
BMPR1B cDNA ORF clone, Homo sapiens (human)

Gene Symbol BMPR1B
Entrez Gene ID 658
Full Name bone morphogenetic protein receptor, type IB
Synonyms ALK-6, ALK6, CDw293
General protein information
Preferred Names
bone morphogenetic protein receptor type-1B
bone morphogenetic protein receptor type-1B
BMP type-1B receptor
activin receptor-like kinase 6
serine/threonine receptor kinase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html: Brachydactyly, type A2, 112600 (3); Chrondrodysplasia, acromesomelic,

mRNA and Protein(s)

mRNA Protein Name
XM_011532201 XP_011530503 bone morphogenetic protein receptor type-1B isoform X1
XM_011532202 XP_011530504 bone morphogenetic protein receptor type-1B isoform X1
NM_001203 NP_001194 bone morphogenetic protein receptor type-1B isoform b precursor
NM_001256792 NP_001243721 bone morphogenetic protein receptor type-1B isoform b precursor
NM_001256793 NP_001243722 bone morphogenetic protein receptor type-1B isoform a precursor
NM_001256794 NP_001243723 bone morphogenetic protein receptor type-1B isoform b precursor

hsa04060 Cytokine-cytokine receptor interaction
hsa04350 TGF-beta signaling pathway
hsa04390 Hippo signaling pathway
hsa04550 Signaling pathways regulating pluripotency of stem cells
hsa_M00679 BMP signaling
R-HSA-162582 Signal Transduction
R-HSA-201451 Signaling by BMP
WP34 Ovarian Infertility Genes
WP1425 BMP signalling and regulation

Homo sapiens (human) BMPR1B NP_001243722.1
Pan troglodytes (chimpanzee) BMPR1B XP_517599.3
Macaca mulatta (Rhesus monkey) BMPR1B XP_001103786.2
Canis lupus familiaris (dog) BMPR1B NP_001138623.1
Bos taurus (cattle) BMPR1B NP_001098798.1
Mus musculus (house mouse) Bmpr1b NP_031586.1
Gallus gallus (chicken) BMPR1B NP_990463.1
Danio rerio (zebrafish) bmpr1ba NP_571532.1
Drosophila melanogaster (fruit fly) tkv NP_787990.1
Caenorhabditis elegans sma-6 NP_495271.1
Xenopus (Silurana) tropicalis (western clawed frog) bmpr1b NP_001072633.1


ID Name Evidence
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane TAS
GO:0005887 integral to plasma membrane IC
GO:0043235 receptor complex TAS


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004674 protein serine/threonine kinase activity IDA
GO:0004675 transmembrane receptor protein serine/threonine kinase activity IMP
GO:0004675 transmembrane receptor protein serine/threonine kinase activity NAS
GO:0004702 receptor signaling protein serine/threonine kinase activity IEA
GO:0004872 receptor activity IEA
GO:0005024 transforming growth factor beta receptor activity IEA
GO:0005515 protein binding IPI
GO:0005524 ATP binding IDA
GO:0046332 SMAD binding IDA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0001501 skeletal system development IMP
GO:0001502 cartilage condensation NAS
GO:0001550 ovarian cumulus expansion ISS
GO:0001654 eye development ISS
GO:0006468 protein phosphorylation IDA
GO:0030501 positive regulation of bone mineralization IMP
GO:0030509 BMP signaling pathway EXP
GO:0030509 BMP signaling pathway IDA
GO:0030509 BMP signaling pathway NAS
GO:0035108 limb morphogenesis IMP
GO:0042698 ovulation cycle ISS
GO:0045597 positive regulation of cell differentiation IMP
GO:0045669 positive regulation of osteoblast differentiation IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following BMPR1B gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the BMPR1B cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

***CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_011532201 PREDICTED: Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50
XM_011532202 PREDICTED: Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50
NM_001203 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50
NM_001256792 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50
NM_001256793 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $219.50
NM_001256794 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

***One clone ID might be correlated to multiple accession numbers, which share the same CDS sequence.

CloneID OHu11503
Clone ID Related Accession (Same CDS sequence) NM_001203 , NM_001256792 , NM_001256794 , XM_011532201 , XM_011532202
Accession Version XM_011532201.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1509bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product bone morphogenetic protein receptor type-1B isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_016354.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq XP_011530503.1
Misc Feature(1)237..479(+)
Misc Feature(2)741..1655(+)
Misc Feature(3)768..1616(+)
Misc Feature(4)777..1277(+)
Misc Feature(5)777..1199(+)
Misc Feature(6)789..1277(+)
Misc Feature(7)870..947(+)
Misc Feature(8)1194..1277(+)
Position Chain Variation Link
16 16 c, t dbSNP:563992994
63 63 a, g dbSNP:143230133
116 116 a, g dbSNP:148290279
128 128 c, t dbSNP:75697273
142 142 c, t dbSNP:770844919
143 143 g, t dbSNP:776714886
160 160 a, c, g dbSNP:150974461
165 165 a, g dbSNP:143885868
167 167 a, g dbSNP:536960015
186 186 a, g dbSNP:111612269
189 189 a, c dbSNP:763496728
206 206 c, g dbSNP:773850751
211 211 c, t dbSNP:190883013
215 215 c, t dbSNP:766827991
219 219 a, g dbSNP:754365645
221 221 c, g, t dbSNP:148603233
223 223 a, c, g dbSNP:145700191
225 225 c, t dbSNP:758706811
226 226 a, c, g dbSNP:377000102
229 229 c, g dbSNP:757312834
234 234 g, t dbSNP:773417270
240 240 c, t dbSNP:745854387
241 241 a, g dbSNP:200035802
251 251 c, t dbSNP:766432447
270 270 g, t dbSNP:775495653
278 278 -, caa dbSNP:754433500
282 282 a, t dbSNP:749047942
296 296 a, g dbSNP:756055104
299 299 c, t dbSNP:147320212
314 314 a, c, g dbSNP:749067196
347 347 a, g dbSNP:778604737
363 363 c, t dbSNP:759149974
374 374 a, g dbSNP:747796220
378 378 g, t dbSNP:200702974
389 389 a, g dbSNP:772766219
396 396 a, c, g, t dbSNP:369807264
397 397 a, c, g dbSNP:140970485
399 399 a, g, t dbSNP:192392906
400 400 c, t dbSNP:200083866
402 402 c, t dbSNP:762270033
403 403 c, g dbSNP:767805662
404 404 c, t dbSNP:144813372
416 416 a, t dbSNP:558142045
421 421 g, t dbSNP:376183647
429 429 a, g dbSNP:200886063
430 430 a, c, t dbSNP:139161475
438 438 a, g, t dbSNP:759423600
439 439 a, c, g dbSNP:151289886
440 440 a, g dbSNP:758222007
449 449 c, t dbSNP:140499888
469 469 a, t dbSNP:746713318
479 479 c, g dbSNP:756763148
498 498 a, g dbSNP:571763786
505 505 g, t dbSNP:541202129
512 512 a, c dbSNP:780913868
519 519 c, t dbSNP:759803347
534 534 c, t dbSNP:755669488
540 540 a, t dbSNP:561117066
544 544 g, t dbSNP:150002205
546 546 a, c dbSNP:772559135
548 548 c, t dbSNP:773770090
549 549 a, g dbSNP:747412096
552 552 g, t dbSNP:145201971
563 563 c, g dbSNP:574267182
567 567 a, g dbSNP:138801821
576 576 -, t dbSNP:774760398
579 579 c, t dbSNP:55980670
584 584 c, t dbSNP:758404304
593 593 a, c dbSNP:775375747
594 594 -, g dbSNP:35806331
594 594 a, c, t dbSNP:34231464
613 613 a, c dbSNP:140360809
616 616 c, g dbSNP:769863111
617 617 a, g dbSNP:775608689
618 618 a, c, t dbSNP:779609471
621 621 c, g dbSNP:774364369
622 622 a, g dbSNP:761486688
626 626 c, t dbSNP:767383109
627 627 a, t dbSNP:750037039
628 628 a, g dbSNP:149589961
631 631 g, t dbSNP:766140919
635 635 a, g dbSNP:753332434
639 639 a, g dbSNP:754565613
641 641 a, g dbSNP:778376263
645 645 a, c, g dbSNP:752156962
646 646 a, t dbSNP:781670372
652 652 c, g dbSNP:373998952
655 655 -, aca dbSNP:772708128
655 655 a, c dbSNP:769948288
656 656 c, t dbSNP:780264116
657 657 a, g dbSNP:778170724
659 659 g, t dbSNP:768768926
672 672 c, t dbSNP:143554488
673 673 c, g dbSNP:367777041
676 676 c, t dbSNP:771747962
678 678 a, g dbSNP:773000162
684 684 c, t dbSNP:760548554
686 686 a, c dbSNP:766089514
688 688 c, t dbSNP:776445882
696 696 c, t dbSNP:141691706
709 709 c, g dbSNP:200839585
710 710 a, g dbSNP:752007054
729 729 c, g dbSNP:757843329
730 730 c, t dbSNP:767925715
745 745 -, t dbSNP:762082748
747 747 a, g dbSNP:750954022
748 748 a, t dbSNP:121434417
752 752 a, t dbSNP:568812097
754 754 a, g dbSNP:185062260
762 762 c, g dbSNP:766791531
777 777 a, g dbSNP:754044696
790 790 a, g dbSNP:755131943
796 796 c, g dbSNP:779006691
798 798 a, g dbSNP:748217063
813 813 a, g dbSNP:758429876
819 819 c, t dbSNP:777745046
820 820 a, g dbSNP:35973133
828 828 a, g dbSNP:574398307
829 829 a, t dbSNP:372556235
831 831 a, g dbSNP:745674753
835 835 c, t dbSNP:769423606
851 851 a, c dbSNP:536641256
854 854 c, g, t dbSNP:56083112
864 864 g, t dbSNP:773700021
873 873 c, g, t dbSNP:761226009
874 874 c, g, t dbSNP:754133041
875 875 a, c, g, t dbSNP:376819253
876 876 a, g dbSNP:755476693
883 883 c, g dbSNP:751532146
884 884 a, c, g dbSNP:757204543
885 885 a, c, g dbSNP:369168607
886 886 a, g dbSNP:779737736
887 887 a, t dbSNP:748957679
892 892 -, t dbSNP:765011271
894 894 c, g, t dbSNP:142696562
895 895 a, t dbSNP:187868598
898 898 c, t dbSNP:771385869
908 908 a, g, t dbSNP:200446727
911 911 g, t dbSNP:200198618
918 918 a, g dbSNP:201034260
920 920 c, t dbSNP:763144778
931 931 a, t dbSNP:375308110
933 933 a, g dbSNP:761965542
939 939 g, t dbSNP:767750336
958 958 a, g dbSNP:750357066
978 978 c, g dbSNP:755942515
980 980 a, g dbSNP:543232420
983 983 c, t dbSNP:753533981
985 985 c, t dbSNP:147336783
987 987 a, g dbSNP:551370449
993 993 c, t dbSNP:556937566
995 995 c, t dbSNP:371779248
1004 1004 c, t dbSNP:777207290
1007 1007 c, g dbSNP:760017395
1011 1011 a, t dbSNP:746544755
1017 1017 c, t dbSNP:770135176
1022 1022 a, g dbSNP:776099461
1028 1028 c, t dbSNP:749570038
1035 1035 c, t dbSNP:769195694
1040 1040 a, c, t dbSNP:112111860
1041 1041 a, g dbSNP:373000965
1044 1044 a, g dbSNP:762320529
1045 1045 a, g dbSNP:773095683
1046 1046 a, g dbSNP:760837301
1050 1050 a, g dbSNP:199613098
1052 1052 a, g dbSNP:753862322
1056 1056 a, c dbSNP:370428276
1058 1058 a, g dbSNP:373401690
1062 1062 a, g dbSNP:765766633
1074 1074 a, g dbSNP:757988979
1077 1077 a, g dbSNP:777487568
1101 1101 c, g dbSNP:750995828
1108 1108 c, t dbSNP:756816303
1127 1127 a, g dbSNP:780406413
1128 1128 a, g dbSNP:141032424
1140 1140 c, g dbSNP:376126706
1167 1167 a, g dbSNP:779359224
1173 1173 a, g dbSNP:748524936
1178 1178 c, t dbSNP:772142440
1183 1183 c, g dbSNP:773503299
1184 1184 a, g, t dbSNP:760647140
1193 1193 c, t dbSNP:373436827
1214 1214 a, g, t dbSNP:139872191
1219 1219 g, t dbSNP:528180688
1224 1224 a, g dbSNP:201289177
1228 1228 a, g dbSNP:763992306
1240 1240 c, t dbSNP:773874757
1242 1242 a, g dbSNP:761588488
1245 1245 a, g dbSNP:767077000
1248 1248 a, c, t dbSNP:148550671
1250 1250 a, g, t dbSNP:563307237
1251 1251 c, t dbSNP:577188671
1254 1254 a, g dbSNP:778257341
1255 1255 a, g dbSNP:747347346
1257 1257 a, t dbSNP:757434006
1258 1258 c, t dbSNP:781424907
1261 1261 a, c, g, t dbSNP:34970181
1268 1268 c, g dbSNP:749302695
1275 1275 c, t dbSNP:768328319
1279 1279 a, g dbSNP:559805218
1286 1286 c, t dbSNP:151056742
1293 1293 a, g dbSNP:749833502
1295 1295 c, g dbSNP:761539694
1296 1296 c, t dbSNP:200523617
1301 1301 c, t dbSNP:375476260
1314 1314 a, g dbSNP:760241910
1318 1318 a, g dbSNP:766046737
1324 1324 c, t dbSNP:753253207
1328 1328 g, t dbSNP:758874215
1338 1338 a, g dbSNP:548452438
1346 1346 c, t dbSNP:751901947
1347 1347 a, g dbSNP:757593146
1352 1352 c, t dbSNP:781359356
1377 1377 c, g, t dbSNP:746134819
1384 1384 a, g dbSNP:561948192
1387 1387 c, g dbSNP:780171269
1388 1388 a, t dbSNP:186299744
1397 1397 a, g dbSNP:768593608
1457 1457 c, t dbSNP:776148917
1460 1460 c, t dbSNP:531619795
1467 1467 a, g dbSNP:376221874
1477 1477 c, t dbSNP:752045710
1484 1484 -, cat dbSNP:776183665
1489 1489 a, g dbSNP:371436999
1496 1496 a, g dbSNP:533642294
1499 1499 c, t dbSNP:775062694
1502 1502 a, c dbSNP:551844397
1512 1512 a, c dbSNP:756258100
1515 1515 c, t dbSNP:780280883
1516 1516 a, g, t dbSNP:140047318
1517 1517 a, g dbSNP:778890672
1534 1534 a, g, t dbSNP:766596192
1543 1543 a, g dbSNP:369609245
1545 1545 a, t dbSNP:778929099
1560 1560 a, g dbSNP:752827445
1583 1583 a, c, t dbSNP:144080146
1584 1584 g, t dbSNP:746760963
1586 1586 a, g dbSNP:770888722
1592 1592 a, g dbSNP:375459734
1593 1593 c, t dbSNP:745563318
1599 1599 g, t dbSNP:769339843
1605 1605 c, t dbSNP:121434418
1606 1606 a, g dbSNP:121434419
1608 1608 a, g dbSNP:369899177
1616 1616 a, g dbSNP:146773802
1620 1620 c, g dbSNP:748806114
1625 1625 c, t dbSNP:140430323
1642 1642 a, g dbSNP:773752951
1648 1648 c, t dbSNP:761009116
1651 1651 a, c dbSNP:766714132
1665 1665 a, g dbSNP:377255740
1667 1667 c, g dbSNP:112333283
1671 1671 a, c dbSNP:377403247
1676 1676 a, g dbSNP:752775295
1677 1677 c, t dbSNP:758581667
1686 1686 -, ag dbSNP:776768569
1690 1690 a, g dbSNP:764090825
1695 1695 a, g, t dbSNP:751594392
1696 1696 -, a dbSNP:761734095
1696 1696 a, c dbSNP:371155612
1700 1700 -, g dbSNP:770070277
1700 1700 c, t dbSNP:745676484
1702 1702 c, t dbSNP:755219700
1707 1707 c, t dbSNP:6813320
1708 1708 -, tgtt dbSNP:773372957
1731 1731 a, g dbSNP:183489869
1741 1741 c, g dbSNP:563289256
1753 1753 a, g dbSNP:532348507
1760 1760 c, g dbSNP:552181587
1767 1767 a, g dbSNP:374115313
1779 1779 a, g dbSNP:534581040
1784 1784 a, g dbSNP:569581364
1799 1799 c, t dbSNP:1434536
1822 1822 a, g dbSNP:536719640
1835 1835 c, t dbSNP:112992418
1853 1853 ca, tg dbSNP:386677448
1853 1853 c, t dbSNP:11725366
1854 1854 a, g dbSNP:1836261
1860 1860 a, g dbSNP:754142439
1870 1870 c, t dbSNP:745861587
1879 1879 c, t dbSNP:779144644
1938 1938 c, t dbSNP:769707423
1947 1947 -, t dbSNP:757375171
1948 1948 -, t dbSNP:11436086
1951 1951 a, t dbSNP:539266615
1960 1960 a, t dbSNP:77552018
1962 1962 a, g dbSNP:77149358
1996 1996 c, t dbSNP:79791228
2003 2003 a, g dbSNP:558963329
2061 2061 g, t dbSNP:572438891
2071 2071 a, g dbSNP:188703962
2074 2074 a, g dbSNP:758329362
2086 2086 c, t dbSNP:777747043
2122 2122 a, g dbSNP:193193227
2145 2145 g, t dbSNP:183245717
2151 2151 a, g dbSNP:543508771
2157 2157 c, t dbSNP:573304132
2173 2173 c, t dbSNP:748768110
2182 2182 c, t dbSNP:770792059
2264 2264 -, ac dbSNP:146159076
2299 2299 c, t dbSNP:17023107
2342 2342 g, t dbSNP:546008301
2350 2350 a, g dbSNP:555876249
2389 2389 c, t dbSNP:774194750
2420 2420 c, t dbSNP:574500341
2455 2455 a, g dbSNP:373221128
2461 2461 -, ttttttttttttt dbSNP:764691449
2461 2461 -, ttttt dbSNP:767551750
2461 2461 c, t dbSNP:373214817
2462 2462 -, tttttttttttt dbSNP:771633924
2463 2463 -, tttttttttttt dbSNP:767363680
2463 2463 -, ttttttttttt dbSNP:745414771
2482 2482 -, ttttttttttt dbSNP:548956012
2489 2489 -, tttt dbSNP:560067004
2494 2494 a, g dbSNP:559672287
2514 2514 g, t dbSNP:528362102
2518 2518 c, t dbSNP:188311185
2533 2533 -, attcaaaggatcaatattaaat dbSNP:111971137
2548 2548 a, g dbSNP:148298750
2566 2566 a, g dbSNP:745534077
2568 2568 a, g dbSNP:141438374
2573 2573 g, t dbSNP:550400234
2598 2598 a, g dbSNP:61443337
2644 2644 a, g dbSNP:570553942
2645 2645 a, g dbSNP:538840799
2647 2647 a, g dbSNP:11097457
2649 2649 a, t dbSNP:150827995
2666 2666 a, g dbSNP:59105855
2671 2671 c, t dbSNP:191551226
2716 2716 -, aaaa dbSNP:754434665
2735 2735 a, g dbSNP:554850187
2770 2770 -, tgtc dbSNP:537668325
2771 2771 a, g dbSNP:139279847
2774 2774 a, t dbSNP:183694616
2815 2815 a, g dbSNP:775047830
2845 2845 a, t dbSNP:557155390
2861 2861 a, g dbSNP:577303456
2868 2868 c, t dbSNP:545998639
2888 2888 g, t dbSNP:762511603
2988 2988 c, t dbSNP:559562363
3018 3018 a, g dbSNP:761096257
3019 3019 a, g dbSNP:56738985
3029 3029 a, g dbSNP:542105565
3033 3033 a, t dbSNP:370915593
3087 3087 c, t dbSNP:562009093
3126 3126 a, g dbSNP:773736447
3129 3129 -, aat dbSNP:145279069
3140 3140 c, g dbSNP:753954482
3191 3191 c, t dbSNP:761043331
3192 3192 a, g dbSNP:766867649
3217 3217 a, g dbSNP:2289044
3287 3287 a, g dbSNP:550583235
3304 3304 -, t dbSNP:565280551
3304 3304 g, t dbSNP:74645391
3318 3318 a, t dbSNP:570367865
3347 3347 a, g dbSNP:533016171
3354 3354 g, t dbSNP:546290295
3362 3362 c, t dbSNP:563721806
3365 3365 a, g dbSNP:186753977
3421 3421 c, t dbSNP:765546645
3442 3442 c, g dbSNP:752875395
3447 3447 c, g dbSNP:758477107
3467 3467 c, t dbSNP:561742257
3472 3472 a, g dbSNP:538267344
3500 3500 a, g dbSNP:554842235
3501 3501 c, g dbSNP:777675339
3540 3540 a, t dbSNP:568766919
3557 3557 a, g dbSNP:372385843
3624 3624 a, g dbSNP:752977059
3629 3629 c, g dbSNP:191224787
3630 3630 a, c dbSNP:185854880
3637 3637 c, t dbSNP:370452157
3640 3640 -, a dbSNP:746433268
3651 3651 -, a dbSNP:58613735
3651 3651 a, t dbSNP:200257459
3706 3706 c, t dbSNP:539897297
3707 3707 g, t dbSNP:190367204
3723 3723 c, t dbSNP:376211295
3734 3734 c, g dbSNP:745657051
3741 3741 a, g dbSNP:573066070
3743 3743 a, t dbSNP:769494319
3783 3783 g, t dbSNP:568153337
3814 3814 c, t dbSNP:115505973
3829 3829 c, t dbSNP:748788086
3832 3832 c, g dbSNP:575460895
3848 3848 a, c dbSNP:544198254
3871 3871 a, c dbSNP:768241828
3874 3874 c, g dbSNP:564061209
3875 3875 c, t dbSNP:532795780
3879 3879 a, g dbSNP:546277742
3881 3881 a, g dbSNP:559864027
3886 3886 a, g dbSNP:773682819
3888 3888 a, g, t dbSNP:529425822
3890 3890 a, t dbSNP:528642618
3898 3898 a, t dbSNP:548411357
3915 3915 c, g dbSNP:551173634
3928 3928 a, c dbSNP:759961764
3960 3960 a, g dbSNP:765599516
3965 3965 c, t dbSNP:569546552
3990 3990 a, t dbSNP:73839218
4008 4008 c, t dbSNP:1863654
4016 4016 a, g dbSNP:764248738
4069 4069 a, t dbSNP:145989039
4070 4070 c, t dbSNP:757253087
4091 4091 a, g dbSNP:139936115
4111 4111 a, g dbSNP:143459680
4154 4154 a, g dbSNP:181930964
4266 4266 g, t dbSNP:535968542
4268 4268 -, attt dbSNP:754999131
4276 4276 a, t dbSNP:529036699
4284 4284 a, t dbSNP:750265994
4306 4306 a, c dbSNP:755871790
4321 4321 g, t dbSNP:555509616
4360 4360 a, g dbSNP:575346915
4415 4415 a, t dbSNP:544451944
4434 4434 a, g dbSNP:1434535
4448 4448 a, g dbSNP:577213345
4518 4518 c, t dbSNP:747757463
4562 4562 a, g dbSNP:574095178
4607 4607 a, g dbSNP:535266062
4620 4620 g, t dbSNP:559802311
4630 4630 -, tatatatatatatatat dbSNP:553525105
4680 4680 a, g dbSNP:185008757
4692 4692 a, g dbSNP:189906922
4710 4710 a, c dbSNP:562262992
4711 4711 a, g dbSNP:144649830
4717 4717 c, t dbSNP:181152855
4733 4733 -, aat dbSNP:778035519
4759 4759 a, g dbSNP:556715070
4822 4822 c, g dbSNP:778487949
4877 4877 c, t dbSNP:185607229
4879 4879 c, t dbSNP:2162450
4913 4913 c, g dbSNP:2162449
4921 4921 c, t dbSNP:189974357
4930 4930 a, g dbSNP:555586650
4935 4935 a, t dbSNP:148400273
4938 4938 a, g dbSNP:545888520
4961 4961 a, g dbSNP:12505161
4962 4962 a, t dbSNP:531959675
4985 4985 a, c dbSNP:577552465
4986 4986 a, g dbSNP:7676885
5008 5008 c, t dbSNP:548853038
5047 5047 c, t dbSNP:553325789
5079 5079 c, g dbSNP:572703652
5142 5142 a, g dbSNP:540232461
5147 5147 a, g dbSNP:142488637
5232 5232 g, t dbSNP:372742440
5235 5235 a, g dbSNP:562486269
5248 5248 a, g dbSNP:377150654
5263 5263 a, g dbSNP:760084321
5276 5276 a, g dbSNP:76804339
5291 5291 c, g dbSNP:564684916
5304 5304 a, g dbSNP:529009401
5311 5311 c, t dbSNP:180838558
5320 5320 c, t dbSNP:763243833
5337 5337 a, g dbSNP:568350802
5349 5349 c, t dbSNP:529344145
5410 5410 c, t dbSNP:764220270
5411 5411 -, t dbSNP:550725580
5432 5432 a, c dbSNP:368327814

Target ORF information:

RefSeq Version XM_011532201
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11503
Clone ID Related Accession (Same CDS sequence) NM_001203 , NM_001256792 , NM_001256794 , XM_011532201 , XM_011532202
Accession Version XM_011532202.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1509bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product bone morphogenetic protein receptor type-1B isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_016354.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq XP_011530504.1
Misc Feature(1)126..368(+)
Misc Feature(2)630..1544(+)
Misc Feature(3)657..1505(+)
Misc Feature(4)666..1166(+)
Misc Feature(5)666..1088(+)
Misc Feature(6)678..1166(+)
Misc Feature(7)759..836(+)
Misc Feature(8)1083..1166(+)
Position Chain Variation Link
5 5 c, t dbSNP:144684999
31 31 c, t dbSNP:770844919
32 32 g, t dbSNP:776714886
49 49 a, c, g dbSNP:150974461
54 54 a, g dbSNP:143885868
56 56 a, g dbSNP:536960015
75 75 a, g dbSNP:111612269
78 78 a, c dbSNP:763496728
95 95 c, g dbSNP:773850751
100 100 c, t dbSNP:190883013
104 104 c, t dbSNP:766827991
108 108 a, g dbSNP:754365645
110 110 c, g, t dbSNP:148603233
112 112 a, c, g dbSNP:145700191
114 114 c, t dbSNP:758706811
115 115 a, c, g dbSNP:377000102
118 118 c, g dbSNP:757312834
123 123 g, t dbSNP:773417270
129 129 c, t dbSNP:745854387
130 130 a, g dbSNP:200035802
140 140 c, t dbSNP:766432447
159 159 g, t dbSNP:775495653
167 167 -, caa dbSNP:754433500
171 171 a, t dbSNP:749047942
185 185 a, g dbSNP:756055104
188 188 c, t dbSNP:147320212
203 203 a, c, g dbSNP:749067196
236 236 a, g dbSNP:778604737
252 252 c, t dbSNP:759149974
263 263 a, g dbSNP:747796220
267 267 g, t dbSNP:200702974
278 278 a, g dbSNP:772766219
285 285 a, c, g, t dbSNP:369807264
286 286 a, c, g dbSNP:140970485
288 288 a, g, t dbSNP:192392906
289 289 c, t dbSNP:200083866
291 291 c, t dbSNP:762270033
292 292 c, g dbSNP:767805662
293 293 c, t dbSNP:144813372
305 305 a, t dbSNP:558142045
310 310 g, t dbSNP:376183647
318 318 a, g dbSNP:200886063
319 319 a, c, t dbSNP:139161475
327 327 a, g, t dbSNP:759423600
328 328 a, c, g dbSNP:151289886
329 329 a, g dbSNP:758222007
338 338 c, t dbSNP:140499888
358 358 a, t dbSNP:746713318
368 368 c, g dbSNP:756763148
387 387 a, g dbSNP:571763786
394 394 g, t dbSNP:541202129
401 401 a, c dbSNP:780913868
408 408 c, t dbSNP:759803347
423 423 c, t dbSNP:755669488
429 429 a, t dbSNP:561117066
433 433 g, t dbSNP:150002205
435 435 a, c dbSNP:772559135
437 437 c, t dbSNP:773770090
438 438 a, g dbSNP:747412096
441 441 g, t dbSNP:145201971
452 452 c, g dbSNP:574267182
456 456 a, g dbSNP:138801821
465 465 -, t dbSNP:774760398
468 468 c, t dbSNP:55980670
473 473 c, t dbSNP:758404304
482 482 a, c dbSNP:775375747
483 483 -, g dbSNP:35806331
483 483 a, c, t dbSNP:34231464
502 502 a, c dbSNP:140360809
505 505 c, g dbSNP:769863111
506 506 a, g dbSNP:775608689
507 507 a, c, t dbSNP:779609471
510 510 c, g dbSNP:774364369
511 511 a, g dbSNP:761486688
515 515 c, t dbSNP:767383109
516 516 a, t dbSNP:750037039
517 517 a, g dbSNP:149589961
520 520 g, t dbSNP:766140919
524 524 a, g dbSNP:753332434
528 528 a, g dbSNP:754565613
530 530 a, g dbSNP:778376263
534 534 a, c, g dbSNP:752156962
535 535 a, t dbSNP:781670372
541 541 c, g dbSNP:373998952
544 544 -, aca dbSNP:772708128
544 544 a, c dbSNP:769948288
545 545 c, t dbSNP:780264116
546 546 a, g dbSNP:778170724
548 548 g, t dbSNP:768768926
561 561 c, t dbSNP:143554488
562 562 c, g dbSNP:367777041
565 565 c, t dbSNP:771747962
567 567 a, g dbSNP:773000162
573 573 c, t dbSNP:760548554
575 575 a, c dbSNP:766089514
577 577 c, t dbSNP:776445882
585 585 c, t dbSNP:141691706
598 598 c, g dbSNP:200839585
599 599 a, g dbSNP:752007054
618 618 c, g dbSNP:757843329
619 619 c, t dbSNP:767925715
634 634 -, t dbSNP:762082748
636 636 a, g dbSNP:750954022
637 637 a, t dbSNP:121434417
641 641 a, t dbSNP:568812097
643 643 a, g dbSNP:185062260
651 651 c, g dbSNP:766791531
666 666 a, g dbSNP:754044696
679 679 a, g dbSNP:755131943
685 685 c, g dbSNP:779006691
687 687 a, g dbSNP:748217063
702 702 a, g dbSNP:758429876
708 708 c, t dbSNP:777745046
709 709 a, g dbSNP:35973133
717 717 a, g dbSNP:574398307
718 718 a, t dbSNP:372556235
720 720 a, g dbSNP:745674753
724 724 c, t dbSNP:769423606
740 740 a, c dbSNP:536641256
743 743 c, g, t dbSNP:56083112
753 753 g, t dbSNP:773700021
762 762 c, g, t dbSNP:761226009
763 763 c, g, t dbSNP:754133041
764 764 a, c, g, t dbSNP:376819253
765 765 a, g dbSNP:755476693
772 772 c, g dbSNP:751532146
773 773 a, c, g dbSNP:757204543
774 774 a, c, g dbSNP:369168607
775 775 a, g dbSNP:779737736
776 776 a, t dbSNP:748957679
781 781 -, t dbSNP:765011271
783 783 c, g, t dbSNP:142696562
784 784 a, t dbSNP:187868598
787 787 c, t dbSNP:771385869
797 797 a, g, t dbSNP:200446727
800 800 g, t dbSNP:200198618
807 807 a, g dbSNP:201034260
809 809 c, t dbSNP:763144778
820 820 a, t dbSNP:375308110
822 822 a, g dbSNP:761965542
828 828 g, t dbSNP:767750336
847 847 a, g dbSNP:750357066
867 867 c, g dbSNP:755942515
869 869 a, g dbSNP:543232420
872 872 c, t dbSNP:753533981
874 874 c, t dbSNP:147336783
876 876 a, g dbSNP:551370449
882 882 c, t dbSNP:556937566
884 884 c, t dbSNP:371779248
893 893 c, t dbSNP:777207290
896 896 c, g dbSNP:760017395
900 900 a, t dbSNP:746544755
906 906 c, t dbSNP:770135176
911 911 a, g dbSNP:776099461
917 917 c, t dbSNP:749570038
924 924 c, t dbSNP:769195694
929 929 a, c, t dbSNP:112111860
930 930 a, g dbSNP:373000965
933 933 a, g dbSNP:762320529
934 934 a, g dbSNP:773095683
935 935 a, g dbSNP:760837301
939 939 a, g dbSNP:199613098
941 941 a, g dbSNP:753862322
945 945 a, c dbSNP:370428276
947 947 a, g dbSNP:373401690
951 951 a, g dbSNP:765766633
963 963 a, g dbSNP:757988979
966 966 a, g dbSNP:777487568
990 990 c, g dbSNP:750995828
997 997 c, t dbSNP:756816303
1016 1016 a, g dbSNP:780406413
1017 1017 a, g dbSNP:141032424
1029 1029 c, g dbSNP:376126706
1056 1056 a, g dbSNP:779359224
1062 1062 a, g dbSNP:748524936
1067 1067 c, t dbSNP:772142440
1072 1072 c, g dbSNP:773503299
1073 1073 a, g, t dbSNP:760647140
1082 1082 c, t dbSNP:373436827
1103 1103 a, g, t dbSNP:139872191
1108 1108 g, t dbSNP:528180688
1113 1113 a, g dbSNP:201289177
1117 1117 a, g dbSNP:763992306
1129 1129 c, t dbSNP:773874757
1131 1131 a, g dbSNP:761588488
1134 1134 a, g dbSNP:767077000
1137 1137 a, c, t dbSNP:148550671
1139 1139 a, g, t dbSNP:563307237
1140 1140 c, t dbSNP:577188671
1143 1143 a, g dbSNP:778257341
1144 1144 a, g dbSNP:747347346
1146 1146 a, t dbSNP:757434006
1147 1147 c, t dbSNP:781424907
1150 1150 a, c, g, t dbSNP:34970181
1157 1157 c, g dbSNP:749302695
1164 1164 c, t dbSNP:768328319
1168 1168 a, g dbSNP:559805218
1175 1175 c, t dbSNP:151056742
1182 1182 a, g dbSNP:749833502
1184 1184 c, g dbSNP:761539694
1185 1185 c, t dbSNP:200523617
1190 1190 c, t dbSNP:375476260
1203 1203 a, g dbSNP:760241910
1207 1207 a, g dbSNP:766046737
1213 1213 c, t dbSNP:753253207
1217 1217 g, t dbSNP:758874215
1227 1227 a, g dbSNP:548452438
1235 1235 c, t dbSNP:751901947
1236 1236 a, g dbSNP:757593146
1241 1241 c, t dbSNP:781359356
1266 1266 c, g, t dbSNP:746134819
1273 1273 a, g dbSNP:561948192
1276 1276 c, g dbSNP:780171269
1277 1277 a, t dbSNP:186299744
1286 1286 a, g dbSNP:768593608
1346 1346 c, t dbSNP:776148917
1349 1349 c, t dbSNP:531619795
1356 1356 a, g dbSNP:376221874
1366 1366 c, t dbSNP:752045710
1373 1373 -, cat dbSNP:776183665
1378 1378 a, g dbSNP:371436999
1385 1385 a, g dbSNP:533642294
1388 1388 c, t dbSNP:775062694
1391 1391 a, c dbSNP:551844397
1401 1401 a, c dbSNP:756258100
1404 1404 c, t dbSNP:780280883
1405 1405 a, g, t dbSNP:140047318
1406 1406 a, g dbSNP:778890672
1423 1423 a, g, t dbSNP:766596192
1432 1432 a, g dbSNP:369609245
1434 1434 a, t dbSNP:778929099
1449 1449 a, g dbSNP:752827445
1472 1472 a, c, t dbSNP:144080146
1473 1473 g, t dbSNP:746760963
1475 1475 a, g dbSNP:770888722
1481 1481 a, g dbSNP:375459734
1482 1482 c, t dbSNP:745563318
1488 1488 g, t dbSNP:769339843
1494 1494 c, t dbSNP:121434418
1495 1495 a, g dbSNP:121434419
1497 1497 a, g dbSNP:369899177
1505 1505 a, g dbSNP:146773802
1509 1509 c, g dbSNP:748806114
1514 1514 c, t dbSNP:140430323
1531 1531 a, g dbSNP:773752951
1537 1537 c, t dbSNP:761009116
1540 1540 a, c dbSNP:766714132
1554 1554 a, g dbSNP:377255740
1556 1556 c, g dbSNP:112333283
1560 1560 a, c dbSNP:377403247
1565 1565 a, g dbSNP:752775295
1566 1566 c, t dbSNP:758581667
1575 1575 -, ag dbSNP:776768569
1579 1579 a, g dbSNP:764090825
1584 1584 a, g, t dbSNP:751594392
1585 1585 -, a dbSNP:761734095
1585 1585 a, c dbSNP:371155612
1589 1589 -, g dbSNP:770070277
1589 1589 c, t dbSNP:745676484
1591 1591 c, t dbSNP:755219700
1596 1596 c, t dbSNP:6813320
1597 1597 -, tgtt dbSNP:773372957
1620 1620 a, g dbSNP:183489869
1630 1630 c, g dbSNP:563289256
1642 1642 a, g dbSNP:532348507
1649 1649 c, g dbSNP:552181587
1656 1656 a, g dbSNP:374115313
1668 1668 a, g dbSNP:534581040
1673 1673 a, g dbSNP:569581364
1688 1688 c, t dbSNP:1434536
1711 1711 a, g dbSNP:536719640
1724 1724 c, t dbSNP:112992418
1742 1742 ca, tg dbSNP:386677448
1742 1742 c, t dbSNP:11725366
1743 1743 a, g dbSNP:1836261
1749 1749 a, g dbSNP:754142439
1759 1759 c, t dbSNP:745861587
1768 1768 c, t dbSNP:779144644
1827 1827 c, t dbSNP:769707423
1836 1836 -, t dbSNP:757375171
1837 1837 -, t dbSNP:11436086
1840 1840 a, t dbSNP:539266615
1849 1849 a, t dbSNP:77552018
1851 1851 a, g dbSNP:77149358
1885 1885 c, t dbSNP:79791228
1892 1892 a, g dbSNP:558963329
1950 1950 g, t dbSNP:572438891
1960 1960 a, g dbSNP:188703962
1963 1963 a, g dbSNP:758329362
1975 1975 c, t dbSNP:777747043
2011 2011 a, g dbSNP:193193227
2034 2034 g, t dbSNP:183245717
2040 2040 a, g dbSNP:543508771
2046 2046 c, t dbSNP:573304132
2062 2062 c, t dbSNP:748768110
2071 2071 c, t dbSNP:770792059
2153 2153 -, ac dbSNP:146159076
2188 2188 c, t dbSNP:17023107
2231 2231 g, t dbSNP:546008301
2239 2239 a, g dbSNP:555876249
2278 2278 c, t dbSNP:774194750
2309 2309 c, t dbSNP:574500341
2344 2344 a, g dbSNP:373221128
2350 2350 -, ttttttttttttt dbSNP:764691449
2350 2350 -, ttttt dbSNP:767551750
2350 2350 c, t dbSNP:373214817
2351 2351 -, tttttttttttt dbSNP:771633924
2352 2352 -, tttttttttttt dbSNP:767363680
2352 2352 -, ttttttttttt dbSNP:745414771
2371 2371 -, ttttttttttt dbSNP:548956012
2378 2378 -, tttt dbSNP:560067004
2383 2383 a, g dbSNP:559672287
2403 2403 g, t dbSNP:528362102
2407 2407 c, t dbSNP:188311185
2422 2422 -, attcaaaggatcaatattaaat dbSNP:111971137
2437 2437 a, g dbSNP:148298750
2455 2455 a, g dbSNP:745534077
2457 2457 a, g dbSNP:141438374
2462 2462 g, t dbSNP:550400234
2487 2487 a, g dbSNP:61443337
2533 2533 a, g dbSNP:570553942
2534 2534 a, g dbSNP:538840799
2536 2536 a, g dbSNP:11097457
2538 2538 a, t dbSNP:150827995
2555 2555 a, g dbSNP:59105855
2560 2560 c, t dbSNP:191551226
2605 2605 -, aaaa dbSNP:754434665
2624 2624 a, g dbSNP:554850187
2659 2659 -, tgtc dbSNP:537668325
2660 2660 a, g dbSNP:139279847
2663 2663 a, t dbSNP:183694616
2704 2704 a, g dbSNP:775047830
2734 2734 a, t dbSNP:557155390
2750 2750 a, g dbSNP:577303456
2757 2757 c, t dbSNP:545998639
2777 2777 g, t dbSNP:762511603
2877 2877 c, t dbSNP:559562363
2907 2907 a, g dbSNP:761096257
2908 2908 a, g dbSNP:56738985
2918 2918 a, g dbSNP:542105565
2922 2922 a, t dbSNP:370915593
2976 2976 c, t dbSNP:562009093
3015 3015 a, g dbSNP:773736447
3018 3018 -, aat dbSNP:145279069
3029 3029 c, g dbSNP:753954482
3080 3080 c, t dbSNP:761043331
3081 3081 a, g dbSNP:766867649
3106 3106 a, g dbSNP:2289044
3176 3176 a, g dbSNP:550583235
3193 3193 -, t dbSNP:565280551
3193 3193 g, t dbSNP:74645391
3207 3207 a, t dbSNP:570367865
3236 3236 a, g dbSNP:533016171
3243 3243 g, t dbSNP:546290295
3251 3251 c, t dbSNP:563721806
3254 3254 a, g dbSNP:186753977
3310 3310 c, t dbSNP:765546645
3331 3331 c, g dbSNP:752875395
3336 3336 c, g dbSNP:758477107
3356 3356 c, t dbSNP:561742257
3361 3361 a, g dbSNP:538267344
3389 3389 a, g dbSNP:554842235
3390 3390 c, g dbSNP:777675339
3429 3429 a, t dbSNP:568766919
3446 3446 a, g dbSNP:372385843
3513 3513 a, g dbSNP:752977059
3518 3518 c, g dbSNP:191224787
3519 3519 a, c dbSNP:185854880
3526 3526 c, t dbSNP:370452157
3529 3529 -, a dbSNP:746433268
3540 3540 -, a dbSNP:58613735
3540 3540 a, t dbSNP:200257459
3595 3595 c, t dbSNP:539897297
3596 3596 g, t dbSNP:190367204
3612 3612 c, t dbSNP:376211295
3623 3623 c, g dbSNP:745657051
3630 3630 a, g dbSNP:573066070
3632 3632 a, t dbSNP:769494319
3672 3672 g, t dbSNP:568153337
3703 3703 c, t dbSNP:115505973
3718 3718 c, t dbSNP:748788086
3721 3721 c, g dbSNP:575460895
3737 3737 a, c dbSNP:544198254
3760 3760 a, c dbSNP:768241828
3763 3763 c, g dbSNP:564061209
3764 3764 c, t dbSNP:532795780
3768 3768 a, g dbSNP:546277742
3770 3770 a, g dbSNP:559864027
3775 3775 a, g dbSNP:773682819
3777 3777 a, g, t dbSNP:529425822
3779 3779 a, t dbSNP:528642618
3787 3787 a, t dbSNP:548411357
3804 3804 c, g dbSNP:551173634
3817 3817 a, c dbSNP:759961764
3849 3849 a, g dbSNP:765599516
3854 3854 c, t dbSNP:569546552
3879 3879 a, t dbSNP:73839218
3897 3897 c, t dbSNP:1863654
3905 3905 a, g dbSNP:764248738
3958 3958 a, t dbSNP:145989039
3959 3959 c, t dbSNP:757253087
3980 3980 a, g dbSNP:139936115
4000 4000 a, g dbSNP:143459680
4043 4043 a, g dbSNP:181930964
4155 4155 g, t dbSNP:535968542
4157 4157 -, attt dbSNP:754999131
4165 4165 a, t dbSNP:529036699
4173 4173 a, t dbSNP:750265994
4195 4195 a, c dbSNP:755871790
4210 4210 g, t dbSNP:555509616
4249 4249 a, g dbSNP:575346915
4304 4304 a, t dbSNP:544451944
4323 4323 a, g dbSNP:1434535
4337 4337 a, g dbSNP:577213345
4407 4407 c, t dbSNP:747757463
4451 4451 a, g dbSNP:574095178
4496 4496 a, g dbSNP:535266062
4509 4509 g, t dbSNP:559802311
4519 4519 -, tatatatatatatatat dbSNP:553525105
4569 4569 a, g dbSNP:185008757
4581 4581 a, g dbSNP:189906922
4599 4599 a, c dbSNP:562262992
4600 4600 a, g dbSNP:144649830
4606 4606 c, t dbSNP:181152855
4622 4622 -, aat dbSNP:778035519
4648 4648 a, g dbSNP:556715070
4711 4711 c, g dbSNP:778487949
4766 4766 c, t dbSNP:185607229
4768 4768 c, t dbSNP:2162450
4802 4802 c, g dbSNP:2162449
4810 4810 c, t dbSNP:189974357
4819 4819 a, g dbSNP:555586650
4824 4824 a, t dbSNP:148400273
4827 4827 a, g dbSNP:545888520
4850 4850 a, g dbSNP:12505161
4851 4851 a, t dbSNP:531959675
4874 4874 a, c dbSNP:577552465
4875 4875 a, g dbSNP:7676885
4897 4897 c, t dbSNP:548853038
4936 4936 c, t dbSNP:553325789
4968 4968 c, g dbSNP:572703652
5031 5031 a, g dbSNP:540232461
5036 5036 a, g dbSNP:142488637
5121 5121 g, t dbSNP:372742440
5124 5124 a, g dbSNP:562486269
5137 5137 a, g dbSNP:377150654
5152 5152 a, g dbSNP:760084321
5165 5165 a, g dbSNP:76804339
5180 5180 c, g dbSNP:564684916
5193 5193 a, g dbSNP:529009401
5200 5200 c, t dbSNP:180838558
5209 5209 c, t dbSNP:763243833
5226 5226 a, g dbSNP:568350802
5238 5238 c, t dbSNP:529344145
5299 5299 c, t dbSNP:764220270
5300 5300 -, t dbSNP:550725580
5321 5321 a, c dbSNP:368327814

Target ORF information:

RefSeq Version XM_011532202
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11503
Clone ID Related Accession (Same CDS sequence) NM_001203 , NM_001256792 , NM_001256794 , XM_011532201 , XM_011532202
Accession Version NM_001203.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1509bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product bone morphogenetic protein receptor type-1B isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW299723.1, BC069796.1 and AC105395.1. This sequence is a reference standard in the RefSeqGene project. On or before Aug 31, 2013 this sequence version replaced gi:530378070, gi:4502430. Summary: This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]. Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and published data. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U89326.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2145245 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_001194.1
Misc Feature(1)251..253(+)
Misc Feature(2)362..604(+)
Misc Feature(3)653..718(+)
Misc Feature(4)866..1780(+)
Misc Feature(5)893..1741(+)
Misc Feature(6)902..1402(+)
Misc Feature(7)902..1324(+)
Misc Feature(8)914..1402(+)
Misc Feature(9)995..1072(+)
Misc Feature(10)1319..1402(+)
Exon (1)1..92
Gene Synonym:
Exon (2)93..162
Gene Synonym:
Exon (3)163..257
Gene Synonym:
Exon (4)258..417
Gene Synonym:
Exon (5)418..520
Gene Synonym:
Exon (6)521..623
Gene Synonym:
Exon (7)624..720
Gene Synonym:
Exon (8)721..859
Gene Synonym:
Exon (9)860..1052
Gene Synonym:
Exon (10)1053..1350
Gene Synonym:
Exon (11)1351..1526
Gene Synonym:
Exon (12)1527..1657
Gene Synonym:
Exon (13)1658..5560
Gene Synonym:
Position Chain Variation Link
46 46 c, t dbSNP:563992994
93 93 a, g dbSNP:143230133
146 146 a, g dbSNP:148290279
158 158 c, t dbSNP:75697273
187 187 c, g dbSNP:756448612
196 196 c, t dbSNP:780424050
198 198 g, t dbSNP:376977648
245 245 c, t dbSNP:117271963
267 267 c, t dbSNP:770844919
268 268 g, t dbSNP:776714886
285 285 a, c, g dbSNP:150974461
290 290 a, g dbSNP:143885868
292 292 a, g dbSNP:536960015
311 311 a, g dbSNP:111612269
314 314 a, c dbSNP:763496728
331 331 c, g dbSNP:773850751
336 336 c, t dbSNP:190883013
340 340 c, t dbSNP:766827991
344 344 a, g dbSNP:754365645
346 346 c, g, t dbSNP:148603233
348 348 a, c, g dbSNP:145700191
350 350 c, t dbSNP:758706811
351 351 a, c, g dbSNP:377000102
354 354 c, g dbSNP:757312834
359 359 g, t dbSNP:773417270
365 365 c, t dbSNP:745854387
366 366 a, g dbSNP:200035802
376 376 c, t dbSNP:766432447
395 395 g, t dbSNP:775495653
403 403 -, caa dbSNP:754433500
407 407 a, t dbSNP:749047942
421 421 a, g dbSNP:756055104
424 424 c, t dbSNP:147320212
439 439 a, c, g dbSNP:749067196
472 472 a, g dbSNP:778604737
488 488 c, t dbSNP:759149974
499 499 a, g dbSNP:747796220
503 503 g, t dbSNP:200702974
514 514 a, g dbSNP:772766219
521 521 a, c, g, t dbSNP:369807264
522 522 a, c, g dbSNP:140970485
524 524 a, g, t dbSNP:192392906
525 525 c, t dbSNP:200083866
527 527 c, t dbSNP:762270033
528 528 c, g dbSNP:767805662
529 529 c, t dbSNP:144813372
541 541 a, t dbSNP:558142045
546 546 g, t dbSNP:376183647
554 554 a, g dbSNP:200886063
555 555 a, c, t dbSNP:139161475
563 563 a, g, t dbSNP:759423600
564 564 a, c, g dbSNP:151289886
565 565 a, g dbSNP:758222007
574 574 c, t dbSNP:140499888
594 594 a, t dbSNP:746713318
604 604 c, g dbSNP:756763148
623 623 a, g dbSNP:571763786
630 630 g, t dbSNP:541202129
637 637 a, c dbSNP:780913868
644 644 c, t dbSNP:759803347
659 659 c, t dbSNP:755669488
665 665 a, t dbSNP:561117066
669 669 g, t dbSNP:150002205
671 671 a, c dbSNP:772559135
673 673 c, t dbSNP:773770090
674 674 a, g dbSNP:747412096
677 677 g, t dbSNP:145201971
688 688 c, g dbSNP:574267182
692 692 a, g dbSNP:138801821
701 701 -, t dbSNP:774760398
704 704 c, t dbSNP:55980670
709 709 c, t dbSNP:758404304
718 718 a, c dbSNP:775375747
719 719 -, g dbSNP:35806331
719 719 a, c, t dbSNP:34231464
738 738 a, c dbSNP:140360809
741 741 c, g dbSNP:769863111
742 742 a, g dbSNP:775608689
743 743 a, c, t dbSNP:779609471
746 746 c, g dbSNP:774364369
747 747 a, g dbSNP:761486688
751 751 c, t dbSNP:767383109
752 752 a, t dbSNP:750037039
753 753 a, g dbSNP:149589961
756 756 g, t dbSNP:766140919
760 760 a, g dbSNP:753332434
764 764 a, g dbSNP:754565613
766 766 a, g dbSNP:778376263
770 770 a, c, g dbSNP:752156962
771 771 a, t dbSNP:781670372
777 777 c, g dbSNP:373998952
780 780 -, aca dbSNP:772708128
780 780 a, c dbSNP:769948288
781 781 c, t dbSNP:780264116
782 782 a, g dbSNP:778170724
784 784 g, t dbSNP:768768926
797 797 c, t dbSNP:143554488
798 798 c, g dbSNP:367777041
801 801 c, t dbSNP:771747962
803 803 a, g dbSNP:773000162
809 809 c, t dbSNP:760548554
811 811 a, c dbSNP:766089514
813 813 c, t dbSNP:776445882
821 821 c, t dbSNP:141691706
834 834 c, g dbSNP:200839585
835 835 a, g dbSNP:752007054
854 854 c, g dbSNP:757843329
855 855 c, t dbSNP:767925715
870 870 -, t dbSNP:762082748
872 872 a, g dbSNP:750954022
873 873 a, t dbSNP:121434417
877 877 a, t dbSNP:568812097
879 879 a, g dbSNP:185062260
887 887 c, g dbSNP:766791531
902 902 a, g dbSNP:754044696
915 915 a, g dbSNP:755131943
921 921 c, g dbSNP:779006691
923 923 a, g dbSNP:748217063
938 938 a, g dbSNP:758429876
944 944 c, t dbSNP:777745046
945 945 a, g dbSNP:35973133
953 953 a, g dbSNP:574398307
954 954 a, t dbSNP:372556235
956 956 a, g dbSNP:745674753
960 960 c, t dbSNP:769423606
976 976 a, c dbSNP:536641256
979 979 c, g, t dbSNP:56083112
989 989 g, t dbSNP:773700021
998 998 c, g, t dbSNP:761226009
999 999 c, g, t dbSNP:754133041
1000 1000 a, c, g, t dbSNP:376819253
1001 1001 a, g dbSNP:755476693
1008 1008 c, g dbSNP:751532146
1009 1009 a, c, g dbSNP:757204543
1010 1010 a, c, g dbSNP:369168607
1011 1011 a, g dbSNP:779737736
1012 1012 a, t dbSNP:748957679
1017 1017 -, t dbSNP:765011271
1019 1019 c, g, t dbSNP:142696562
1020 1020 a, t dbSNP:187868598
1023 1023 c, t dbSNP:771385869
1033 1033 a, g, t dbSNP:200446727
1036 1036 g, t dbSNP:200198618
1043 1043 a, g dbSNP:201034260
1045 1045 c, t dbSNP:763144778
1056 1056 a, t dbSNP:375308110
1058 1058 a, g dbSNP:761965542
1064 1064 g, t dbSNP:767750336
1083 1083 a, g dbSNP:750357066
1103 1103 c, g dbSNP:755942515
1105 1105 a, g dbSNP:543232420
1108 1108 c, t dbSNP:753533981
1110 1110 c, t dbSNP:147336783
1112 1112 a, g dbSNP:551370449
1118 1118 c, t dbSNP:556937566
1120 1120 c, t dbSNP:371779248
1129 1129 c, t dbSNP:777207290
1132 1132 c, g dbSNP:760017395
1136 1136 a, t dbSNP:746544755
1142 1142 c, t dbSNP:770135176
1147 1147 a, g dbSNP:776099461
1153 1153 c, t dbSNP:749570038
1160 1160 c, t dbSNP:769195694
1165 1165 a, c, t dbSNP:112111860
1166 1166 a, g dbSNP:373000965
1169 1169 a, g dbSNP:762320529
1170 1170 a, g dbSNP:773095683
1171 1171 a, g dbSNP:760837301
1175 1175 a, g dbSNP:199613098
1177 1177 a, g dbSNP:753862322
1181 1181 a, c dbSNP:370428276
1183 1183 a, g dbSNP:373401690
1187 1187 a, g dbSNP:765766633
1199 1199 a, g dbSNP:757988979
1202 1202 a, g dbSNP:777487568
1226 1226 c, g dbSNP:750995828
1233 1233 c, t dbSNP:756816303
1252 1252 a, g dbSNP:780406413
1253 1253 a, g dbSNP:141032424
1265 1265 c, g dbSNP:376126706
1292 1292 a, g dbSNP:779359224
1298 1298 a, g dbSNP:748524936
1303 1303 c, t dbSNP:772142440
1308 1308 c, g dbSNP:773503299
1309 1309 a, g, t dbSNP:760647140
1318 1318 c, t dbSNP:373436827
1339 1339 a, g, t dbSNP:139872191
1344 1344 g, t dbSNP:528180688
1349 1349 a, g dbSNP:201289177
1353 1353 a, g dbSNP:763992306
1365 1365 c, t dbSNP:773874757
1367 1367 a, g dbSNP:761588488
1370 1370 a, g dbSNP:767077000
1373 1373 a, c, t dbSNP:148550671
1375 1375 a, g, t dbSNP:563307237
1376 1376 c, t dbSNP:577188671
1379 1379 a, g dbSNP:778257341
1380 1380 a, g dbSNP:747347346
1382 1382 a, t dbSNP:757434006
1383 1383 c, t dbSNP:781424907
1386 1386 a, c, g, t dbSNP:34970181
1393 1393 c, g dbSNP:749302695
1400 1400 c, t dbSNP:768328319
1404 1404 a, g dbSNP:559805218
1411 1411 c, t dbSNP:151056742
1418 1418 a, g dbSNP:749833502
1420 1420 c, g dbSNP:761539694
1421 1421 c, t dbSNP:200523617
1426 1426 c, t dbSNP:375476260
1439 1439 a, g dbSNP:760241910
1443 1443 a, g dbSNP:766046737
1449 1449 c, t dbSNP:753253207
1453 1453 g, t dbSNP:758874215
1463 1463 a, g dbSNP:548452438
1471 1471 c, t dbSNP:751901947
1472 1472 a, g dbSNP:757593146
1477 1477 c, t dbSNP:781359356
1502 1502 c, g, t dbSNP:746134819
1509 1509 a, g dbSNP:561948192
1512 1512 c, g dbSNP:780171269
1513 1513 a, t dbSNP:186299744
1522 1522 a, g dbSNP:768593608
1582 1582 c, t dbSNP:776148917
1585 1585 c, t dbSNP:531619795
1592 1592 a, g dbSNP:376221874
1602 1602 c, t dbSNP:752045710
1609 1609 -, cat dbSNP:776183665
1614 1614 a, g dbSNP:371436999
1621 1621 a, g dbSNP:533642294
1624 1624 c, t dbSNP:775062694
1627 1627 a, c dbSNP:551844397
1637 1637 a, c dbSNP:756258100
1640 1640 c, t dbSNP:780280883
1641 1641 a, g, t dbSNP:140047318
1642 1642 a, g dbSNP:778890672
1659 1659 a, g, t dbSNP:766596192
1668 1668 a, g dbSNP:369609245
1670 1670 a, t dbSNP:778929099
1685 1685 a, g dbSNP:752827445
1708 1708 a, c, t dbSNP:144080146
1709 1709 g, t dbSNP:746760963
1711 1711 a, g dbSNP:770888722
1717 1717 a, g dbSNP:375459734
1718 1718 c, t dbSNP:745563318
1724 1724 g, t dbSNP:769339843
1730 1730 c, t dbSNP:121434418
1731 1731 a, g dbSNP:121434419
1733 1733 a, g dbSNP:369899177
1741 1741 a, g dbSNP:146773802
1745 1745 c, g dbSNP:748806114
1750 1750 c, t dbSNP:140430323
1767 1767 a, g dbSNP:773752951
1773 1773 c, t dbSNP:761009116
1776 1776 a, c dbSNP:766714132
1790 1790 a, g dbSNP:377255740
1792 1792 c, g dbSNP:112333283
1796 1796 a, c dbSNP:377403247
1801 1801 a, g dbSNP:752775295
1802 1802 c, t dbSNP:758581667
1811 1811 -, ag dbSNP:776768569
1815 1815 a, g dbSNP:764090825
1820 1820 a, g, t dbSNP:751594392
1821 1821 -, a dbSNP:761734095
1821 1821 a, c dbSNP:371155612
1825 1825 -, g dbSNP:770070277
1825 1825 c, t dbSNP:745676484
1827 1827 c, t dbSNP:755219700
1832 1832 c, t dbSNP:6813320
1833 1833 -, tgtt dbSNP:773372957
1856 1856 a, g dbSNP:183489869
1866 1866 c, g dbSNP:563289256
1878 1878 a, g dbSNP:532348507
1885 1885 c, g dbSNP:552181587
1892 1892 a, g dbSNP:374115313
1904 1904 a, g dbSNP:534581040
1909 1909 a, g dbSNP:569581364
1924 1924 c, t dbSNP:1434536
1947 1947 a, g dbSNP:536719640
1960 1960 c, t dbSNP:112992418
1978 1978 ca, tg dbSNP:386677448
1978 1978 c, t dbSNP:11725366
1979 1979 a, g dbSNP:1836261
1985 1985 a, g dbSNP:754142439
1995 1995 c, t dbSNP:745861587
2004 2004 c, t dbSNP:779144644
2063 2063 c, t dbSNP:769707423
2072 2072 -, t dbSNP:757375171
2073 2073 -, t dbSNP:11436086
2076 2076 a, t dbSNP:539266615
2085 2085 a, t dbSNP:77552018
2087 2087 a, g dbSNP:77149358
2121 2121 c, t dbSNP:79791228
2128 2128 a, g dbSNP:558963329
2186 2186 g, t dbSNP:572438891
2196 2196 a, g dbSNP:188703962
2199 2199 a, g dbSNP:758329362
2211 2211 c, t dbSNP:777747043
2247 2247 a, g dbSNP:193193227
2270 2270 g, t dbSNP:183245717
2276 2276 a, g dbSNP:543508771
2282 2282 c, t dbSNP:573304132
2298 2298 c, t dbSNP:748768110
2307 2307 c, t dbSNP:770792059
2389 2389 -, ac dbSNP:146159076
2424 2424 c, t dbSNP:17023107
2467 2467 g, t dbSNP:546008301
2475 2475 a, g dbSNP:555876249
2514 2514 c, t dbSNP:774194750
2545 2545 c, t dbSNP:574500341
2580 2580 a, g dbSNP:373221128
2586 2586 -, ttttttttttttt dbSNP:764691449
2586 2586 -, ttttt dbSNP:767551750
2586 2586 c, t dbSNP:373214817
2587 2587 -, tttttttttttt dbSNP:771633924
2588 2588 -, tttttttttttt dbSNP:767363680
2588 2588 -, ttttttttttt dbSNP:745414771
2607 2607 -, ttttttttttt dbSNP:548956012
2614 2614 -, tttt dbSNP:560067004
2619 2619 a, g dbSNP:559672287
2639 2639 g, t dbSNP:528362102
2643 2643 c, t dbSNP:188311185
2658 2658 -, attcaaaggatcaatattaaat dbSNP:111971137
2673 2673 a, g dbSNP:148298750
2691 2691 a, g dbSNP:745534077
2693 2693 a, g dbSNP:141438374
2698 2698 g, t dbSNP:550400234
2723 2723 a, g dbSNP:61443337
2769 2769 a, g dbSNP:570553942
2770 2770 a, g dbSNP:538840799
2772 2772 a, g dbSNP:11097457
2774 2774 a, t dbSNP:150827995
2791 2791 a, g dbSNP:59105855
2796 2796 c, t dbSNP:191551226
2841 2841 -, aaaa dbSNP:754434665
2860 2860 a, g dbSNP:554850187
2895 2895 -, tgtc dbSNP:537668325
2896 2896 a, g dbSNP:139279847
2899 2899 a, t dbSNP:183694616
2940 2940 a, g dbSNP:775047830
2970 2970 a, t dbSNP:557155390
2986 2986 a, g dbSNP:577303456
2993 2993 c, t dbSNP:545998639
3013 3013 g, t dbSNP:762511603
3113 3113 c, t dbSNP:559562363
3143 3143 a, g dbSNP:761096257
3144 3144 a, g dbSNP:56738985
3154 3154 a, g dbSNP:542105565
3158 3158 a, t dbSNP:370915593
3212 3212 c, t dbSNP:562009093
3251 3251 a, g dbSNP:773736447
3254 3254 -, aat dbSNP:145279069
3265 3265 c, g dbSNP:753954482
3316 3316 c, t dbSNP:761043331
3317 3317 a, g dbSNP:766867649
3342 3342 a, g dbSNP:2289044
3412 3412 a, g dbSNP:550583235
3429 3429 -, t dbSNP:565280551
3429 3429 g, t dbSNP:74645391
3443 3443 a, t dbSNP:570367865
3472 3472 a, g dbSNP:533016171
3479 3479 g, t dbSNP:546290295
3487 3487 c, t dbSNP:563721806
3490 3490 a, g dbSNP:186753977
3546 3546 c, t dbSNP:765546645
3567 3567 c, g dbSNP:752875395
3572 3572 c, g dbSNP:758477107
3592 3592 c, t dbSNP:561742257
3597 3597 a, g dbSNP:538267344
3625 3625 a, g dbSNP:554842235
3626 3626 c, g dbSNP:777675339
3665 3665 a, t dbSNP:568766919
3682 3682 a, g dbSNP:372385843
3749 3749 a, g dbSNP:752977059
3754 3754 c, g dbSNP:191224787
3755 3755 a, c dbSNP:185854880
3762 3762 c, t dbSNP:370452157
3765 3765 -, a dbSNP:746433268
3776 3776 -, a dbSNP:58613735
3776 3776 a, t dbSNP:200257459
3831 3831 c, t dbSNP:539897297
3832 3832 g, t dbSNP:190367204
3848 3848 c, t dbSNP:376211295
3859 3859 c, g dbSNP:745657051
3866 3866 a, g dbSNP:573066070
3868 3868 a, t dbSNP:769494319
3908 3908 g, t dbSNP:568153337
3939 3939 c, t dbSNP:115505973
3954 3954 c, t dbSNP:748788086
3957 3957 c, g dbSNP:575460895
3973 3973 a, c dbSNP:544198254
3996 3996 a, c dbSNP:768241828
3999 3999 c, g dbSNP:564061209
4000 4000 c, t dbSNP:532795780
4004 4004 a, g dbSNP:546277742
4006 4006 a, g dbSNP:559864027
4011 4011 a, g dbSNP:773682819
4013 4013 a, g, t dbSNP:529425822
4015 4015 a, t dbSNP:528642618
4023 4023 a, t dbSNP:548411357
4040 4040 c, g dbSNP:551173634
4053 4053 a, c dbSNP:759961764
4085 4085 a, g dbSNP:765599516
4090 4090 c, t dbSNP:569546552
4115 4115 a, t dbSNP:73839218
4133 4133 c, t dbSNP:1863654
4141 4141 a, g dbSNP:764248738
4194 4194 a, t dbSNP:145989039
4195 4195 c, t dbSNP:757253087
4216 4216 a, g dbSNP:139936115
4236 4236 a, g dbSNP:143459680
4279 4279 a, g dbSNP:181930964
4391 4391 g, t dbSNP:535968542
4393 4393 -, attt dbSNP:754999131
4401 4401 a, t dbSNP:529036699
4409 4409 a, t dbSNP:750265994
4431 4431 a, c dbSNP:755871790
4446 4446 g, t dbSNP:555509616
4485 4485 a, g dbSNP:575346915
4540 4540 a, t dbSNP:544451944
4559 4559 a, g dbSNP:1434535
4573 4573 a, g dbSNP:577213345
4643 4643 c, t dbSNP:747757463
4687 4687 a, g dbSNP:574095178
4732 4732 a, g dbSNP:535266062
4745 4745 g, t dbSNP:559802311
4755 4755 -, tatatatatatatatat dbSNP:553525105
4805 4805 a, g dbSNP:185008757
4817 4817 a, g dbSNP:189906922
4835 4835 a, c dbSNP:562262992
4836 4836 a, g dbSNP:144649830
4842 4842 c, t dbSNP:181152855
4858 4858 -, aat dbSNP:778035519
4884 4884 a, g dbSNP:556715070
4947 4947 c, g dbSNP:778487949
5002 5002 c, t dbSNP:185607229
5004 5004 c, t dbSNP:2162450
5038 5038 c, g dbSNP:2162449
5046 5046 c, t dbSNP:189974357
5055 5055 a, g dbSNP:555586650
5060 5060 a, t dbSNP:148400273
5063 5063 a, g dbSNP:545888520
5086 5086 a, g dbSNP:12505161
5087 5087 a, t dbSNP:531959675
5110 5110 a, c dbSNP:577552465
5111 5111 a, g dbSNP:7676885
5133 5133 c, t dbSNP:548853038
5172 5172 c, t dbSNP:553325789
5204 5204 c, g dbSNP:572703652
5267 5267 a, g dbSNP:540232461
5272 5272 a, g dbSNP:142488637
5357 5357 g, t dbSNP:372742440
5360 5360 a, g dbSNP:562486269
5373 5373 a, g dbSNP:377150654
5388 5388 a, g dbSNP:760084321
5401 5401 a, g dbSNP:76804339
5416 5416 c, g dbSNP:564684916
5429 5429 a, g dbSNP:529009401
5436 5436 c, t dbSNP:180838558
5445 5445 c, t dbSNP:763243833
5462 5462 a, g dbSNP:568350802
5474 5474 c, t dbSNP:529344145
5535 5535 c, t dbSNP:764220270
5536 5536 -, t dbSNP:550725580
5557 5557 a, c dbSNP:368327814

Target ORF information:

RefSeq Version NM_001203
Organism Homo sapiens (human)
Definition Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11503
Clone ID Related Accession (Same CDS sequence) NM_001203 , NM_001256792 , NM_001256794 , XM_011532201 , XM_011532202
Accession Version NM_001256792.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1509bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product bone morphogenetic protein receptor type-1B isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK313642.1, AC092609.2 and AC105395.1. Summary: This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]. Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK313642.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1970526, SAMEA2145743 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_001243721.1
Misc Feature(1)111..113(+)
Misc Feature(2)258..500(+)
Misc Feature(3)549..614(+)
Misc Feature(4)762..1676(+)
Misc Feature(5)789..1637(+)
Misc Feature(6)798..1298(+)
Misc Feature(7)798..1220(+)
Misc Feature(8)810..1298(+)
Misc Feature(9)891..968(+)
Misc Feature(10)1215..1298(+)
Exon (1)1..153
Gene Synonym:
Exon (2)154..313
Gene Synonym:
Exon (3)314..416
Gene Synonym:
Exon (4)417..519
Gene Synonym:
Exon (5)520..616
Gene Synonym:
Exon (6)617..755
Gene Synonym:
Exon (7)756..948
Gene Synonym:
Exon (8)949..1246
Gene Synonym:
Exon (9)1247..1422
Gene Synonym:
Exon (10)1423..1553
Gene Synonym:
Exon (11)1554..5456
Gene Synonym:
Position Chain Variation Link
29 29 a, t dbSNP:534044375
55 55 c, t dbSNP:772723493
81 81 g, t dbSNP:577933017
88 88 c, g dbSNP:760112119
101 101 c, g dbSNP:373923624
103 103 a, g dbSNP:748014144
153 153 a, g dbSNP:553241474
163 163 c, t dbSNP:770844919
164 164 g, t dbSNP:776714886
181 181 a, c, g dbSNP:150974461
186 186 a, g dbSNP:143885868
188 188 a, g dbSNP:536960015
207 207 a, g dbSNP:111612269
210 210 a, c dbSNP:763496728
227 227 c, g dbSNP:773850751
232 232 c, t dbSNP:190883013
236 236 c, t dbSNP:766827991
240 240 a, g dbSNP:754365645
242 242 c, g, t dbSNP:148603233
244 244 a, c, g dbSNP:145700191
246 246 c, t dbSNP:758706811
247 247 a, c, g dbSNP:377000102
250 250 c, g dbSNP:757312834
255 255 g, t dbSNP:773417270
261 261 c, t dbSNP:745854387
262 262 a, g dbSNP:200035802
272 272 c, t dbSNP:766432447
291 291 g, t dbSNP:775495653
299 299 -, caa dbSNP:754433500
303 303 a, t dbSNP:749047942
317 317 a, g dbSNP:756055104
320 320 c, t dbSNP:147320212
335 335 a, c, g dbSNP:749067196
368 368 a, g dbSNP:778604737
384 384 c, t dbSNP:759149974
395 395 a, g dbSNP:747796220
399 399 g, t dbSNP:200702974
410 410 a, g dbSNP:772766219
417 417 a, c, g, t dbSNP:369807264
418 418 a, c, g dbSNP:140970485
420 420 a, g, t dbSNP:192392906
421 421 c, t dbSNP:200083866
423 423 c, t dbSNP:762270033
424 424 c, g dbSNP:767805662
425 425 c, t dbSNP:144813372
437 437 a, t dbSNP:558142045
442 442 g, t dbSNP:376183647
450 450 a, g dbSNP:200886063
451 451 a, c, t dbSNP:139161475
459 459 a, g, t dbSNP:759423600
460 460 a, c, g dbSNP:151289886
461 461 a, g dbSNP:758222007
470 470 c, t dbSNP:140499888
490 490 a, t dbSNP:746713318
500 500 c, g dbSNP:756763148
519 519 a, g dbSNP:571763786
526 526 g, t dbSNP:541202129
533 533 a, c dbSNP:780913868
540 540 c, t dbSNP:759803347
555 555 c, t dbSNP:755669488
561 561 a, t dbSNP:561117066
565 565 g, t dbSNP:150002205
567 567 a, c dbSNP:772559135
569 569 c, t dbSNP:773770090
570 570 a, g dbSNP:747412096
573 573 g, t dbSNP:145201971
584 584 c, g dbSNP:574267182
588 588 a, g dbSNP:138801821
597 597 -, t dbSNP:774760398
600 600 c, t dbSNP:55980670
605 605 c, t dbSNP:758404304
614 614 a, c dbSNP:775375747
615 615 -, g dbSNP:35806331
615 615 a, c, t dbSNP:34231464
634 634 a, c dbSNP:140360809
637 637 c, g dbSNP:769863111
638 638 a, g dbSNP:775608689
639 639 a, c, t dbSNP:779609471
642 642 c, g dbSNP:774364369
643 643 a, g dbSNP:761486688
647 647 c, t dbSNP:767383109
648 648 a, t dbSNP:750037039
649 649 a, g dbSNP:149589961
652 652 g, t dbSNP:766140919
656 656 a, g dbSNP:753332434
660 660 a, g dbSNP:754565613
662 662 a, g dbSNP:778376263
666 666 a, c, g dbSNP:752156962
667 667 a, t dbSNP:781670372
673 673 c, g dbSNP:373998952
676 676 -, aca dbSNP:772708128
676 676 a, c dbSNP:769948288
677 677 c, t dbSNP:780264116
678 678 a, g dbSNP:778170724
680 680 g, t dbSNP:768768926
693 693 c, t dbSNP:143554488
694 694 c, g dbSNP:367777041
697 697 c, t dbSNP:771747962
699 699 a, g dbSNP:773000162
705 705 c, t dbSNP:760548554
707 707 a, c dbSNP:766089514
709 709 c, t dbSNP:776445882
717 717 c, t dbSNP:141691706
730 730 c, g dbSNP:200839585
731 731 a, g dbSNP:752007054
750 750 c, g dbSNP:757843329
751 751 c, t dbSNP:767925715
766 766 -, t dbSNP:762082748
768 768 a, g dbSNP:750954022
769 769 a, t dbSNP:121434417
773 773 a, t dbSNP:568812097
775 775 a, g dbSNP:185062260
783 783 c, g dbSNP:766791531
798 798 a, g dbSNP:754044696
811 811 a, g dbSNP:755131943
817 817 c, g dbSNP:779006691
819 819 a, g dbSNP:748217063
834 834 a, g dbSNP:758429876
840 840 c, t dbSNP:777745046
841 841 a, g dbSNP:35973133
849 849 a, g dbSNP:574398307
850 850 a, t dbSNP:372556235
852 852 a, g dbSNP:745674753
856 856 c, t dbSNP:769423606
872 872 a, c dbSNP:536641256
875 875 c, g, t dbSNP:56083112
885 885 g, t dbSNP:773700021
894 894 c, g, t dbSNP:761226009
895 895 c, g, t dbSNP:754133041
896 896 a, c, g, t dbSNP:376819253
897 897 a, g dbSNP:755476693
904 904 c, g dbSNP:751532146
905 905 a, c, g dbSNP:757204543
906 906 a, c, g dbSNP:369168607
907 907 a, g dbSNP:779737736
908 908 a, t dbSNP:748957679
913 913 -, t dbSNP:765011271
915 915 c, g, t dbSNP:142696562
916 916 a, t dbSNP:187868598
919 919 c, t dbSNP:771385869
929 929 a, g, t dbSNP:200446727
932 932 g, t dbSNP:200198618
939 939 a, g dbSNP:201034260
941 941 c, t dbSNP:763144778
952 952 a, t dbSNP:375308110
954 954 a, g dbSNP:761965542
960 960 g, t dbSNP:767750336
979 979 a, g dbSNP:750357066
999 999 c, g dbSNP:755942515
1001 1001 a, g dbSNP:543232420
1004 1004 c, t dbSNP:753533981
1006 1006 c, t dbSNP:147336783
1008 1008 a, g dbSNP:551370449
1014 1014 c, t dbSNP:556937566
1016 1016 c, t dbSNP:371779248
1025 1025 c, t dbSNP:777207290
1028 1028 c, g dbSNP:760017395
1032 1032 a, t dbSNP:746544755
1038 1038 c, t dbSNP:770135176
1043 1043 a, g dbSNP:776099461
1049 1049 c, t dbSNP:749570038
1056 1056 c, t dbSNP:769195694
1061 1061 a, c, t dbSNP:112111860
1062 1062 a, g dbSNP:373000965
1065 1065 a, g dbSNP:762320529
1066 1066 a, g dbSNP:773095683
1067 1067 a, g dbSNP:760837301
1071 1071 a, g dbSNP:199613098
1073 1073 a, g dbSNP:753862322
1077 1077 a, c dbSNP:370428276
1079 1079 a, g dbSNP:373401690
1083 1083 a, g dbSNP:765766633
1095 1095 a, g dbSNP:757988979
1098 1098 a, g dbSNP:777487568
1122 1122 c, g dbSNP:750995828
1129 1129 c, t dbSNP:756816303
1148 1148 a, g dbSNP:780406413
1149 1149 a, g dbSNP:141032424
1161 1161 c, g dbSNP:376126706
1188 1188 a, g dbSNP:779359224
1194 1194 a, g dbSNP:748524936
1199 1199 c, t dbSNP:772142440
1204 1204 c, g dbSNP:773503299
1205 1205 a, g, t dbSNP:760647140
1214 1214 c, t dbSNP:373436827
1235 1235 a, g, t dbSNP:139872191
1240 1240 g, t dbSNP:528180688
1245 1245 a, g dbSNP:201289177
1249 1249 a, g dbSNP:763992306
1261 1261 c, t dbSNP:773874757
1263 1263 a, g dbSNP:761588488
1266 1266 a, g dbSNP:767077000
1269 1269 a, c, t dbSNP:148550671
1271 1271 a, g, t dbSNP:563307237
1272 1272 c, t dbSNP:577188671
1275 1275 a, g dbSNP:778257341
1276 1276 a, g dbSNP:747347346
1278 1278 a, t dbSNP:757434006
1279 1279 c, t dbSNP:781424907
1282 1282 a, c, g, t dbSNP:34970181
1289 1289 c, g dbSNP:749302695
1296 1296 c, t dbSNP:768328319
1300 1300 a, g dbSNP:559805218
1307 1307 c, t dbSNP:151056742
1314 1314 a, g dbSNP:749833502
1316 1316 c, g dbSNP:761539694
1317 1317 c, t dbSNP:200523617
1322 1322 c, t dbSNP:375476260
1335 1335 a, g dbSNP:760241910
1339 1339 a, g dbSNP:766046737
1345 1345 c, t dbSNP:753253207
1349 1349 g, t dbSNP:758874215
1359 1359 a, g dbSNP:548452438
1367 1367 c, t dbSNP:751901947
1368 1368 a, g dbSNP:757593146
1373 1373 c, t dbSNP:781359356
1398 1398 c, g, t dbSNP:746134819
1405 1405 a, g dbSNP:561948192
1408 1408 c, g dbSNP:780171269
1409 1409 a, t dbSNP:186299744
1418 1418 a, g dbSNP:768593608
1478 1478 c, t dbSNP:776148917
1481 1481 c, t dbSNP:531619795
1488 1488 a, g dbSNP:376221874
1498 1498 c, t dbSNP:752045710
1505 1505 -, cat dbSNP:776183665
1510 1510 a, g dbSNP:371436999
1517 1517 a, g dbSNP:533642294
1520 1520 c, t dbSNP:775062694
1523 1523 a, c dbSNP:551844397
1533 1533 a, c dbSNP:756258100
1536 1536 c, t dbSNP:780280883
1537 1537 a, g, t dbSNP:140047318
1538 1538 a, g dbSNP:778890672
1555 1555 a, g, t dbSNP:766596192
1564 1564 a, g dbSNP:369609245
1566 1566 a, t dbSNP:778929099
1581 1581 a, g dbSNP:752827445
1604 1604 a, c, t dbSNP:144080146
1605 1605 g, t dbSNP:746760963
1607 1607 a, g dbSNP:770888722
1613 1613 a, g dbSNP:375459734
1614 1614 c, t dbSNP:745563318
1620 1620 g, t dbSNP:769339843
1626 1626 c, t dbSNP:121434418
1627 1627 a, g dbSNP:121434419
1629 1629 a, g dbSNP:369899177
1637 1637 a, g dbSNP:146773802
1641 1641 c, g dbSNP:748806114
1646 1646 c, t dbSNP:140430323
1663 1663 a, g dbSNP:773752951
1669 1669 c, t dbSNP:761009116
1672 1672 a, c dbSNP:766714132
1686 1686 a, g dbSNP:377255740
1688 1688 c, g dbSNP:112333283
1692 1692 a, c dbSNP:377403247
1697 1697 a, g dbSNP:752775295
1698 1698 c, t dbSNP:758581667
1707 1707 -, ag dbSNP:776768569
1711 1711 a, g dbSNP:764090825
1716 1716 a, g, t dbSNP:751594392
1717 1717 -, a dbSNP:761734095
1717 1717 a, c dbSNP:371155612
1721 1721 -, g dbSNP:770070277
1721 1721 c, t dbSNP:745676484
1723 1723 c, t dbSNP:755219700
1728 1728 c, t dbSNP:6813320
1729 1729 -, tgtt dbSNP:773372957
1752 1752 a, g dbSNP:183489869
1762 1762 c, g dbSNP:563289256
1774 1774 a, g dbSNP:532348507
1781 1781 c, g dbSNP:552181587
1788 1788 a, g dbSNP:374115313
1800 1800 a, g dbSNP:534581040
1805 1805 a, g dbSNP:569581364
1820 1820 c, t dbSNP:1434536
1843 1843 a, g dbSNP:536719640
1856 1856 c, t dbSNP:112992418
1874 1874 ca, tg dbSNP:386677448
1874 1874 c, t dbSNP:11725366
1875 1875 a, g dbSNP:1836261
1881 1881 a, g dbSNP:754142439
1891 1891 c, t dbSNP:745861587
1900 1900 c, t dbSNP:779144644
1959 1959 c, t dbSNP:769707423
1968 1968 -, t dbSNP:757375171
1969 1969 -, t dbSNP:11436086
1972 1972 a, t dbSNP:539266615
1981 1981 a, t dbSNP:77552018
1983 1983 a, g dbSNP:77149358
2017 2017 c, t dbSNP:79791228
2024 2024 a, g dbSNP:558963329
2082 2082 g, t dbSNP:572438891
2092 2092 a, g dbSNP:188703962
2095 2095 a, g dbSNP:758329362
2107 2107 c, t dbSNP:777747043
2143 2143 a, g dbSNP:193193227
2166 2166 g, t dbSNP:183245717
2172 2172 a, g dbSNP:543508771
2178 2178 c, t dbSNP:573304132
2194 2194 c, t dbSNP:748768110
2203 2203 c, t dbSNP:770792059
2285 2285 -, ac dbSNP:146159076
2320 2320 c, t dbSNP:17023107
2363 2363 g, t dbSNP:546008301
2371 2371 a, g dbSNP:555876249
2410 2410 c, t dbSNP:774194750
2441 2441 c, t dbSNP:574500341
2476 2476 a, g dbSNP:373221128
2482 2482 -, ttttttttttttt dbSNP:764691449
2482 2482 -, ttttt dbSNP:767551750
2482 2482 c, t dbSNP:373214817
2483 2483 -, tttttttttttt dbSNP:771633924
2484 2484 -, tttttttttttt dbSNP:767363680
2484 2484 -, ttttttttttt dbSNP:745414771
2503 2503 -, ttttttttttt dbSNP:548956012
2510 2510 -, tttt dbSNP:560067004
2515 2515 a, g dbSNP:559672287
2535 2535 g, t dbSNP:528362102
2539 2539 c, t dbSNP:188311185
2554 2554 -, attcaaaggatcaatattaaat dbSNP:111971137
2569 2569 a, g dbSNP:148298750
2587 2587 a, g dbSNP:745534077
2589 2589 a, g dbSNP:141438374
2594 2594 g, t dbSNP:550400234
2619 2619 a, g dbSNP:61443337
2665 2665 a, g dbSNP:570553942
2666 2666 a, g dbSNP:538840799
2668 2668 a, g dbSNP:11097457
2670 2670 a, t dbSNP:150827995
2687 2687 a, g dbSNP:59105855
2692 2692 c, t dbSNP:191551226
2737 2737 -, aaaa dbSNP:754434665
2756 2756 a, g dbSNP:554850187
2791 2791 -, tgtc dbSNP:537668325
2792 2792 a, g dbSNP:139279847
2795 2795 a, t dbSNP:183694616
2836 2836 a, g dbSNP:775047830
2866 2866 a, t dbSNP:557155390
2882 2882 a, g dbSNP:577303456
2889 2889 c, t dbSNP:545998639
2909 2909 g, t dbSNP:762511603
3009 3009 c, t dbSNP:559562363
3039 3039 a, g dbSNP:761096257
3040 3040 a, g dbSNP:56738985
3050 3050 a, g dbSNP:542105565
3054 3054 a, t dbSNP:370915593
3108 3108 c, t dbSNP:562009093
3147 3147 a, g dbSNP:773736447
3150 3150 -, aat dbSNP:145279069
3161 3161 c, g dbSNP:753954482
3212 3212 c, t dbSNP:761043331
3213 3213 a, g dbSNP:766867649
3238 3238 a, g dbSNP:2289044
3308 3308 a, g dbSNP:550583235
3325 3325 -, t dbSNP:565280551
3325 3325 g, t dbSNP:74645391
3339 3339 a, t dbSNP:570367865
3368 3368 a, g dbSNP:533016171
3375 3375 g, t dbSNP:546290295
3383 3383 c, t dbSNP:563721806
3386 3386 a, g dbSNP:186753977
3442 3442 c, t dbSNP:765546645
3463 3463 c, g dbSNP:752875395
3468 3468 c, g dbSNP:758477107
3488 3488 c, t dbSNP:561742257
3493 3493 a, g dbSNP:538267344
3521 3521 a, g dbSNP:554842235
3522 3522 c, g dbSNP:777675339
3561 3561 a, t dbSNP:568766919
3578 3578 a, g dbSNP:372385843
3645 3645 a, g dbSNP:752977059
3650 3650 c, g dbSNP:191224787
3651 3651 a, c dbSNP:185854880
3658 3658 c, t dbSNP:370452157
3661 3661 -, a dbSNP:746433268
3672 3672 -, a dbSNP:58613735
3672 3672 a, t dbSNP:200257459
3727 3727 c, t dbSNP:539897297
3728 3728 g, t dbSNP:190367204
3744 3744 c, t dbSNP:376211295
3755 3755 c, g dbSNP:745657051
3762 3762 a, g dbSNP:573066070
3764 3764 a, t dbSNP:769494319
3804 3804 g, t dbSNP:568153337
3835 3835 c, t dbSNP:115505973
3850 3850 c, t dbSNP:748788086
3853 3853 c, g dbSNP:575460895
3869 3869 a, c dbSNP:544198254
3892 3892 a, c dbSNP:768241828
3895 3895 c, g dbSNP:564061209
3896 3896 c, t dbSNP:532795780
3900 3900 a, g dbSNP:546277742
3902 3902 a, g dbSNP:559864027
3907 3907 a, g dbSNP:773682819
3909 3909 a, g, t dbSNP:529425822
3911 3911 a, t dbSNP:528642618
3919 3919 a, t dbSNP:548411357
3936 3936 c, g dbSNP:551173634
3949 3949 a, c dbSNP:759961764
3981 3981 a, g dbSNP:765599516
3986 3986 c, t dbSNP:569546552
4011 4011 a, t dbSNP:73839218
4029 4029 c, t dbSNP:1863654
4037 4037 a, g dbSNP:764248738
4090 4090 a, t dbSNP:145989039
4091 4091 c, t dbSNP:757253087
4112 4112 a, g dbSNP:139936115
4132 4132 a, g dbSNP:143459680
4175 4175 a, g dbSNP:181930964
4287 4287 g, t dbSNP:535968542
4289 4289 -, attt dbSNP:754999131
4297 4297 a, t dbSNP:529036699
4305 4305 a, t dbSNP:750265994
4327 4327 a, c dbSNP:755871790
4342 4342 g, t dbSNP:555509616
4381 4381 a, g dbSNP:575346915
4436 4436 a, t dbSNP:544451944
4455 4455 a, g dbSNP:1434535
4469 4469 a, g dbSNP:577213345
4539 4539