
2537 2537 c, t dbSNP:545661630
2538 2538 g, t dbSNP:7942612
2542 2542 a, g dbSNP:560354358
2552 2552 c, g dbSNP:76845793
2554 2554 a, g dbSNP:574449963
2576 2576 a, g dbSNP:556140195
2582 2582 a, g dbSNP:371942370
2589 2589 a, g dbSNP:537895424
2618 2618 a, g dbSNP:531847254
2710 2710 a, g dbSNP:577110812
2723 2723 c, t dbSNP:559237769
2735 2735 a, g dbSNP:55959427
2740 2740 a, g dbSNP:78007447
2742 2742 c, t dbSNP:547143560
2750 2750 a, g dbSNP:751205455
2752 2752 a, g dbSNP:189662898
2841 2841 -, c dbSNP:35568325
2851 2851 a, g dbSNP:192255899
2869 2869 -, g dbSNP:539395363
2910 2910 -, c dbSNP:748703603
2949 2949 a, g dbSNP:7105993
2967 2967 c, t dbSNP:531378094
2971 2971 a, g dbSNP:749948307
2975 2975 g, t dbSNP:144345241
2993 2993 a, t dbSNP:552464810
3025 3025 c, t dbSNP:764716559
3065 3065 a, g dbSNP:78607024
3073 3073 c, t dbSNP:188326744
3083 3083 a, g dbSNP:183882854
3123 3123 a, g dbSNP:768402292
3188 3188 a, c dbSNP:139570599
3189 3189 c, t dbSNP:562682705
3208 3208 a, g dbSNP:540283910
3232 3232 c, t dbSNP:775302113
3233 3233 a, g dbSNP:544184954
3254 3254 c, t dbSNP:577196862
3256 3256 -, a dbSNP:139529859
3278 3278 c, g dbSNP:370961774
3285 3285 c, g dbSNP:757829050
3302 3302 a, t dbSNP:192114163
3309 3309 a, g dbSNP:749529470
3317 3317 c, t dbSNP:187228888
3318 3318 c, t dbSNP:897004
3346 3346 a, g dbSNP:75369525
3397 3397 a, t dbSNP:536896010
3399 3399 a, c dbSNP:568154025
3404 3404 -, t dbSNP:376571868
3446 3446 c, t dbSNP:148576097
3484 3484 -, c dbSNP:752134665
3493 3493 a, g dbSNP:112232037
3511 3511 c, g dbSNP:370745972
3512 3512 a, t dbSNP:146304390
3521 3521 c, t dbSNP:897005
3557 3557 c, t dbSNP:570441911
3588 3588 c, t dbSNP:755590000
3589 3589 a, g dbSNP:372769669
3603 3603 c, t dbSNP:765560684
3607 3607 c, t dbSNP:747349734
3608 3608 a, g dbSNP:369226766
3645 3645 g, t dbSNP:566698169
3667 3667 c, t dbSNP:77015141
3671 3671 a, c dbSNP:1840254
3681 3681 c, t dbSNP:562621207
3684 3684 a, g dbSNP:182853569
3692 3692 c, g dbSNP:532370405
3700 3700 a, c dbSNP:192487688
3753 3753 c, t dbSNP:188675900
3754 3754 a, g dbSNP:573480816
3784 3784 a, g dbSNP:373283
3785 3785 a, g dbSNP:453267
3830 3830 a, g dbSNP:556132435
3843 3843 c, t dbSNP:543230713
3851 3851 c, g dbSNP:117877500
3883 3883 a, g dbSNP:149764792
3920 3920 c, t dbSNP:139681611
3946 3946 a, g dbSNP:4755239
3962 3962 a, g dbSNP:182987016
3973 3973 a, g dbSNP:766967309
3991 3991 a, g dbSNP:537495662
4005 4005 c, t dbSNP:7116335
4026 4026 a, c dbSNP:566743690
4061 4061 c, t dbSNP:548107538
4072 4072 c, t dbSNP:767228404
4078 4078 c, t dbSNP:190643475
4080 4080 c, g dbSNP:550434819
4088 4088 a, g dbSNP:568728928
4097 4097 c, t dbSNP:773333256
4140 4140 g, t dbSNP:550622242
4186 4186 a, c dbSNP:150701828
4220 4220 c, t dbSNP:531931217
4221 4221 a, g dbSNP:748214374
4224 4224 c, t dbSNP:142004753
4238 4238 a, c dbSNP:113734133
4244 4244 a, g, t dbSNP:7115841
4248 4248 a, g dbSNP:747580754
4252 4252 a, g dbSNP:780412869
4271 4271 c, t dbSNP:758694942
4278 4278 -, gt dbSNP:374150602
4305 4305 a, c dbSNP:778340814
4360 4360 c, g dbSNP:561534323
4366 4366 a, g dbSNP:185781739
4368 4368 a, c dbSNP:745494340
4370 4370 a, g dbSNP:575864402
4416 4416 c, t dbSNP:569151215
4435 4435 c, g dbSNP:11037919
4476 4476 c, t dbSNP:756954535
4502 4502 c, t dbSNP:576862101
4545 4545 a, g dbSNP:558403646
4562 4562 a, c dbSNP:753339429
4608 4608 c, t dbSNP:116662493
4612 4612 a, g dbSNP:114755169
4615 4615 c, g dbSNP:552414721
4619 4619 c, t dbSNP:771229047
4623 4623 a, c dbSNP:554409058
4631 4631 c, t dbSNP:147497663
4644 4644 a, g dbSNP:373307279
4651 4651 a, g dbSNP:143536201
4664 4664 c, g dbSNP:538499078
4681 4681 c, t dbSNP:571701553
4715 4715 c, t dbSNP:755986390
4721 4721 c, g dbSNP:546810144
4752 4752 a, g dbSNP:528449092
4781 4781 a, g dbSNP:532671795
4782 4782 a, g dbSNP:373059937
4826 4826 a, g dbSNP:752581342
4838 4838 c, t dbSNP:369328027
4879 4879 a, t dbSNP:767299156
4937 4937 a, g dbSNP:759267585
4944 4944 c, t dbSNP:560087261
4957 4957 -, t dbSNP:34557775
4973 4973 a, c dbSNP:531226738
4976 4976 -, a dbSNP:540638130
4990 4990 a, g dbSNP:765522183
5034 5034 a, g dbSNP:778437510
5066 5066 a, g dbSNP:564010958
5108 5108 c, t dbSNP:545567068
5114 5114 a, g dbSNP:578129939
5123 5123 c, g, t dbSNP:10734522
5133 5133 a, c dbSNP:768874612
5143 5143 a, g dbSNP:137974654
5167 5167 a, g dbSNP:558293622
5172 5172 c, t dbSNP:554149054
5183 5183 c, t dbSNP:115411752
5196 5196 c, t dbSNP:575179093
5201 5201 -, c dbSNP:779265170
5214 5214 g, t dbSNP:200760569
5218 5218 -, gtt dbSNP:548359569

Target ORF information:

RefSeq Version XM_011520266
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ALX homeobox 4 (ALX4), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu22706
Accession Version NM_021926.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1236bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 4
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF294629.1, AB058691.1 and AC103854.2. This sequence is a reference standard in the RefSeqGene project. On Oct 10, 2009 this sequence version replaced gi:55743091. Summary: This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF294629.1, AB058691.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2142680 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)747..923(+)
Misc Feature(2)747..917(+)
Misc Feature(3)753..905(+)
Misc Feature(4)1263..1322(+)
Misc Feature(5)1275..1316(+)
Exon (1)1..570
Gene Synonym:
Exon (2)571..881
Gene Synonym:
Exon (3)882..1010
Gene Synonym:
Exon (4)1011..5466
Gene Synonym:
Position Chain Variation Link
14 14 a, c dbSNP:116381450
45 45 a, g dbSNP:530695931
54 54 c, t dbSNP:764565331
60 60 c, g dbSNP:377130834
65 65 c, t dbSNP:551356786
68 68 a, c dbSNP:772303422
69 69 c, g dbSNP:533107251
73 73 g, t dbSNP:774417073
75 75 a, g, t dbSNP:748167884
85 85 a, g dbSNP:373304528
93 93 a, c dbSNP:370141684
94 94 g, t dbSNP:746807473
95 95 c, g dbSNP:779702556
101 101 a, g dbSNP:758130420
105 105 a, g dbSNP:749945782
109 109 a, g dbSNP:778621319
111 111 c, g dbSNP:559427156
120 120 -, t dbSNP:746479735
120 120 c, t dbSNP:754405082
121 121 -, g dbSNP:772754759
122 122 c, g dbSNP:764539399
123 123 g, t dbSNP:281865153
128 128 c, t dbSNP:755972714
134 134 a, c dbSNP:767658097
143 143 c, g, t dbSNP:774394460
148 148 a, c dbSNP:766486576
156 156 a, g dbSNP:762975194
166 166 a, g dbSNP:374650044
167 167 c, t dbSNP:61737298
171 171 c, t dbSNP:746753665
172 172 c, t dbSNP:775495740
173 173 c, g, t dbSNP:115968657
179 179 g, t dbSNP:778531428
186 186 a, c dbSNP:756783968
187 187 c, g dbSNP:748769921
193 193 a, g dbSNP:370055325
203 203 a, t dbSNP:375641880
208 208 c, g dbSNP:3824915
209 209 g, t dbSNP:753099218
213 213 c, t dbSNP:767919976
216 216 c, t dbSNP:755162732
218 218 a, c, t dbSNP:766611438
223 223 a, g dbSNP:763035360
224 224 c, t dbSNP:773173346
225 225 a, g dbSNP:373566188
230 230 g, t dbSNP:369346595
234 234 a, g dbSNP:775401450
245 245 c, t dbSNP:772029021
247 247 c, t dbSNP:745685096
250 250 c, t dbSNP:764877187
251 251 c, g dbSNP:770503138
252 252 a, g dbSNP:374868143
263 263 a, g dbSNP:777213803
268 268 a, g dbSNP:756623127
276 276 a, g dbSNP:748695888
279 279 g, t dbSNP:781687811
290 290 c, t dbSNP:371338431
291 291 a, c dbSNP:374839498
292 292 a, g dbSNP:372830230
321 321 c, t dbSNP:766525768
330 330 a, c dbSNP:79200219
356 356 a, g dbSNP:750505389
357 357 a, g dbSNP:765279140
384 384 c, t dbSNP:760627532
385 385 a, c dbSNP:752638029
395 395 a, g dbSNP:767580968
396 396 a, c dbSNP:759346076
398 398 g, t dbSNP:774293144
399 399 a, c dbSNP:770611828
400 400 a, c dbSNP:762569952
402 402 a, c dbSNP:772749428
403 403 a, g dbSNP:769148200
406 406 c, g dbSNP:747680014
408 408 c, t dbSNP:12421995
409 409 c, g, t dbSNP:747374643
414 414 c, g dbSNP:780343108
415 415 a, c dbSNP:758621060
418 418 -, cgcagccgcagc dbSNP:201777848
418 418 c, t dbSNP:750648485
419 419 a, c, g dbSNP:757359392
422 422 a, g dbSNP:753978747
424 424 -, cgcagc dbSNP:778909542
430 430 a, c dbSNP:767495097
433 433 -, agcagc dbSNP:780001000
436 436 a, c dbSNP:759611855
437 437 -, tcg dbSNP:749275971
439 439 a, c dbSNP:751385178
440 440 -, tcgccg dbSNP:756167646
440 440 g, t dbSNP:766129018
448 448 a, c dbSNP:762839322
451 451 a, c dbSNP:772691401
452 452 g, t dbSNP:769501075
455 455 c, t dbSNP:761250433
461 461 a, g dbSNP:538795114
463 463 c, t dbSNP:186600034
464 464 g, t dbSNP:199971294
488 488 a, c dbSNP:769140906
489 489 -, tgcaagacgc dbSNP:387906325
495 495 a, g dbSNP:747567353
496 496 a, c dbSNP:776145976
499 499 a, c dbSNP:534395095
507 507 a, g dbSNP:772281686
521 521 c, g dbSNP:746262802
522 522 c, t dbSNP:104894191
529 529 a, g dbSNP:778941350
533 533 c, t dbSNP:757556220
536 536 c, t dbSNP:200895706
544 544 a, g dbSNP:374726657
558 558 g, t dbSNP:754942746
564 564 a, t dbSNP:182274454
578 578 c, g dbSNP:553689111
591 591 g, t dbSNP:371740812
593 593 a, g dbSNP:147204958
598 598 a, t dbSNP:779790993
601 601 c, t dbSNP:758432138
606 606 c, t dbSNP:750173751
608 608 -, t dbSNP:587776614
622 622 c, t dbSNP:765070227
626 626 a, g dbSNP:774447144
628 628 g, t dbSNP:769556306
631 631 a, g dbSNP:756876669
632 632 c, g dbSNP:376287400
638 638 c, g dbSNP:763754428
641 641 c, t dbSNP:760043881
642 642 c, g dbSNP:775067051
651 651 a, g dbSNP:368396709
653 653 a, g dbSNP:760145254
665 665 g, t dbSNP:774556630
673 673 a, c, t dbSNP:143620051
681 681 c, t dbSNP:773510510
682 682 a, g dbSNP:201303900
685 685 a, c dbSNP:748173197
698 698 a, c dbSNP:61737295
700 700 c, t dbSNP:758249273
705 705 c, t dbSNP:745862299
709 709 g, t dbSNP:150424138
713 713 a, g dbSNP:756993500
717 717 g, t dbSNP:753642057
719 719 c, t dbSNP:777337755
720 720 a, g dbSNP:140457891
722 722 c, t dbSNP:180962051
724 724 a, c, t dbSNP:104894197
725 725 a, c, g dbSNP:10769028
731 731 a, c dbSNP:568863681
734 734 c, t dbSNP:763344358
735 735 a, g dbSNP:281865154
740 740 c, g dbSNP:773780472
747 747 c, t dbSNP:770130333
748 748 a, g dbSNP:370195126
750 750 c, g, t dbSNP:587777700
752 752 a, g dbSNP:550698378
756 756 a, c, t dbSNP:138094422
757 757 a, g dbSNP:104894193
767 767 c, t dbSNP:770858153
777 777 c, g dbSNP:587777701
780 780 c, t dbSNP:749075893
783 783 a, g dbSNP:376402455
784 784 a, g dbSNP:755698536
786 786 a, g dbSNP:201889959
788 788 a, g dbSNP:752434708
789 789 a, c dbSNP:780739319
805 805 a, c dbSNP:754454206
818 818 c, t dbSNP:751119502
824 824 c, t dbSNP:766990322
825 825 a, g, t dbSNP:750798110
832 832 c, t dbSNP:145166164
833 833 a, g dbSNP:11037928
840 840 c, t dbSNP:104894192
843 843 a, c dbSNP:776867365
845 845 c, g dbSNP:768770098
850 850 c, t dbSNP:760676423
860 860 c, t dbSNP:775610689
873 873 c, t dbSNP:528383817
874 874 a, g dbSNP:200419726
875 875 c, t dbSNP:146633975
876 876 a, g, t dbSNP:747909089
884 884 c, t dbSNP:767748164
895 895 a, g dbSNP:759545911
896 896 c, t dbSNP:375808395
897 897 c, t dbSNP:267606653
898 898 g, t dbSNP:765208460
902 902 a, g dbSNP:761707439
919 919 c, g dbSNP:104894196
920 920 a, g dbSNP:371742894
923 923 a, g dbSNP:768535130
924 924 c, t dbSNP:746826513
925 925 a, g dbSNP:368050443
934 934 -, a dbSNP:764486762
935 935 c, g dbSNP:530368100
939 939 a, c dbSNP:771851241
947 947 a, t dbSNP:745376185
949 949 a, g dbSNP:144440589
952 952 a, c dbSNP:771444101
983 983 c, t dbSNP:12419361
986 986 c, t dbSNP:778373738
988 988 c, g dbSNP:756421390
990 990 c, g dbSNP:753073089
991 991 a, g dbSNP:144961504
1004 1004 c, t dbSNP:373589363
1005 1005 a, g, t dbSNP:766411205
1019 1019 a, c dbSNP:748695742
1021 1021 c, t dbSNP:149897209
1022 1022 a, g dbSNP:145904583
1031 1031 c, t dbSNP:747416406
1032 1032 a, g dbSNP:780076792
1040 1040 c, t dbSNP:150706927
1043 1043 a, g, t dbSNP:541605039
1046 1046 c, t dbSNP:756084826
1051 1051 c, t dbSNP:752640074
1053 1053 c, t dbSNP:767511619
1063 1063 c, g dbSNP:754671277
1064 1064 c, t dbSNP:574187575
1067 1067 c, t dbSNP:561018820
1068 1068 a, g, t dbSNP:762716140
1076 1076 c, t dbSNP:542338601
1080 1080 ctaagatctcaacagagatggcaact, gacccggtgc dbSNP:587777702
1080 1080 a, g dbSNP:186244229
1084 1084 c, t dbSNP:372163762
1085 1085 a, g dbSNP:367915603
1105 1105 c, t dbSNP:760189256
1115 1115 a, c dbSNP:747334899
1116 1116 a, c dbSNP:144198846
1117 1117 c, g dbSNP:772158840
1119 1119 a, c, g, t dbSNP:757361317
1138 1138 a, g dbSNP:749390789
1139 1139 a, c, t dbSNP:140652481
1140 1140 a, g dbSNP:751290539
1145 1145 c, t dbSNP:766238204
1146 1146 a, g dbSNP:369033845
1156 1156 g, t dbSNP:750030599
1159 1159 -, tgt dbSNP:776002938
1160 1160 a, c, g dbSNP:147215488
1162 1162 c, t dbSNP:761250353
1166 1166 a, g dbSNP:776186258
1173 1173 a, g dbSNP:764490498
1178 1178 c, t dbSNP:3802805
1179 1179 a, g dbSNP:775689545
1186 1186 a, t dbSNP:772445432
1187 1187 a, g dbSNP:760004486
1188 1188 a, g dbSNP:774659166
1189 1189 c, t dbSNP:61737293
1190 1190 a, g, t dbSNP:201245023
1194 1194 a, g dbSNP:768446841
1199 1199 a, c dbSNP:369085844
1200 1200 a, t dbSNP:779876897
1202 1202 c, t dbSNP:758129706
1210 1210 a, g dbSNP:750221052
1216 1216 a, c dbSNP:778529834
1221 1221 c, t dbSNP:148027225
1224 1224 a, g dbSNP:753270187
1233 1233 c, t dbSNP:763704637
1237 1237 a, g dbSNP:144742417
1244 1244 c, t dbSNP:753201422
1245 1245 c, g dbSNP:768153687
1246 1246 a, g dbSNP:759914813
1247 1247 a, g dbSNP:774924693
1250 1250 c, t dbSNP:355697
1253 1253 c, t dbSNP:376675326
1254 1254 a, g dbSNP:763307132
1256 1256 c, t dbSNP:549463745
1257 1257 a, c, g dbSNP:748187496
1260 1260 c, g dbSNP:779972509
1262 1262 a, g, t dbSNP:372442372
1264 1264 a, g dbSNP:200431603
1266 1266 c, t dbSNP:778724337
1267 1267 a, g dbSNP:756876780
1277 1277 a, g dbSNP:753493510
1282 1282 a, t dbSNP:777315924
1283 1283 c, t dbSNP:755595641
1284 1284 a, g dbSNP:369740288
1285 1285 c, t dbSNP:774043649
1286 1286 a, g dbSNP:149365713
1289 1289 c, g dbSNP:751941183
1293 1293 c, t dbSNP:766809146
1294 1294 a, g dbSNP:763248407
1297 1297 g, t dbSNP:773423723
1310 1310 a, g dbSNP:375068808
1318 1318 a, c, g, t dbSNP:200122905
1319 1319 a, g dbSNP:770986777
1322 1322 c, t dbSNP:745849255
1331 1331 a, g dbSNP:774306730
1356 1356 c, t dbSNP:770666353
1358 1358 a, g dbSNP:749052167
1360 1360 c, g dbSNP:369302027
1363 1363 c, t dbSNP:755790488
1364 1364 a, g dbSNP:533211314
1365 1365 c, t dbSNP:780898515
1368 1368 a, c, t dbSNP:559981237
1369 1369 a, g dbSNP:749632326
1373 1373 a, c, t dbSNP:200498976
1376 1376 c, t dbSNP:750817902
1385 1385 c, t dbSNP:201804180
1386 1386 a, g dbSNP:72905941
1389 1389 c, t dbSNP:368986164
1409 1409 c, t dbSNP:542277168
1418 1418 -, tttcctaa dbSNP:780535907
1440 1440 g, t dbSNP:574989828
1476 1476 c, t dbSNP:563081740
1478 1478 c, t dbSNP:576693004
1495 1495 c, t dbSNP:544585965
1496 1496 a, g dbSNP:376658247
1516 1516 a, g dbSNP:750475916
1530 1530 -, t dbSNP:149189417
1536 1536 c, t dbSNP:189945537
1537 1537 -, c dbSNP:34142561
1568 1568 c, t dbSNP:4755798
1602 1602 a, g dbSNP:560751940
1606 1606 g, t dbSNP:60998360
1630 1630 c, t dbSNP:7128671
1655 1655 a, t dbSNP:761134482
1687 1687 a, c dbSNP:570155774
1691 1691 c, t dbSNP:775765158
1712 1712 a, g dbSNP:113482355
1737 1737 c, g dbSNP:558317757
1747 1747 a, g dbSNP:539799951
1764 1764 -, c dbSNP:113592690
1777 1777 c, t dbSNP:542591808
1857 1857 c, t dbSNP:4755797
1864 1864 c, t dbSNP:534068592
1883 1883 c, t dbSNP:568270311
1886 1886 c, t dbSNP:549951730
1887 1887 a, g dbSNP:4755796
1903 1903 c, t dbSNP:574340639
1913 1913 c, t dbSNP:554752826
1960 1960 c, t dbSNP:544795542
1995 1995 a, g dbSNP:532906858
1999 1999 c, t dbSNP:147563621
2053 2053 a, c, g, t dbSNP:410592
2054 2054 a, c, g dbSNP:454205
2078 2078 c, t dbSNP:747955576
2096 2096 a, t dbSNP:781008520
2122 2122 a, g dbSNP:373562733
2142 2142 -, aga dbSNP:373830863
2147 2147 -, aag dbSNP:149719812
2178 2178 c, t dbSNP:369798593
2195 2195 c, t dbSNP:573850141
2199 2199 a, c dbSNP:758619819
2207 2207 c, t dbSNP:746147000
2213 2213 c, t dbSNP:555740434
2239 2239 c, t dbSNP:543627488
2242 2242 a, g dbSNP:76229477
2253 2253 a, c dbSNP:763305324
2262 2262 g, t dbSNP:185632337
2263 2263 c, t dbSNP:181642223
2268 2268 a, t dbSNP:566027488
2284 2284 g, t dbSNP:188954464
2302 2302 c, t dbSNP:552527026
2303 2303 a, g dbSNP:140400459
2312 2312 c, t dbSNP:151214135
2313 2313 a, g dbSNP:117526668
2322 2322 a, c dbSNP:768051621
2330 2330 c, t dbSNP:184957641
2337 2337 c, g dbSNP:192668810
2343 2343 a, c dbSNP:776365654
2365 2365 c, t dbSNP:142207322
2387 2387 g, t dbSNP:759202883
2388 2388 c, t dbSNP:532888348
2389 2389 a, g dbSNP:190383779
2428 2428 a, g dbSNP:149094042
2440 2440 c, g dbSNP:765943711
2461 2461 c, t dbSNP:146483327
2471 2471 c, t dbSNP:10458913
2476 2476 a, g dbSNP:543762689
2487 2487 c, t dbSNP:576272082
2521 2521 c, t dbSNP:760091330
2546 2546 c, t dbSNP:761727621
2558 2558 c, t dbSNP:776401651
2559 2559 a, g dbSNP:564284430
2567 2567 a, g dbSNP:76501131
2631 2631 a, g dbSNP:768453519
2677 2677 a, c dbSNP:572446886
2684 2684 c, t dbSNP:546675090
2685 2685 a, g dbSNP:113781536
2686 2686 -, g dbSNP:544187857
2705 2705 a, c dbSNP:529798397
2711 2711 g, t dbSNP:556404097
2737 2737 a, g dbSNP:538156753
2787 2787 a, g dbSNP:11037920
2803 2803 c, g dbSNP:771684261
2806 2806 a, g dbSNP:552492615
2858 2858 a, g dbSNP:534446074
2864 2864 c, t dbSNP:565623792
2872 2872 a, g dbSNP:373805569
2902 2902 c, g dbSNP:111964563
2907 2907 -, g dbSNP:572968250
2925 2925 a, g dbSNP:777781257
2930 2930 a, g dbSNP:562110335
2939 2939 c, t dbSNP:561685019
2944 2944 a, g dbSNP:371745373
2958 2958 c, g dbSNP:550061337
2969 2969 c, t dbSNP:184605209
2980 2980 a, g dbSNP:564454698
3038 3038 c, t dbSNP:545661630
3039 3039 g, t dbSNP:7942612
3043 3043 a, g dbSNP:560354358
3053 3053 c, g dbSNP:76845793
3055 3055 a, g dbSNP:574449963
3077 3077 a, g dbSNP:556140195
3083 3083 a, g dbSNP:371942370
3090 3090 a, g dbSNP:537895424
3119 3119 a, g dbSNP:531847254
3211 3211 a, g dbSNP:577110812
3224 3224 c, t dbSNP:559237769
3236 3236 a, g dbSNP:55959427
3241 3241 a, g dbSNP:78007447
3243 3243 c, t dbSNP:547143560
3251 3251 a, g dbSNP:751205455
3253 3253 a, g dbSNP:189662898
3342 3342 -, c dbSNP:35568325
3352 3352 a, g dbSNP:192255899
3370 3370 -, g dbSNP:539395363
3411 3411 -, c dbSNP:748703603
3450 3450 a, g dbSNP:7105993
3468 3468 c, t dbSNP:531378094
3472 3472 a, g dbSNP:749948307
3476 3476 g, t dbSNP:144345241
3494 3494 a, t dbSNP:552464810
3526 3526 c, t dbSNP:764716559
3566 3566 a, g dbSNP:78607024
3574 3574 c, t dbSNP:188326744
3584 3584 a, g dbSNP:183882854
3624 3624 a, g dbSNP:768402292
3689 3689 a, c dbSNP:139570599
3690 3690 c, t dbSNP:562682705
3709 3709 a, g dbSNP:540283910
3733 3733 c, t dbSNP:775302113
3734 3734 a, g dbSNP:544184954
3755 3755 c, t dbSNP:577196862
3757 3757 -, a dbSNP:139529859
3779 3779 c, g dbSNP:370961774
3786 3786 c, g dbSNP:757829050
3803 3803 a, t dbSNP:192114163
3810 3810 a, g dbSNP:749529470
3818 3818 c, t dbSNP:187228888
3819 3819 c, t dbSNP:897004
3847 3847 a, g dbSNP:75369525
3898 3898 a, t dbSNP:536896010
3900 3900 a, c dbSNP:568154025
3905 3905 -, t dbSNP:376571868
3947 3947 c, t dbSNP:148576097
3985 3985 -, c dbSNP:752134665
3994 3994 a, g dbSNP:112232037
4012 4012 c, g dbSNP:370745972
4013 4013 a, t dbSNP:146304390
4022 4022 c, t dbSNP:897005
4058 4058 c, t dbSNP:570441911
4089 4089 c, t dbSNP:755590000
4090 4090 a, g dbSNP:372769669
4104 4104 c, t dbSNP:765560684
4108 4108 c, t dbSNP:747349734
4109 4109 a, g dbSNP:369226766
4146 4146 g, t dbSNP:566698169
4168 4168 c, t dbSNP:77015141
4172 4172 a, c dbSNP:1840254
4182 4182 c, t dbSNP:562621207
4185 4185 a, g dbSNP:182853569
4193 4193 c, g dbSNP:532370405
4201 4201 a, c dbSNP:192487688
4254 4254 c, t dbSNP:188675900
4255 4255 a, g dbSNP:573480816
4285 4285 a, g dbSNP:373283
4286 4286 a, g dbSNP:453267
4331 4331 a, g dbSNP:556132435
4344 4344 c, t dbSNP:543230713
4352 4352 c, g dbSNP:117877500
4384 4384 a, g dbSNP:149764792
4421 4421 c, t dbSNP:139681611
4447 4447 a, g dbSNP:4755239
4463 4463 a, g dbSNP:182987016
4474 4474 a, g dbSNP:766967309
4492 4492 a, g dbSNP:537495662
4506 4506 c, t dbSNP:7116335
4527 4527 a, c dbSNP:566743690
4562 4562 c, t dbSNP:548107538
4573 4573 c, t dbSNP:767228404
4579 4579 c, t dbSNP:190643475
4581 4581 c, g dbSNP:550434819
4589 4589 a, g dbSNP:568728928
4598 4598 c, t dbSNP:773333256
4641 4641 g, t dbSNP:550622242
4687 4687 a, c dbSNP:150701828
4721 4721 c, t dbSNP:531931217
4722 4722 a, g dbSNP:748214374
4725 4725 c, t dbSNP:142004753
4739 4739 a, c dbSNP:113734133
4745 4745 a, g, t dbSNP:7115841
4749 4749 a, g dbSNP:747580754
4753 4753 a, g dbSNP:780412869
4772 4772 c, t dbSNP:758694942
4779 4779 -, gt dbSNP:374150602
4806 4806 a, c dbSNP:778340814
4861 4861 c, g dbSNP:561534323
4867 4867 a, g dbSNP:185781739
4869 4869 a, c dbSNP:745494340
4871 4871 a, g dbSNP:575864402
4917 4917 c, t dbSNP:569151215
4936 4936 c, g dbSNP:11037919
4977 4977 c, t dbSNP:756954535
5003 5003 c, t dbSNP:576862101
5046 5046 a, g dbSNP:558403646
5063 5063 a, c dbSNP:753339429
5109 5109 c, t dbSNP:116662493
5113 5113 a, g dbSNP:114755169
5116 5116 c, g dbSNP:552414721
5120 5120 c, t dbSNP:771229047
5124 5124 a, c dbSNP:554409058
5132 5132 c, t dbSNP:147497663
5145 5145 a, g dbSNP:373307279
5152 5152 a, g dbSNP:143536201
5165 5165 c, g dbSNP:538499078
5182 5182 c, t dbSNP:571701553
5216 5216 c, t dbSNP:755986390
5222 5222 c, g dbSNP:546810144
5253 5253 a, g dbSNP:528449092
5282 5282 a, g dbSNP:532671795
5283 5283 a, g dbSNP:373059937
5327 5327 a, g dbSNP:752581342
5339 5339 c, t dbSNP:369328027
5380 5380 a, t dbSNP:767299156
5438 5438 a, g dbSNP:759267585
5445 5445 c, t dbSNP:560087261
5458 5458 -, t dbSNP:34557775

Target ORF information:

RefSeq Version NM_021926
Organism Homo sapiens (human)
Definition Homo sapiens ALX homeobox 4 (ALX4), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.