Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

RS1 retinoschisin 1 [Homo sapiens (human)]

Gene Symbol RS1
Entrez Gene ID 6247
Full Name retinoschisin 1
Synonyms RS, XLRS1
General protein information
Preferred Names
X-linked juvenile retinoschisis protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu18101 NM_000330 Homo sapiens retinoschisin 1 (RS1), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu18101D
Sequence Information ORF Nucleotide Sequence (Length: 675bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product retinoschisin precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DQ426892.1, AF014459.1, Z92542.2 and BQ185379.1. This sequence is a reference standard in the RefSeqGene project. On Sep 19, 2008 this sequence version replaced gi:56550120. Summary: This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF014459.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA2142363 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)3..5(+)
Misc Feature(2)237..686(+)
Misc Feature(3)372..473(+)
Exon (1)1..87
Gene Synonym:
Exon (2)88..113
Gene Synonym:
Exon (3)114..219
Gene Synonym:
Exon (4)220..361
Gene Synonym:
Exon (5)362..557
Gene Synonym:
Exon (6)558..3026
Gene Synonym:
Position Chain Variation Link
1 1 a, t dbSNP:755875252
6 6 a, c, g dbSNP:770267407
21 21 a, c, g dbSNP:781282917
26 26 c, t dbSNP:370979911
27 27 a, g dbSNP:376367416
36 36 a, g dbSNP:281865332
37 37 c, t dbSNP:281865333
41 41 a, t dbSNP:780257454
42 42 c, g, t dbSNP:571944937
43 43 a, g dbSNP:374672514
45 45 a, g dbSNP:756086692
54 54 a, g dbSNP:752638328
68 68 -, actt dbSNP:281865335
70 70 a, t dbSNP:62645879
72 72 c, t dbSNP:767155536
73 73 c, t dbSNP:104894935
76 76 c, t dbSNP:766906113
88 88 -, ccacattgggattatcgtctaccga dbSNP:281865339
89 89 a, c dbSNP:777065897
103 103 a, c dbSNP:62645882
104 104 a, g dbSNP:768728087
110 110 c, t dbSNP:747107504
111 111 a, g, t dbSNP:140983930
122 122 c, t dbSNP:750030376
123 123 a, g dbSNP:146477940
126 126 g, t dbSNP:776900786
147 147 g, t dbSNP:574384039
155 155 a, c dbSNP:62645885
156 156 a, g dbSNP:144049906
171 171 c, t dbSNP:777196841
185 185 g, t dbSNP:200866925
195 195 a, g dbSNP:760716963
196 196 c, t dbSNP:200221392
198 198 -, gcca dbSNP:281865342
198 198 -, a dbSNP:62645886
210 210 a, t dbSNP:62645889
217 217 c, t dbSNP:772003584
223 223 a, g dbSNP:760405772
229 229 -, a dbSNP:62645893
229 229 a, g dbSNP:62645892
243 243 c, g dbSNP:62645894
244 244 a, g dbSNP:62645895
248 248 c, t dbSNP:764292483
249 249 a, c, g dbSNP:104894928
251 251 a, c, g dbSNP:104894932
252 252 c, t dbSNP:62645899
254 254 -, a dbSNP:62645900
256 256 g, t dbSNP:104894933
258 258 a, g, t dbSNP:62641252
268 268 c, t dbSNP:752656412
269 269 a, g dbSNP:183092299
277 277 a, t dbSNP:61750457
281 281 c, t dbSNP:764662119
288 288 -, aac dbSNP:61750458
292 292 c, t dbSNP:761385911
293 293 a, g dbSNP:147290350
297 297 c, t dbSNP:61750459
299 299 c, g dbSNP:201680258
301 301 a, g dbSNP:61752060
302 302 a, c, t dbSNP:61752061
307 307 a, c, g dbSNP:373612815
311 311 c, g dbSNP:61752062
320 320 a, g dbSNP:143920122
321 321 c, t dbSNP:61752063
323 323 a, g dbSNP:61752064
324 324 a, c dbSNP:746374375
328 328 a, c dbSNP:61752065
330 330 a, g dbSNP:144683916
331 331 a, g dbSNP:757345261
336 336 c, g dbSNP:61752066
336 336 -, g dbSNP:63465862
339 339 c, t dbSNP:61752067
340 340 a, g dbSNP:61752068
341 341 g, t dbSNP:762601581
343 343 g, t dbSNP:61752069
347 347 c, g dbSNP:61752070
352 352 -, a dbSNP:61752071
355 355 g, t dbSNP:143682861
358 358 g, t dbSNP:61752072
360 360 c, g, t dbSNP:104894934
361 361 a, g dbSNP:281865345
363 363 g, t dbSNP:770267626
364 364 a, g dbSNP:61752075
365 365 a, c, t dbSNP:1801161
371 371 c, g, t dbSNP:61752144
372 372 c, t dbSNP:61752145
375 375 c, t dbSNP:776803555
380 380 a, g dbSNP:768571577
384 384 -, t dbSNP:61752146
384 384 c, t dbSNP:199469696
401 401 c, g dbSNP:61752147
407 407 g, t dbSNP:779660363
409 409 g, t dbSNP:199469695
410 410 -, agat dbSNP:61752148
411 411 c, g dbSNP:199469698
415 415 c, t dbSNP:61752149
427 427 -, aa dbSNP:281865347
432 432 a, t dbSNP:61752151
439 439 g, t dbSNP:61752152
442 442 c, t dbSNP:61752153
447 447 a, g dbSNP:61752154
451 451 -, a dbSNP:61752155
453 453 a, g dbSNP:61752156
454 454 a, g dbSNP:61752157
456 456 c, g, t dbSNP:61752158
457 457 a, g dbSNP:61752159
461 461 -, tg dbSNP:61753160
461 461 c, g, t dbSNP:1800001
463 463 a, t dbSNP:61753161
467 467 c, t dbSNP:775507405
468 468 a, g dbSNP:184603580
469 469 -, gatcaaagtgatttcagggatcctcacccaggggcgctgtgacatcga dbSNP:199469699
470 470 c, t dbSNP:749081937
471 471 a, g dbSNP:61753162
473 473 c, g dbSNP:61753163
491 491 c, t dbSNP:777902881
492 492 a, g dbSNP:756084649
495 495 c, g, t dbSNP:61753164
497 497 a, g dbSNP:780774646
499 499 a, g dbSNP:61753165
506 506 c, t dbSNP:754381417
507 507 a, g dbSNP:1800002
513 513 c, t dbSNP:766007270
514 514 a, g dbSNP:758816133
524 524 a, g, t dbSNP:61753166
528 528 c, t dbSNP:750755649
534 534 a, t dbSNP:61753167
536 536 c, g dbSNP:61753168
556 556 a, g dbSNP:765547068
557 557 a, g dbSNP:762407219
568 568 a, g dbSNP:61753169
570 570 a, c, g dbSNP:61753170
574 574 c, t dbSNP:760857618
575 575 a, c, g dbSNP:767660711
579 579 c, t dbSNP:61753171
583 583 -, cc dbSNP:61753172
583 583 c, t dbSNP:150172233
589 589 c, t dbSNP:61753173
590 590 g, t dbSNP:769781603
600 600 c, t dbSNP:375231198
606 606 c, t dbSNP:141077105
609 609 a, c, t dbSNP:61753174
610 610 c, g dbSNP:61753175
611 611 -, t dbSNP:281865350
611 611 c, t dbSNP:186334493
612 612 c, t dbSNP:281865351
613 613 c, t dbSNP:281865352
614 614 -, c dbSNP:199469697
614 614 -, c dbSNP:281875359
618 618 a, g dbSNP:746925122
620 620 -, atc dbSNP:199469701
624 624 c, t dbSNP:281865354
625 625 a, c, g dbSNP:281865355
631 631 c, t dbSNP:281865356
632 632 a, c dbSNP:200052722
633 633 c, t dbSNP:281865357
634 634 a, g dbSNP:281865358
635 635 c, t dbSNP:771514400
641 641 c, t dbSNP:1800003
643 643 c, t dbSNP:104894930
653 653 a, g dbSNP:281865359
656 656 c, g dbSNP:281865360
657 657 a, g dbSNP:745526075
660 660 c, g, t dbSNP:281865361
661 661 a, g dbSNP:281865362
664 664 a, g, t dbSNP:757697856
666 666 a, g dbSNP:281865363
672 672 c, t dbSNP:281865365
673 673 a, g dbSNP:281865364
674 674 -, g dbSNP:281865366
678 678 a, c, g dbSNP:281865367
682 682 c, t dbSNP:281865368
690 690 -, tgcgtcagcaagtgtgcctgatgcc dbSNP:281865371
690 690 c, g, t dbSNP:281865369
690 690 -, t dbSNP:281865370
698 698 -, c dbSNP:199469700
701 701 c, g dbSNP:1800004
702 702 c, t dbSNP:104894929
707 707 c, t dbSNP:773102905
711 711 c, t dbSNP:377299974
712 712 g, t dbSNP:756606916
713 713 c, t dbSNP:1800005
723 723 c, t dbSNP:199949646
725 725 c, t dbSNP:759620016
735 735 c, t dbSNP:371251209
739 739 a, g dbSNP:766491401
740 740 a, g, t dbSNP:776325745
747 747 a, g dbSNP:768450307
756 756 c, t dbSNP:760620810
761 761 c, t dbSNP:376894507
766 766 a, g dbSNP:761218643
809 809 a, g dbSNP:370884638
843 843 a, t dbSNP:776150678
856 856 -, t dbSNP:377648180
1016 1016 c, g dbSNP:774583585
1120 1120 c, t dbSNP:373796791
1126 1126 a, g dbSNP:746622239
1239 1239 c, t dbSNP:779879832
1262 1262 a, g dbSNP:771403672
1276 1276 c, t dbSNP:147704131
1291 1291 a, g dbSNP:778125688
1304 1304 a, t dbSNP:150011364
1346 1346 c, t dbSNP:753145790
1354 1354 g, t dbSNP:781291294
1380 1380 c, t dbSNP:755070594
1410 1410 c, t dbSNP:181962555
1445 1445 c, t dbSNP:766627736
1487 1487 g, t dbSNP:762733796
1522 1522 a, g dbSNP:750291459
1584 1584 a, g dbSNP:776404166
1598 1598 c, g dbSNP:139226936
1650 1650 c, t dbSNP:761745534
1651 1651 a, g dbSNP:3810667
1689 1689 a, t dbSNP:768166344
1754 1754 c, g dbSNP:746805710
1793 1793 -, t dbSNP:760315286
1796 1796 a, g dbSNP:775316663
1810 1810 c, t dbSNP:151253353
1823 1823 a, g dbSNP:189004156
1876 1876 a, g dbSNP:745527387
1915 1915 a, t dbSNP:778130202
1963 1963 c, t dbSNP:56063474
1969 1969 c, g dbSNP:139441041
2050 2050 c, t dbSNP:781598838
2052 2052 c, t dbSNP:184482473
2078 2078 a, t dbSNP:751705227
2096 2096 a, g dbSNP:774950331
2180 2180 a, c dbSNP:756728161
2275 2275 g, t dbSNP:192694551
2276 2276 -, gggg dbSNP:753767629
2280 2280 -, t dbSNP:765044767
2324 2324 c, t dbSNP:561740701
2383 2383 c, g dbSNP:749841836
2414 2414 c, t dbSNP:190004049
2429 2429 c, t dbSNP:184280844
2445 2445 c, t dbSNP:764170478
2471 2471 -, gag dbSNP:766105401
2497 2497 c, g dbSNP:192216213
2511 2511 a, g dbSNP:778164773
2543 2543 a, c dbSNP:775078269
2546 2546 a, t dbSNP:767137401
2550 2550 -, gagatt dbSNP:759221406
2581 2581 g, t dbSNP:773897041
2583 2583 a, g dbSNP:770170712
2602 2602 c, t dbSNP:756604283
2656 2656 c, t dbSNP:753004674
2663 2663 c, t dbSNP:748501990
2711 2711 a, g dbSNP:767861658
2736 2736 c, t dbSNP:187452719
2741 2741 c, t dbSNP:769210416
2742 2742 a, g dbSNP:183120067
2751 2751 c, t dbSNP:755306678
2757 2757 c, t dbSNP:780043085
2760 2760 a, g dbSNP:563753319
2774 2774 c, t dbSNP:193264073
2805 2805 c, t dbSNP:746055972
2809 2809 a, g dbSNP:779055883
2847 2847 c, t dbSNP:146242676
2854 2854 c, t dbSNP:753645965
2865 2865 a, g dbSNP:763990628
2959 2959 c, t dbSNP:756046821

Target ORF information:

RefSeq Version NM_000330
Organism Homo sapiens (human)
Definition Homo sapiens retinoschisin 1 (RS1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.