Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

NOD2 nucleotide-binding oligomerization domain containing 2 [Homo sapiens (human)]

Gene Symbol NOD2
Entrez Gene ID 64127
Full Name nucleotide-binding oligomerization domain containing 2
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]. lac of sum
Disorder MIM:


Disorder Html: {Inflammatory bowel disease 1}, 266600 (3); Blau syndrome, 186580
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu27927 NM_022162 Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu27928 XM_005256084 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu49454 XM_006721242 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu71259 XM_011523257 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu71259 XM_011523258 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu71260 XM_011523259 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu49455 XM_006721243 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu71261 XM_011523260 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X9, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu71261 XM_011523261 PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X11, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu27928 NM_001293557 Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu27927D
Sequence Information ORF Nucleotide Sequence (Length: 3123bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 10-JUN-2014
Organism Homo sapiens (human)
Product nucleotide-binding oligomerization domain-containing protein 2 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF178930.1 and HY272594.1. On Jun 10, 2014 this sequence version replaced gi:11545911. Summary: This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]. Transcript Variant: This variant (1) encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF178930.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)94..96(+)
Misc Feature(2)205..462(+)
Misc Feature(3)292..336(+)
Misc Feature(4)505..747(+)
Misc Feature(5)982..1494(+)
Misc Feature(6)2404..3201(+)
Misc Feature(7)2404..3174(+)
Misc Feature(8)2413..3156(+)
Misc Feature(9)2476..2541(+)
Misc Feature(10)2488..3225(+)
Misc Feature(11)2551..2622(+)
Misc Feature(12)2563..2637(+)
Misc Feature(13)2635..2700(+)
Misc Feature(14)2638..2709(+)
Misc Feature(15)2710..2805(+)
Misc Feature(16)2719..2757(+)
Misc Feature(17)2803..2865(+)
Misc Feature(18)2806..2889(+)
Misc Feature(19)2887..2952(+)
Misc Feature(20)2890..2961(+)
Misc Feature(21)2971..3033(+)
Misc Feature(22)2974..3057(+)
Misc Feature(23)3055..3120(+)
Misc Feature(24)3058..3123(+)
Misc Feature(25)3124..3177(+)
Misc Feature(26)3139..3201(+)
Exon (1)1..178
Gene Synonym:
Exon (2)179..645
Gene Synonym:
Exon (3)646..751
Gene Synonym:
Exon (4)752..2567
Gene Synonym:
Exon (5)2568..2651
Gene Synonym:
Exon (6)2652..2735
Gene Synonym:
Exon (7)2736..2819
Gene Synonym:
Exon (8)2820..2903
Gene Synonym:
Exon (9)2904..2987
Gene Synonym:
Exon (10)2988..3071
Gene Synonym:
Exon (11)3072..3155
Gene Synonym:
Exon (12)3156..4486
Gene Synonym:
Position Chain Variation Link
10 10 -, t dbSNP:5743265
15 15 c, g dbSNP:199475910
23 23 a, g dbSNP:544996914
46 46 c, t dbSNP:565604357
47 47 a, g dbSNP:2076752
48 48 c, t dbSNP:139485985
53 53 c, t dbSNP:188341692
58 58 a, g dbSNP:772850820
66 66 c, t dbSNP:530145719
67 67 a, g dbSNP:377397140
74 74 -, ca dbSNP:747385864
74 74 c, t dbSNP:370447004
75 75 c, t dbSNP:751258340
80 80 c, t dbSNP:561366535
92 92 c, t dbSNP:117611225
98 98 a, g dbSNP:566551188
105 105 a, g dbSNP:754383446
107 107 c, t dbSNP:765406921
111 111 a, g dbSNP:753028578
118 118 c, g dbSNP:140977130
127 127 g, t dbSNP:764563350
128 128 c, g dbSNP:373796134
131 131 c, t dbSNP:376966894
135 135 c, t dbSNP:781482576
136 136 a, g dbSNP:746379299
137 137 a, t dbSNP:754538287
141 141 a, g dbSNP:149939201
165 165 c, t dbSNP:144993105
166 166 a, g dbSNP:771671839
176 176 c, t dbSNP:149122717
179 179 a, g dbSNP:567793250
180 180 c, t dbSNP:371044393
187 187 a, g dbSNP:372321755
194 194 c, t dbSNP:768775316
195 195 a, g dbSNP:774491311
203 203 c, g dbSNP:762072566
218 218 g, t dbSNP:104895487
224 224 a, c dbSNP:750745611
226 226 a, c dbSNP:761191478
231 231 c, t dbSNP:766815592
232 232 a, g dbSNP:200089552
236 236 c, t dbSNP:757914381
238 238 c, t dbSNP:777325175
239 239 c, t dbSNP:751223046
245 245 c, t dbSNP:201586544
248 248 c, g dbSNP:758548184
254 254 c, t dbSNP:781166995
256 256 g, t dbSNP:745597071
264 264 c, t dbSNP:769855133
265 265 a, g dbSNP:780204985
269 269 a, g dbSNP:749222396
270 270 c, t dbSNP:768665692
273 273 c, g dbSNP:774456364
286 286 c, g dbSNP:761972851
291 291 c, g, t dbSNP:367895771
304 304 c, t dbSNP:760962549
305 305 c, g dbSNP:146149433
318 318 c, t dbSNP:754402504
319 319 a, g dbSNP:760069458
320 320 a, g dbSNP:138881230
323 323 c, g dbSNP:751044848
329 329 a, c dbSNP:756886427
331 331 c, t dbSNP:780921204
335 335 c, t dbSNP:750092643
338 338 c, g dbSNP:756028666
340 340 c, t dbSNP:779970018
343 343 a, c, g dbSNP:370734707
346 346 c, g dbSNP:34936594
361 361 a, g dbSNP:748200640
362 362 a, g dbSNP:772287143
364 364 c, t dbSNP:374128251
374 374 a, t dbSNP:747221457
375 375 c, t dbSNP:771336423
378 378 c, t dbSNP:146923251
379 379 a, g, t dbSNP:187264529
383 383 a, g dbSNP:773733975
384 384 a, g dbSNP:761449474
392 392 a, g, t dbSNP:767119064
397 397 c, t dbSNP:755795167
404 404 g, t dbSNP:367756419
406 406 c, g dbSNP:753619374
408 408 a, c, g dbSNP:138041175
417 417 c, t dbSNP:778843858
418 418 a, g dbSNP:113706344
419 419 c, t dbSNP:202052365
420 420 a, g, t dbSNP:104895419
429 429 a, g dbSNP:747274659
433 433 a, g dbSNP:571102620
434 434 c, g, t dbSNP:35095295
437 437 a, g dbSNP:746189550
441 441 a, c, t dbSNP:770046355
442 442 a, g dbSNP:104895468
443 443 a, c dbSNP:767173948
444 444 c, t dbSNP:138889062
454 454 c, t dbSNP:760423983
459 459 a, g dbSNP:766071199
462 462 g, t dbSNP:672601267
477 477 c, t dbSNP:753579507
479 479 c, t dbSNP:149390911
480 480 c, t dbSNP:764929082
481 481 c, g dbSNP:781448444
482 482 a, g dbSNP:758303366
485 485 c, t dbSNP:146395646
486 486 a, g dbSNP:535978538
494 494 c, g dbSNP:200160605
499 499 c, g dbSNP:757487598
500 500 a, g dbSNP:781540619
508 508 a, c dbSNP:572556762
509 509 a, g dbSNP:770240116
517 517 a, c, t dbSNP:184502667
518 518 a, g dbSNP:104895456
518 518 -, g dbSNP:776176047
520 520 c, t dbSNP:749841667
523 523 a, g dbSNP:34684955
528 528 c, t dbSNP:772861513
532 532 a, g dbSNP:760196682
537 537 a, g dbSNP:770343724
545 545 a, g dbSNP:776403451
562 562 -, a dbSNP:761486886
565 565 a, g dbSNP:146054564
568 568 c, t dbSNP:765122435
569 569 a, t dbSNP:148753593
574 574 c, t dbSNP:104895420
580 580 c, t dbSNP:562557464
581 581 a, g dbSNP:150996156
584 584 a, g dbSNP:751647609
587 587 c, t dbSNP:757381363
588 588 c, t dbSNP:565504727
589 589 gcatgggagcggggtttca, tcagccagtatgaatgtgatgaaatcaggt dbSNP:45575333
589 589 a, g dbSNP:139571975
590 590 c, t dbSNP:756247553
591 591 a, c dbSNP:780488493
603 603 a, t dbSNP:749605438
604 604 c, g, t dbSNP:769289791
622 622 c, t dbSNP:748652020
623 623 c, t dbSNP:770524298
624 624 a, g dbSNP:77153279
635 635 a, c, t dbSNP:144368009
636 636 a, g dbSNP:775281342
639 639 a, c, g dbSNP:2067085
647 647 a, c dbSNP:141414002
649 649 a, g dbSNP:748912559
657 657 g, t dbSNP:768476112
669 669 c, g dbSNP:774089880
671 671 c, t dbSNP:61755182
672 672 a, g dbSNP:144887729
675 675 a, g dbSNP:555550682
680 680 c, t dbSNP:149071116
681 681 a, g dbSNP:369122423
695 695 a, c, g dbSNP:373838219
696 696 c, t dbSNP:765729513
702 702 c, t dbSNP:201115206
704 704 c, t dbSNP:758959985
705 705 a, g dbSNP:778078737
711 711 c, t dbSNP:747534110
712 712 a, g dbSNP:369764782
721 721 c, t dbSNP:755641532
726 726 a, g, t dbSNP:377752699
729 729 c, t dbSNP:768259661
730 730 c, t dbSNP:143080077
731 731 c, t dbSNP:753744335
736 736 a, g dbSNP:771887760
738 738 c, t dbSNP:5743269
739 739 c, t dbSNP:760629717
759 759 a, g dbSNP:778455499
776 776 c, t dbSNP:375336137
777 777 c, t dbSNP:758019098
786 786 a, g dbSNP:777458605
791 791 c, t dbSNP:529640892
792 792 a, g dbSNP:771003092
802 802 c, t dbSNP:781333877
803 803 a, c dbSNP:369098290
808 808 c, t dbSNP:104895422
809 809 a, g, t dbSNP:201790577
819 819 c, t dbSNP:768859303
824 824 a, g dbSNP:202190367
830 830 a, g dbSNP:762225932
839 839 c, t dbSNP:148516118
840 840 a, g, t dbSNP:773749264
844 844 c, t dbSNP:764675751
845 845 g, t dbSNP:752210177
848 848 g, t dbSNP:104895423
849 849 a, g dbSNP:145694647
850 850 a, g dbSNP:763743511
851 851 a, g dbSNP:117836686
856 856 a, g dbSNP:758462936
857 857 c, t dbSNP:757182049
864 864 a, g, t dbSNP:781099046
883 883 -, tgggcagatg dbSNP:764849041
885 885 c, g dbSNP:528290590
892 892 a, g dbSNP:756042160
900 900 -, g dbSNP:772914954
904 904 a, g dbSNP:780005934
907 907 a, c, t dbSNP:2066842
911 911 c, t dbSNP:774703072
912 912 a, c, g dbSNP:369766454
918 918 a, g dbSNP:773516123
921 921 c, t dbSNP:35090774
928 928 a, g dbSNP:766841285
930 930 c, t dbSNP:774873537
931 931 c, g dbSNP:762579270
933 933 a, g dbSNP:763504952
941 941 a, c dbSNP:200744970
944 944 a, g dbSNP:146074127
946 946 c, t dbSNP:756943416
951 951 c, t dbSNP:767456023
955 955 a, g dbSNP:369740939
964 964 c, t dbSNP:560242309
971 971 a, g dbSNP:5743271
975 975 c, t dbSNP:749180535
976 976 a, g dbSNP:104895424
977 977 a, g dbSNP:755127265
978 978 c, t dbSNP:778942858
980 980 c, t dbSNP:149338478
986 986 c, g dbSNP:104895425
988 988 a, g dbSNP:778114969
993 993 g, t dbSNP:375002962
999 999 a, g dbSNP:747340360
1001 1001 a, g dbSNP:771184127
1007 1007 c, t dbSNP:104895426
1008 1008 a, g dbSNP:531906536
1020 1020 a, g dbSNP:768258168
1025 1025 c, t dbSNP:191901394
1026 1026 a, g dbSNP:376601025
1031 1031 c, t dbSNP:767225117
1032 1032 a, g dbSNP:144738371
1033 1033 c, t dbSNP:760588667
1034 1034 a, g dbSNP:148526508
1035 1035 a, g dbSNP:753862753
1036 1036 c, t dbSNP:104895427
1037 1037 a, g dbSNP:778995814
1055 1055 c, t dbSNP:199975570
1059 1059 a, g dbSNP:199951979
1060 1060 g, t dbSNP:758631940
1063 1063 -, c dbSNP:762547903
1064 1064 a, g dbSNP:201591164
1067 1067 a, c dbSNP:747190206
1068 1068 c, g dbSNP:771364403
1084 1084 -, tt dbSNP:762053317
1093 1093 c, t dbSNP:773132030
1095 1095 a, g dbSNP:746405870
1105 1105 c, t dbSNP:104895462
1106 1106 a, g dbSNP:104895461
1110 1110 c, g dbSNP:7498256
1123 1123 a, g dbSNP:770361381
1124 1124 c, g dbSNP:774016655
1133 1133 c, g, t dbSNP:369732140
1134 1134 c, g dbSNP:144439629
1136 1136 c, t dbSNP:199475912
1138 1138 g, t dbSNP:760224068
1139 1139 c, t dbSNP:766219817
1141 1141 c, t dbSNP:753537879
1142 1142 a, c, g dbSNP:759520552
1147 1147 c, g dbSNP:104895428
1150 1150 c, g dbSNP:752615209
1152 1152 a, c, t dbSNP:758539057
1158 1158 c, g dbSNP:554991667
1160 1160 a, g dbSNP:5743272
1166 1166 g, t dbSNP:751854684
1170 1170 a, g dbSNP:104895488
1171 1171 c, t dbSNP:757368076
1172 1172 c, t dbSNP:201107567
1175 1175 a, c dbSNP:104895469
1176 1176 a, t dbSNP:756538468
1182 1182 c, t dbSNP:780775868
1186 1186 c, g dbSNP:556617095
1189 1189 -, g dbSNP:766265864
1192 1192 a, t dbSNP:104895470
1193 1193 a, t dbSNP:772548332
1198 1198 c, t dbSNP:746706579
1200 1200 a, g dbSNP:770423311
1207 1207 c, t dbSNP:776498009
1212 1212 a, c dbSNP:759382357
1213 1213 c, t dbSNP:199858111
1216 1216 c, g dbSNP:775443143
1222 1222 c, t dbSNP:145293873
1223 1223 c, g dbSNP:764176270
1226 1226 c, t dbSNP:751550117
1227 1227 c, t dbSNP:757517796
1233 1233 a, t dbSNP:767694243
1236 1236 c, g, t dbSNP:750655947
1237 1237 g, t dbSNP:780544950
1239 1239 c, t dbSNP:527305056
1251 1251 c, g, t dbSNP:104895476
1252 1252 a, g, t dbSNP:104895477
1253 1253 a, g dbSNP:104895493
1256 1256 a, t dbSNP:777343284
1269 1269 c, t dbSNP:746445875
1271 1271 c, t dbSNP:528926956
1272 1272 a, g dbSNP:776211261
1273 1273 a, g dbSNP:147283871
1274 1274 a, t dbSNP:769622495
1276 1276 c, t dbSNP:104895481
1277 1277 a, g dbSNP:554887705
1279 1279 a, g dbSNP:763868196
1282 1282 c, t dbSNP:140716236
1283 1283 a, g dbSNP:140918872
1287 1287 c, t dbSNP:767605899
1293 1293 c, t dbSNP:750664442
1295 1295 c, t dbSNP:150078153
1296 1296 a, g dbSNP:766883774
1299 1299 c, t dbSNP:5743273
1300 1300 a, g dbSNP:755554858
1304 1304 c, t dbSNP:779346494
1310 1310 c, t dbSNP:753241960
1315 1315 c, t dbSNP:756755875
1317 1317 c, g dbSNP:367630707
1324 1324 c, t dbSNP:760998620
1346 1346 a, g dbSNP:104895429
1348 1348 c, g dbSNP:745540141
1351 1351 c, g dbSNP:766612118
1363 1363 c, t dbSNP:367883043
1364 1364 a, g dbSNP:199475913
1368 1368 a, g dbSNP:749142500
1370 1370 g, t dbSNP:768497619
1372 1372 a, g dbSNP:774197781
1374 1374 g, t dbSNP:77966199
1381 1381 c, t dbSNP:545466982
1382 1382 a, g dbSNP:562225614
1384 1384 c, t dbSNP:760982375
1385 1385 c, t dbSNP:766651775
1386 1386 a, c, g dbSNP:104895430
1389 1389 c, t dbSNP:547826765
1390 1390 a, g dbSNP:144827713
1397 1397 c, t dbSNP:104895431
1398 1398 a, g, t dbSNP:145834617
1400 1400 c, t dbSNP:2076754
1401 1401 a, g dbSNP:779751017
1404 1404 c, t dbSNP:748910444
1408 1408 a, g dbSNP:768389547
1412 1412 a, t dbSNP:778723375
1413 1413 a, g dbSNP:748068611
1416 1416 c, t dbSNP:771979324
1419 1419 a, c dbSNP:773440974
1420 1420 c, t dbSNP:375201229
1421 1421 a, g dbSNP:143110172
1422 1422 c, t dbSNP:777034157
1425 1425 c, t dbSNP:143395754
1426 1426 a, g dbSNP:104895432
1431 1431 c, t dbSNP:151315883
1444 1444 c, t dbSNP:763372171
1446 1446 c, t dbSNP:370728357
1454 1454 a, t dbSNP:764525298
1461 1461 c, t dbSNP:186719861
1462 1462 a, g dbSNP:556728426
1471 1471 c, t dbSNP:104895433
1480 1480 c, t dbSNP:765857594
1481 1481 a, g dbSNP:753458507
1482 1482 a, c, t dbSNP:2066843
1491 1491 a, g dbSNP:747921876
1492 1492 c, g dbSNP:104895482
1494 1494 c, t dbSNP:200656015
1495 1495 a, g, t dbSNP:104895492
1497 1497 c, g dbSNP:771183089
1502 1502 c, t dbSNP:776802746
1503 1503 a, g dbSNP:746104214
1507 1507 a, c, t dbSNP:769988393
1508 1508 a, g dbSNP:775728252
1510 1510 c, t dbSNP:104895460
1516 1516 c, t dbSNP:1078327
1517 1517 a, g dbSNP:764414933
1518 1518 c, t dbSNP:770712938
1524 1524 c, g dbSNP:762262935
1526 1526 a, g dbSNP:367819045
1545 1545 c, t dbSNP:753323790
1547 1547 a, g dbSNP:104895494
1548 1548 c, t dbSNP:754600020
1552 1552 g, t dbSNP:764999813
1553 1553 c, g dbSNP:752289154
1556 1556 a, c dbSNP:201712814
1558 1558 c, t dbSNP:5743274
1561 1561 c, t dbSNP:746965323
1563 1563 c, t dbSNP:757216877
1574 1574 g, t dbSNP:104895480
1581 1581 a, g dbSNP:781421828
1589 1589 a, g dbSNP:104895478
1592 1592 a, t dbSNP:104895472
1613 1613 -, g dbSNP:754761524
1614 1614 a, g dbSNP:104895434
1614 1614 -, g dbSNP:767278572
1615 1615 g, t dbSNP:769745923
1616 1616 g, t dbSNP:775823953
1618 1618 g, t dbSNP:749451506
1620 1620 a, g, t dbSNP:769034739
1627 1627 a, g dbSNP:762313725
1629 1629 a, g dbSNP:767954756
1631 1631 a, c dbSNP:773580517
1636 1636 a, g dbSNP:759153904
1643 1643 c, t dbSNP:104895473
1645 1645 c, g, t dbSNP:540122692
1650 1650 g, t dbSNP:553575063
1661 1661 a, c, g dbSNP:368316739
1664 1664 a, g dbSNP:757269951
1672 1672 c, t dbSNP:781245628
1673 1673 c, t dbSNP:750320692
1676 1676 a, g dbSNP:756269477
1681 1681 -, c dbSNP:754073471
1682 1682 -, c dbSNP:757534831
1683 1683 c, g, t dbSNP:779950802
1686 1686 c, g dbSNP:104895435
1687 1687 a, c, g, t dbSNP:779264256
1688 1688 a, c, g, t dbSNP:773811702
1692 1692 c, t dbSNP:774822066
1697 1697 c, t dbSNP:762694876
1702 1702 c, t dbSNP:147417132
1706 1706 g, t dbSNP:139663808
1708 1708 c, t dbSNP:145190613
1714 1714 c, t dbSNP:767197520
1716 1716 c, t dbSNP:750399794
1722 1722 g, t dbSNP:755968960
1726 1726 c, t dbSNP:576658764
1727 1727 a, c, g dbSNP:753857915
1730 1730 a, g dbSNP:779174604
1732 1732 c, t dbSNP:545580252
1733 1733 g, t dbSNP:772534917
1739 1739 c, t dbSNP:777949388
1740 1740 c, t dbSNP:747581406
1744 1744 c, t dbSNP:771275838
1745 1745 c, t dbSNP:762186831
1749 1749 a, g dbSNP:369085294
1753 1753 c, g dbSNP:104895471
1755 1755 c, g dbSNP:372877004
1759 1759 a, g dbSNP:374916056
1765 1765 g, t dbSNP:768274192
1773 1773 -, gggcct dbSNP:779106464
1776 1776 c, t dbSNP:35422070
1777 1777 -, ctgggc dbSNP:104895436
1780 1780 a, g dbSNP:369310865
1783 1783 a, g dbSNP:761511477
1787 1787 a, g dbSNP:767379148
1794 1794 c, t dbSNP:111608429
1795 1795 a, g dbSNP:760678831
1798 1798 c, t dbSNP:766284613
1812 1812 a, g dbSNP:753771904
1813 1813 c, t dbSNP:755091130
1822 1822 a, g dbSNP:765280724
1823 1823 c, t dbSNP:752936259
1834 1834 a, c dbSNP:758507559
1838 1838 a, g dbSNP:778204006
1844 1844 c, t dbSNP:747275567
1849 1849 c, g dbSNP:750625667
1857 1857 c, t dbSNP:538438330
1863 1863 a, g, t dbSNP:369719210
1864 1864 c, t dbSNP:104895479
1865 1865 a, g dbSNP:373185098
1866 1866 g, t dbSNP:1861759
1874 1874 g, t dbSNP:777290697
1876 1876 a, g dbSNP:768306879
1878 1878 c, t dbSNP:773962188
1879 1879 a, g dbSNP:148683734
1884 1884 a, g dbSNP:771570437
1892 1892 c, t dbSNP:142077546
1893 1893 a, g dbSNP:104895437
1895 1895 c, t dbSNP:377554134
1896 1896 a, g dbSNP:140312093
1897 1897 a, c dbSNP:759418926
1915 1915 a, g dbSNP:572217630
1918 1918 a, c dbSNP:104895474
1922 1922 c, t dbSNP:765330092
1925 1925 a, g dbSNP:752707000
1931 1931 g, t dbSNP:777798807
1933 1933 g, t dbSNP:764277453
1938 1938 c, t dbSNP:61736932
1939 1939 a, g, t dbSNP:104895438
1940 1940 c, t dbSNP:104895439
1941 1941 a, g dbSNP:756626309
1944 1944 c, t dbSNP:149870902
1951 1951 a, g dbSNP:747674172
1952 1952 c, t dbSNP:771607438
1955 1955 a, t dbSNP:772781164
1988 1988 a, g dbSNP:746653187
2010 2010 a, g dbSNP:770737571
2013 2013 c, t dbSNP:564754539
2019 2019 a, g dbSNP:759472437
2026 2026 a, g dbSNP:199770660
2032 2032 c, t dbSNP:775480458
2033 2033 a, t dbSNP:763005931
2034 2034 c, t dbSNP:764199623
2039 2039 c, g dbSNP:550393501
2042 2042 c, t dbSNP:370615110
2043 2043 a, g dbSNP:762058298
2044 2044 a, t dbSNP:768002172
2049 2049 c, g dbSNP:78848722
2051 2051 c, t dbSNP:367637762
2060 2060 c, t dbSNP:780773726
2061 2061 a, g dbSNP:141355588
2062 2062 a, g dbSNP:757895989
2065 2065 a, g dbSNP:777290315
2074 2074 a, g dbSNP:150236752
2079 2079 c, t dbSNP:370519531
2080 2080 a, g dbSNP:570167996
2084 2084 c, g dbSNP:111400183
2085 2085 a, g dbSNP:769569037
2086 2086 c, g dbSNP:369957746
2092 2092 c, t dbSNP:762922997
2103 2103 c, t dbSNP:374171106
2104 2104 a, g dbSNP:774425599
2107 2107 c, g dbSNP:762143113
2108 2108 c, t dbSNP:5743275
2109 2109 a, g, t dbSNP:199475914
2109 2109 -, g dbSNP:758485603
2112 2112 c, t dbSNP:761162184
2115 2115 a, c, t dbSNP:104895475
2117 2117 g, t dbSNP:754325924
2124 2124 c, g dbSNP:755473279
2129 2129 c, t dbSNP:138958152
2136 2136 c, g dbSNP:374116563
2142 2142 a, g dbSNP:756746121
2143 2143 a, g dbSNP:371339573
2145 2145 a, g dbSNP:745486213
2146 2146 c, t dbSNP:769622387
2151 2151 g, t dbSNP:149002807
2155 2155 c, g, t dbSNP:5743276
2156 2156 a, g dbSNP:114664276
2162 2162 a, c dbSNP:201709367
2166 2166 a, g dbSNP:772247744
2175 2175 a, g dbSNP:773618663
2179 2179 a, g dbSNP:143782684
2180 2180 a, g dbSNP:766687492
2190 2190 a, c dbSNP:776985681
2206 2206 c, t dbSNP:759970720
2209 2209 c, t dbSNP:2066844
2210 2210 a, g dbSNP:139104022
2212 2212 c, g, t dbSNP:5743277
2213 2213 a, g dbSNP:750096604
2215 2215 c, t dbSNP:755721919
2216 2216 a, g dbSNP:779728017
2218 2218 g, t dbSNP:749166558
2219 2219 c, t dbSNP:754726436
2222 2222 a, c, g dbSNP:539297110
2225 2225 c, g dbSNP:772304813
2226 2226 c, t dbSNP:773388062
2227 2227 c, t dbSNP:747241427
2228 2228 a, g dbSNP:35285618
2232 2232 a, g dbSNP:776701942
2242 2242 c, t dbSNP:104895440
2243 2243 a, g dbSNP:104895483
2251 2251 c, t dbSNP:776025574
2252 2252 a, g dbSNP:200035357
2259 2259 c, t dbSNP:368952727
2263 2263 c, t dbSNP:749879341
2265 2265 c, t dbSNP:755568125
2268 2268 c, t dbSNP:766123432
2273 2273 c, t dbSNP:201076024
2274 2274 g, t dbSNP:754856212
2279 2279 c, g dbSNP:5743278
2285 2285 c, t dbSNP:104895489
2286 2286 a, c, g dbSNP:144468550
2294 2294 c, t dbSNP:375016055
2300 2300 a, g dbSNP:369766227
2301 2301 c, t dbSNP:6413461
2302 2302 a, g dbSNP:746055479
2306 2306 a, c dbSNP:770215737
2309 2309 c, t dbSNP:139097081
2315 2315 c, t dbSNP:763452657
2316 2316 c, t dbSNP:769210593
2319 2319 c, g dbSNP:143963486
2323 2323 a, c, g, t dbSNP:766637609
2324 2324 c, t dbSNP:374106394
2325 2325 c, t dbSNP:104895441
2327 2327 a, g dbSNP:759074613
2331 2331 a, c, t dbSNP:765131217
2334 2334 c, g dbSNP:146458676
2335 2335 c, t dbSNP:140876663
2336 2336 a, g dbSNP:751849531
2346 2346 c, t dbSNP:751417475
2347 2347 a, g dbSNP:757403209
2349 2349 a, g dbSNP:781083084
2350 2350 a, g dbSNP:746132151
2352 2352 g, t dbSNP:571979342
2353 2353 c, g dbSNP:780243828
2362 2362 a, c, t dbSNP:749720540
2363 2363 a, g dbSNP:774888496
2367 2367 a, g dbSNP:199475915
2369 2369 c, t dbSNP:61747625
2371 2371 c, t dbSNP:376201089
2372 2372 a, g dbSNP:375713299
2378 2378 c, t dbSNP:104895442
2380 2380 a, g dbSNP:752390709
2383 2383 c, t dbSNP:3813758
2384 2384 a, g dbSNP:763955590
2394 2394 c, g, t dbSNP:564815866
2395 2395 a, g dbSNP:533618528
2403 2403 c, t dbSNP:767638398
2404 2404 c, t dbSNP:750410680
2423 2423 a, g dbSNP:753779656
2435 2435 a, c dbSNP:756184386
2437 2437 a, g dbSNP:104895443
2441 2441 a, g dbSNP:749491290
2445 2445 c, t dbSNP:563698283
2449 2449 c, t dbSNP:372566145
2461 2461 c, g dbSNP:374321834
2469 2469 a, c, t dbSNP:748697332
2470 2470 c, t dbSNP:773758818
2472 2472 c, g dbSNP:745434839
2473 2473 c, t dbSNP:62029861
2474 2474 a, g dbSNP:5743279
2476 2476 c, t dbSNP:104895484
2477 2477 a, g dbSNP:104895464
2481 2481 c, t dbSNP:5743280
2482 2482 a, g dbSNP:104895444
2484 2484 a, g dbSNP:534738790
2491 2491 c, t dbSNP:750344762
2505 2505 c, t dbSNP:756235741
2511 2511 g, t dbSNP:104895495
2519 2519 c, t dbSNP:754094105
2523 2523 c, g, t dbSNP:199475916
2524 2524 a, g dbSNP:748522514
2531 2531 a, g dbSNP:61736931
2539 2539 c, t dbSNP:746692864
2555 2555 a, g dbSNP:758782544
2559 2559 a, c, g dbSNP:539311609
2572 2572 c, t dbSNP:575509512
2573 2573 a, g, t dbSNP:768930237
2574 2574 a, c, t dbSNP:757770726
2575 2575 a, g, t dbSNP:61755272
2576 2576 a, g dbSNP:778481419
2579 2579 a, g dbSNP:747787438
2580 2580 c, g dbSNP:104895485
2582 2582 a, g dbSNP:771795137
2589 2589 a, c dbSNP:772928775
2593 2593 c, t dbSNP:760623178
2594 2594 a, g, t dbSNP:770915641
2598 2598 c, t dbSNP:759649933
2599 2599 a, t dbSNP:765335094
2608 2608 c, t dbSNP:761818945
2611 2611 a, g dbSNP:752881716
2612 2612 c, t dbSNP:763192145
2613 2613 c, t dbSNP:764369783
2617 2617 c, t dbSNP:751914672
2620 2620 g, t dbSNP:757680896
2621 2621 c, t dbSNP:781781095
2629 2629 c, t dbSNP:146313066
2630 2630 a, g dbSNP:754471017
2631 2631 c, t dbSNP:778447050
2632 2632 a, g dbSNP:104895445
2636 2636 -, aattgcag dbSNP:776993718
2646 2646 a, g dbSNP:771701417
2651 2651 c, g, t dbSNP:104895486
2655 2655 a, g dbSNP:768823670
2658 2658 c, t dbSNP:774738662
2660 2660 a, g dbSNP:104895467
2662 2662 a, t dbSNP:767998441
2663 2663 a, g dbSNP:104895446
2676 2676 c, t dbSNP:144083291
2677 2677 a, g dbSNP:760938311
2681 2681 a, g dbSNP:766980553
2683 2683 a, g dbSNP:754270929
2685 2685 a, g dbSNP:757978263
2687 2687 a, g dbSNP:763542516
2692 2692 a, g dbSNP:104895447
2694 2694 a, g dbSNP:756832040
2695 2695 a, g dbSNP:780975637
2704 2704 c, t dbSNP:745733405
2709 2709 a, g dbSNP:755857709
2710 2710 g, t dbSNP:780077950
2711 2711 g, t dbSNP:749157324
2714 2714 a, g dbSNP:768889214
2720 2720 a, g dbSNP:201806207
2724 2724 c, t dbSNP:104895448
2731 2731 c, t dbSNP:748396173
2744 2744 a, g dbSNP:374506720
2751 2751 c, t dbSNP:766014518
2752 2752 a, c dbSNP:146276010
2753 2753 c, t dbSNP:776394582
2758 2758 c, g dbSNP:759456303
2760 2760 c, t dbSNP:765080035
2761 2761 g, t dbSNP:376366287
2762 2762 a, c, t dbSNP:565200911
2772 2772 a, c dbSNP:764244331
2775 2775 a, g dbSNP:751646683
2776 2776 c, g, t dbSNP:371163141
2778 2778 a, g dbSNP:746066586
2781 2781 c, g, t dbSNP:375012324
2782 2782 a, g, t dbSNP:201884393
2791 2791 c, t dbSNP:769101191
2792 2792 a, g dbSNP:201831159
2795 2795 g, t dbSNP:746542083
2801 2801 c, t dbSNP:770454777
2804 2804 c, t dbSNP:199552944
2805 2805 c, t dbSNP:759227592
2809 2809 a, c dbSNP:201035873
2811 2811 c, g, t dbSNP:200428513
2817 2817 a, g dbSNP:142559533
2822 2822 a, t dbSNP:750560134
2823 2823 c, t dbSNP:58586167
2824 2824 c, t dbSNP:104895490
2827 2827 c, g, t dbSNP:2066845
2828 2828 c, g dbSNP:142376491
2829 2829 c, t dbSNP:375346218
2840 2840 c, g dbSNP:779300567
2844 2844 c, t dbSNP:104895451
2845 2845 a, g dbSNP:758913334
2851 2851 c, g dbSNP:778408661
2854 2854 c, t dbSNP:553794692
2857 2857 a, g dbSNP:769395722
2858 2858 a, c dbSNP:104895452
2876 2876 a, g dbSNP:104895453
2879 2879 a, g dbSNP:545734771
2880 2880 a, t dbSNP:774129547
2882 2882 a, c dbSNP:761500764
2888 2888 a, g dbSNP:772064514
2895 2895 a, g dbSNP:139886679
2905 2905 c, g dbSNP:771833402
2907 2907 a, g dbSNP:149691662
2908 2908 a, g dbSNP:746911440
2912 2912 a, g dbSNP:542558237
2918 2918 a, g dbSNP:770924038
2920 2920 a, g dbSNP:201781416
2922 2922 c, t dbSNP:104895454
2925 2925 c, t dbSNP:372443143
2933 2933 a, g dbSNP:775540348
2934 2934 g, t dbSNP:763457215
2935 2935 a, g dbSNP:764503364
2936 2936 c, g dbSNP:752141641
2945 2945 g, t dbSNP:757770809
2946 2946 a, g dbSNP:765820451
2951 2951 g, t dbSNP:753454914
2953 2953 a, c, g dbSNP:527892258
2956 2956 c, g dbSNP:768561004
2962 2962 a, g dbSNP:375705174
2967 2967 c, t dbSNP:758223679
2968 2968 a, g dbSNP:5743291
2978 2978 a, g dbSNP:746965976
2999 2999 a, g dbSNP:752353565
3000 3000 c, t dbSNP:757991023
3002 3002 a, g dbSNP:189453919
3010 3010 a, g dbSNP:528345270
3014 3014 a, g dbSNP:371389581
3019 3019 a, g dbSNP:104895455
3021 3021 a, g dbSNP:756968128
3026 3026 c, t dbSNP:200463498
3030 3030 c, t dbSNP:104895463
3031 3031 a, g dbSNP:148561632
3032 3032 c, t dbSNP:779522908
3038 3038 a, g dbSNP:104895457
3045 3045 a, g dbSNP:749533773
3048 3048 a, g dbSNP:769056708
3082 3082 a, g dbSNP:142904241
3083 3083 a, c, g dbSNP:147750423
3088 3088 a, g dbSNP:768835583
3099 3099 a, c dbSNP:779300338
3112 3112 c, t dbSNP:748277158
3115 3115 c, g dbSNP:772487940
3117 3117 a, g dbSNP:773388366
3120 3120 c, g dbSNP:111403064
3121 3121 -, c dbSNP:2066847
3121 3121 c, g dbSNP:199883290
3122 3122 -, c dbSNP:540973741
3124 3124 -, c dbSNP:5743293
3124 3124 c, t dbSNP:761083670
3125 3125 c, t dbSNP:112436597
3130 3130 a, g dbSNP:771490210
3134 3134 a, g dbSNP:367905706
3138 3138 c, t dbSNP:574818285
3141 3141 a, c dbSNP:762502185
3151 3151 a, g dbSNP:574467124
3157 3157 c, t dbSNP:146435555
3158 3158 g, t dbSNP:771267307
3160 3160 c, g, t dbSNP:104895491
3161 3161 a, g, t dbSNP:5743295
3162 3162 a, c dbSNP:761373812
3165 3165 a, g dbSNP:374689495
3167 3167 a, g dbSNP:772890413
3168 3168 c, g dbSNP:760568789
3180 3180 a, g dbSNP:766235880
3188 3188 c, t dbSNP:752941888
3198 3198 c, t dbSNP:201214915
3199 3199 a, g dbSNP:147874812
3201 3201 a, c dbSNP:765204397
3205 3205 a, c dbSNP:752783717
3211 3211 a, g dbSNP:758469287
3216 3216 a, g dbSNP:777902344
3220 3220 c, t dbSNP:372787414
3223 3223 a, c dbSNP:757653432
3234 3234 -, c dbSNP:765494080
3236 3236 a, c, g dbSNP:199475923
3237 3237 a, g dbSNP:104895459
3239 3239 a, g dbSNP:770345296
3242 3242 a, g dbSNP:776061012
3243 3243 a, t dbSNP:747651929
3246 3246 c, t dbSNP:771562333
3247 3247 c, t dbSNP:777907851
3248 3248 a, c, g dbSNP:5743296
3249 3249 a, t dbSNP:776623410
3252 3252 -, ca dbSNP:750598682
3253 3253 -, agtt dbSNP:758436028
3254 3254 -, gttt dbSNP:780112629
3270 3270 g, t dbSNP:759397246
3272 3272 -, tg dbSNP:752017238
3273 3273 a, g dbSNP:765123802
3279 3279 g, t dbSNP:752653511
3284 3284 c, t dbSNP:112011764
3308 3308 c, t dbSNP:199475924
3317 3317 c, t dbSNP:184545855
3360 3360 -, g dbSNP:35980453
3370 3370 a, g dbSNP:527525652
3377 3377 a, c dbSNP:768016648
3411 3411 c, t dbSNP:547264433
3420 3420 c, t dbSNP:199475925
3423 3423 a, g dbSNP:757428844
3442 3442 a, c, t dbSNP:199475926
3466 3466 c, t dbSNP:750856649
3487 3487 a, t dbSNP:372022771
3492 3492 c, t dbSNP:547767004
3507 3507 c, t dbSNP:140956945
3559 3559 c, t dbSNP:746980077
3590 3590 a, g dbSNP:533083386
3594 3594 a, g dbSNP:549869777
3601 3601 c, t dbSNP:768545710
3603 3603 a, g dbSNP:563749168
3610 3610 c, t dbSNP:535063121
3625 3625 a, c dbSNP:3135499
3640 3640 a, g dbSNP:779375339
3660 3660 a, g dbSNP:566233506
3685 3685 c, t dbSNP:535257127
3690 3690 a, c dbSNP:562972090
3694 3694 a, t dbSNP:188988267
3698 3698 c, t dbSNP:770461687
3715 3715 c, t dbSNP:748885287
3716 3716 a, g dbSNP:577786590
3749 3749 c, t dbSNP:5743297
3815 3815 c, t dbSNP:556994965
3848 3848 a, g dbSNP:116213743
3853 3853 a, g dbSNP:767910906
3915 3915 c, t dbSNP:542650591
3916 3916 a, g dbSNP:775789402
3928 3928 a, g dbSNP:761109800
3944 3944 c, t dbSNP:764167335
3966 3966 c, t dbSNP:562052651
3968 3968 g, t dbSNP:5743298
3974 3974 a, c dbSNP:145051635
3979 3979 a, g dbSNP:541292537
3986 3986 a, c dbSNP:564290737
3990 3990 g, t dbSNP:546314209
4010 4010 a, c dbSNP:564389186
4027 4027 c, t dbSNP:114899313
4039 4039 c, t dbSNP:549908533
4079 4079 c, t dbSNP:60727336
4101 4101 c, t dbSNP:373812846
4105 4105 a, c dbSNP:140643942
4166 4166 a, c dbSNP:548686827
4218 4218 c, t dbSNP:192842874
4241 4241 a, g dbSNP:549273021
4245 4245 c, t dbSNP:370557520
4248 4248 a, g dbSNP:778575221
4251 4251 c, t dbSNP:5743299
4252 4252 a, g dbSNP:113884530
4274 4274 c, t dbSNP:145816297
4358 4358 a, g dbSNP:138313319
4384 4384 a, g dbSNP:3135500
4407 4407 a, g dbSNP:372288537
4429 4429 a, t dbSNP:751525993
4433 4433 c, t dbSNP:573783671

Target ORF information:

RefSeq Version NM_022162
Organism Homo sapiens (human)
Definition Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu27928D
Sequence Information ORF Nucleotide Sequence (Length: 3042bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nucleotide-binding oligomerization domain-containing protein 2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010498.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530424183. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)109..366(+)
Misc Feature(2)409..651(+)
Misc Feature(3)886..1398(+)
Misc Feature(4)2308..3105(+)
Misc Feature(5)2308..3078(+)
Misc Feature(6)2317..3060(+)
Misc Feature(7)2467..2541(+)
Misc Feature(8)2542..2613(+)
Misc Feature(9)2614..2709(+)
Misc Feature(10)2710..2793(+)
Misc Feature(11)2794..2865(+)
Misc Feature(12)2878..2961(+)
Misc Feature(13)2962..3027(+)
Misc Feature(14)3028..3081(+)
Position Chain Variation Link
52 52 c, g dbSNP:570075610
53 53 c, g dbSNP:369410275
63 63 c, g dbSNP:370316846
68 68 c, t dbSNP:373297050
83 83 a, g dbSNP:567793250
84 84 c, t dbSNP:371044393
91 91 a, g dbSNP:372321755
98 98 c, t dbSNP:768775316
99 99 a, g dbSNP:774491311
107 107 c, g dbSNP:762072566
122 122 g, t dbSNP:104895487
128 128 a, c dbSNP:750745611
130 130 a, c dbSNP:761191478
135 135 c, t dbSNP:766815592
136 136 a, g dbSNP:200089552
140 140 c, t dbSNP:757914381
142 142 c, t dbSNP:777325175
143 143 c, t dbSNP:751223046
149 149 c, t dbSNP:201586544
152 152 c, g dbSNP:758548184
158 158 c, t dbSNP:781166995
160 160 g, t dbSNP:745597071
168 168 c, t dbSNP:769855133
169 169 a, g dbSNP:780204985
173 173 a, g dbSNP:749222396
174 174 c, t dbSNP:768665692
177 177 c, g dbSNP:774456364
190 190 c, g dbSNP:761972851
195 195 c, g, t dbSNP:367895771
208 208 c, t dbSNP:760962549
209 209 c, g dbSNP:146149433
222 222 c, t dbSNP:754402504
223 223 a, g dbSNP:760069458
224 224 a, g dbSNP:138881230
227 227 c, g dbSNP:751044848
233 233 a, c dbSNP:756886427
235 235 c, t dbSNP:780921204
239 239 c, t dbSNP:750092643
242 242 c, g dbSNP:756028666
244 244 c, t dbSNP:779970018
247 247 a, c, g dbSNP:370734707
250 250 c, g dbSNP:34936594
265 265 a, g dbSNP:748200640
266 266 a, g dbSNP:772287143
268 268 c, t dbSNP:374128251
278 278 a, t dbSNP:747221457
279 279 c, t dbSNP:771336423
282 282 c, t dbSNP:146923251
283 283 a, g, t dbSNP:187264529
287 287 a, g dbSNP:773733975
288 288 a, g dbSNP:761449474
296 296 a, g, t dbSNP:767119064
301 301 c, t dbSNP:755795167
308 308 g, t dbSNP:367756419
310 310 c, g dbSNP:753619374
312 312 a, c, g dbSNP:138041175
321 321 c, t dbSNP:778843858
322 322 a, g dbSNP:113706344
323 323 c, t dbSNP:202052365
324 324 a, g, t dbSNP:104895419
333 333 a, g dbSNP:747274659
337 337 a, g dbSNP:571102620
338 338 c, g, t dbSNP:35095295
341 341 a, g dbSNP:746189550
345 345 a, c, t dbSNP:770046355
346 346 a, g dbSNP:104895468
347 347 a, c dbSNP:767173948
348 348 c, t dbSNP:138889062
358 358 c, t dbSNP:760423983
363 363 a, g dbSNP:766071199
366 366 g, t dbSNP:672601267
381 381 c, t dbSNP:753579507
383 383 c, t dbSNP:149390911
384 384 c, t dbSNP:764929082
385 385 c, g dbSNP:781448444
386 386 a, g dbSNP:758303366
389 389 c, t dbSNP:146395646
390 390 a, g dbSNP:535978538
398 398 c, g dbSNP:200160605
403 403 c, g dbSNP:757487598
404 404 a, g dbSNP:781540619
412 412 a, c dbSNP:572556762
413 413 a, g dbSNP:770240116
421 421 a, c, t dbSNP:184502667
422 422 a, g dbSNP:104895456
422 422 -, g dbSNP:776176047
424 424 c, t dbSNP:749841667
427 427 a, g dbSNP:34684955
432 432 c, t dbSNP:772861513
436 436 a, g dbSNP:760196682
441 441 a, g dbSNP:770343724
449 449 a, g dbSNP:776403451
466 466 -, a dbSNP:761486886
469 469 a, g dbSNP:146054564
472 472 c, t dbSNP:765122435
473 473 a, t dbSNP:148753593
478 478 c, t dbSNP:104895420
484 484 c, t dbSNP:562557464
485 485 a, g dbSNP:150996156
488 488 a, g dbSNP:751647609
491 491 c, t dbSNP:757381363
492 492 c, t dbSNP:565504727
493 493 gcatgggagcggggtttca, tcagccagtatgaatgtgatgaaatcaggt dbSNP:45575333
493 493 a, g dbSNP:139571975
494 494 c, t dbSNP:756247553
495 495 a, c dbSNP:780488493
507 507 a, t dbSNP:749605438
508 508 c, g, t dbSNP:769289791
526 526 c, t dbSNP:748652020
527 527 c, t dbSNP:770524298
528 528 a, g dbSNP:77153279
539 539 a, c, t dbSNP:144368009
540 540 a, g dbSNP:775281342
543 543 a, c, g dbSNP:2067085
551 551 a, c dbSNP:141414002
553 553 a, g dbSNP:748912559
561 561 g, t dbSNP:768476112
573 573 c, g dbSNP:774089880
575 575 c, t dbSNP:61755182
576 576 a, g dbSNP:144887729
579 579 a, g dbSNP:555550682
584 584 c, t dbSNP:149071116
585 585 a, g dbSNP:369122423
599 599 a, c, g dbSNP:373838219
600 600 c, t dbSNP:765729513
606 606 c, t dbSNP:201115206
608 608 c, t dbSNP:758959985
609 609 a, g dbSNP:778078737
615 615 c, t dbSNP:747534110
616 616 a, g dbSNP:369764782
625 625 c, t dbSNP:755641532
630 630 a, g, t dbSNP:377752699
633 633 c, t dbSNP:768259661
634 634 c, t dbSNP:143080077
635 635 c, t dbSNP:753744335
640 640 a, g dbSNP:771887760
642 642 c, t dbSNP:5743269
643 643 c, t dbSNP:760629717
663 663 a, g dbSNP:778455499
680 680 c, t dbSNP:375336137
681 681 c, t dbSNP:758019098
690 690 a, g dbSNP:777458605
695 695 c, t dbSNP:529640892
696 696 a, g dbSNP:771003092
706 706 c, t dbSNP:781333877
707 707 a, c dbSNP:369098290
712 712 c, t dbSNP:104895422
713 713 a, g, t dbSNP:201790577
723 723 c, t dbSNP:768859303
728 728 a, g dbSNP:202190367
734 734 a, g dbSNP:762225932
743 743 c, t dbSNP:148516118
744 744 a, g, t dbSNP:773749264
748 748 c, t dbSNP:764675751
749 749 g, t dbSNP:752210177
752 752 g, t dbSNP:104895423
753 753 a, g dbSNP:145694647
754 754 a, g dbSNP:763743511
755 755 a, g dbSNP:117836686
760 760 a, g dbSNP:758462936
761 761 c, t dbSNP:757182049
768 768 a, g, t dbSNP:781099046
787 787 -, tgggcagatg dbSNP:764849041
789 789 c, g dbSNP:528290590
796 796 a, g dbSNP:756042160
804 804 -, g dbSNP:772914954
808 808 a, g dbSNP:780005934
811 811 a, c, t dbSNP:2066842
815 815 c, t dbSNP:774703072
816 816 a, c, g dbSNP:369766454
822 822 a, g dbSNP:773516123
825 825 c, t dbSNP:35090774
832 832 a, g dbSNP:766841285
834 834 c, t dbSNP:774873537
835 835 c, g dbSNP:762579270
837 837 a, g dbSNP:763504952
845 845 a, c dbSNP:200744970
848 848 a, g dbSNP:146074127
850 850 c, t dbSNP:756943416
855 855 c, t dbSNP:767456023
859 859 a, g dbSNP:369740939
868 868 c, t dbSNP:560242309
875 875 a, g dbSNP:5743271
879 879 c, t dbSNP:749180535
880 880 a, g dbSNP:104895424
881 881 a, g dbSNP:755127265
882 882 c, t dbSNP:778942858
884 884 c, t dbSNP:149338478
890 890 c, g dbSNP:104895425
892 892 a, g dbSNP:778114969
897 897 g, t dbSNP:375002962
903 903 a, g dbSNP:747340360
905 905 a, g dbSNP:771184127
911 911 c, t dbSNP:104895426
912 912 a, g dbSNP:531906536
924 924 a, g dbSNP:768258168
929 929 c, t dbSNP:191901394
930 930 a, g dbSNP:376601025
935 935 c, t dbSNP:767225117
936 936 a, g dbSNP:144738371
937 937 c, t dbSNP:760588667
938 938 a, g dbSNP:148526508
939 939 a, g dbSNP:753862753
940 940 c, t dbSNP:104895427
941 941 a, g dbSNP:778995814
959 959 c, t dbSNP:199975570
963 963 a, g dbSNP:199951979
964 964 g, t dbSNP:758631940
967 967 -, c dbSNP:762547903
968 968 a, g dbSNP:201591164
971 971 a, c dbSNP:747190206
972 972 c, g dbSNP:771364403
988 988 -, tt dbSNP:762053317
997 997 c, t dbSNP:773132030
999 999 a, g dbSNP:746405870
1009 1009 c, t dbSNP:104895462
1010 1010 a, g dbSNP:104895461
1014 1014 c, g dbSNP:7498256
1027 1027 a, g dbSNP:770361381
1028 1028 c, g dbSNP:774016655
1037 1037 c, g, t dbSNP:369732140
1038 1038 c, g dbSNP:144439629
1040 1040 c, t dbSNP:199475912
1042 1042 g, t dbSNP:760224068
1043 1043 c, t dbSNP:766219817
1045 1045 c, t dbSNP:753537879
1046 1046 a, c, g dbSNP:759520552
1051 1051 c, g dbSNP:104895428
1054 1054 c, g dbSNP:752615209
1056 1056 a, c, t dbSNP:758539057
1062 1062 c, g dbSNP:554991667
1064 1064 a, g dbSNP:5743272
1070 1070 g, t dbSNP:751854684
1074 1074 a, g dbSNP:104895488
1075 1075 c, t dbSNP:757368076
1076 1076 c, t dbSNP:201107567
1079 1079 a, c dbSNP:104895469
1080 1080 a, t dbSNP:756538468
1086 1086 c, t dbSNP:780775868
1090 1090 c, g dbSNP:556617095
1093 1093 -, g dbSNP:766265864
1096 1096 a, t dbSNP:104895470
1097 1097 a, t dbSNP:772548332
1102 1102 c, t dbSNP:746706579
1104 1104 a, g dbSNP:770423311
1111 1111 c, t dbSNP:776498009
1116 1116 a, c dbSNP:759382357
1117 1117 c, t dbSNP:199858111
1120 1120 c, g dbSNP:775443143
1126 1126 c, t dbSNP:145293873
1127 1127 c, g dbSNP:764176270
1130 1130 c, t dbSNP:751550117
1131 1131 c, t dbSNP:757517796
1137 1137 a, t dbSNP:767694243
1140 1140 c, g, t dbSNP:750655947
1141 1141 g, t dbSNP:780544950
1143 1143 c, t dbSNP:527305056
1155 1155 c, g, t dbSNP:104895476
1156 1156 a, g, t dbSNP:104895477
1157 1157 a, g dbSNP:104895493
1160 1160 a, t dbSNP:777343284
1173 1173 c, t dbSNP:746445875
1175 1175 c, t dbSNP:528926956
1176 1176 a, g dbSNP:776211261
1177 1177 a, g dbSNP:147283871
1178 1178 a, t dbSNP:769622495
1180 1180 c, t dbSNP:104895481
1181 1181 a, g dbSNP:554887705
1183 1183 a, g dbSNP:763868196
1186 1186 c, t dbSNP:140716236
1187 1187 a, g dbSNP:140918872
1191 1191 c, t dbSNP:767605899
1197 1197 c, t dbSNP:750664442
1199 1199 c, t dbSNP:150078153
1200 1200 a, g dbSNP:766883774
1203 1203 c, t dbSNP:5743273
1204 1204 a, g dbSNP:755554858
1208 1208 c, t dbSNP:779346494
1214 1214 c, t dbSNP:753241960
1219 1219 c, t dbSNP:756755875
1221 1221 c, g dbSNP:367630707
1228 1228 c, t dbSNP:760998620
1250 1250 a, g dbSNP:104895429
1252 1252 c, g dbSNP:745540141
1255 1255 c, g dbSNP:766612118
1267 1267 c, t dbSNP:367883043
1268 1268 a, g dbSNP:199475913
1272 1272 a, g dbSNP:749142500
1274 1274 g, t dbSNP:768497619
1276 1276 a, g dbSNP:774197781
1278 1278 g, t dbSNP:77966199
1285 1285 c, t dbSNP:545466982
1286 1286 a, g dbSNP:562225614
1288 1288 c, t dbSNP:760982375
1289 1289 c, t dbSNP:766651775
1290 1290 a, c, g dbSNP:104895430
1293 1293 c, t dbSNP:547826765
1294 1294 a, g dbSNP:144827713
1301 1301 c, t dbSNP:104895431
1302 1302 a, g, t dbSNP:145834617
1304 1304 c, t dbSNP:2076754
1305 1305 a, g dbSNP:779751017
1308 1308 c, t dbSNP:748910444
1312 1312 a, g dbSNP:768389547
1316 1316 a, t dbSNP:778723375
1317 1317 a, g dbSNP:748068611
1320 1320 c, t dbSNP:771979324
1323 1323 a, c dbSNP:773440974
1324 1324 c, t dbSNP:375201229
1325 1325 a, g dbSNP:143110172
1326 1326 c, t dbSNP:777034157
1329 1329 c, t dbSNP:143395754
1330 1330 a, g dbSNP:104895432
1335 1335 c, t dbSNP:151315883
1348 1348 c, t dbSNP:763372171
1350 1350 c, t dbSNP:370728357
1358 1358 a, t dbSNP:764525298
1365 1365 c, t dbSNP:186719861
1366 1366 a, g dbSNP:556728426
1375 1375 c, t dbSNP:104895433
1384 1384 c, t dbSNP:765857594
1385 1385 a, g dbSNP:753458507
1386 1386 a, c, t dbSNP:2066843
1395 1395 a, g dbSNP:747921876
1396 1396 c, g dbSNP:104895482
1398 1398 c, t dbSNP:200656015
1399 1399 a, g, t dbSNP:104895492
1401 1401 c, g dbSNP:771183089
1406 1406 c, t dbSNP:776802746
1407 1407 a, g dbSNP:746104214
1411 1411 a, c, t dbSNP:769988393
1412 1412 a, g dbSNP:775728252
1414 1414 c, t dbSNP:104895460
1420 1420 c, t dbSNP:1078327
1421 1421 a, g dbSNP:764414933
1422 1422 c, t dbSNP:770712938
1428 1428 c, g dbSNP:762262935
1430 1430 a, g dbSNP:367819045
1449 1449 c, t dbSNP:753323790
1451 1451 a, g dbSNP:104895494
1452 1452 c, t dbSNP:754600020
1456 1456 g, t dbSNP:764999813
1457 1457 c, g dbSNP:752289154
1460 1460 a, c dbSNP:201712814
1462 1462 c, t dbSNP:5743274
1465 1465 c, t dbSNP:746965323
1467 1467 c, t dbSNP:757216877
1478 1478 g, t dbSNP:104895480
1485 1485 a, g dbSNP:781421828
1493 1493 a, g dbSNP:104895478
1496 1496 a, t dbSNP:104895472
1517 1517 -, g dbSNP:754761524
1518 1518 a, g dbSNP:104895434
1518 1518 -, g dbSNP:767278572
1519 1519 g, t dbSNP:769745923
1520 1520 g, t dbSNP:775823953
1522 1522 g, t dbSNP:749451506
1524 1524 a, g, t dbSNP:769034739
1531 1531 a, g dbSNP:762313725
1533 1533 a, g dbSNP:767954756
1535 1535 a, c dbSNP:773580517
1540 1540 a, g dbSNP:759153904
1547 1547 c, t dbSNP:104895473
1549 1549 c, g, t dbSNP:540122692
1554 1554 g, t dbSNP:553575063
1565 1565 a, c, g dbSNP:368316739
1568 1568 a, g dbSNP:757269951
1576 1576 c, t dbSNP:781245628
1577 1577 c, t dbSNP:750320692
1580 1580 a, g dbSNP:756269477
1585 1585 -, c dbSNP:754073471
1586 1586 -, c dbSNP:757534831
1587 1587 c, g, t dbSNP:779950802
1590 1590 c, g dbSNP:104895435
1591 1591 a, c, g, t dbSNP:779264256
1592 1592 a, c, g, t dbSNP:773811702
1596 1596 c, t dbSNP:774822066
1601 1601 c, t dbSNP:762694876
1606 1606 c, t dbSNP:147417132
1610 1610 g, t dbSNP:139663808
1612 1612 c, t dbSNP:145190613
1618 1618 c, t dbSNP:767197520
1620 1620 c, t dbSNP:750399794
1626 1626 g, t dbSNP:755968960
1630 1630 c, t dbSNP:576658764
1631 1631 a, c, g dbSNP:753857915
1634 1634 a, g dbSNP:779174604
1636 1636 c, t dbSNP:545580252
1637 1637 g, t dbSNP:772534917
1643 1643 c, t dbSNP:777949388
1644 1644 c, t dbSNP:747581406
1648 1648 c, t dbSNP:771275838
1649 1649 c, t dbSNP:762186831
1653 1653 a, g dbSNP:369085294
1657 1657 c, g dbSNP:104895471
1659 1659 c, g dbSNP:372877004
1663 1663 a, g dbSNP:374916056
1669 1669 g, t dbSNP:768274192
1677 1677 -, gggcct dbSNP:779106464
1680 1680 c, t dbSNP:35422070
1681 1681 -, ctgggc dbSNP:104895436
1684 1684 a, g dbSNP:369310865
1687 1687 a, g dbSNP:761511477
1691 1691 a, g dbSNP:767379148
1698 1698 c, t dbSNP:111608429
1699 1699 a, g dbSNP:760678831
1702 1702 c, t dbSNP:766284613
1716 1716 a, g dbSNP:753771904
1717 1717 c, t dbSNP:755091130
1726 1726 a, g dbSNP:765280724
1727 1727 c, t dbSNP:752936259
1738 1738 a, c dbSNP:758507559
1742 1742 a, g dbSNP:778204006
1748 1748 c, t dbSNP:747275567
1753 1753 c, g dbSNP:750625667
1761 1761 c, t dbSNP:538438330
1767 1767 a, g, t dbSNP:369719210
1768 1768 c, t dbSNP:104895479
1769 1769 a, g dbSNP:373185098
1770 1770 g, t dbSNP:1861759
1778 1778 g, t dbSNP:777290697
1780 1780 a, g dbSNP:768306879
1782 1782 c, t dbSNP:773962188
1783 1783 a, g dbSNP:148683734
1788 1788 a, g dbSNP:771570437
1796 1796 c, t dbSNP:142077546
1797 1797 a, g dbSNP:104895437
1799 1799 c, t dbSNP:377554134
1800 1800 a, g dbSNP:140312093
1801 1801 a, c dbSNP:759418926
1819 1819 a, g dbSNP:572217630
1822 1822 a, c dbSNP:104895474
1826 1826 c, t dbSNP:765330092
1829 1829 a, g dbSNP:752707000
1835 1835 g, t dbSNP:777798807
1837 1837 g, t dbSNP:764277453
1842 1842 c, t dbSNP:61736932
1843 1843 a, g, t dbSNP:104895438
1844 1844 c, t dbSNP:104895439
1845 1845 a, g dbSNP:756626309
1848 1848 c, t dbSNP:149870902
1855 1855 a, g dbSNP:747674172
1856 1856 c, t dbSNP:771607438
1859 1859 a, t dbSNP:772781164
1892 1892 a, g dbSNP:746653187
1914 1914 a, g dbSNP:770737571
1917 1917 c, t dbSNP:564754539
1923 1923 a, g dbSNP:759472437
1930 1930 a, g dbSNP:199770660
1936 1936 c, t dbSNP:775480458
1937 1937 a, t dbSNP:763005931
1938 1938 c, t dbSNP:764199623
1943 1943 c, g dbSNP:550393501
1946 1946 c, t dbSNP:370615110
1947 1947 a, g dbSNP:762058298
1948 1948 a, t dbSNP:768002172
1953 1953 c, g dbSNP:78848722
1955 1955 c, t dbSNP:367637762
1964 1964 c, t dbSNP:780773726
1965 1965 a, g dbSNP:141355588
1966 1966 a, g dbSNP:757895989
1969 1969 a, g dbSNP:777290315
1978 1978 a, g dbSNP:150236752
1983 1983 c, t dbSNP:370519531
1984 1984 a, g dbSNP:570167996
1988 1988 c, g dbSNP:111400183
1989 1989 a, g dbSNP:769569037
1990 1990 c, g dbSNP:369957746
1996 1996 c, t dbSNP:762922997
2007 2007 c, t dbSNP:374171106
2008 2008 a, g dbSNP:774425599
2011 2011 c, g dbSNP:762143113
2012 2012 c, t dbSNP:5743275
2013 2013 a, g, t dbSNP:199475914
2013 2013 -, g dbSNP:758485603
2016 2016 c, t dbSNP:761162184
2019 2019 a, c, t dbSNP:104895475
2021 2021 g, t dbSNP:754325924
2028 2028 c, g dbSNP:755473279
2033 2033 c, t dbSNP:138958152
2040 2040 c, g dbSNP:374116563
2046 2046 a, g dbSNP:756746121
2047 2047 a, g dbSNP:371339573
2049 2049 a, g dbSNP:745486213
2050 2050 c, t dbSNP:769622387
2055 2055 g, t dbSNP:149002807
2059 2059 c, g, t dbSNP:5743276
2060 2060 a, g dbSNP:114664276
2066 2066 a, c dbSNP:201709367
2070 2070 a, g dbSNP:772247744
2079 2079 a, g dbSNP:773618663
2083 2083 a, g dbSNP:143782684
2084 2084 a, g dbSNP:766687492
2094 2094 a, c dbSNP:776985681
2110 2110 c, t dbSNP:759970720
2113 2113 c, t dbSNP:2066844
2114 2114 a, g dbSNP:139104022
2116 2116 c, g, t dbSNP:5743277
2117 2117 a, g dbSNP:750096604
2119 2119 c, t dbSNP:755721919
2120 2120 a, g dbSNP:779728017
2122 2122 g, t dbSNP:749166558
2123 2123 c, t dbSNP:754726436
2126 2126 a, c, g dbSNP:539297110
2129 2129 c, g dbSNP:772304813
2130 2130 c, t dbSNP:773388062
2131 2131 c, t dbSNP:747241427
2132 2132 a, g dbSNP:35285618
2136 2136 a, g dbSNP:776701942
2146 2146 c, t dbSNP:104895440
2147 2147 a, g dbSNP:104895483
2155 2155 c, t dbSNP:776025574
2156 2156 a, g dbSNP:200035357
2163 2163 c, t dbSNP:368952727
2167 2167 c, t dbSNP:749879341
2169 2169 c, t dbSNP:755568125
2172 2172 c, t dbSNP:766123432
2177 2177 c, t dbSNP:201076024
2178 2178 g, t dbSNP:754856212
2183 2183 c, g dbSNP:5743278
2189 2189 c, t dbSNP:104895489
2190 2190 a, c, g dbSNP:144468550
2198 2198 c, t dbSNP:375016055
2204 2204 a, g dbSNP:369766227
2205 2205 c, t dbSNP:6413461
2206 2206 a, g dbSNP:746055479
2210 2210 a, c dbSNP:770215737
2213 2213 c, t dbSNP:139097081
2219 2219 c, t dbSNP:763452657
2220 2220 c, t dbSNP:769210593
2223 2223 c, g dbSNP:143963486
2227 2227 a, c, g, t dbSNP:766637609
2228 2228 c, t dbSNP:374106394
2229 2229 c, t dbSNP:104895441
2231 2231 a, g dbSNP:759074613
2235 2235 a, c, t dbSNP:765131217
2238 2238 c, g dbSNP:146458676
2239 2239 c, t dbSNP:140876663
2240 2240 a, g dbSNP:751849531
2250 2250 c, t dbSNP:751417475
2251 2251 a, g dbSNP:757403209
2253 2253 a, g dbSNP:781083084
2254 2254 a, g dbSNP:746132151
2256 2256 g, t dbSNP:571979342
2257 2257 c, g dbSNP:780243828
2266 2266 a, c, t dbSNP:749720540
2267 2267 a, g dbSNP:774888496
2271 2271 a, g dbSNP:199475915
2273 2273 c, t dbSNP:61747625
2275 2275 c, t dbSNP:376201089
2276 2276 a, g dbSNP:375713299
2282 2282 c, t dbSNP:104895442
2284 2284 a, g dbSNP:752390709
2287 2287 c, t dbSNP:3813758
2288 2288 a, g dbSNP:763955590
2298 2298 c, g, t dbSNP:564815866
2299 2299 a, g dbSNP:533618528
2307 2307 c, t dbSNP:767638398
2308 2308 c, t dbSNP:750410680
2327 2327 a, g dbSNP:753779656
2339 2339 a, c dbSNP:756184386
2341 2341 a, g dbSNP:104895443
2345 2345 a, g dbSNP:749491290
2349 2349 c, t dbSNP:563698283
2353 2353 c, t dbSNP:372566145
2365 2365 c, g dbSNP:374321834
2373 2373 a, c, t dbSNP:748697332
2374 2374 c, t dbSNP:773758818
2376 2376 c, g dbSNP:745434839
2377 2377 c, t dbSNP:62029861
2378 2378 a, g dbSNP:5743279
2380 2380 c, t dbSNP:104895484
2381 2381 a, g dbSNP:104895464
2385 2385 c, t dbSNP:5743280
2386 2386 a, g dbSNP:104895444
2388 2388 a, g dbSNP:534738790
2395 2395 c, t dbSNP:750344762
2409 2409 c, t dbSNP:756235741
2415 2415 g, t dbSNP:104895495
2423 2423 c, t dbSNP:754094105
2427 2427 c, g, t dbSNP:199475916
2428 2428 a, g dbSNP:748522514
2435 2435 a, g dbSNP:61736931
2443 2443 c, t dbSNP:746692864
2459 2459 a, g dbSNP:758782544
2463 2463 a, c, g dbSNP:539311609
2476 2476 c, t dbSNP:575509512
2477 2477 a, g, t dbSNP:768930237
2478 2478 a, c, t dbSNP:757770726
2479 2479 a, g, t dbSNP:61755272
2480 2480 a, g dbSNP:778481419
2483 2483 a, g dbSNP:747787438
2484 2484 c, g dbSNP:104895485
2486 2486 a, g dbSNP:771795137
2493 2493 a, c dbSNP:772928775
2497 2497 c, t dbSNP:760623178
2498 2498 a, g, t dbSNP:770915641
2502 2502 c, t dbSNP:759649933
2503 2503 a, t dbSNP:765335094
2512 2512 c, t dbSNP:761818945
2515 2515 a, g dbSNP:752881716
2516 2516 c, t dbSNP:763192145
2517 2517 c, t dbSNP:764369783
2521 2521 c, t dbSNP:751914672
2524 2524 g, t dbSNP:757680896
2525 2525 c, t dbSNP:781781095
2533 2533 c, t dbSNP:146313066
2534 2534 a, g dbSNP:754471017
2535 2535 c, t dbSNP:778447050
2536 2536 a, g dbSNP:104895445
2540 2540 -, aattgcag dbSNP:776993718
2550 2550 a, g dbSNP:771701417
2555 2555 c, g, t dbSNP:104895486
2559 2559 a, g dbSNP:768823670
2562 2562 c, t dbSNP:774738662
2564 2564 a, g dbSNP:104895467
2566 2566 a, t dbSNP:767998441
2567 2567 a, g dbSNP:104895446
2580 2580 c, t dbSNP:144083291
2581 2581 a, g dbSNP:760938311
2585 2585 a, g dbSNP:766980553
2587 2587 a, g dbSNP:754270929
2589 2589 a, g dbSNP:757978263
2591 2591 a, g dbSNP:763542516
2596 2596 a, g dbSNP:104895447
2598 2598 a, g dbSNP:756832040
2599 2599 a, g dbSNP:780975637
2608 2608 c, t dbSNP:745733405
2613 2613 a, g dbSNP:755857709
2614 2614 g, t dbSNP:780077950
2615 2615 g, t dbSNP:749157324
2618 2618 a, g dbSNP:768889214
2624 2624 a, g dbSNP:201806207
2628 2628 c, t dbSNP:104895448
2635 2635 c, t dbSNP:748396173
2648 2648 a, g dbSNP:374506720
2655 2655 c, t dbSNP:766014518
2656 2656 a, c dbSNP:146276010
2657 2657 c, t dbSNP:776394582
2662 2662 c, g dbSNP:759456303
2664 2664 c, t dbSNP:765080035
2665 2665 g, t dbSNP:376366287
2666 2666 a, c, t dbSNP:565200911
2676 2676 a, c dbSNP:764244331
2679 2679 a, g dbSNP:751646683
2680 2680 c, g, t dbSNP:371163141
2682 2682 a, g dbSNP:746066586
2685 2685 c, g, t dbSNP:375012324
2686 2686 a, g, t dbSNP:201884393
2695 2695 c, t dbSNP:769101191
2696 2696 a, g dbSNP:201831159
2699 2699 g, t dbSNP:746542083
2705 2705 c, t dbSNP:770454777
2708 2708 c, t dbSNP:199552944
2709 2709 c, t dbSNP:759227592
2713 2713 a, c dbSNP:201035873
2715 2715 c, g, t dbSNP:200428513
2721 2721 a, g dbSNP:142559533
2726 2726 a, t dbSNP:750560134
2727 2727 c, t dbSNP:58586167
2728 2728 c, t dbSNP:104895490
2731 2731 c, g, t dbSNP:2066845
2732 2732 c, g dbSNP:142376491
2733 2733 c, t dbSNP:375346218
2744 2744 c, g dbSNP:779300567
2748 2748 c, t dbSNP:104895451
2749 2749 a, g dbSNP:758913334
2755 2755 c, g dbSNP:778408661
2758 2758 c, t dbSNP:553794692
2761 2761 a, g dbSNP:769395722
2762 2762 a, c dbSNP:104895452
2780 2780 a, g dbSNP:104895453
2783 2783 a, g dbSNP:545734771
2784 2784 a, t dbSNP:774129547
2786 2786 a, c dbSNP:761500764
2792 2792 a, g dbSNP:772064514
2799 2799 a, g dbSNP:139886679
2809 2809 c, g dbSNP:771833402
2811 2811 a, g dbSNP:149691662
2812 2812 a, g dbSNP:746911440
2816 2816 a, g dbSNP:542558237
2822 2822 a, g dbSNP:770924038
2824 2824 a, g dbSNP:201781416
2826 2826 c, t dbSNP:104895454
2829 2829 c, t dbSNP:372443143
2837 2837 a, g dbSNP:775540348
2838 2838 g, t dbSNP:763457215
2839 2839 a, g dbSNP:764503364
2840 2840 c, g dbSNP:752141641
2849 2849 g, t dbSNP:757770809
2850 2850 a, g dbSNP:765820451
2855 2855 g, t dbSNP:753454914
2857 2857 a, c, g dbSNP:527892258
2860 2860 c, g dbSNP:768561004
2866 2866 a, g dbSNP:375705174
2871 2871 c, t dbSNP:758223679
2872 2872 a, g dbSNP:5743291
2882 2882 a, g dbSNP:746965976
2903 2903 a, g dbSNP:752353565
2904 2904 c, t dbSNP:757991023
2906 2906 a, g dbSNP:189453919
2914 2914 a, g dbSNP:528345270
2918 2918 a, g dbSNP:371389581
2923 2923 a, g dbSNP:104895455
2925 2925 a, g dbSNP:756968128
2930 2930 c, t dbSNP:200463498
2934 2934 c, t dbSNP:104895463
2935 2935 a, g dbSNP:148561632
2936 2936 c, t dbSNP:779522908
2942 2942 a, g dbSNP:104895457
2949 2949 a, g dbSNP:749533773
2952 2952 a, g dbSNP:769056708
2986 2986 a, g dbSNP:142904241
2987 2987 a, c, g dbSNP:147750423
2992 2992 a, g dbSNP:768835583
3003 3003 a, c dbSNP:779300338
3016 3016 c, t dbSNP:748277158
3019 3019 c, g dbSNP:772487940
3021 3021 a, g dbSNP:773388366
3024 3024 c, g dbSNP:111403064
3025 3025 -, c dbSNP:2066847
3025 3025 c, g dbSNP:199883290
3026 3026 -, c dbSNP:540973741
3028 3028 -, c dbSNP:5743293
3028 3028 c, t dbSNP:761083670
3029 3029 c, t dbSNP:112436597
3034 3034 a, g dbSNP:771490210
3038 3038 a, g dbSNP:367905706
3042 3042 c, t dbSNP:574818285
3045 3045 a, c dbSNP:762502185
3055 3055 a, g dbSNP:574467124
3061 3061 c, t dbSNP:146435555
3062 3062 g, t dbSNP:771267307
3064 3064 c, g, t dbSNP:104895491
3065 3065 a, g, t dbSNP:5743295
3066 3066 a, c dbSNP:761373812
3069 3069 a, g dbSNP:374689495
3071 3071 a, g dbSNP:772890413
3072 3072 c, g dbSNP:760568789
3084 3084 a, g dbSNP:766235880
3092 3092 c, t dbSNP:752941888
3102 3102 c, t dbSNP:201214915
3103 3103 a, g dbSNP:147874812
3105 3105 a, c dbSNP:765204397
3109 3109 a, c dbSNP:752783717
3115 3115 a, g dbSNP:758469287
3120 3120 a, g dbSNP:777902344
3124 3124 c, t dbSNP:372787414
3127 3127 a, c dbSNP:757653432
3138 3138 -, c dbSNP:765494080
3140 3140 a, c, g dbSNP:199475923
3141 3141 a, g dbSNP:104895459
3143 3143 a, g dbSNP:770345296
3146 3146 a, g dbSNP:776061012
3147 3147 a, t dbSNP:747651929
3150 3150 c, t dbSNP:771562333
3151 3151 c, t dbSNP:777907851
3152 3152 a, c, g dbSNP:5743296
3153 3153 a, t dbSNP:776623410
3156 3156 -, ca dbSNP:750598682
3157 3157 -, agtt dbSNP:758436028
3158 3158 -, gttt dbSNP:780112629
3174 3174 g, t dbSNP:759397246
3176 3176 -, tg dbSNP:752017238
3177 3177 a, g dbSNP:765123802
3183 3183 g, t dbSNP:752653511
3188 3188 c, t dbSNP:112011764
3212 3212 c, t dbSNP:199475924
3221 3221 c, t dbSNP:184545855
3264 3264 -, g dbSNP:35980453
3274 3274 a, g dbSNP:527525652
3281 3281 a, c dbSNP:768016648
3315 3315 c, t dbSNP:547264433
3324 3324 c, t dbSNP:199475925
3327 3327 a, g dbSNP:757428844
3346 3346 a, c, t dbSNP:199475926
3370 3370 c, t dbSNP:750856649
3391 3391 a, t dbSNP:372022771
3396 3396 c, t dbSNP:547767004
3411 3411 c, t dbSNP:140956945
3463 3463 c, t dbSNP:746980077
3494 3494 a, g dbSNP:533083386
3498 3498 a, g dbSNP:549869777
3505 3505 c, t dbSNP:768545710
3507 3507 a, g dbSNP:563749168
3514 3514 c, t dbSNP:535063121
3529 3529 a, c dbSNP:3135499
3544 3544 a, g dbSNP:779375339
3564 3564 a, g dbSNP:566233506
3589 3589 c, t dbSNP:535257127
3594 3594 a, c dbSNP:562972090
3598 3598 a, t dbSNP:188988267
3602 3602 c, t dbSNP:770461687
3619 3619 c, t dbSNP:748885287
3620 3620 a, g dbSNP:577786590
3653 3653 c, t dbSNP:5743297
3719 3719 c, t dbSNP:556994965
3752 3752 a, g dbSNP:116213743
3757 3757 a, g dbSNP:767910906
3819 3819 c, t dbSNP:542650591
3820 3820 a, g dbSNP:775789402
3832 3832 a, g dbSNP:761109800
3848 3848 c, t dbSNP:764167335
3870 3870 c, t dbSNP:562052651
3872 3872 g, t dbSNP:5743298
3878 3878 a, c dbSNP:145051635
3883 3883 a, g dbSNP:541292537
3890 3890 a, c dbSNP:564290737
3894 3894 g, t dbSNP:546314209
3914 3914 a, c dbSNP:564389186
3931 3931 c, t dbSNP:114899313
3943 3943 c, t dbSNP:549908533
3983 3983 c, t dbSNP:60727336
4005 4005 c, t dbSNP:373812846
4009 4009 a, c dbSNP:140643942
4070 4070 a, c dbSNP:548686827
4122 4122 c, t dbSNP:192842874
4145 4145 a, g dbSNP:549273021
4149 4149 c, t dbSNP:370557520
4152 4152 a, g dbSNP:778575221
4155 4155 c, t dbSNP:5743299
4156 4156 a, g dbSNP:113884530
4178 4178 c, t dbSNP:145816297
4262 4262 a, g dbSNP:138313319
4288 4288 a, g dbSNP:3135500
4311 4311 a, g dbSNP:372288537
4333 4333 a, t dbSNP:751525993
4337 4337 c, t dbSNP:573783671

Target ORF information:

RefSeq Version XM_005256084
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nucleotide-binding oligomerization domain containing 2 (NOD2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu49454D
Sequence Information ORF Nucleotide Sequence (Length: 2958bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nucleotide-binding oligomerization domain-containing protein 2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010498.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578829111. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)109..366(+)
Misc Feature(2)409..651(+)
Misc Feature(3)886..1398(+)
Misc Feature(4)2347..3021(+)
Misc Feature(5)2392..>3045(+)
Misc Feature(6)2392..2994(+)
Misc Feature(7)2467..2541(+)
Misc Feature(8)2542..2613(+)
Misc Feature(9)2563..2976(+)
Misc Feature(10)2614..2709(+)
Misc Feature(11)2710..2757(+)
Misc Feature(12)2794..2877(+)
Misc Feature(13)2878..2943(+)
Misc Feature(14)2944..2997(+)
Position Chain Variation Link
52 52 c, g dbSNP:570075610
53 53 c, g dbSNP:369410275
63 63 c, g dbSNP:370316846
68 68 c, t dbSNP:373297050
83 83 a, g dbSNP:567793250
84 84 c, t dbSNP:371044393
91 91 a, g dbSNP:372321755
98 98 c, t dbSNP:768775316
99 99 a, g dbSNP:774491311
107 107 c, g dbSNP:762072566
122 122 g, t dbSNP:104895487
128 128 a, c dbSNP:750745611
130 130 a, c dbSNP:761191478
135 135 c, t dbSNP:766815592
136 136 a, g dbSNP:200089552
140 140 c, t dbSNP:757914381
142 142 c, t dbSNP:777325175
143 143 c, t dbSNP:751223046
149 149 c, t dbSNP:201586544
152 152 c, g dbSNP:758548184
158 158 c, t dbSNP:781166995
160 160 g, t dbSNP:745597071
168 168 c, t dbSNP:769855133
169 169 a, g dbSNP:780204985
173 173 a, g dbSNP:749222396
174 174 c, t dbSNP:768665692
177 177 c, g dbSNP:774456364
190 190 c, g dbSNP:761972851
195 195 c, g, t dbSNP:367895771
208 208 c, t dbSNP:760962549
209 209 c, g dbSNP:146149433
222 222 c, t dbSNP:754402504
223 223 a, g dbSNP:760069458
224 224 a, g dbSNP:138881230
227 227 c, g dbSNP:751044848
233 233 a, c dbSNP:756886427
235 235 c, t dbSNP:780921204
239 239 c, t dbSNP:750092643
242 242 c, g dbSNP:756028666
244 244 c, t dbSNP:779970018
247 247 a, c, g dbSNP:370734707
250 250 c, g dbSNP:34936594
265 265 a, g dbSNP:748200640
266 266 a, g dbSNP:772287143
268 268 c, t dbSNP:374128251
278 278 a, t dbSNP:747221457
279 279 c, t dbSNP:771336423
282 282 c, t dbSNP:146923251
283 283 a, g, t dbSNP:187264529
287 287 a, g dbSNP:773733975
288 288 a, g dbSNP:761449474
296 296 a, g, t dbSNP:767119064
301 301 c, t dbSNP:755795167
308 308 g, t dbSNP:367756419
310 310 c, g dbSNP:753619374
312 312 a, c, g dbSNP:138041175
321 321 c, t dbSNP:778843858
322 322 a, g dbSNP:113706344
323 323 c, t dbSNP:202052365
324 324 a, g, t dbSNP:104895419
333 333 a, g dbSNP:747274659
337 337 a, g dbSNP:571102620
338 338 c, g, t dbSNP:35095295
341 341 a, g dbSNP:746189550
345 345 a, c, t dbSNP:770046355
346 346 a, g dbSNP:104895468
347 347 a, c dbSNP:767173948
348 348 c, t dbSNP:138889062
358 358 c, t dbSNP:760423983
363 363 a, g dbSNP:766071199
366 366 g, t dbSNP:672601267
381 381 c, t dbSNP:753579507
383 383 c, t dbSNP:149390911
384 384 c, t dbSNP:764929082
385 385 c, g dbSNP:781448444
386 386 a, g dbSNP:758303366
389 389 c, t dbSNP:146395646
390 390 a, g dbSNP:535978538
398 398 c, g dbSNP:200160605
403 403 c, g dbSNP:757487598
404 404 a, g dbSNP:781540619
412 412 a, c dbSNP:572556762
413 413 a, g dbSNP:770240116
421 421 a, c, t dbSNP:184502667
422 422 a, g dbSNP:104895456
422 422 -, g dbSNP:776176047
424 424 c, t dbSNP:749841667
427 427 a, g dbSNP:34684955
432 432 c, t dbSNP:772861513
436 436 a, g dbSNP:760196682
441 441 a, g dbSNP:770343724
449 449 a, g dbSNP:776403451
466 466 -, a dbSNP:761486886
469 469 a, g dbSNP:146054564
472 472 c, t dbSNP:765122435
473 473 a, t dbSNP:148753593
478 478 c, t dbSNP:104895420
484 484 c, t dbSNP:562557464
485 485 a, g dbSNP:150996156
488 488 a, g dbSNP:751647609
491 491 c, t dbSNP:757381363
492 492 c, t dbSNP:565504727
493 493 gcatgggagcggggtttca, tcagccagtatgaatgtgatgaaatcaggt dbSNP:45575333
493 493 a, g dbSNP:139571975
494 494 c, t dbSNP:756247553
495 495 a, c dbSNP:780488493
507 507 a, t dbSNP:749605438
508 508 c, g, t dbSNP:769289791
526 526 c, t dbSNP:748652020
527 527 c, t dbSNP:770524298
528 528 a, g dbSNP:77153279
539 539 a, c, t dbSNP:144368009
540 540 a, g dbSNP:775281342
543 543 a, c, g dbSNP:2067085
551 551 a, c dbSNP:141414002
553 553 a, g dbSNP:748912559
561 561 g, t dbSNP:768476112
573 573 c, g dbSNP:774089880
575 575 c, t dbSNP:61755182
576 576 a, g dbSNP:144887729
579 579 a, g dbSNP:555550682
584 584 c, t dbSNP:149071116
585 585 a, g dbSNP:369122423
599 599 a, c, g dbSNP:373838219
600 600 c, t dbSNP:765729513
606 606 c, t dbSNP:201115206
608 608 c, t dbSNP:758959985
609 609 a, g dbSNP:778078737
615 615 c, t dbSNP:747534110
616 616 a, g dbSNP:369764782
625 625 c, t dbSNP:755641532
630 630 a, g, t dbSNP:377752699
633 633 c, t dbSNP:768259661
634 634 c, t dbSNP:143080077
635 635 c, t dbSNP:753744335
640 640 a, g dbSNP:771887760
642 642 c, t dbSNP:5743269
643 643 c, t dbSNP:760629717
663 663 a, g dbSNP:778455499
680 680 c, t dbSNP:375336137
681 681 c, t dbSNP:758019098
690 690 a, g dbSNP:777458605
695 695 c, t dbSNP:529640892
696 696 a, g dbSNP:771003092
706 706 c, t dbSNP:781333877
707 707 a, c dbSNP:369098290
712 712 c, t dbSNP:104895422
713 713 a, g, t dbSNP:201790577
723 723 c, t dbSNP:768859303
728 728 a, g dbSNP:202190367
734 734 a, g dbSNP:762225932
743 743 c, t dbSNP:148516118
744 744 a, g, t dbSNP:773749264
748 748 c, t dbSNP:764675751
749 749 g, t dbSNP:752210177
752 752 g, t dbSNP:104895423
753 753 a, g dbSNP:145694647
754 754 a, g dbSNP:763743511
755 755 a, g dbSNP:117836686
760 760 a, g dbSNP:758462936
761 761 c, t dbSNP:757182049
768 768 a, g, t dbSNP:781099046
787 787 -, tgggcagatg dbSNP:764849041
789 789 c, g dbSNP:528290590
796 796 a, g dbSNP:756042160
804 804 -, g dbSNP:772914954
808 808 a, g dbSNP:780005934
811 811 a, c, t dbSNP:2066842
815 815 c, t dbSNP:774703072
816 816 a, c, g dbSNP:369766454
822 822 a, g dbSNP:773516123
825 825 c, t dbSNP:35090774
832 832 a, g dbSNP:766841285
834 834 c, t dbSNP:774873537
835 835 c, g dbSNP:762579270
837 837 a, g dbSNP:763504952
845 845 a, c dbSNP:200744970
848 848 a, g dbSNP:146074127
850 850 c, t dbSNP:756943416
855 855 c, t dbSNP:767456023
859 859 a, g dbSNP:369740939
868 868 c, t dbSNP:560242309
875 875 a, g dbSNP:5743271
879 879 c, t dbSNP:749180535
880 880 a, g dbSNP:104895424
881 881 a, g dbSNP:755127265
882 882 c, t dbSNP:778942858
884 884 c, t dbSNP:149338478
890 890 c, g dbSNP:104895425
892 892 a, g dbSNP:778114969
897 897 g, t dbSNP:375002962
903 903 a, g dbSNP:747340360
905 905 a, g dbSNP:771184127
911 911 c, t dbSNP:104895426
912 912 a, g dbSNP:531906536
924 924 a, g dbSNP:768258168
929 929 c, t dbSNP:191901394
930 930 a, g dbSNP:376601025
935 935 c, t dbSNP:767225117
936 936 a, g dbSNP:144738371
937 937 c, t dbSNP:760588667
938 938 a, g dbSNP:148526508
939 939 a, g dbSNP:753862753
940 940 c, t dbSNP:104895427
941 941 a, g dbSNP:778995814
959 959 c, t dbSNP:199975570
963 963 a, g dbSNP:199951979
964 964 g, t dbSNP:758631940
967 967 -, c dbSNP:762547903
968 968 a, g dbSNP:201591164
971 971 a, c dbSNP:747190206
972 972 c, g dbSNP:771364403
988 988 -, tt dbSNP:762053317
997 997 c, t dbSNP:773132030
999 999 a, g dbSNP:746405870
1009 1009 c, t dbSNP:104895462
1010 1010 a, g dbSNP:104895461
1014 1014 c, g dbSNP:7498256
1027 1027 a, g dbSNP:770361381
1028 1028 c, g dbSNP:774016655
1037 1037 c, g, t dbSNP:369732140
1038 1038 c, g dbSNP:144439629
1040 1040 c, t dbSNP:199475912
1042 1042 g, t dbSNP:760224068
1043 1043 c, t dbSNP:766219817
1045 1045 c, t dbSNP:753537879
1046 1046 a, c, g dbSNP:759520552
1051 1051 c, g dbSNP:104895428
1054 1054 c, g dbSNP:752615209
1056 1056 a, c, t dbSNP:758539057
1062 1062 c, g dbSNP:554991667
1064 1064 a, g dbSNP:5743272
1070 1070 g, t dbSNP:751854684
1074 1074 a, g dbSNP:104895488
1075 1075 c, t dbSNP:757368076
1076 1076 c, t dbSNP:201107567
1079 1079 a, c dbSNP:104895469
1080 1080 a, t dbSNP:756538468
1086 1086 c, t dbSNP:780775868
1090 1090 c, g dbSNP:556617095
1093 1093 -, g dbSNP:766265864
1096 1096 a, t dbSNP:104895470
1097 1097 a, t dbSNP:772548332
1102 1102 c, t dbSNP:746706579
1104 1104 a, g dbSNP:770423311
1111 1111 c, t dbSNP:776498009
1116 1116 a, c dbSNP:759382357
1117 1117 c, t dbSNP:199858111
1120 1120 c, g dbSNP:775443143
1126 1126 c, t dbSNP:145293873
1127 1127 c, g dbSNP:764176270
1130 1130 c, t dbSNP:751550117
1131 1131 c, t dbSNP:757517796
1137 1137 a, t dbSNP:767694243
1140 1140 c, g, t dbSNP:750655947
1141 1141 g, t dbSNP:780544950
1143 1143 c, t dbSNP:527305056
1155 1155 c, g, t dbSNP:104895476
1156 1156 a, g, t dbSNP:104895477
1157 1157 a, g dbSNP:104895493
1160 1160 a, t dbSNP:777343284
1173 1173 c, t dbSNP:746445875
1175 1175 c, t dbSNP:528926956
1176 1176 a, g dbSNP:776211261
1177 1177 a, g dbSNP:147283871
1178 1178 a, t dbSNP:769622495
1180 1180 c, t dbSNP:104895481
1181 1181 a, g dbSNP:554887705
1183 1183 a, g dbSNP:763868196
1186 1186 c, t dbSNP:140716236
1187 1187 a, g dbSNP:140918872
1191 1191 c, t dbSNP:767605899
1197 1197 c, t dbSNP:750664442
1199 1199 c, t dbSNP:150078153
1200 1200 a, g dbSNP:766883774
1203 1203 c, t dbSNP:5743273
1204 1204 a, g dbSNP:755554858
1208 1208 c, t dbSNP:779346494
1214 1214 c, t dbSNP:753241960
1219 1219 c, t dbSNP:756755875
1221 1221 c, g dbSNP:367630707
1228 1228 c, t dbSNP:760998620
1250 1250 a, g dbSNP:104895429
1252 1252 c, g dbSNP:745540141
1255 1255 c, g dbSNP:766612118
1267 1267 c, t dbSNP:367883043
1268 1268 a, g dbSNP:199475913
1272 1272 a, g dbSNP:749142500
1274 1274 g, t dbSNP:768497619
1276 1276 a, g dbSNP:774197781
1278 1278 g, t dbSNP:77966199
1285 1285 c, t dbSNP:545466982
1286 1286 a, g dbSNP:562225614
1288 1288 c, t dbSNP:760982375
1289 1289 c, t dbSNP:766651775
1290 1290 a, c, g dbSNP:104895430
1293 1293 c, t dbSNP:547826765
1294 1294 a, g dbSNP:144827713
1301 1301 c, t dbSNP:104895431
1302 1302 a, g, t dbSNP:145834617
1304 1304 c, t dbSNP:2076754
1305 1305 a, g dbSNP:779751017
1308 1308 c, t dbSNP:748910444
1312 1312 a, g dbSNP:768389547
1316 1316 a, t dbSNP:778723375
1317 1317 a, g dbSNP:748068611
1320 1320 c, t dbSNP:771979324
1323 1323 a, c dbSNP:773440974
1324 1324 c, t dbSNP:375201229
1325 1325 a, g dbSNP:143110172
1326 1326 c, t dbSNP:777034157
1329 1329 c, t dbSNP:143395754
1330 1330 a, g dbSNP:104895432
1335 1335 c, t dbSNP:151315883
1348 1348 c, t dbSNP:763372171
1350 1350 c, t dbSNP:370728357
1358 1358 a, t dbSNP:764525298
1365 1365 c, t dbSNP:186719861
1366 1366 a, g dbSNP:556728426
1375 1375 c, t dbSNP:104895433
1384 1384 c, t dbSNP:765857594
1385 1385 a, g dbSNP:753458507
1386 1386 a, c, t dbSNP:2066843
1395 1395 a, g dbSNP:747921876
1396 1396 c, g dbSNP:104895482
1398 1398 c, t dbSNP:200656015
1399 1399 a, g, t dbSNP:104895492