Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

RPGR retinitis pigmentosa GTPase regulator [Homo sapiens (human)]

Gene Symbol RPGR
Entrez Gene ID 6103
Full Name retinitis pigmentosa GTPase regulator
Synonyms COD1, CORDX1, CRD, PCDX, RP15, RP3, XLRP3, orf15
General protein information
Preferred Names
X-linked retinitis pigmentosa GTPase regulator
X-linked retinitis pigmentosa GTPase regulator
retinitis pigmentosa 15
retinitis pigmentosa 3 GTPase regulator
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]. lac of sum
Disorder MIM:


Disorder Html: Retinitis pigmentosa-3, 300029 (3); Cone-rod dystrophy-1, 304020 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu60306 XM_011543940 PREDICTED: Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu54008 XM_005272633 PREDICTED: Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu22373 NM_000328 Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant A, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu22105 NM_001034853 Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant C, mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu60306D
Sequence Information ORF Nucleotide Sequence (Length: 2445bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product X-linked retinitis pigmentosa GTPase regulator isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)309..395(+)
Misc Feature(2)360..500(+)
Misc Feature(3)513..662(+)
Misc Feature(4)621..710(+)
Misc Feature(5)669..812(+)
Misc Feature(6)816..968(+)
Misc Feature(7)981..1124(+)
Misc Feature(8)1134..1274(+)
Position Chain Variation Link
26 26 a, g dbSNP:765080006
51 51 c, t dbSNP:372175632
70 70 g, t dbSNP:774769874
117 117 c, g dbSNP:111635026
134 134 c, t dbSNP:766903516
146 146 a, c dbSNP:147711382
149 149 c, g dbSNP:768845421
152 152 c, g dbSNP:12835565
157 157 a, g dbSNP:745535195
161 161 c, t dbSNP:773984408
162 162 c, t dbSNP:770482519
163 163 g, t dbSNP:773673080
177 177 a, g dbSNP:368132110
182 182 c, t dbSNP:748771594
191 191 c, t dbSNP:777227535
192 192 c, t dbSNP:769796451
206 206 a, g dbSNP:769874474
221 221 c, g dbSNP:781050545
227 227 a, t dbSNP:202156474
229 229 c, t dbSNP:143975950
233 233 g, t dbSNP:769123303
237 237 a, g dbSNP:748188165
243 243 a, g dbSNP:780978686
245 245 a, g dbSNP:768546451
256 256 g, t dbSNP:746771241
279 279 a, g dbSNP:779957555
294 294 -, a dbSNP:281865295
302 302 a, t dbSNP:193018400
303 303 a, g, t dbSNP:62638628
324 324 a, g dbSNP:62638629
325 325 a, g dbSNP:62638630
338 338 g, t dbSNP:62638631
348 348 a, g dbSNP:757275147
350 350 c, t dbSNP:201242851
351 351 g, t dbSNP:281865296
376 376 g, t dbSNP:62638634
419 419 c, t dbSNP:143521661
420 420 a, g dbSNP:111631988
424 424 g, t dbSNP:1801685
434 434 -, at dbSNP:62650215
434 434 a, g dbSNP:753138628
457 457 -, a dbSNP:36043846
462 462 c, g dbSNP:745631996
487 487 a, g dbSNP:774670559
491 491 a, c, t dbSNP:62638636
492 492 -, ca dbSNP:62638638
493 493 a, c dbSNP:62638637
516 516 a, c dbSNP:769910194
517 517 a, g dbSNP:748199207
552 552 -, t dbSNP:62638641
568 568 -, c dbSNP:62638642
568 568 c, t dbSNP:781213060
570 570 a, g dbSNP:769175863
576 576 a, g dbSNP:62638643
586 586 g, t dbSNP:62638644
591 591 a, g dbSNP:768274240
611 611 c, g, t dbSNP:376887697
612 612 a, g, t dbSNP:62638645
614 614 a, g dbSNP:777541233
618 618 a, g dbSNP:146920569
641 641 a, t dbSNP:752286330
645 645 a, g dbSNP:745860528
650 650 g, t dbSNP:759398299
664 664 c, g dbSNP:751512713
668 668 a, g dbSNP:201702850
679 679 -, tt dbSNP:281865298
679 679 -, t dbSNP:281865297
689 689 a, g dbSNP:62638648
702 702 a, g, t dbSNP:369037463
714 714 c, g dbSNP:137852550
726 726 a, g dbSNP:751501198
729 729 a, g dbSNP:766309823
749 749 a, g, t dbSNP:5963403
758 758 -, ttg dbSNP:779230198
776 776 c, t dbSNP:764956891
778 778 a, g dbSNP:62650216
782 782 a, c dbSNP:376866035
800 800 c, t dbSNP:765580620
802 802 a, c dbSNP:62650217
806 806 c, t dbSNP:371899162
821 821 c, t dbSNP:764342399
827 827 a, g dbSNP:760768561
831 831 a, g dbSNP:775660295
838 838 g, t dbSNP:62650218
862 862 a, g dbSNP:767436763
867 867 c, t dbSNP:150477878
871 871 a, g dbSNP:760123267
874 874 a, g dbSNP:774988145
884 884 a, c dbSNP:370173004
887 887 a, t dbSNP:749640965
897 897 c, t dbSNP:62638651
900 900 c, t dbSNP:62638652
919 919 c, t dbSNP:773408909
920 920 a, g dbSNP:768381214
924 924 a, t dbSNP:62638653
926 926 a, g dbSNP:62638654
941 941 -, c dbSNP:62650219
942 942 c, t dbSNP:62650220
944 944 -, tg dbSNP:281865299
944 944 c, t dbSNP:745651741
976 976 a, c dbSNP:751266432
979 979 c, g dbSNP:138018739
1000 1000 a, g dbSNP:398123336
1003 1003 a, g dbSNP:760445607
1016 1016 a, g dbSNP:774989787
1017 1017 a, g dbSNP:62642057
1021 1021 g, t dbSNP:771616566
1027 1027 -, cttt dbSNP:62640584
1028 1028 -, tt dbSNP:281865300
1028 1028 -, t dbSNP:62640586
1056 1056 a, g dbSNP:767814278
1059 1059 a, g dbSNP:62640587
1063 1063 -, a dbSNP:62640588
1066 1066 a, g dbSNP:778350385
1080 1080 -, acaataagttatatt dbSNP:62653026
1081 1081 c, t dbSNP:41309615
1088 1088 -, tt dbSNP:527236111
1093 1093 c, t dbSNP:111883266
1098 1098 c, t dbSNP:62640589
1099 1099 a, c, g dbSNP:62640590
1116 1116 c, g dbSNP:527236112
1125 1125 a, g dbSNP:62640591
1133 1133 c, t dbSNP:369916698
1139 1139 g, t dbSNP:750679565
1152 1152 a, g dbSNP:62640593
1161 1161 c, t dbSNP:757712647
1165 1165 a, g dbSNP:775245027
1166 1166 c, t dbSNP:771739225
1174 1174 g, t dbSNP:62640594
1188 1188 g, t dbSNP:62642058
1195 1195 g, t dbSNP:759136845
1196 1196 c, t dbSNP:200413654
1200 1200 a, t dbSNP:761972732
1227 1227 a, g dbSNP:41305223
1232 1232 c, t dbSNP:777556630
1235 1235 c, g dbSNP:144187092
1275 1275 a, g dbSNP:372028552
1281 1281 -, gtag dbSNP:527236109
1282 1282 -, t dbSNP:281865301
1288 1288 c, t dbSNP:773986350
1289 1289 g, t dbSNP:765929940
1292 1292 c, t dbSNP:369391462
1293 1293 -, c dbSNP:62635000
1293 1293 c, g, t dbSNP:769641256
1296 1296 a, c dbSNP:748061578
1299 1299 a, c, t dbSNP:768571911
1303 1303 a, g dbSNP:747294782
1313 1313 -, aaa dbSNP:750534667
1314 1314 g, t dbSNP:62635001
1317 1317 a, g dbSNP:780403919
1323 1323 c, t dbSNP:758542643
1325 1325 c, t dbSNP:17852968
1336 1336 a, g dbSNP:778997316
1338 1338 -, gat dbSNP:748280677
1339 1339 a, t dbSNP:757714144
1343 1343 a, t dbSNP:754275914
1354 1354 c, t dbSNP:148501922
1357 1357 c, t dbSNP:199661899
1358 1358 a, g dbSNP:1801686
1364 1364 g, t dbSNP:765979499
1369 1369 c, t dbSNP:372004762
1370 1370 a, c, g dbSNP:149742786
1383 1383 a, g dbSNP:761727775
1393 1393 a, g dbSNP:750333146
1394 1394 c, t dbSNP:768625051
1395 1395 a, g dbSNP:746767061
1398 1398 c, t dbSNP:368494625
1414 1414 c, t dbSNP:772201779
1420 1420 a, g dbSNP:746041459
1426 1426 a, g dbSNP:139594653
1431 1431 a, g dbSNP:771039023
1434 1434 c, g dbSNP:150549982
1438 1438 -, ag dbSNP:281865302
1438 1438 g, t dbSNP:143536063
1444 1444 a, g dbSNP:775157459
1450 1450 a, c dbSNP:771830247
1451 1451 a, c dbSNP:759743089
1455 1455 -, tctttttcaatgaggagaa dbSNP:281865303
1464 1464 a, g dbSNP:774619361
1465 1465 c, t dbSNP:770963251
1467 1467 a, c dbSNP:749334487
1468 1468 a, g dbSNP:1801687
1473 1473 a, t dbSNP:770300575
1476 1476 c, g dbSNP:182345461
1485 1485 a, g, t dbSNP:62635003
1490 1490 a, t dbSNP:28718831
1494 1494 a, t dbSNP:750094058
1501 1501 a, g dbSNP:62635004
1503 1503 c, t dbSNP:531930581
1525 1525 a, g dbSNP:756926974
1540 1540 a, g dbSNP:753418463
1550 1550 a, g dbSNP:763638295
1561 1561 a, g dbSNP:144635565
1563 1563 c, g dbSNP:752674076
1565 1565 c, g dbSNP:371226433
1570 1570 -, tc dbSNP:62653029
1585 1585 a, g dbSNP:759352792
1590 1590 a, g dbSNP:774476238
1593 1593 a, c dbSNP:774321455
1596 1596 -, ccag dbSNP:62653030
1637 1637 a, c dbSNP:144863059
1643 1643 g, t dbSNP:774609177
1660 1660 c, t dbSNP:149417653
1670 1670 -, c dbSNP:62635005
1672 1672 a, t dbSNP:62635006
1679 1679 a, t dbSNP:756979959
1694 1694 a, c dbSNP:375014257
1698 1698 a, g dbSNP:777489877
1701 1701 a, g dbSNP:776536747
1702 1702 -, ca dbSNP:281865304
1702 1702 c, g dbSNP:374555833
1710 1710 a, g dbSNP:747412709
1712 1712 a, g dbSNP:775998767
1713 1713 a, g dbSNP:772557101
1720 1720 a, g dbSNP:749005478
1726 1726 a, g dbSNP:777543422
1755 1755 c, g dbSNP:755725531
1769 1769 -, acaa dbSNP:281865305
1769 1769 a, g dbSNP:761895475
1770 1770 -, caa dbSNP:62653033
1773 1773 -, caa dbSNP:398123335
1779 1779 a, c, g dbSNP:764009509
1784 1784 a, g dbSNP:375288851
1792 1792 c, t dbSNP:41312104
1793 1793 a, g dbSNP:368883287
1797 1797 a, g dbSNP:772612305
1799 1799 c, t dbSNP:759947310
1802 1802 a, t dbSNP:145089607
1817 1817 c, t dbSNP:769507521
1828 1828 a, g dbSNP:747690060
1834 1834 a, t dbSNP:750857784
1838 1838 a, g dbSNP:768040222
1847 1847 a, g dbSNP:747017740
1865 1865 a, g dbSNP:779938667
1869 1869 a, t dbSNP:758295621
1881 1881 a, g dbSNP:148334278
1883 1883 g, t dbSNP:183675735
1887 1887 c, g dbSNP:757501405
1888 1888 a, g dbSNP:753999119
1891 1891 a, g dbSNP:1801688
1892 1892 g, t dbSNP:760647256
1899 1899 a, g dbSNP:753294383
1902 1902 a, g dbSNP:768169831
1903 1903 c, t dbSNP:202154504
1904 1904 a, g dbSNP:138347728
1911 1911 c, g dbSNP:771196039
1912 1912 c, t dbSNP:761586336
1915 1915 c, t dbSNP:202013664
1916 1916 a, g dbSNP:372171763
1922 1922 c, t dbSNP:145682975
1926 1926 c, g dbSNP:779494768
1928 1928 a, g dbSNP:772015036
1930 1930 g, t dbSNP:745734739
1939 1939 a, c dbSNP:778831340
1941 1941 g, t dbSNP:62635013
1973 1973 a, g dbSNP:765290437
1978 1978 a, t dbSNP:761787495
1990 1990 a, t dbSNP:776574633
1996 1996 c, t dbSNP:768570309
2009 2009 a, g dbSNP:760860514
2012 2012 a, g dbSNP:775756094
2026 2026 -, a dbSNP:62635014
2041 2041 a, g dbSNP:184789544
2060 2060 a, g dbSNP:201069691
2062 2062 c, t dbSNP:140467410
2076 2076 c, g dbSNP:778914040
2088 2088 c, g dbSNP:771440674
2096 2096 a, g dbSNP:749728332
2100 2100 g, t dbSNP:770101727
2110 2110 a, t dbSNP:748251204
2129 2129 a, g dbSNP:781266050
2142 2142 a, g dbSNP:755501450
2143 2143 c, t dbSNP:752091528
2144 2144 a, g dbSNP:574171500
2145 2145 g, t dbSNP:780328745
2216 2216 a, g dbSNP:370252136
2217 2217 a, g dbSNP:750741536
2227 2227 a, g dbSNP:763754607
2239 2239 c, g dbSNP:760267187
2244 2244 c, g dbSNP:780831994
2249 2249 a, g dbSNP:281865306
2254 2254 a, g dbSNP:752212461
2268 2268 c, g dbSNP:775817687
2274 2274 a, t dbSNP:281865307
2285 2285 a, g dbSNP:17352126
2295 2295 a, g dbSNP:781185543
2296 2296 c, t dbSNP:768757205
2308 2308 a, c dbSNP:747506896
2310 2310 c, t dbSNP:780639887
2311 2311 a, g dbSNP:758849023
2317 2317 c, t dbSNP:750796478
2327 2327 c, t dbSNP:779998371
2340 2340 a, g dbSNP:771791722
2346 2346 c, t dbSNP:762173989
2347 2347 a, c dbSNP:776877677
2369 2369 a, c, t dbSNP:747130152
2373 2373 a, t dbSNP:775370522
2380 2380 a, g dbSNP:772576305
2400 2400 a, g dbSNP:746373784
2420 2420 a, g dbSNP:281865308
2425 2425 a, c dbSNP:779309526
2435 2435 a, g dbSNP:757598542
2440 2440 c, t dbSNP:749685289
2450 2450 a, c dbSNP:777943257
2453 2453 a, t dbSNP:281865309
2454 2454 g, t dbSNP:281865310
2461 2461 c, t dbSNP:766828733
2463 2463 a, g dbSNP:746627825
2480 2480 c, g dbSNP:779757462
2493 2493 a, g dbSNP:757948609
2495 2495 a, g dbSNP:749909061
2496 2496 a, c dbSNP:34117835
2497 2497 c, t dbSNP:757080712
2498 2498 a, g dbSNP:781426804
2503 2503 c, t dbSNP:763796226
2505 2505 -, g dbSNP:281865311
2510 2510 a, g dbSNP:140895976
2517 2517 a, g dbSNP:147649203
2518 2518 c, t dbSNP:145289281
2519 2519 a, c dbSNP:759644180
2539 2539 a, g dbSNP:748423437
2550 2550 -, aa dbSNP:281865312
2551 2551 -, aagatgccgaccagaacca dbSNP:281865313
2559 2559 a, g dbSNP:113968324
2578 2578 a, g dbSNP:763302755
2591 2591 a, t dbSNP:768820582
2629 2629 c, g dbSNP:371704187
2634 2634 a, g dbSNP:745781744
2636 2636 a, g dbSNP:779882319
2639 2639 a, g dbSNP:771798016
2641 2641 -, aaatatatatttatg dbSNP:281865314
2674 2674 a, g dbSNP:745380815
2678 2678 c, t dbSNP:778496830
2679 2679 a, g dbSNP:757282676
2684 2684 a, g dbSNP:753709095
2685 2685 a, t dbSNP:777675495
2686 2686 a, g dbSNP:367795047
2688 2688 a, g dbSNP:752453443
2690 2690 c, t dbSNP:376653587
2696 2696 a, g dbSNP:778875656
2704 2704 -, aacttat dbSNP:11279874
2716 2716 -, a dbSNP:281865315
2735 2735 -, tttaaaagatataagacttaa dbSNP:281865316
2746 2746 c, t dbSNP:183539805
2767 2767 c, t dbSNP:752481152
2771 2771 c, t dbSNP:777555856
2775 2775 a, g dbSNP:192375655
2799 2799 -, tatttatgctaatat dbSNP:281865317
2813 2813 c, t dbSNP:752428660
2819 2819 -, a dbSNP:281865318
2878 2878 a, g dbSNP:780541258
2911 2911 a, t dbSNP:187807093
2937 2937 c, t dbSNP:182071709
2983 2983 a, g dbSNP:5964325
2998 2998 c, t dbSNP:189722742
2999 2999 a, g dbSNP:763561218
3034 3034 -, tttgatgtatttacaattttt dbSNP:281865319
3064 3064 a, t dbSNP:186136231

Target ORF information:

RefSeq Version XM_011543940
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu54008D
Sequence Information ORF Nucleotide Sequence (Length: 2115bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product X-linked retinitis pigmentosa GTPase regulator isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)309..395(+)
Misc Feature(2)360..500(+)
Misc Feature(3)513..662(+)
Misc Feature(4)621..710(+)
Misc Feature(5)669..812(+)
Misc Feature(6)819..971(+)
Misc Feature(7)984..1127(+)
Misc Feature(8)1137..1277(+)
Position Chain Variation Link
26 26 a, g dbSNP:765080006
51 51 c, t dbSNP:372175632
70 70 g, t dbSNP:774769874
117 117 c, g dbSNP:111635026
134 134 c, t dbSNP:766903516
146 146 a, c dbSNP:147711382
149 149 c, g dbSNP:768845421
152 152 c, g dbSNP:12835565
157 157 a, g dbSNP:745535195
161 161 c, t dbSNP:773984408
162 162 c, t dbSNP:770482519
163 163 g, t dbSNP:773673080
177 177 a, g dbSNP:368132110
182 182 c, t dbSNP:748771594
191 191 c, t dbSNP:777227535
192 192 c, t dbSNP:769796451
206 206 a, g dbSNP:769874474
221 221 c, g dbSNP:781050545
227 227 a, t dbSNP:202156474
229 229 c, t dbSNP:143975950
233 233 g, t dbSNP:769123303
237 237 a, g dbSNP:748188165
243 243 a, g dbSNP:780978686
245 245 a, g dbSNP:768546451
256 256 g, t dbSNP:746771241
279 279 a, g dbSNP:779957555
294 294 -, a dbSNP:281865295
302 302 a, t dbSNP:193018400
303 303 a, g, t dbSNP:62638628
324 324 a, g dbSNP:62638629
325 325 a, g dbSNP:62638630
338 338 g, t dbSNP:62638631
348 348 a, g dbSNP:757275147
350 350 c, t dbSNP:201242851
351 351 g, t dbSNP:281865296
376 376 g, t dbSNP:62638634
419 419 c, t dbSNP:143521661
420 420 a, g dbSNP:111631988
424 424 g, t dbSNP:1801685
434 434 -, at dbSNP:62650215
434 434 a, g dbSNP:753138628
457 457 -, a dbSNP:36043846
462 462 c, g dbSNP:745631996
487 487 a, g dbSNP:774670559
491 491 a, c, t dbSNP:62638636
492 492 -, ca dbSNP:62638638
493 493 a, c dbSNP:62638637
516 516 a, c dbSNP:769910194
517 517 a, g dbSNP:748199207
552 552 -, t dbSNP:62638641
568 568 -, c dbSNP:62638642
568 568 c, t dbSNP:781213060
570 570 a, g dbSNP:769175863
576 576 a, g dbSNP:62638643
586 586 g, t dbSNP:62638644
591 591 a, g dbSNP:768274240
611 611 c, g, t dbSNP:376887697
612 612 a, g, t dbSNP:62638645
614 614 a, g dbSNP:777541233
618 618 a, g dbSNP:146920569
641 641 a, t dbSNP:752286330
645 645 a, g dbSNP:745860528
650 650 g, t dbSNP:759398299
664 664 c, g dbSNP:751512713
668 668 a, g dbSNP:201702850
679 679 -, tt dbSNP:281865298
679 679 -, t dbSNP:281865297
689 689 a, g dbSNP:62638648
702 702 a, g, t dbSNP:369037463
714 714 c, g dbSNP:137852550
726 726 a, g dbSNP:751501198
729 729 a, g dbSNP:766309823
749 749 a, g, t dbSNP:5963403
758 758 -, ttg dbSNP:779230198
776 776 c, t dbSNP:764956891
778 778 a, g dbSNP:62650216
782 782 a, c dbSNP:376866035
800 800 c, t dbSNP:765580620
802 802 a, c dbSNP:62650217
806 806 c, t dbSNP:371899162
824 824 c, t dbSNP:764342399
830 830 a, g dbSNP:760768561
834 834 a, g dbSNP:775660295
841 841 g, t dbSNP:62650218
865 865 a, g dbSNP:767436763
870 870 c, t dbSNP:150477878
874 874 a, g dbSNP:760123267
877 877 a, g dbSNP:774988145
887 887 a, c dbSNP:370173004
890 890 a, t dbSNP:749640965
900 900 c, t dbSNP:62638651
903 903 c, t dbSNP:62638652
922 922 c, t dbSNP:773408909
923 923 a, g dbSNP:768381214
927 927 a, t dbSNP:62638653
929 929 a, g dbSNP:62638654
944 944 -, c dbSNP:62650219
945 945 c, t dbSNP:62650220
947 947 -, tg dbSNP:281865299
947 947 c, t dbSNP:745651741
979 979 a, c dbSNP:751266432
982 982 c, g dbSNP:138018739
1003 1003 a, g dbSNP:398123336
1006 1006 a, g dbSNP:760445607
1019 1019 a, g dbSNP:774989787
1020 1020 a, g dbSNP:62642057
1024 1024 g, t dbSNP:771616566
1030 1030 -, cttt dbSNP:62640584
1031 1031 -, tt dbSNP:281865300
1031 1031 -, t dbSNP:62640586
1059 1059 a, g dbSNP:767814278
1062 1062 a, g dbSNP:62640587
1066 1066 -, a dbSNP:62640588
1069 1069 a, g dbSNP:778350385
1083 1083 -, acaataagttatatt dbSNP:62653026
1084 1084 c, t dbSNP:41309615
1091 1091 -, tt dbSNP:527236111
1096 1096 c, t dbSNP:111883266
1101 1101 c, t dbSNP:62640589
1102 1102 a, c, g dbSNP:62640590
1119 1119 c, g dbSNP:527236112
1128 1128 a, g dbSNP:62640591
1136 1136 c, t dbSNP:369916698
1142 1142 g, t dbSNP:750679565
1155 1155 a, g dbSNP:62640593
1164 1164 c, t dbSNP:757712647
1168 1168 a, g dbSNP:775245027
1169 1169 c, t dbSNP:771739225
1177 1177 g, t dbSNP:62640594
1191 1191 g, t dbSNP:62642058
1198 1198 g, t dbSNP:759136845
1199 1199 c, t dbSNP:200413654
1203 1203 a, t dbSNP:761972732
1230 1230 a, g dbSNP:41305223
1235 1235 c, t dbSNP:777556630
1238 1238 c, g dbSNP:144187092
1278 1278 a, g dbSNP:372028552
1284 1284 -, gtag dbSNP:527236109
1285 1285 -, t dbSNP:281865301
1291 1291 c, t dbSNP:773986350
1292 1292 g, t dbSNP:765929940
1295 1295 c, t dbSNP:369391462
1296 1296 -, c dbSNP:62635000
1296 1296 c, g, t dbSNP:769641256
1299 1299 a, c dbSNP:748061578
1302 1302 a, c, t dbSNP:768571911
1306 1306 a, g dbSNP:747294782
1316 1316 -, aaa dbSNP:750534667
1317 1317 g, t dbSNP:62635001
1320 1320 a, g dbSNP:780403919
1326 1326 c, t dbSNP:758542643
1328 1328 c, t dbSNP:17852968
1339 1339 a, g dbSNP:778997316
1341 1341 -, gat dbSNP:748280677
1342 1342 a, t dbSNP:757714144
1346 1346 a, t dbSNP:754275914
1357 1357 c, t dbSNP:148501922
1360 1360 c, t dbSNP:199661899
1361 1361 a, g dbSNP:1801686
1367 1367 g, t dbSNP:765979499
1372 1372 c, t dbSNP:372004762
1373 1373 a, c, g dbSNP:149742786
1386 1386 a, g dbSNP:761727775
1396 1396 a, g dbSNP:750333146
1397 1397 c, t dbSNP:768625051
1398 1398 a, g dbSNP:746767061
1401 1401 c, t dbSNP:368494625
1417 1417 c, t dbSNP:772201779
1423 1423 a, g dbSNP:746041459
1429 1429 a, g dbSNP:139594653
1434 1434 a, g dbSNP:771039023
1437 1437 c, g dbSNP:150549982
1441 1441 -, ag dbSNP:281865302
1441 1441 g, t dbSNP:143536063
1447 1447 a, g dbSNP:775157459
1453 1453 a, c dbSNP:771830247
1454 1454 a, c dbSNP:759743089
1458 1458 -, tctttttcaatgaggagaa dbSNP:281865303
1467 1467 a, g dbSNP:774619361
1468 1468 c, t dbSNP:770963251
1470 1470 a, c dbSNP:749334487
1471 1471 a, g dbSNP:1801687
1476 1476 a, t dbSNP:770300575
1479 1479 c, g dbSNP:182345461
1488 1488 a, g, t dbSNP:62635003
1493 1493 a, t dbSNP:28718831
1497 1497 a, t dbSNP:750094058
1504 1504 a, g dbSNP:62635004
1506 1506 c, t dbSNP:531930581
1528 1528 a, g dbSNP:756926974
1543 1543 a, g dbSNP:753418463
1553 1553 a, g dbSNP:763638295
1564 1564 a, g dbSNP:144635565
1566 1566 c, g dbSNP:752674076
1568 1568 c, g dbSNP:371226433
1573 1573 -, tc dbSNP:62653029
1588 1588 a, g dbSNP:759352792
1593 1593 a, g dbSNP:774476238
1596 1596 a, c dbSNP:774321455
1599 1599 -, ccag dbSNP:62653030
1640 1640 a, c dbSNP:144863059
1646 1646 g, t dbSNP:774609177
1663 1663 c, t dbSNP:149417653
1673 1673 -, c dbSNP:62635005
1675 1675 a, t dbSNP:62635006
1682 1682 a, t dbSNP:756979959
1697 1697 a, c dbSNP:375014257
1701 1701 a, g dbSNP:777489877
1704 1704 a, g dbSNP:776536747
1705 1705 -, ca dbSNP:281865304
1705 1705 c, g dbSNP:374555833
1713 1713 a, g dbSNP:747412709
1715 1715 a, g dbSNP:775998767
1716 1716 a, g dbSNP:772557101
1723 1723 a, g dbSNP:749005478
1729 1729 a, g dbSNP:777543422
1758 1758 c, g dbSNP:755725531
1770 1770 g, t dbSNP:770101727
1780 1780 a, t dbSNP:748251204
1799 1799 a, g dbSNP:781266050
1812 1812 a, g dbSNP:755501450
1813 1813 c, t dbSNP:752091528
1814 1814 a, g dbSNP:574171500
1815 1815 g, t dbSNP:780328745
1886 1886 a, g dbSNP:370252136
1887 1887 a, g dbSNP:750741536
1897 1897 a, g dbSNP:763754607
1909 1909 c, g dbSNP:760267187
1914 1914 c, g dbSNP:780831994
1919 1919 a, g dbSNP:281865306
1924 1924 a, g dbSNP:752212461
1938 1938 c, g dbSNP:775817687
1944 1944 a, t dbSNP:281865307
1955 1955 a, g dbSNP:17352126
1965 1965 a, g dbSNP:781185543
1966 1966 c, t dbSNP:768757205
1978 1978 a, c dbSNP:747506896
1980 1980 c, t dbSNP:780639887
1981 1981 a, g dbSNP:758849023
1987 1987 c, t dbSNP:750796478
1997 1997 c, t dbSNP:779998371
2010 2010 a, g dbSNP:771791722
2016 2016 c, t dbSNP:762173989
2017 2017 a, c dbSNP:776877677
2039 2039 a, c, t dbSNP:747130152
2043 2043 a, t dbSNP:775370522
2050 2050 a, g dbSNP:772576305
2070 2070 a, g dbSNP:746373784
2090 2090 a, g dbSNP:281865308
2095 2095 a, c dbSNP:779309526
2105 2105 a, g dbSNP:757598542
2110 2110 c, t dbSNP:749685289
2120 2120 a, c dbSNP:777943257
2123 2123 a, t dbSNP:281865309
2124 2124 g, t dbSNP:281865310
2131 2131 c, t dbSNP:766828733
2133 2133 a, g dbSNP:746627825
2150 2150 c, g dbSNP:779757462
2163 2163 a, g dbSNP:757948609
2165 2165 a, g dbSNP:749909061
2166 2166 a, c dbSNP:34117835
2167 2167 c, t dbSNP:757080712
2168 2168 a, g dbSNP:781426804
2173 2173 c, t dbSNP:763796226
2175 2175 -, g dbSNP:281865311
2180 2180 a, g dbSNP:140895976
2187 2187 a, g dbSNP:147649203
2188 2188 c, t dbSNP:145289281
2189 2189 a, c dbSNP:759644180
2209 2209 a, g dbSNP:748423437
2220 2220 -, aa dbSNP:281865312
2221 2221 -, aagatgccgaccagaacca dbSNP:281865313
2229 2229 a, g dbSNP:113968324
2248 2248 a, g dbSNP:763302755
2261 2261 a, t dbSNP:768820582
2299 2299 c, g dbSNP:371704187
2304 2304 a, g dbSNP:745781744
2306 2306 a, g dbSNP:779882319
2309 2309 a, g dbSNP:771798016
2311 2311 -, aaatatatatttatg dbSNP:281865314
2344 2344 a, g dbSNP:745380815
2348 2348 c, t dbSNP:778496830
2349 2349 a, g dbSNP:757282676
2354 2354 a, g dbSNP:753709095
2355 2355 a, t dbSNP:777675495
2356 2356 a, g dbSNP:367795047
2358 2358 a, g dbSNP:752453443
2360 2360 c, t dbSNP:376653587
2366 2366 a, g dbSNP:778875656
2374 2374 -, aacttat dbSNP:11279874
2386 2386 -, a dbSNP:281865315
2405 2405 -, tttaaaagatataagacttaa dbSNP:281865316
2416 2416 c, t dbSNP:183539805
2437 2437 c, t dbSNP:752481152
2441 2441 c, t dbSNP:777555856
2445 2445 a, g dbSNP:192375655
2469 2469 -, tatttatgctaatat dbSNP:281865317
2483 2483 c, t dbSNP:752428660
2489 2489 -, a dbSNP:281865318
2548 2548 a, g dbSNP:780541258
2581 2581 a, t dbSNP:187807093
2607 2607 c, t dbSNP:182071709
2653 2653 a, g dbSNP:5964325
2668 2668 c, t dbSNP:189722742
2669 2669 a, g dbSNP:763561218
2704 2704 -, tttgatgtatttacaattttt dbSNP:281865319
2734 2734 a, t dbSNP:186136231

Target ORF information:

RefSeq Version XM_005272633
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu22373D
Sequence Information ORF Nucleotide Sequence (Length: 2448bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product X-linked retinitis pigmentosa GTPase regulator isoform A
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP233620.1, BX644678.1, U57629.1 and CA313540.1. This sequence is a reference standard in the RefSeqGene project. On Jun 3, 2005 this sequence version replaced gi:4506580. Summary: This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]. Transcript Variant: This variant (A) uses an alternate splice site and contains multiple alternative exons in the 3' coding region, compared to variant C. The resulting isoform (A, also referred to as isoform 1) is shorter and has a distinct C-terminus, compared to isoform C. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK291832.1, AK223491.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)28..30(+)
Misc Feature(2)280..366(+)
Misc Feature(3)331..471(+)
Misc Feature(4)484..633(+)
Misc Feature(5)592..681(+)
Misc Feature(6)640..783(+)
Misc Feature(7)790..942(+)
Misc Feature(8)955..1098(+)
Misc Feature(9)1108..1248(+)
Exon (1)1..196
Gene Synonym:
Exon (2)197..322
Gene Synonym:
Exon (3)323..415
Gene Synonym:
Exon (4)416..478
Gene Synonym:
Exon (5)479..637
Gene Synonym:
Exon (6)638..787
Gene Synonym:
Exon (7)788..946
Gene Synonym:
Exon (8)947..1102
Gene Synonym:
Exon (9)1103..1227
Gene Synonym:
Exon (10)1228..1413
Gene Synonym:
Exon (11)1414..1582
Gene Synonym:
Exon (12)1583..1674
Gene Synonym:
Exon (13)1675..1740
Gene Synonym:
Exon (14)1741..1921
Gene Synonym:
Exon (15)1922..2073
Gene Synonym:
Exon (16)2074..2259
Gene Synonym:
Exon (17)2260..2317
Gene Synonym:
Exon (18)2318..2409
Gene Synonym:
Exon (19)2410..3072
Gene Synonym:
Position Chain Variation Link
22 22 c, t dbSNP:372175632
41 41 g, t dbSNP:774769874
88 88 c, g dbSNP:111635026
105 105 c, t dbSNP:766903516
117 117 a, c dbSNP:147711382
120 120 c, g dbSNP:768845421
123 123 c, g dbSNP:12835565
128 128 a, g dbSNP:745535195
132 132 c, t dbSNP:773984408
133 133 c, t dbSNP:770482519
134 134 g, t dbSNP:773673080
148 148 a, g dbSNP:368132110
153 153 c, t dbSNP:748771594
162 162 c, t dbSNP:777227535
163 163 c, t dbSNP:769796451
177 177 a, g dbSNP:769874474
192 192 c, g dbSNP:781050545
198 198 a, t dbSNP:202156474
200 200 c, t dbSNP:143975950
204 204 g, t dbSNP:769123303
208 208 a, g dbSNP:748188165
214 214 a, g dbSNP:780978686
216 216 a, g dbSNP:768546451
227 227 g, t dbSNP:746771241
250 250 a, g dbSNP:779957555
265 265 -, a dbSNP:281865295
273 273 a, t dbSNP:193018400
274 274 a, g, t dbSNP:62638628
295 295 a, g dbSNP:62638629
296 296 a, g dbSNP:62638630
309 309 g, t dbSNP:62638631
319 319 a, g dbSNP:757275147
321 321 c, t dbSNP:201242851
322 322 g, t dbSNP:281865296
347 347 g, t dbSNP:62638634
390 390 c, t dbSNP:143521661
391 391 a, g dbSNP:111631988
395 395 g, t dbSNP:1801685
405 405 -, at dbSNP:62650215
405 405 a, g dbSNP:753138628
428 428 -, a dbSNP:36043846
433 433 c, g dbSNP:745631996
458 458 a, g dbSNP:774670559
462 462 a, c, t dbSNP:62638636
463 463 -, ca dbSNP:62638638
464 464 a, c dbSNP:62638637
487 487 a, c dbSNP:769910194
488 488 a, g dbSNP:748199207
523 523 -, t dbSNP:62638641
539 539 -, c dbSNP:62638642
539 539 c, t dbSNP:781213060
541 541 a, g dbSNP:769175863
547 547 a, g dbSNP:62638643
557 557 g, t dbSNP:62638644
562 562 a, g dbSNP:768274240
582 582 c, g, t dbSNP:376887697
583 583 a, g, t dbSNP:62638645
585 585 a, g dbSNP:777541233
589 589 a, g dbSNP:146920569
612 612 a, t dbSNP:752286330
616 616 a, g dbSNP:745860528
621 621 g, t dbSNP:759398299
635 635 c, g dbSNP:751512713
639 639 a, g dbSNP:201702850
650 650 -, tt dbSNP:281865298
650 650 -, t dbSNP:281865297
660 660 a, g dbSNP:62638648
673 673 a, g, t dbSNP:369037463
685 685 c, g dbSNP:137852550
697 697 a, g dbSNP:751501198
700 700 a, g dbSNP:766309823
720 720 a, g, t dbSNP:5963403
729 729 -, ttg dbSNP:779230198
747 747 c, t dbSNP:764956891
749 749 a, g dbSNP:62650216
753 753 a, c dbSNP:376866035
771 771 c, t dbSNP:765580620
773 773 a, c dbSNP:62650217
777 777 c, t dbSNP:371899162
795 795 c, t dbSNP:764342399
801 801 a, g dbSNP:760768561
805 805 a, g dbSNP:775660295
812 812 g, t dbSNP:62650218
836 836 a, g dbSNP:767436763
841 841 c, t dbSNP:150477878
845 845 a, g dbSNP:760123267
848 848 a, g dbSNP:774988145
858 858 a, c dbSNP:370173004
861 861 a, t dbSNP:749640965
871 871 c, t dbSNP:62638651
874 874 c, t dbSNP:62638652
893 893 c, t dbSNP:773408909
894 894 a, g dbSNP:768381214
898 898 a, t dbSNP:62638653
900 900 a, g dbSNP:62638654
915 915 -, c dbSNP:62650219
916 916 c, t dbSNP:62650220
918 918 -, tg dbSNP:281865299
918 918 c, t dbSNP:745651741
950 950 a, c dbSNP:751266432
953 953 c, g dbSNP:138018739
974 974 a, g dbSNP:398123336
977 977 a, g dbSNP:760445607
990 990 a, g dbSNP:774989787
991 991 a, g dbSNP:62642057
995 995 g, t dbSNP:771616566
1001 1001 -, cttt dbSNP:62640584
1002 1002 -, tt dbSNP:281865300
1002 1002 -, t dbSNP:62640586
1030 1030 a, g dbSNP:767814278
1033 1033 a, g dbSNP:62640587
1037 1037 -, a dbSNP:62640588
1040 1040 a, g dbSNP:778350385
1054 1054 -, acaataagttatatt dbSNP:62653026
1055 1055 c, t dbSNP:41309615
1062 1062 -, tt dbSNP:527236111
1067 1067 c, t dbSNP:111883266
1072 1072 c, t dbSNP:62640589
1073 1073 a, c, g dbSNP:62640590
1090 1090 c, g dbSNP:527236112
1099 1099 a, g dbSNP:62640591
1107 1107 c, t dbSNP:369916698
1113 1113 g, t dbSNP:750679565
1126 1126 a, g dbSNP:62640593
1135 1135 c, t dbSNP:757712647
1139 1139 a, g dbSNP:775245027
1140 1140 c, t dbSNP:771739225
1148 1148 g, t dbSNP:62640594
1162 1162 g, t dbSNP:62642058
1169 1169 g, t dbSNP:759136845
1170 1170 c, t dbSNP:200413654
1174 1174 a, t dbSNP:761972732
1201 1201 a, g dbSNP:41305223
1206 1206 c, t dbSNP:777556630
1209 1209 c, g dbSNP:144187092
1249 1249 a, g dbSNP:372028552
1255 1255 -, gtag dbSNP:527236109
1256 1256 -, t dbSNP:281865301
1262 1262 c, t dbSNP:773986350
1263 1263 g, t dbSNP:765929940
1266 1266 c, t dbSNP:369391462
1267 1267 -, c dbSNP:62635000
1267 1267 c, g, t dbSNP:769641256
1270 1270 a, c dbSNP:748061578
1273 1273 a, c, t dbSNP:768571911
1277 1277 a, g dbSNP:747294782
1287 1287 -, aaa dbSNP:750534667
1288 1288 g, t dbSNP:62635001
1291 1291 a, g dbSNP:780403919
1297 1297 c, t dbSNP:758542643
1299 1299 c, t dbSNP:17852968
1310 1310 a, g dbSNP:778997316
1312 1312 -, gat dbSNP:748280677
1313 1313 a, t dbSNP:757714144
1317 1317 a, t dbSNP:754275914
1328 1328 c, t dbSNP:148501922
1331 1331 c, t dbSNP:199661899
1332 1332 a, g dbSNP:1801686
1338 1338 g, t dbSNP:765979499
1343 1343 c, t dbSNP:372004762
1344 1344 a, c, g dbSNP:149742786
1357 1357 a, g dbSNP:761727775
1367 1367 a, g dbSNP:750333146
1368 1368 c, t dbSNP:768625051
1369 1369 a, g dbSNP:746767061
1372 1372 c, t dbSNP:368494625
1388 1388 c, t dbSNP:772201779
1394 1394 a, g dbSNP:746041459
1400 1400 a, g dbSNP:139594653
1405 1405 a, g dbSNP:771039023
1408 1408 c, g dbSNP:150549982
1412 1412 -, ag dbSNP:281865302
1412 1412 g, t dbSNP:143536063
1418 1418 a, g dbSNP:775157459
1424 1424 a, c dbSNP:771830247
1425 1425 a, c dbSNP:759743089
1429 1429 -, tctttttcaatgaggagaa dbSNP:281865303
1438 1438 a, g dbSNP:774619361
1439 1439 c, t dbSNP:770963251
1441 1441 a, c dbSNP:749334487
1442 1442 a, g dbSNP:1801687
1447 1447 a, t dbSNP:770300575
1450 1450 c, g dbSNP:182345461
1459 1459 a, g, t dbSNP:62635003
1464 1464 a, t dbSNP:28718831
1468 1468 a, t dbSNP:750094058
1475 1475 a, g dbSNP:62635004
1477 1477 c, t dbSNP:531930581
1499 1499 a, g dbSNP:756926974
1514 1514 a, g dbSNP:753418463
1524 1524 a, g dbSNP:763638295
1535 1535 a, g dbSNP:144635565
1537 1537 c, g dbSNP:752674076
1539 1539 c, g dbSNP:371226433
1544 1544 -, tc dbSNP:62653029
1559 1559 a, g dbSNP:759352792
1564 1564 a, g dbSNP:774476238
1567 1567 a, c dbSNP:774321455
1570 1570 -, ccag dbSNP:62653030
1611 1611 a, c dbSNP:144863059
1617 1617 g, t dbSNP:774609177
1634 1634 c, t dbSNP:149417653
1644 1644 -, c dbSNP:62635005
1646 1646 a, t dbSNP:62635006
1653 1653 a, t dbSNP:756979959
1668 1668 a, c dbSNP:375014257
1672 1672 a, g dbSNP:777489877
1675 1675 a, g dbSNP:776536747
1676 1676 -, ca dbSNP:281865304
1676 1676 c, g dbSNP:374555833
1684 1684 a, g dbSNP:747412709
1686 1686 a, g dbSNP:775998767
1687 1687 a, g dbSNP:772557101
1694 1694 a, g dbSNP:749005478
1700 1700 a, g dbSNP:777543422
1729 1729 c, g dbSNP:755725531
1743 1743 -, acaa dbSNP:281865305
1743 1743 a, g dbSNP:761895475
1744 1744 -, caa dbSNP:62653033
1747 1747 -, caa dbSNP:398123335
1753 1753 a, c, g dbSNP:764009509
1758 1758 a, g dbSNP:375288851
1766 1766 c, t dbSNP:41312104
1767 1767 a, g dbSNP:368883287
1771 1771 a, g dbSNP:772612305
1773 1773 c, t dbSNP:759947310
1776 1776 a, t dbSNP:145089607
1791 1791 c, t dbSNP:769507521
1802 1802 a, g dbSNP:747690060
1808 1808 a, t dbSNP:750857784
1812 1812 a, g dbSNP:768040222
1821 1821 a, g dbSNP:747017740
1839 1839 a, g dbSNP:779938667
1843 1843 a, t dbSNP:758295621
1855 1855 a, g dbSNP:148334278
1857 1857 g, t dbSNP:183675735
1861 1861 c, g dbSNP:757501405
1862 1862 a, g dbSNP:753999119
1865 1865 a, g dbSNP:1801688
1866 1866 g, t dbSNP:760647256
1873 1873 a, g dbSNP:753294383
1876 1876 a, g dbSNP:768169831
1877 1877 c, t dbSNP:202154504
1878 1878 a, g dbSNP:138347728
1885 1885 c, g dbSNP:771196039
1886 1886 c, t dbSNP:761586336
1889 1889 c, t dbSNP:202013664
1890 1890 a, g dbSNP:372171763
1896 1896 c, t dbSNP:145682975
1900 1900 c, g dbSNP:779494768
1902 1902 a, g dbSNP:772015036
1904 1904 g, t dbSNP:745734739
1913 1913 a, c dbSNP:778831340
1915 1915 g, t dbSNP:62635013
1947 1947 a, g dbSNP:765290437
1952 1952 a, t dbSNP:761787495
1964 1964 a, t dbSNP:776574633
1970 1970 c, t dbSNP:768570309
1983 1983 a, g dbSNP:760860514
1986 1986 a, g dbSNP:775756094
2000 2000 -, a dbSNP:62635014
2015 2015 a, g dbSNP:184789544
2034 2034 a, g dbSNP:201069691
2036 2036 c, t dbSNP:140467410
2050 2050 c, g dbSNP:778914040
2062 2062 c, g dbSNP:771440674
2070 2070 a, g dbSNP:749728332
2074 2074 g, t dbSNP:770101727
2084 2084 a, t dbSNP:748251204
2103 2103 a, g dbSNP:781266050
2116 2116 a, g dbSNP:755501450
2117 2117 c, t dbSNP:752091528
2118 2118 a, g dbSNP:574171500
2119 2119 g, t dbSNP:780328745
2190 2190 a, g dbSNP:370252136
2191 2191 a, g dbSNP:750741536
2201 2201 a, g dbSNP:763754607
2213 2213 c, g dbSNP:760267187
2218 2218 c, g dbSNP:780831994
2223 2223 a, g dbSNP:281865306
2228 2228 a, g dbSNP:752212461
2242 2242 c, g dbSNP:775817687
2248 2248 a, t dbSNP:281865307
2259 2259 a, g dbSNP:17352126
2269 2269 a, g dbSNP:781185543
2270 2270 c, t dbSNP:768757205
2282 2282 a, c dbSNP:747506896
2284 2284 c, t dbSNP:780639887
2285 2285 a, g dbSNP:758849023
2291 2291 c, t dbSNP:750796478
2301 2301 c, t dbSNP:779998371
2314 2314 a, g dbSNP:771791722
2320 2320 c, t dbSNP:762173989
2321 2321 a, c dbSNP:776877677
2343 2343 a, c, t dbSNP:747130152
2347 2347 a, t dbSNP:775370522
2354 2354 a, g dbSNP:772576305
2374 2374 a, g dbSNP:746373784
2394 2394 a, g dbSNP:281865308
2399 2399 a, c dbSNP:779309526
2409 2409 a, g dbSNP:757598542
2414 2414 c, t dbSNP:749685289
2424 2424 a, c dbSNP:777943257
2427 2427 a, t dbSNP:281865309
2428 2428 g, t dbSNP:281865310
2435 2435 c, t dbSNP:766828733
2437 2437 a, g dbSNP:746627825
2454 2454 c, g dbSNP:779757462
2467 2467 a, g dbSNP:757948609
2469 2469 a, g dbSNP:749909061
2470 2470 a, c dbSNP:34117835
2471 2471 c, t dbSNP:757080712
2472 2472 a, g dbSNP:781426804
2477 2477 c, t dbSNP:763796226
2479 2479 -, g dbSNP:281865311
2484 2484 a, g dbSNP:140895976
2491 2491 a, g dbSNP:147649203
2492 2492 c, t dbSNP:145289281
2493 2493 a, c dbSNP:759644180
2513 2513 a, g dbSNP:748423437
2524 2524 -, aa dbSNP:281865312
2525 2525 -, aagatgccgaccagaacca dbSNP:281865313
2533 2533 a, g dbSNP:113968324
2552 2552 a, g dbSNP:763302755
2565 2565 a, t dbSNP:768820582
2603 2603 c, g dbSNP:371704187
2608 2608 a, g dbSNP:745781744
2610 2610 a, g dbSNP:779882319
2613 2613 a, g dbSNP:771798016
2615 2615 -, aaatatatatttatg dbSNP:281865314
2648 2648 a, g dbSNP:745380815
2652 2652 c, t dbSNP:778496830
2653 2653 a, g dbSNP:757282676
2658 2658 a, g dbSNP:753709095
2659 2659 a, t dbSNP:777675495
2660 2660 a, g dbSNP:367795047
2662 2662 a, g dbSNP:752453443
2664 2664 c, t dbSNP:376653587
2670 2670 a, g dbSNP:778875656
2678 2678 -, aacttat dbSNP:11279874
2690 2690 -, a dbSNP:281865315
2709 2709 -, tttaaaagatataagacttaa dbSNP:281865316
2720 2720 c, t dbSNP:183539805
2741 2741 c, t dbSNP:752481152
2745 2745 c, t dbSNP:777555856
2749 2749 a, g dbSNP:192375655
2773 2773 -, tatttatgctaatat dbSNP:281865317
2787 2787 c, t dbSNP:752428660
2793 2793 -, a dbSNP:281865318
2852 2852 a, g dbSNP:780541258
2885 2885 a, t dbSNP:187807093
2911 2911 c, t dbSNP:182071709
2957 2957 a, g dbSNP:5964325
2972 2972 c, t dbSNP:189722742
2973 2973 a, g dbSNP:763561218
3008 3008 -, tttgatgtatttacaattttt dbSNP:281865319
3038 3038 a, t dbSNP:186136231

Target ORF information:

RefSeq Version NM_000328
Organism Homo sapiens (human)
Definition Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant A, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu22105D
Sequence Information ORF Nucleotide Sequence (Length: 3459bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product X-linked retinitis pigmentosa GTPase regulator isoform C
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP233620.1, BK005711.1 and AL606748.9. Summary: This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]. Transcript Variant: This variant (C) encodes the longest isoform (C). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BK005711.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)28..30(+)
Misc Feature(2)280..366(+)
Misc Feature(3)331..471(+)
Misc Feature(4)484..633(+)
Misc Feature(5)592..681(+)
Misc Feature(6)640..783(+)
Misc Feature(7)790..942(+)
Misc Feature(8)955..1098(+)
Misc Feature(9)1108..1248(+)
Exon (1)1..196
Gene Synonym:
Exon (2)197..322
Gene Synonym:
Exon (3)323..415
Gene Synonym:
Exon (4)416..478
Gene Synonym:
Exon (5)479..637
Gene Synonym:
Exon (6)638..787
Gene Synonym:
Exon (7)788..946
Gene Synonym:
Exon (8)947..1102
Gene Synonym:
Exon (9)1103..1227
Gene Synonym:
Exon (10)1228..1413
Gene Synonym:
Exon (11)1414..1582
Gene Synonym:
Exon (12)1583..1674
Gene Synonym:
Exon (13)1675..1740
Gene Synonym:
Exon (14)1741..1921
Gene Synonym:
Exon (15)1922..4718
Gene Synonym:
Position Chain Variation Link
22 22 c, t dbSNP:372175632
41 41 g, t dbSNP:774769874
88 88 c, g dbSNP:111635026
105 105 c, t dbSNP:766903516
117 117 a, c dbSNP:147711382
120 120 c, g dbSNP:768845421
123 123 c, g dbSNP:12835565
128 128 a, g dbSNP:745535195
132 132 c, t dbSNP:773984408
133 133 c, t dbSNP:770482519
134 134 g, t dbSNP:773673080
148 148 a, g dbSNP:368132110
153 153 c, t dbSNP:748771594
162 162 c, t dbSNP:777227535
163 163 c, t dbSNP:769796451
177 177 a, g dbSNP:769874474
192 192 c, g dbSNP:781050545
198 198 a, t dbSNP:202156474
200 200 c, t dbSNP:143975950
204 204 g, t dbSNP:769123303
208 208 a, g dbSNP:748188165
214 214 a, g dbSNP:780978686
216 216 a, g dbSNP:768546451
227 227 g, t dbSNP:746771241
250 250 a, g dbSNP:779957555
265 265 -, a dbSNP:281865295
273 273 a, t dbSNP:193018400
274 274 a, g, t dbSNP:62638628
295 295 a, g dbSNP:62638629
296 296 a, g dbSNP:62638630
309 309 g, t dbSNP:62638631
319 319 a, g dbSNP:757275147
321 321 c, t dbSNP:201242851
322 322 g, t dbSNP:281865296
347 347 g, t dbSNP:62638634
390 390 c, t dbSNP:143521661
391 391 a, g dbSNP:111631988
395 395 g, t dbSNP:1801685
405 405 -, at dbSNP:62650215
405 405 a, g dbSNP:753138628
428 428 -, a dbSNP:36043846
433 433 c, g dbSNP:745631996
458 458 a, g dbSNP:774670559
462 462 a, c, t dbSNP:62638636
463 463 -, ca dbSNP:62638638
464 464 a, c dbSNP:62638637
487 487 a, c dbSNP:769910194
488 488 a, g dbSNP:748199207
523 523 -, t dbSNP:62638641
539 539 -, c dbSNP:62638642
539 539 c, t dbSNP:781213060
541 541 a, g dbSNP:769175863
547 547 a, g dbSNP:62638643
557 557 g, t dbSNP:62638644
562 562 a, g dbSNP:768274240
582 582 c, g, t dbSNP:376887697
583 583 a, g, t dbSNP:62638645
585 585 a, g dbSNP:777541233
589 589 a, g dbSNP:146920569
612 612 a, t dbSNP:752286330
616 616 a, g dbSNP:745860528
621 621 g, t dbSNP:759398299
635 635 c, g dbSNP:751512713
639 639 a, g dbSNP:201702850
650 650 -, tt dbSNP:281865298
650 650 -, t dbSNP:281865297
660 660 a, g dbSNP:62638648
673 673 a, g, t dbSNP:369037463
685 685 c, g dbSNP:137852550
697 697 a, g dbSNP:751501198
700 700 a, g dbSNP:766309823
720 720 a, g, t dbSNP:5963403
729 729 -, ttg dbSNP:779230198
747 747 c, t dbSNP:764956891
749 749 a, g dbSNP:62650216
753 753 a, c dbSNP:376866035
771 771 c, t dbSNP:765580620
773 773 a, c dbSNP:62650217
777 777 c, t dbSNP:371899162
795 795 c, t dbSNP:764342399
801 801 a, g dbSNP:760768561
805 805 a, g dbSNP:775660295
812 812 g, t dbSNP:62650218
836 836 a, g dbSNP:767436763
841 841 c, t dbSNP:150477878
845 845 a, g dbSNP:760123267
848 848 a, g dbSNP:774988145
858 858 a, c dbSNP:370173004
861 861 a, t dbSNP:749640965
871 871 c, t dbSNP:62638651
874 874 c, t dbSNP:62638652
893 893 c, t dbSNP:773408909
894 894 a, g dbSNP:768381214
898 898 a, t dbSNP:62638653
900 900 a, g dbSNP:62638654
915 915 -, c dbSNP:62650219
916 916 c, t dbSNP:62650220
918 918 -, tg dbSNP:281865299
918 918 c, t dbSNP:745651741
950 950 a, c dbSNP:751266432
953 953 c, g dbSNP:138018739
974 974 a, g dbSNP:398123336
977 977 a, g dbSNP:760445607
990 990 a, g dbSNP:774989787
991 991 a, g dbSNP:62642057
995 995 g, t dbSNP:771616566
1001 1001 -, cttt dbSNP:62640584
1002 1002 -, tt dbSNP:281865300
1002 1002 -, t dbSNP:62640586
1030 1030 a, g dbSNP:767814278
1033 1033 a, g dbSNP:62640587
1037 1037 -, a dbSNP:62640588
1040 1040 a, g dbSNP:778350385
1054 1054 -, acaataagttatatt dbSNP:62653026
1055 1055 c, t dbSNP:41309615
1062 1062 -, tt dbSNP:527236111
1067 1067 c, t dbSNP:111883266
1072 1072 c, t dbSNP:62640589
1073 1073 a, c, g dbSNP:62640590
1090 1090 c, g dbSNP:527236112
1099 1099 a, g dbSNP:62640591
1107 1107 c, t dbSNP:369916698
1113 1113 g, t dbSNP:750679565
1126 1126 a, g dbSNP:62640593
1135 1135 c, t dbSNP:757712647
1139 1139 a, g dbSNP:775245027
1140 1140 c, t dbSNP:771739225
1148 1148 g, t dbSNP:62640594
1162 1162 g, t dbSNP:62642058
1169 1169 g, t dbSNP:759136845
1170 1170 c, t dbSNP:200413654
1174 1174 a, t dbSNP:761972732
1201 1201 a, g dbSNP:41305223
1206 1206 c, t dbSNP:777556630
1209 1209 c, g dbSNP:144187092
1249 1249 a, g dbSNP:372028552
1255 1255 -, gtag dbSNP:527236109
1256 1256 -, t dbSNP:281865301
1262 1262 c, t dbSNP:773986350
1263 1263 g, t dbSNP:765929940
1266 1266 c, t dbSNP:369391462
1267 1267 -, c dbSNP:62635000
1267 1267 c, g, t dbSNP:769641256
1270 1270 a, c dbSNP:748061578
1273 1273 a, c, t dbSNP:768571911
1277 1277 a, g dbSNP:747294782
1287 1287 -, aaa dbSNP:750534667
1288 1288 g, t dbSNP:62635001
1291 1291 a, g dbSNP:780403919
1297 1297 c, t dbSNP:758542643
1299 1299 c, t dbSNP:17852968
1310 1310 a, g dbSNP:778997316
1312 1312 -, gat dbSNP:748280677
1313 1313 a, t dbSNP:757714144
1317 1317 a, t dbSNP:754275914
1328 1328 c, t dbSNP:148501922
1331 1331 c, t dbSNP:199661899
1332 1332 a, g dbSNP:1801686
1338 1338 g, t dbSNP:765979499
1343 1343 c, t dbSNP:372004762
1344 1344 a, c, g dbSNP:149742786
1357 1357 a, g dbSNP:761727775
1367 1367 a, g dbSNP:750333146
1368 1368 c, t dbSNP:768625051
1369 1369 a, g dbSNP:746767061
1372 1372 c, t dbSNP:368494625
1388 1388 c, t dbSNP:772201779
1394 1394 a, g dbSNP:746041459
1400 1400 a, g dbSNP:139594653
1405 1405 a, g dbSNP:771039023
1408 1408 c, g dbSNP:150549982
1412 1412 -, ag dbSNP:281865302
1412 1412 g, t dbSNP:143536063
1418 1418 a, g dbSNP:775157459
1424 1424 a, c dbSNP:771830247
1425 1425 a, c dbSNP:759743089
1429 1429 -, tctttttcaatgaggagaa dbSNP:281865303
1438 1438 a, g dbSNP:774619361
1439 1439 c, t dbSNP:770963251
1441 1441 a, c dbSNP:749334487
1442 1442 a, g dbSNP:1801687
1447 1447 a, t dbSNP:770300575
1450 1450 c, g dbSNP:182345461
1459 1459 a, g, t dbSNP:62635003
1464 1464 a, t dbSNP:28718831
1468 1468 a, t dbSNP:750094058
1475 1475 a, g dbSNP:62635004
1477 1477 c, t dbSNP:531930581
1499 1499 a, g dbSNP:756926974
1514 1514 a, g dbSNP:753418463
1524 1524 a, g dbSNP:763638295
1535 1535 a, g dbSNP:144635565
1537 1537 c, g dbSNP:752674076
1539 1539 c, g dbSNP:371226433
1544 1544 -, tc dbSNP:62653029
1559 1559 a, g dbSNP:759352792
1564 1564 a, g dbSNP:774476238
1567 1567 a, c dbSNP:774321455
1570 1570 -, ccag dbSNP:62653030
1611 1611 a, c dbSNP:144863059
1617 1617 g, t dbSNP:774609177
1634 1634 c, t dbSNP:149417653
1644 1644 -, c dbSNP:62635005
1646 1646 a, t dbSNP:62635006
1653 1653 a, t dbSNP:756979959
1668 1668 a, c dbSNP:375014257
1672 1672 a, g dbSNP:777489877
1675 1675 a, g dbSNP:776536747
1676 1676 -, ca dbSNP:281865304
1676 1676 c, g dbSNP:374555833
1684 1684 a, g dbSNP:747412709
1686 1686 a, g dbSNP:775998767
1687 1687 a, g dbSNP:772557101
1694 1694 a, g dbSNP:749005478
1700 1700 a, g dbSNP:777543422
1729 1729 c, g dbSNP:755725531
1743 1743 -, acaa dbSNP:281865305
1743 1743 a, g dbSNP:761895475
1744 1744 -, caa dbSNP:62653033
1747 1747 -, caa dbSNP:398123335
1753 1753 a, c, g dbSNP:764009509
1758 1758 a, g dbSNP:375288851
1766 1766 c, t dbSNP:41312104
1767 1767 a, g dbSNP:368883287
1771 1771 a, g dbSNP:772612305
1773 1773 c, t dbSNP:759947310
1776 1776 a, t dbSNP:145089607
1791 1791 c, t dbSNP:769507521
1802 1802 a, g dbSNP:747690060
1808 1808 a, t dbSNP:750857784
1812 1812 a, g dbSNP:768040222
1821 1821 a, g dbSNP:747017740
1839 1839 a, g dbSNP:779938667
1843 1843 a, t dbSNP:758295621
1855 1855 a, g dbSNP:148334278
1857 1857 g, t dbSNP:183675735
1861 1861 c, g dbSNP:757501405
1862 1862 a, g dbSNP:753999119
1865 1865 a, g dbSNP:1801688
1866 1866 g, t dbSNP:760647256
1873 1873 a, g dbSNP:753294383
1876 1876 a, g dbSNP:768169831
1877 1877 c, t dbSNP:202154504
1878 1878 a, g dbSNP:138347728
1885 1885 c, g dbSNP:771196039
1886 1886 c, t dbSNP:761586336
1889 1889 c, t dbSNP:202013664
1890 1890 a, g dbSNP:372171763
1896 1896 c, t dbSNP:145682975
1900 1900 c, g dbSNP:779494768
1902 1902 a, g dbSNP:772015036
1904 1904 g, t dbSNP:745734739
1913 1913 a, c dbSNP:778831340
1915 1915 g, t dbSNP:62635013
1947 1947 a, g dbSNP:765290437
1952 1952 a, t dbSNP:761787495
1964 1964 a, t dbSNP:776574633
1970 1970 c, t dbSNP:768570309
1983 1983 a, g dbSNP:760860514
1986 1986 a, g dbSNP:775756094
2000 2000 -, a dbSNP:62635014
2015 2015 a, g dbSNP:184789544
2034 2034 a, g dbSNP:201069691
2036 2036 c, t dbSNP:140467410
2050 2050 c, g dbSNP:778914040
2062 2062 c, g dbSNP:771440674
2070 2070 a, g dbSNP:749728332
2089 2089 g, t dbSNP:371422457
2112 2112 a, g dbSNP:756479756
2114 2114 a, t dbSNP:367882990
2142 2142 c, t dbSNP:779788632
2148 2148 a, g dbSNP:757940856
2149 2149 g, t dbSNP:527236108
2150 2150 a, g dbSNP:374039361
2163 2163 a, g dbSNP:764777252
2211 2211 a, g dbSNP:753741318
2214 2214 a, t dbSNP:762926089
2220 2220 a, g dbSNP:753818354
2223 2223 a, g dbSNP:370892592
2225 2225 a, t dbSNP:151247357
2247 2247 a, g dbSNP:775104362
2262 2262 g, t dbSNP:377524122
2266 2266 c, g dbSNP:373790368
2277 2277 c, g dbSNP:767800135
2280 2280 a, g dbSNP:759617046
2282 2282 c, g dbSNP:774417183
2287 2287 a, g dbSNP:770993246
2303 2303 a, g dbSNP:749852225
2312 2312 a, g dbSNP:142222599
2321 2321 a, g dbSNP:773679348
2368 2368 a, g dbSNP:769446347
2378 2378 -, aag dbSNP:761717156
2381 2381 a, g dbSNP:770161775
2382 2382 a, g dbSNP:748570356
2388 2388 a, g dbSNP:149101436
2391 2391 a, g dbSNP:147619484
2393 2393 -, agg dbSNP:756401194
2409 2409 g, t dbSNP:745515080
2425 2425 a, g dbSNP:267606453
2439 2439 a, g dbSNP:746648402
2444 2444 g, t dbSNP:774925495
2458 2458 a, g dbSNP:756800463
2465 2465 a, g dbSNP:754741167
2486 2486 a, g dbSNP:753869899
2502 2502 -, gga dbSNP:201730068
2509 2509 a, g dbSNP:5917557
2510 2510 c, t dbSNP:368235489
2511 2511 a, g dbSNP:139643783
2533 2533 a, g dbSNP:752551497
2573 2573 -, ag dbSNP:398122960
2573 2573 a, t dbSNP:767152528
2579 2579 a, g dbSNP:147388235
2592 2592 -, aga dbSNP:767581994
2594 2594 -, ag dbSNP:730882261
2595 2595 a, g dbSNP:774543262
2597 2597 -, agg dbSNP:745480662
2609 2609 g, t dbSNP:757535958
2615 2615 -, gaggggaagtagagg dbSNP:777850798
2624 2624 g, t dbSNP:749717659
2625 2625 a, g dbSNP:766484947
2632 2632 a, g dbSNP:375806829
2633 2633 a, g dbSNP:763051284
2662 2662 c, g dbSNP:773115918
2663 2663 -, agg dbSNP:765319100
2663 2663 a, g dbSNP:756291766
2667 2667 g, t dbSNP:752979508
2669 2669 a, g dbSNP:767656254
2672 2672 c, g dbSNP:770346168
2674 2674 a, g dbSNP:748534694
2682 2682 -, gga dbSNP:759536041
2685 2685 a, g dbSNP:755138994
2687 2687 a, g dbSNP:777118393
2688 2688 -, ggagggggaagaggaggaagg dbSNP:780701932
2690 2690 a, g dbSNP:768886293
2706 2706 a, g dbSNP:745560455
2709 2709 -, ggagggggaagaggaggaagg dbSNP:751710678
2709 2709 a, g dbSNP:750364695
2711 2711 a, g dbSNP:765277647
2712 2712 a, g dbSNP:761510942
2720 2720 a, g dbSNP:776423695
2724 2724 -, gga dbSNP:763811133
2725 2725 a, g dbSNP:756933299
2733 2733 a, g dbSNP:748831947
2757 2757 a, g dbSNP:777091269
2762 2762 -, gag dbSNP:771584745
2774 2774 -, aagaaggggaggaag dbSNP:200824587
2774 2774 a, g dbSNP:201131185
2777 2777 -, aaggggaggaag dbSNP:747742286
2787 2787 a, g dbSNP:756083902
2798 2798 a, g dbSNP:752573444
2802 2802 a, g dbSNP:371230592
2811 2811 -, gga dbSNP:749799824
2818 2818 g, t dbSNP:137852549
2829 2829 a, g dbSNP:775158422
2835 2835 -, gga dbSNP:199663434
2835 2835 a, g dbSNP:781099799
2838 2838 -, a dbSNP:771536788
2862 2862 -, gga dbSNP:745428229
2880 2880 a, g dbSNP:774705528
2883 2883 a, g dbSNP:771531988
2897 2897 a, g dbSNP:749762268
2913 2913 -, gga dbSNP:751721873
2949 2949 a, t dbSNP:192410099
2955 2955 a, g dbSNP:778140396
2969 2969 a, g dbSNP:751314374
2976 2976 a, t dbSNP:187844918
2989 2989 g, t dbSNP:763102799
2997 2997 a, g, t dbSNP:201655057
3008 3008 -, aggggaggatggagaagggga dbSNP:764268405
3015 3015 -, agagga dbSNP:751757697
3015 3015 ag, ct dbSNP:267607019
3015 3015 a, g dbSNP:781614138
3017 3017 a, g dbSNP:755095966
3021 3021 a, g dbSNP:766376194
3024 3024 a, t dbSNP:757164085
3031 3031 g, t dbSNP:765224300
3047 3047 a, g dbSNP:111221005
3063 3063 a, g dbSNP:762437958
3065 3065 -, gggaagagg dbSNP:760550079
3067 3067 -, gaag dbSNP:753842840
3068 3068 -, aa dbSNP:758486646
3069 3069 -, aga dbSNP:753744103
3075 3075 a, t dbSNP:201247231
3090 3090 a, g dbSNP:769179127
3096 3096 a, g, t dbSNP:775098930
3097 3097 g, t dbSNP:137852551
3114 3114 -, agagga dbSNP:767210576
3158 3158 a, c dbSNP:761156255
3166 3166 c, g dbSNP:775951479
3171 3171 a, g dbSNP:770723125
3182 3182 -, ggaagg dbSNP:768165381
3207 3207 c, g dbSNP:748827157
3211 3211 g, t dbSNP:777409549
3216 3216 -, aga dbSNP:770165952
3219 3219 -, gga dbSNP:200955614
3228 3228 -, agtggaagggga dbSNP:199896738
3230 3230 a, t dbSNP:144299434
3232 3232 a, g dbSNP:748166031
3235 3235 a, g dbSNP:781023442
3239 3239 -, agtggaagggga dbSNP:756596841
3239 3239 a, g dbSNP:754860829
3240 3240 a, g dbSNP:373542041
3242 3242 -, tggaaggggagg dbSNP:201134185
3242 3242 -, tgg dbSNP:202048304
3242 3242 g, t dbSNP:773842474
3253 3253 -, tggaaggggagg dbSNP:757569199
3260 3260 -, ag dbSNP:606231181
3260 3260 a, g dbSNP:779756682
3261 3261 a, c, g dbSNP:763465912
3264 3264 -, gg dbSNP:606231180
3264 3264 g, t dbSNP:765404267
3273 3273 a, g dbSNP:761764357
3276 3276 -, aga dbSNP:773623324
3276 3276 a, g dbSNP:753917900
3277 3277 -, g dbSNP:752785210
3280 3280 -, gaa dbSNP:766460691
3282 3282 -, aggagagga dbSNP:763694930
3282 3282 a, g dbSNP:764724151
3284 3284 -, gag dbSNP:200211905
3285 3285 -, aaag dbSNP:755991327
3287 3287 -, a dbSNP:767219869
3290 3290 -, a dbSNP:761610612
3290 3290 a, g dbSNP:761209255
3291 3291 -, gga dbSNP:748582313
3296 3296 -, gag dbSNP:774956002
3301 3301 -, gaa dbSNP:781560777
3315 3315 a, g dbSNP:776004622
3318 3318 a, g dbSNP:772563043
3328 3328 -, gaa dbSNP:746359809
3334 3334 a, t dbSNP:141583035
3338 3338 -, gga dbSNP:777132996
3339 3339 a, g dbSNP:772718033
3341 3341 a, g dbSNP:769386712
3346 3346 -, ga dbSNP:771214648
3348 3348 -, aga dbSNP:747329361
3357 3357 -, gga dbSNP:746535151
3363 3363 -, aga dbSNP:772393926
3367 3367 g, t dbSNP:747633561
3372 3372 a, g dbSNP:766253895
3383 3383 c, t dbSNP:768584692
3386 3386 a, g dbSNP:746942235
3387 3387 c, t dbSNP:111787313
3393 3393 -, aga dbSNP:748294347
3399 3399 a, t dbSNP:62636730
3407 3407 a, g dbSNP:746138366
3430 3430 a, g dbSNP:779031166
3432 3432 a, g dbSNP:78736275
3451 3451 a, g dbSNP:753881282
3461 3461 a, g dbSNP:764205212
3474 3474 a, g dbSNP:756753383
3477 3477 c, t dbSNP:753243394
3485 3485 a, g dbSNP:574644551
3489 3489 a, g dbSNP:759788208
3496 3496 a, t dbSNP:774727813
3501 3501 a, t dbSNP:764808871
3502 3502 -, ca dbSNP:778853261
3506 3506 g, t dbSNP:761342257
3509 3509 -, a dbSNP:755018871
3516 3516 a, g dbSNP:138405457
3519 3519 c, g dbSNP:199691696
3525 3525 a, g dbSNP:768138793
3535 3535 c, t dbSNP:200556302
3539 3539 a, t dbSNP:201671932
3551 3551 a, g dbSNP:772001902
3564 3564 a, c, t dbSNP:12687163
3565 3565 a, g dbSNP:749648072
3567 3567 a, g dbSNP:562712159
3570 3570 a, c dbSNP:199602213
3575 3575 a, g dbSNP:150960964
3584 3584 a, c dbSNP:756242105
3598 3598 a, g dbSNP:12688514
3609 3609 c, t dbSNP:768170067
3631 3631 a, g dbSNP:755454454
3639 3639 -, tt dbSNP:750341019
3639 3639 a, t dbSNP:751874121
3646 3646 c, t dbSNP:766759865
3647 3647 a, g dbSNP:376964154
3659 3659 -, tcag dbSNP:781132332
3661 3661 a, g dbSNP:776241118
3672 3672 a, g dbSNP:763631777
3683 3683 a, g dbSNP:770255758
3699 3699 a, g dbSNP:139467624
3716 3716 a, t dbSNP:529465801
3743 3743 -, a dbSNP:397895009
3752 3752 -, a dbSNP:762417012
3752 3752 -, a dbSNP:35637775
3788 3788 a, g dbSNP:190788513
3811 3811 a, g dbSNP:147363795
3819 3819 c, g dbSNP:376714176
3855 3855 a, t dbSNP:371002358
3860 3860 a, c dbSNP:79675956
3904 3904 -, tat dbSNP:780184464
4001 4001 c, t dbSNP:772173620
4046 4046 c, t dbSNP:745989954
4097 4097 a, g dbSNP:5963392
4122 4122 -, aatt dbSNP:755976137
4123 4123 a, g dbSNP:771001409
4128 4128 a, g dbSNP:544514026
4146 4146 a, g dbSNP:752641746
4168 4168 a, g dbSNP:144832227
4250 4250 a, c, g dbSNP:186269331
4254 4254 c, g dbSNP:751192020
4263 4263 g, t dbSNP:182953211
4329 4329 a, t dbSNP:577098308
4348 4348 a, g dbSNP:149408606
4355 4355 c, t dbSNP:55711031
4504 4504 a, t dbSNP:191558770
4527 4527 c, t dbSNP:753612093
4610 4610 c, t dbSNP:762362189
4613 4613 a, g dbSNP:185996057

Target ORF information:

RefSeq Version NM_001034853
Organism Homo sapiens (human)
Definition Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant C, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.