Email to GenScript

RS1 retinoschisin 1 [Homo sapiens (human)]

Gene Symbol RS1
Entrez Gene ID 6247
Full Name retinoschisin 1
Synonyms RS, XLRS1
General protein information
Preferred Names
X-linked juvenile retinoschisis protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html:

The following RS1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the RS1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu18101 NM_000330 Homo sapiens retinoschisin 1 (RS1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu18101
Accession Version NM_000330.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 675bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu18101D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product retinoschisin precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DQ426892.1, AF014459.1, Z92542.2 and BQ185379.1. This sequence is a reference standard in the RefSeqGene project. On Sep 19, 2008 this sequence version replaced gi:56550120. Summary: This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. [provided by RefSeq, Oct 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF014459.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA2142363 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)3..5(+)
Misc Feature(2)237..686(+)
Misc Feature(3)372..473(+)
Exon (1)1..87
Gene Synonym:
Exon (2)88..113
Gene Synonym:
Exon (3)114..219
Gene Synonym:
Exon (4)220..361
Gene Synonym:
Exon (5)362..557
Gene Synonym:
Exon (6)558..3026
Gene Synonym:
Position Chain Variation Link
1 1 a, t dbSNP:755875252
6 6 a, c, g dbSNP:770267407
21 21 a, c, g dbSNP:781282917
26 26 c, t dbSNP:370979911
27 27 a, g dbSNP:376367416
36 36 a, g dbSNP:281865332
37 37 c, t dbSNP:281865333
41 41 a, t dbSNP:780257454
42 42 c, g, t dbSNP:571944937
43 43 a, g dbSNP:374672514
45 45 a, g dbSNP:756086692
54 54 a, g dbSNP:752638328
68 68 -, actt dbSNP:281865335
70 70 a, t dbSNP:62645879
72 72 c, t dbSNP:767155536
73 73 c, t dbSNP:104894935
76 76 c, t dbSNP:766906113
88 88 -, ccacattgggattatcgtctaccga dbSNP:281865339
89 89 a, c dbSNP:777065897
103 103 a, c dbSNP:62645882
104 104 a, g dbSNP:768728087
110 110 c, t dbSNP:747107504
111 111 a, g, t dbSNP:140983930
122 122 c, t dbSNP:750030376
123 123 a, g dbSNP:146477940
126 126 g, t dbSNP:776900786
147 147 g, t dbSNP:574384039
155 155 a, c dbSNP:62645885
156 156 a, g dbSNP:144049906
171 171 c, t dbSNP:777196841
185 185 g, t dbSNP:200866925
195 195 a, g dbSNP:760716963
196 196 c, t dbSNP:200221392
198 198 -, gcca dbSNP:281865342
198 198 -, a dbSNP:62645886
210 210 a, t dbSNP:62645889
217 217 c, t dbSNP:772003584
223 223 a, g dbSNP:760405772
229 229 -, a dbSNP:62645893
229 229 a, g dbSNP:62645892
243 243 c, g dbSNP:62645894
244 244 a, g dbSNP:62645895
248 248 c, t dbSNP:764292483
249 249 a, c, g dbSNP:104894928
251 251 a, c, g dbSNP:104894932
252 252 c, t dbSNP:62645899
254 254 -, a dbSNP:62645900
256 256 g, t dbSNP:104894933
258 258 a, g, t dbSNP:62641252
268 268 c, t dbSNP:752656412
269 269 a, g dbSNP:183092299
277 277 a, t dbSNP:61750457
281 281 c, t dbSNP:764662119
288 288 -, aac dbSNP:61750458
292 292 c, t dbSNP:761385911
293 293 a, g dbSNP:147290350
297 297 c, t dbSNP:61750459
299 299 c, g dbSNP:201680258
301 301 a, g dbSNP:61752060
302 302 a, c, t dbSNP:61752061
307 307 a, c, g dbSNP:373612815
311 311 c, g dbSNP:61752062
320 320 a, g dbSNP:143920122
321 321 c, t dbSNP:61752063
323 323 a, g dbSNP:61752064
324 324 a, c dbSNP:746374375
328 328 a, c dbSNP:61752065
330 330 a, g dbSNP:144683916
331 331 a, g dbSNP:757345261
336 336 c, g dbSNP:61752066
336 336 -, g dbSNP:63465862
339 339 c, t dbSNP:61752067
340 340 a, g dbSNP:61752068
341 341 g, t dbSNP:762601581
343 343 g, t dbSNP:61752069
347 347 c, g dbSNP:61752070
352 352 -, a dbSNP:61752071
355 355 g, t dbSNP:143682861
358 358 g, t dbSNP:61752072
360 360 c, g, t dbSNP:104894934
361 361 a, g dbSNP:281865345
363 363 g, t dbSNP:770267626
364 364 a, g dbSNP:61752075
365 365 a, c, t dbSNP:1801161
371 371 c, g, t dbSNP:61752144
372 372 c, t dbSNP:61752145
375 375 c, t dbSNP:776803555
380 380 a, g dbSNP:768571577
384 384 -, t dbSNP:61752146
384 384 c, t dbSNP:199469696
401 401 c, g dbSNP:61752147
407 407 g, t dbSNP:779660363
409 409 g, t dbSNP:199469695
410 410 -, agat dbSNP:61752148
411 411 c, g dbSNP:199469698
415 415 c, t dbSNP:61752149
427 427 -, aa dbSNP:281865347
432 432 a, t dbSNP:61752151
439 439 g, t dbSNP:61752152
442 442 c, t dbSNP:61752153
447 447 a, g dbSNP:61752154
451 451 -, a dbSNP:61752155
453 453 a, g dbSNP:61752156
454 454 a, g dbSNP:61752157
456 456 c, g, t dbSNP:61752158
457 457 a, g dbSNP:61752159
461 461 -, tg dbSNP:61753160
461 461 c, g, t dbSNP:1800001
463 463 a, t dbSNP:61753161
467 467 c, t dbSNP:775507405
468 468 a, g dbSNP:184603580
469 469 -, gatcaaagtgatttcagggatcctcacccaggggcgctgtgacatcga dbSNP:199469699
470 470 c, t dbSNP:749081937
471 471 a, g dbSNP:61753162
473 473 c, g dbSNP:61753163
491 491 c, t dbSNP:777902881
492 492 a, g dbSNP:756084649
495 495 c, g, t dbSNP:61753164
497 497 a, g dbSNP:780774646
499 499 a, g dbSNP:61753165
506 506 c, t dbSNP:754381417
507 507 a, g dbSNP:1800002
513 513 c, t dbSNP:766007270
514 514 a, g dbSNP:758816133
524 524 a, g, t dbSNP:61753166
528 528 c, t dbSNP:750755649
534 534 a, t dbSNP:61753167
536 536 c, g dbSNP:61753168
556 556 a, g dbSNP:765547068
557 557 a, g dbSNP:762407219
568 568 a, g dbSNP:61753169
570 570 a, c, g dbSNP:61753170
574 574 c, t dbSNP:760857618
575 575 a, c, g dbSNP:767660711
579 579 c, t dbSNP:61753171
583 583 -, cc dbSNP:61753172
583 583 c, t dbSNP:150172233
589 589 c, t dbSNP:61753173
590 590 g, t dbSNP:769781603
600 600 c, t dbSNP:375231198
606 606 c, t dbSNP:141077105
609 609 a, c, t dbSNP:61753174
610 610 c, g dbSNP:61753175
611 611 -, t dbSNP:281865350
611 611 c, t dbSNP:186334493
612 612 c, t dbSNP:281865351
613 613 c, t dbSNP:281865352
614 614 -, c dbSNP:199469697
614 614 -, c dbSNP:281875359
618 618 a, g dbSNP:746925122
620 620 -, atc dbSNP:199469701
624 624 c, t dbSNP:281865354
625 625 a, c, g dbSNP:281865355
631 631 c, t dbSNP:281865356
632 632 a, c dbSNP:200052722
633 633 c, t dbSNP:281865357
634 634 a, g dbSNP:281865358
635 635 c, t dbSNP:771514400
641 641 c, t dbSNP:1800003
643 643 c, t dbSNP:104894930
653 653 a, g dbSNP:281865359
656 656 c, g dbSNP:281865360
657 657 a, g dbSNP:745526075
660 660 c, g, t dbSNP:281865361
661 661 a, g dbSNP:281865362
664 664 a, g, t dbSNP:757697856
666 666 a, g dbSNP:281865363
672 672 c, t dbSNP:281865365
673 673 a, g dbSNP:281865364
674 674 -, g dbSNP:281865366
678 678 a, c, g dbSNP:281865367
682 682 c, t dbSNP:281865368
690 690 -, tgcgtcagcaagtgtgcctgatgcc dbSNP:281865371
690 690 c, g, t dbSNP:281865369
690 690 -, t dbSNP:281865370
698 698 -, c dbSNP:199469700
701 701 c, g dbSNP:1800004
702 702 c, t dbSNP:104894929
707 707 c, t dbSNP:773102905
711 711 c, t dbSNP:377299974
712 712 g, t dbSNP:756606916
713 713 c, t dbSNP:1800005
723 723 c, t dbSNP:199949646
725 725 c, t dbSNP:759620016
735 735 c, t dbSNP:371251209
739 739 a, g dbSNP:766491401
740 740 a, g, t dbSNP:776325745
747 747 a, g dbSNP:768450307
756 756 c, t dbSNP:760620810
761 761 c, t dbSNP:376894507
766 766 a, g dbSNP:761218643
809 809 a, g dbSNP:370884638
843 843 a, t dbSNP:776150678
856 856 -, t dbSNP:377648180
1016 1016 c, g dbSNP:774583585
1120 1120 c, t dbSNP:373796791
1126 1126 a, g dbSNP:746622239
1239 1239 c, t dbSNP:779879832
1262 1262 a, g dbSNP:771403672
1276 1276 c, t dbSNP:147704131
1291 1291 a, g dbSNP:778125688
1304 1304 a, t dbSNP:150011364
1346 1346 c, t dbSNP:753145790
1354 1354 g, t dbSNP:781291294
1380 1380 c, t dbSNP:755070594
1410 1410 c, t dbSNP:181962555
1445 1445 c, t dbSNP:766627736
1487 1487 g, t dbSNP:762733796
1522 1522 a, g dbSNP:750291459
1584 1584 a, g dbSNP:776404166
1598 1598 c, g dbSNP:139226936
1650 1650 c, t dbSNP:761745534
1651 1651 a, g dbSNP:3810667
1689 1689 a, t dbSNP:768166344
1754 1754 c, g dbSNP:746805710
1793 1793 -, t dbSNP:760315286
1796 1796 a, g dbSNP:775316663
1810 1810 c, t dbSNP:151253353
1823 1823 a, g dbSNP:189004156
1876 1876 a, g dbSNP:745527387
1915 1915 a, t dbSNP:778130202
1963 1963 c, t dbSNP:56063474
1969 1969 c, g dbSNP:139441041
2050 2050 c, t dbSNP:781598838
2052 2052 c, t dbSNP:184482473
2078 2078 a, t dbSNP:751705227
2096 2096 a, g dbSNP:774950331
2180 2180 a, c dbSNP:756728161
2275 2275 g, t dbSNP:192694551
2276 2276 -, gggg dbSNP:753767629
2280 2280 -, t dbSNP:765044767
2324 2324 c, t dbSNP:561740701
2383 2383 c, g dbSNP:749841836
2414 2414 c, t dbSNP:190004049
2429 2429 c, t dbSNP:184280844
2445 2445 c, t dbSNP:764170478
2471 2471 -, gag dbSNP:766105401
2497 2497 c, g dbSNP:192216213
2511 2511 a, g dbSNP:778164773
2543 2543 a, c dbSNP:775078269
2546 2546 a, t dbSNP:767137401
2550 2550 -, gagatt dbSNP:759221406
2581 2581 g, t dbSNP:773897041
2583 2583 a, g dbSNP:770170712
2602 2602 c, t dbSNP:756604283
2656 2656 c, t dbSNP:753004674
2663 2663 c, t dbSNP:748501990
2711 2711 a, g dbSNP:767861658
2736 2736 c, t dbSNP:187452719
2741 2741 c, t dbSNP:769210416
2742 2742 a, g dbSNP:183120067
2751 2751 c, t dbSNP:755306678
2757 2757 c, t dbSNP:780043085
2760 2760 a, g dbSNP:563753319
2774 2774 c, t dbSNP:193264073
2805 2805 c, t dbSNP:746055972
2809 2809 a, g dbSNP:779055883
2847 2847 c, t dbSNP:146242676
2854 2854 c, t dbSNP:753645965
2865 2865 a, g dbSNP:763990628
2959 2959 c, t dbSNP:756046821

Target ORF information:

RefSeq Version NM_000330
Organism Homo sapiens (human)
Definition Homo sapiens retinoschisin 1 (RS1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.