
SLC22A5 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SLC22A5
Entrez Gene ID 6584
Full Name solute carrier family 22 (organic cation/carnitine transporter), member 5
Synonyms CDSP, OCTN2
General protein information
Preferred Names
solute carrier family 22 member 5
solute carrier family 22 member 5
organic cation/carnitine transporter 2
high-affinity sodium dependent carnitine cotransporter
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]. lac of sum
Disorder MIM:


Disorder Html: Carnitine deficiency, systemic primary, 212140 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011543590 XP_011541892 solute carrier family 22 member 5 isoform X2
NM_003060 NP_003051 solute carrier family 22 member 5 isoform b
NM_001308122 NP_001295051 solute carrier family 22 member 5 isoform a

hsa05231 Choline metabolism in cancer
R-HSA-425407 SLC-mediated transmembrane transport
R-HSA-425366 Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds
R-HSA-382551 Transmembrane transport of small molecules
R-HSA-549127 Organic cation transport
R-HSA-549132 Organic cation/anion/zwitterion transport

Homo sapiens (human) SLC22A5 NP_003051.1
Pan troglodytes (chimpanzee) SLC22A5 XP_003310855.1
Macaca mulatta (Rhesus monkey) SLC22A5 XP_001103789.1
Canis lupus familiaris (dog) SLC22A5 XP_860734.1
Bos taurus (cattle) SLC22A5 NP_001039967.1
Mus musculus (house mouse) Slc22a5 NP_035526.1
Rattus norvegicus (Norway rat) Slc22a5 NP_062142.1
Danio rerio (zebrafish) slc22a4 NP_957143.1
Arabidopsis thaliana (thale cress) 2-Oct NP_178054.1
Arabidopsis thaliana (thale cress) 3-Oct NP_173089.1
Xenopus (Silurana) tropicalis (western clawed frog) slc22a4 NP_989323.1
Xenopus (Silurana) tropicalis (western clawed frog) slc22a5 XP_002934410.1
Xenopus (Silurana) tropicalis (western clawed frog) LOC101731319 XP_004920385.1


ID Name Evidence
GO:0005886 plasma membrane IC
GO:0005886 plasma membrane TAS
GO:0016021 integral to membrane IEA
GO:0016323 basolateral plasma membrane IEA
GO:0016324 apical plasma membrane IDA
GO:0031526 brush border membrane IDA
GO:0031526 brush border membrane ISS


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0005515 protein binding IPI
GO:0005524 ATP binding IEA
GO:0015075 ion transmembrane transporter activity IEA
GO:0015226 carnitine transporter activity IDA
GO:0015226 carnitine transporter activity IMP
GO:0015226 carnitine transporter activity TAS
GO:0015238 drug transmembrane transporter activity IC
GO:0015293 symporter activity IEA
GO:0015651 quaternary ammonium group transmembrane transporter activity IDA
GO:0030165 PDZ domain binding IPI
GO:0042895 antibiotic transporter activity IEA


ID Name Evidence
GO:0006814 sodium ion transport IEA
GO:0006855 drug transmembrane transport IC
GO:0015697 quaternary ammonium group transport IDA
GO:0015879 carnitine transport IDA
GO:0015879 carnitine transport IMP
GO:0015879 carnitine transport TAS
GO:0015893 drug transport IC
GO:0052106 quorum sensing involved in interaction with host IMP
GO:0055085 transmembrane transport TAS
GO:0060731 positive regulation of intestinal epithelial structure maintenance IMP
GO:0070715 sodium-dependent organic cation transport IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SLC22A5 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SLC22A5 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu60626 XM_011543590 PREDICTED: Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
NM_003060 Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu39679 NM_001308122 Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu60626
Accession Version XM_011543590.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1056bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product solute carrier family 22 member 5 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_034772.7) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)482..1000(+)
Position Chain Variation Link
2 2 g, t dbSNP:767792700
13 13 c, t dbSNP:569496252
14 14 c, t dbSNP:386134197
18 18 g, t dbSNP:760566360
20 20 -, tct dbSNP:777207671
22 22 c, t dbSNP:2405518
26 26 c, t dbSNP:766106506
27 27 a, g dbSNP:561032476
29 29 a, g dbSNP:200290813
30 30 g, t dbSNP:765204844
35 35 -, ttgagatgtttgtcgtgctgtttg dbSNP:746618459
37 37 c, g dbSNP:373005205
48 48 c, t dbSNP:113656768
49 49 a, g dbSNP:757979350
62 62 c, t dbSNP:142447950
78 78 c, g dbSNP:746623532
86 86 a, g dbSNP:386134198
88 88 c, t dbSNP:780314370
89 89 a, g dbSNP:121908888
94 94 a, g dbSNP:749602236
98 98 c, t dbSNP:386134199
110 110 a, g, t dbSNP:386134200
112 112 a, g dbSNP:774833531
115 115 a, g dbSNP:4551059
139 139 c, t dbSNP:752652705
144 144 c, t dbSNP:386134205
147 147 a, t dbSNP:373199019
149 149 c, g, t dbSNP:546902674
150 150 a, g dbSNP:185551386
153 153 c, t dbSNP:113443763
155 155 a, c dbSNP:780840380
156 156 c, t dbSNP:749680475
158 158 c, t dbSNP:756650860
162 162 c, t dbSNP:386134206
164 164 a, g dbSNP:188698686
165 165 c, t dbSNP:114269482
166 166 a, g dbSNP:748677211
173 173 a, g dbSNP:772523436
175 175 a, g dbSNP:773166899
176 176 c, t dbSNP:747050292
190 190 a, g dbSNP:771114311
195 195 g, t dbSNP:72552728
200 200 a, g dbSNP:749322974
205 205 a, c, g dbSNP:776910189
217 217 c, t dbSNP:746473075
223 223 c, t dbSNP:112305333
230 230 a, c, t dbSNP:121908893
231 231 a, g dbSNP:200699819
232 232 a, g dbSNP:761319686
233 233 a, g dbSNP:774619135
235 235 c, t dbSNP:751045558
238 238 a, g dbSNP:386134202
239 239 c, g, t dbSNP:386134203
240 240 a, g dbSNP:148989838
247 247 g, t dbSNP:370175430
249 249 c, t dbSNP:779280690
255 255 c, t dbSNP:752989096
256 256 a, g dbSNP:758916243
261 261 c, g, t dbSNP:201262157
262 262 a, g dbSNP:771014732
267 267 c, g, t dbSNP:538372785
268 268 a, g dbSNP:143758508
270 270 a, c, g dbSNP:775430253
271 271 a, g dbSNP:554745191
272 272 a, g dbSNP:774311428
276 276 -, t dbSNP:386134204
277 277 a, g dbSNP:274558
280 280 c, t dbSNP:200046767
281 281 a, g dbSNP:143013773
288 288 c, t dbSNP:760320629
294 294 a, g dbSNP:765954398
295 295 a, g dbSNP:386134207
309 309 -, c dbSNP:386134209
309 309 c, t dbSNP:386134208
313 313 c, t dbSNP:764544978
314 314 c, t dbSNP:121908886
315 315 a, g dbSNP:386134210
317 317 a, c, t dbSNP:72552729
319 319 g, t dbSNP:386134211
320 320 c, t dbSNP:150278881
322 322 c, t dbSNP:146185976
335 335 c, t dbSNP:386134212
336 336 a, g dbSNP:756260416
345 345 a, t dbSNP:371692440
350 350 a, g dbSNP:376450643
359 359 a, g dbSNP:749545267
362 362 c, g, t dbSNP:755114089
363 363 a, g dbSNP:747835354
372 372 a, c dbSNP:72552730
373 373 c, t dbSNP:772101972
374 374 a, g dbSNP:75783492
381 381 a, g dbSNP:746559733
399 399 c, t dbSNP:368926084
402 402 c, g dbSNP:770408585
404 404 a, g dbSNP:77300588
414 414 c, t dbSNP:200697217
415 415 a, g dbSNP:764733247
419 419 a, g dbSNP:774792831
431 431 c, g dbSNP:761264590
442 442 a, g dbSNP:766930904
448 448 a, g dbSNP:1045019
461 461 a, c dbSNP:376012221
476 476 c, t dbSNP:754008420
477 477 a, g dbSNP:759529143
479 479 -, a dbSNP:386134213
480 480 c, t dbSNP:142479732
481 481 c, t dbSNP:370373155
486 486 a, g dbSNP:752838947
487 487 c, t dbSNP:758572818
488 488 a, t dbSNP:777576712
491 491 c, t dbSNP:780990156
492 492 a, g dbSNP:757199947
505 505 c, g dbSNP:780982778
506 506 a, g dbSNP:745453534
507 507 c, t dbSNP:769158441
512 512 a, c dbSNP:779808817
513 513 a, c, t dbSNP:150544263
521 521 c, t dbSNP:68018207
541 541 c, g dbSNP:746394942
542 542 a, t dbSNP:61731073
547 547 g, t dbSNP:775446374
550 550 c, g dbSNP:139508856
556 556 a, g dbSNP:764371993
558 558 c, t dbSNP:386134214
560 560 a, g dbSNP:774528978
564 564 c, t dbSNP:761648900
566 566 c, t dbSNP:767240544
569 569 a, g dbSNP:750162911
576 576 a, c dbSNP:756015838
583 583 c, t dbSNP:200637508
586 586 c, g dbSNP:753461448
594 594 a, g dbSNP:754506497
595 595 c, t dbSNP:202219455
597 597 g, t dbSNP:550832951
602 602 c, t dbSNP:758027186
608 608 a, g dbSNP:781417085
609 609 c, t dbSNP:746187344
610 610 a, g dbSNP:375679167
612 612 c, t dbSNP:149730454
622 622 c, t dbSNP:749413889
631 631 g, t dbSNP:72552731
632 632 c, g dbSNP:768703578
640 640 c, g dbSNP:774368158
643 643 -, gct dbSNP:762932965
647 647 c, t dbSNP:368514254
651 651 -, tgc dbSNP:386134215
663 663 c, t dbSNP:144547521
665 665 c, t dbSNP:267607054
666 666 a, g dbSNP:121908891
669 669 a, g dbSNP:371219688
671 671 -, a dbSNP:768720460
672 672 -, a dbSNP:121908887
683 683 a, c dbSNP:766267814
687 687 a, c dbSNP:753804082
689 689 c, t dbSNP:754913053
691 691 c, t dbSNP:764869356
695 695 c, g dbSNP:573330330
699 699 a, g dbSNP:200125400
703 703 c, t dbSNP:777469186
719 719 -, t dbSNP:781330134
719 719 a, g dbSNP:139775414
721 721 a, g dbSNP:756473868
725 725 c, g dbSNP:780591287
728 728 c, g dbSNP:535222699
741 741 c, t dbSNP:184618759
742 742 g, t dbSNP:756815047
744 744 a, g dbSNP:772074935
754 754 a, t dbSNP:780429964
757 757 a, t dbSNP:754137149
766 766 c, g dbSNP:755533900
768 768 c, t dbSNP:779385095
769 769 a, g dbSNP:748212030
772 772 -, g dbSNP:386134217
773 773 a, g dbSNP:772169460
774 774 -, g dbSNP:786205079
789 789 c, t dbSNP:72552732
790 790 a, g dbSNP:747285272
794 794 at, gc dbSNP:267607053
794 794 a, g dbSNP:369179457
795 795 c, t dbSNP:760819971
801 801 c, g dbSNP:759393311
802 802 c, t dbSNP:769918856
803 803 a, g dbSNP:545428531
805 805 g, t dbSNP:762422835
806 806 g, t dbSNP:72552733
810 810 a, g dbSNP:386134218
811 811 c, t dbSNP:58188318
812 812 g, t dbSNP:386134219
815 815 g, t dbSNP:11568514
823 823 c, t dbSNP:374662740
824 824 a, g dbSNP:72552734
830 830 c, t dbSNP:766555353
831 831 a, t dbSNP:754265674
835 835 c, t dbSNP:755301306
838 838 a, g dbSNP:142355575
843 843 c, t dbSNP:753268767
847 847 a, g dbSNP:142264458
850 850 c, t dbSNP:149521997
851 851 a, c dbSNP:747001795
856 856 c, t dbSNP:757611449
862 862 agtcagctccacagcatc, ca dbSNP:386134220
865 865 c, g dbSNP:781562637
870 870 c, g dbSNP:60376624
873 873 a, c, g dbSNP:386134221
876 876 c, t dbSNP:746953436
879 879 c, t dbSNP:386134222
881 881 c, t dbSNP:749282641
882 882 a, g, t dbSNP:386134223
888 888 g, t dbSNP:181483390
903 903 c, t dbSNP:72552735
904 904 c, t dbSNP:140495935
907 907 c, t dbSNP:761305616
910 910 c, t dbSNP:150457229
911 911 a, g, t dbSNP:11568513
912 912 -, t dbSNP:750722461
916 916 a, c dbSNP:569268772
917 917 c, g dbSNP:760267592
921 921 g, t dbSNP:28383480
923 923 a, g dbSNP:145147616
928 928 a, c, t dbSNP:763224132
932 932 c, g, t dbSNP:377216516
933 933 a, g dbSNP:28383481
952 952 c, t dbSNP:771112492
956 956 a, g dbSNP:727504161
962 962 a, c dbSNP:183379391
975 975 c, t dbSNP:750468729
983 983 c, g dbSNP:756375506
985 985 c, t dbSNP:780129415
987 987 c, t dbSNP:753704081
989 989 g, t dbSNP:754704279
991 991 c, g dbSNP:778716973
992 992 c, t dbSNP:11568521
1003 1003 c, g dbSNP:748111365
1009 1009 c, t dbSNP:370593952
1010 1010 a, g dbSNP:551153027
1012 1012 a, t dbSNP:746506858
1013 1013 -, c dbSNP:761090705
1017 1017 c, g dbSNP:563142575
1019 1019 c, t dbSNP:200479243
1021 1021 c, t dbSNP:763424726
1022 1022 c, g dbSNP:768925240
1024 1024 a, c dbSNP:774820478
1025 1025 a, g dbSNP:762419076
1029 1029 -, acac dbSNP:386134225
1030 1030 c, t dbSNP:768082057
1038 1038 a, g dbSNP:28383482
1041 1041 c, t dbSNP:760636939
1049 1049 c, g dbSNP:145792427
1056 1056 g, t dbSNP:201307440
1058 1058 a, g dbSNP:11568524
1060 1060 g, t dbSNP:148233131
1073 1073 a, t dbSNP:767208303
1084 1084 c, t dbSNP:765430049
1085 1085 a, g dbSNP:141181092
1091 1091 a, t dbSNP:758158685
1101 1101 a, t dbSNP:764068991
1113 1113 a, g dbSNP:150775371
1115 1115 c, t dbSNP:11568525
1116 1116 c, g dbSNP:780575908
1121 1121 a, g dbSNP:745329092
1146 1146 a, g dbSNP:375467859
1148 1148 c, t dbSNP:534520165
1149 1149 a, g dbSNP:554373076
1155 1155 a, c dbSNP:375789371
1160 1160 c, g dbSNP:772583485
1161 1161 a, g dbSNP:773583158
1162 1162 c, g dbSNP:747472119
1165 1165 a, g dbSNP:771409459
1176 1176 -, a dbSNP:766918304
1177 1177 a, g dbSNP:776630689
1182 1182 c, t dbSNP:759657193
1184 1184 a, g dbSNP:535360220
1191 1191 c, t dbSNP:1045020
1218 1218 a, g dbSNP:565654675
1233 1233 -, a dbSNP:142209594
1233 1233 -, a dbSNP:60522531
1233 1233 a, c dbSNP:139072908
1235 1235 -, a dbSNP:398084481
1236 1236 -, a dbSNP:397999277
1236 1236 a, g dbSNP:113943881
1237 1237 -, g dbSNP:201329220
1238 1238 c, g dbSNP:200713706
1306 1306 a, g dbSNP:370616549
1311 1311 c, t dbSNP:774936630
1340 1340 a, g dbSNP:557809028
1347 1347 g, t dbSNP:138380116
1382 1382 a, t dbSNP:113139850
1398 1398 c, g dbSNP:539999867
1409 1409 a, g dbSNP:554549824
1415 1415 g, t dbSNP:116252376
1425 1425 a, t dbSNP:190955191
1433 1433 a, c dbSNP:374638128
1446 1446 a, t dbSNP:542523868
1460 1460 c, t dbSNP:183289645
1559 1559 -, g dbSNP:776206187
1591 1591 c, g dbSNP:538561603
1614 1614 c, t dbSNP:187964154
1628 1628 a, g dbSNP:760545883
1630 1630 c, t dbSNP:572377511
1678 1678 c, g dbSNP:137938350
1688 1688 a, g dbSNP:142531910
1736 1736 g, t dbSNP:564562623
1744 1744 c, g dbSNP:146004611
1773 1773 c, t dbSNP:562881143
1822 1822 g, t dbSNP:148673968
1896 1896 a, g dbSNP:748444428
1976 1976 g, t dbSNP:543260969
1987 1987 c, t dbSNP:274548
2055 2055 g, t dbSNP:564958389
2083 2083 -, t dbSNP:752046465
2084 2084 (t)16, 18 dbSNP:4646307
2087 2087 c, t dbSNP:143842799
2100 2100 -, ta dbSNP:746348980
2100 2100 a, t dbSNP:72795171
2101 2101 a, t dbSNP:200950736
2103 2103 -, c dbSNP:144261584
2103 2103 a, c dbSNP:14701
2153 2153 a, g dbSNP:373404698
2167 2167 c, t dbSNP:778326538
2181 2181 -, agtgccaaaaac dbSNP:148749750
2206 2206 a, g dbSNP:138469584
2210 2210 a, t dbSNP:548845880
2286 2286 c, t dbSNP:62385689
2323 2323 g, t dbSNP:79274129
2339 2339 c, t dbSNP:192176261
2358 2358 a, g dbSNP:529124788
2388 2388 c, t dbSNP:184494469
2428 2428 a, g dbSNP:187971062
2484 2484 a, t dbSNP:274547

Target ORF information:

RefSeq Version XM_011543590
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26051
Accession Version NM_003060.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1674bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 22-APR-2015
Organism Homo sapiens (human)
Product solute carrier family 22 member 5 isoform b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA567722.1, AF057164.1, DA186237.1, BC012325.1 and AK128610.1. On Jan 24, 2008 this sequence version replaced gi:24497491. Summary: Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]. Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF057164.1, BC012325.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)85..87(+)
Misc Feature(2)298..1824(+)
Misc Feature(3)325..387(+)
Misc Feature(4)631..1794(+)
Misc Feature(5)631..1686(+)
Misc Feature(6)691..753(+)
Misc Feature(7)781..843(+)
Misc Feature(8)856..918(+)
Misc Feature(9)961..1023(+)
Misc Feature(10)1036..1098(+)
Misc Feature(11)1288..1350(+)
Misc Feature(12)1384..1446(+)
Misc Feature(13)1483..1545(+)
Misc Feature(14)1555..1617(+)
Misc Feature(15)1651..1713(+)
Misc Feature(16)1720..1722(+)
Misc Feature(17)1729..1791(+)
Misc Feature(18)1912..1914(+)
Exon (1)1..657
Gene Synonym:
Exon (2)658..761
Gene Synonym:
Exon (3)762..916
Gene Synonym:
Exon (4)917..1088
Gene Synonym:
Exon (5)1089..1215
Gene Synonym:
Exon (6)1216..1316
Gene Synonym:
Exon (7)1317..1531
Gene Synonym:
Exon (8)1532..1714
Gene Synonym:
Exon (9)1715..1850
Gene Synonym:
Exon (10)1851..3277
Gene Synonym:
Position Chain Variation Link
10 10 c, t dbSNP:140331558
21 21 c, t dbSNP:370136886
27 27 c, t dbSNP:543340883
31 31 c, g dbSNP:4646300
45 45 c, g dbSNP:528509660
58 58 c, g dbSNP:2631367
61 61 c, t dbSNP:565391275
80 80 a, c dbSNP:2631366
95 95 c, t dbSNP:530867815
96 96 a, g dbSNP:550659326
103 103 a, g dbSNP:567162714
116 116 a, g dbSNP:57262206
125 125 c, t dbSNP:546897858
126 126 g, t dbSNP:13180169
147 147 a, g dbSNP:538643468
158 158 g, t dbSNP:13180186
165 165 c, g dbSNP:568975386
187 187 cg, ta dbSNP:71590771
187 187 c, t dbSNP:13180043
188 188 a, g dbSNP:13180295
214 214 a, c dbSNP:760915501
224 224 a, c dbSNP:375483744
227 227 a, c dbSNP:1045018
228 228 g, t dbSNP:80268429
229 229 a, c dbSNP:754712315
232 232 c, t dbSNP:778972453
234 234 a, g dbSNP:752550632
235 235 c, g dbSNP:758034537
239 239 a, g dbSNP:369724970
242 242 c, t dbSNP:746480923
243 243 c, t dbSNP:770714592
244 244 c, t dbSNP:780651884
252 252 c, t dbSNP:749720017
259 259 a, g dbSNP:768898702
265 265 a, g dbSNP:774971089
267 267 g, t dbSNP:121908892
268 268 -, c dbSNP:377767443
268 268 c, g, t dbSNP:762330138
269 269 c, g dbSNP:773282630
276 276 c, g dbSNP:72552722
288 288 a, c dbSNP:766678115
290 290 c, t dbSNP:753998904
292 292 c, t dbSNP:759420042
294 294 c, t dbSNP:574313463
298 298 a, g dbSNP:139203363
301 301 a, g dbSNP:553647459
304 304 a, t dbSNP:756863825
307 307 g, t dbSNP:267607052
308 308 a, g dbSNP:751129547
315 315 c, g dbSNP:11568520
320 320 c, g dbSNP:72552723
321 321 c, t dbSNP:780964945
323 323 a, t dbSNP:144020613
326 326 -, tct dbSNP:765192896
327 327 c, t dbSNP:769437903
331 331 -, ttc dbSNP:377767444
335 335 -, t dbSNP:775502377
337 337 c, g dbSNP:779174922
339 339 c, t dbSNP:144054688
341 341 a, g dbSNP:772578415
347 347 g, t dbSNP:72552724
348 348 c, t dbSNP:773693788
357 357 c, t dbSNP:375293546
358 358 a, c dbSNP:727504158
359 359 a, g dbSNP:72552725
367 367 a, g dbSNP:776965130
368 368 c, t dbSNP:759704527
369 369 c, t dbSNP:765461422
372 372 c, g dbSNP:775432496
375 375 c, g dbSNP:762780354
377 377 a, c, t dbSNP:369354736
378 378 c, t dbSNP:756867867
379 379 g, t dbSNP:544332057
381 381 c, t dbSNP:201427730
382 382 a, g dbSNP:148657753
395 395 a, c, g, t dbSNP:199689597
397 397 a, g dbSNP:376438682
398 398 -, c dbSNP:762986044
399 399 c, g, t dbSNP:202000855
400 400 c, g, t dbSNP:202088921
401 401 c, t dbSNP:377767445
408 408 c, t dbSNP:745897099
412 412 -, t dbSNP:386134227
422 422 c, g, t dbSNP:373077213
424 424 a, g dbSNP:745313662
426 426 c, t dbSNP:762909506
428 428 c, t dbSNP:763951604
430 430 a, g dbSNP:774238199
441 441 c, g dbSNP:761687115
446 446 c, t dbSNP:767419997
455 455 a, t dbSNP:749914366
458 458 a, g dbSNP:755634551
463 463 -, tccc dbSNP:764144793
471 471 a, c, g dbSNP:377767446
472 472 c, t dbSNP:753453677
473 473 c, g dbSNP:758808008
481 481 c, g dbSNP:778137386
487 487 a, c dbSNP:747338063
488 488 c, g dbSNP:757711838
496 496 -, c dbSNP:377767447
501 501 c, t dbSNP:781684339
504 504 a, c dbSNP:745994172
507 507 c, t dbSNP:769914988
510 510 c, t dbSNP:377767448
511 511 c, t dbSNP:749499293
512 512 g, t dbSNP:72552726
513 513 c, t dbSNP:774293063
514 514 -, accggctcgcc dbSNP:757431170
518 518 a, g dbSNP:761608940
523 523 a, c, g dbSNP:199942468
526 526 a, c dbSNP:760140309
528 528 -, ggctcgccacc dbSNP:377767449
529 529 -, atcg dbSNP:767853877
529 529 a, c dbSNP:765849408
530 530 c, t dbSNP:753293547
532 532 c, g dbSNP:759221037
533 533 c, t dbSNP:764805645
536 536 a, g dbSNP:546442503
540 540 a, c dbSNP:757630368
542 542 c, g dbSNP:386134190
543 543 c, g dbSNP:377734902
547 547 c, g, t dbSNP:386134191
549 549 c, t dbSNP:2631365
551 551 c, g dbSNP:377767450
553 553 a, c, g dbSNP:749314368
562 562 c, g dbSNP:779263168
563 563 a, g dbSNP:747956537
564 564 a, g dbSNP:552442289
571 571 g, t dbSNP:773067144
591 591 c, g dbSNP:760680664
602 602 a, g dbSNP:727504159
605 605 c, t dbSNP:11544587
608 608 a, g dbSNP:386134192
613 613 c, t dbSNP:398123692
621 621 c, t dbSNP:776127629
627 627 a, g, t dbSNP:758991830
628 628 g, t dbSNP:201082652
632 632 g, t dbSNP:748605096
635 635 a, g dbSNP:762126547
641 641 a, c dbSNP:568906114
646 646 a, g dbSNP:772405276
648 648 c, t dbSNP:773749345
654 654 c, g dbSNP:750705553
660 660 a, g dbSNP:72552727
669 669 a, g dbSNP:777083211
676 676 g, t dbSNP:534336326
678 678 c, t dbSNP:150705788
679 679 a, g dbSNP:577131769
688 688 a, g, t dbSNP:151231558
694 694 c, t dbSNP:10040427
698 698 c, t dbSNP:757093530
711 711 a, c, g dbSNP:780989844
714 714 c, t dbSNP:756089971
715 715 a, c, g, t dbSNP:386134193
717 717 a, g dbSNP:386134194
719 719 a, g dbSNP:747821417
722 722 -, tg dbSNP:386134195
726 726 a, g dbSNP:771808266
727 727 c, t dbSNP:777136671
734 734 c, t dbSNP:759925126
740 740 c, t dbSNP:770393286
760 760 a, c dbSNP:775861079
769 769 c, t dbSNP:121908890
770 770 a, g dbSNP:121908889
778 778 a, g dbSNP:558978831
779 779 c, t dbSNP:746313890
783 783 c, g dbSNP:770028341
784 784 c, t dbSNP:776118000
786 786 c, t dbSNP:145350949
787 787 a, g dbSNP:781721860
793 793 a, g dbSNP:145068530
794 794 c, t dbSNP:761866020
799 799 a, t dbSNP:386134196
809 809 g, t dbSNP:767792700
820 820 c, t dbSNP:569496252
821 821 c, t dbSNP:386134197
825 825 g, t dbSNP:760566360
827 827 -, tct dbSNP:777207671
829 829 c, t dbSNP:2405518
833 833 c, t dbSNP:766106506
834 834 a, g dbSNP:561032476
836 836 a, g dbSNP:200290813
837 837 g, t dbSNP:765204844
842 842 -, ttgagatgtttgtcgtgctgtttg dbSNP:746618459
844 844 c, g dbSNP:373005205
855 855 c, t dbSNP:113656768
856 856 a, g dbSNP:757979350
869 869 c, t dbSNP:142447950
885 885 c, g dbSNP:746623532
893 893 a, g dbSNP:386134198
895 895 c, t dbSNP:780314370
896 896 a, g dbSNP:121908888
901 901 a, g dbSNP:749602236
905 905 c, t dbSNP:386134199
933 933 c, t dbSNP:752652705
938 938 c, t dbSNP:386134205
941 941 a, t dbSNP:373199019
943 943 c, g, t dbSNP:546902674
944 944 a, g dbSNP:185551386
947 947 c, t dbSNP:113443763
949 949 a, c dbSNP:780840380
950 950 c, t dbSNP:749680475
952 952 c, t dbSNP:756650860
956 956 c, t dbSNP:386134206
958 958 a, g dbSNP:188698686
959 959 c, t dbSNP:114269482
960 960 a, g dbSNP:748677211
967 967 a, g dbSNP:772523436
969 969 a, g dbSNP:773166899
970 970 c, t dbSNP:747050292
984 984 a, g dbSNP:771114311
989 989 g, t dbSNP:72552728
994 994 a, g dbSNP:749322974
999 999 a, c, g dbSNP:776910189
1011 1011 c, t dbSNP:746473075
1017 1017 c, t dbSNP:112305333
1024 1024 a, c, t dbSNP:121908893
1025 1025 a, g dbSNP:200699819
1026 1026 a, g dbSNP:761319686
1027 1027 a, g dbSNP:774619135
1029 1029 c, t dbSNP:751045558
1032 1032 a, g dbSNP:386134202
1033 1033 c, g, t dbSNP:386134203
1034 1034 a, g dbSNP:148989838
1041 1041 g, t dbSNP:370175430
1043 1043 c, t dbSNP:779280690
1049 1049 c, t dbSNP:752989096
1050 1050 a, g dbSNP:758916243
1055 1055 c, g, t dbSNP:201262157
1056 1056 a, g dbSNP:771014732
1061 1061 c, g, t dbSNP:538372785
1062 1062 a, g dbSNP:143758508
1064 1064 a, c, g dbSNP:775430253
1065 1065 a, g dbSNP:554745191
1066 1066 a, g dbSNP:774311428
1070 1070 -, t dbSNP:386134204
1071 1071 a, g dbSNP:274558
1074 1074 c, t dbSNP:200046767
1075 1075 a, g dbSNP:143013773
1082 1082 c, t dbSNP:760320629
1088 1088 a, g dbSNP:765954398
1089 1089 a, g dbSNP:386134207
1103 1103 -, c dbSNP:386134209
1103 1103 c, t dbSNP:386134208
1107 1107 c, t dbSNP:764544978
1108 1108 c, t dbSNP:121908886
1109 1109 a, g dbSNP:386134210
1111 1111 a, c, t dbSNP:72552729
1113 1113 g, t dbSNP:386134211
1114 1114 c, t dbSNP:150278881
1116 1116 c, t dbSNP:146185976
1129 1129 c, t dbSNP:386134212
1130 1130 a, g dbSNP:756260416
1139 1139 a, t dbSNP:371692440
1144 1144 a, g dbSNP:376450643
1153 1153 a, g dbSNP:749545267
1156 1156 c, g, t dbSNP:755114089
1157 1157 a, g dbSNP:747835354
1166 1166 a, c dbSNP:72552730
1167 1167 c, t dbSNP:772101972
1168 1168 a, g dbSNP:75783492
1175 1175 a, g dbSNP:746559733
1193 1193 c, t dbSNP:368926084
1196 1196 c, g dbSNP:770408585
1198 1198 a, g dbSNP:77300588
1208 1208 c, t dbSNP:200697217
1209 1209 a, g dbSNP:764733247
1213 1213 a, g dbSNP:774792831
1225 1225 c, g dbSNP:761264590
1236 1236 a, g dbSNP:766930904
1242 1242 a, g dbSNP:1045019
1255 1255 a, c dbSNP:376012221
1270 1270 c, t dbSNP:754008420
1271 1271 a, g dbSNP:759529143
1273 1273 -, a dbSNP:386134213
1274 1274 c, t dbSNP:142479732
1275 1275 c, t dbSNP:370373155
1280 1280 a, g dbSNP:752838947
1281 1281 c, t dbSNP:758572818
1282 1282 a, t dbSNP:777576712
1285 1285 c, t dbSNP:780990156
1286 1286 a, g dbSNP:757199947
1299 1299 c, g dbSNP:780982778
1300 1300 a, g dbSNP:745453534
1301 1301 c, t dbSNP:769158441
1306 1306 a, c dbSNP:779808817
1307 1307 a, c, t dbSNP:150544263
1315 1315 c, t dbSNP:68018207
1335 1335 c, g dbSNP:746394942
1336 1336 a, t dbSNP:61731073
1341 1341 g, t dbSNP:775446374
1344 1344 c, g dbSNP:139508856
1350 1350 a, g dbSNP:764371993
1352 1352 c, t dbSNP:386134214
1354 1354 a, g dbSNP:774528978
1358 1358 c, t dbSNP:761648900
1360 1360 c, t dbSNP:767240544
1363 1363 a, g dbSNP:750162911
1370 1370 a, c dbSNP:756015838
1377 1377 c, t dbSNP:200637508
1380 1380 c, g dbSNP:753461448
1388 1388 a, g dbSNP:754506497
1389 1389 c, t dbSNP:202219455
1391 1391 g, t dbSNP:550832951
1396 1396 c, t dbSNP:758027186
1402 1402 a, g dbSNP:781417085
1403 1403 c, t dbSNP:746187344
1404 1404 a, g dbSNP:375679167
1406 1406 c, t dbSNP:149730454
1416 1416 c, t dbSNP:749413889
1425 1425 g, t dbSNP:72552731
1426 1426 c, g dbSNP:768703578
1434 1434 c, g dbSNP:774368158
1437 1437 -, gct dbSNP:762932965
1441 1441 c, t dbSNP:368514254
1445 1445 -, tgc dbSNP:386134215
1457 1457 c, t dbSNP:144547521
1459 1459 c, t dbSNP:267607054
1460 1460 a, g dbSNP:121908891
1463 1463 a, g dbSNP:371219688
1465 1465 -, a dbSNP:768720460
1466 1466 -, a dbSNP:121908887
1477 1477 a, c dbSNP:766267814
1481 1481 a, c dbSNP:753804082
1483 1483 c, t dbSNP:754913053
1485 1485 c, t dbSNP:764869356
1489 1489 c, g dbSNP:573330330
1493 1493 a, g dbSNP:200125400
1497 1497 c, t dbSNP:777469186
1513 1513 -, t dbSNP:781330134
1513 1513 a, g dbSNP:139775414
1515 1515 a, g dbSNP:756473868
1519 1519 c, g dbSNP:780591287
1522 1522 c, g dbSNP:535222699
1535 1535 c, t dbSNP:184618759
1536 1536 g, t dbSNP:756815047
1538 1538 a, g dbSNP:772074935
1548 1548 a, t dbSNP:780429964
1551 1551 a, t dbSNP:754137149
1560 1560 c, g dbSNP:755533900
1562 1562 c, t dbSNP:779385095
1563 1563 a, g dbSNP:748212030
1566 1566 -, g dbSNP:386134217
1567 1567 a, g dbSNP:772169460
1568 1568 -, g dbSNP:786205079
1583 1583 c, t dbSNP:72552732
1584 1584 a, g dbSNP:747285272
1588 1588 at, gc dbSNP:267607053
1588 1588 a, g dbSNP:369179457
1589 1589 c, t dbSNP:760819971
1595 1595 c, g dbSNP:759393311
1596 1596 c, t dbSNP:769918856
1597 1597 a, g dbSNP:545428531
1599 1599 g, t dbSNP:762422835
1600 1600 g, t dbSNP:72552733
1604 1604 a, g dbSNP:386134218
1605 1605 c, t dbSNP:58188318
1606 1606 g, t dbSNP:386134219
1609 1609 g, t dbSNP:11568514
1617 1617 c, t dbSNP:374662740
1618 1618 a, g dbSNP:72552734
1624 1624 c, t dbSNP:766555353
1625 1625 a, t dbSNP:754265674
1629 1629 c, t dbSNP:755301306
1632 1632 a, g dbSNP:142355575
1637 1637 c, t dbSNP:753268767
1641 1641 a, g dbSNP:142264458
1644 1644 c, t dbSNP:149521997
1645 1645 a, c dbSNP:747001795
1650 1650 c, t dbSNP:757611449
1656 1656 agtcagctccacagcatc, ca dbSNP:386134220
1659 1659 c, g dbSNP:781562637
1664 1664 c, g dbSNP:60376624
1667 1667 a, c, g dbSNP:386134221
1670 1670 c, t dbSNP:746953436
1673 1673 c, t dbSNP:386134222
1675 1675 c, t dbSNP:749282641
1676 1676 a, g, t dbSNP:386134223
1682 1682 g, t dbSNP:181483390
1697 1697 c, t dbSNP:72552735
1698 1698 c, t dbSNP:140495935
1701 1701 c, t dbSNP:761305616
1704 1704 c, t dbSNP:150457229
1705 1705 a, g, t dbSNP:11568513
1706 1706 -, t dbSNP:750722461
1710 1710 a, c dbSNP:569268772
1711 1711 c, g dbSNP:760267592
1715 1715 g, t dbSNP:28383480
1717 1717 a, g dbSNP:145147616
1722 1722 a, c, t dbSNP:763224132
1726 1726 c, g, t dbSNP:377216516
1727 1727 a, g dbSNP:28383481
1746 1746 c, t dbSNP:771112492
1750 1750 a, g dbSNP:727504161
1756 1756 a, c dbSNP:183379391
1769 1769 c, t dbSNP:750468729
1777 1777 c, g dbSNP:756375506
1779 1779 c, t dbSNP:780129415
1781 1781 c, t dbSNP:753704081
1783 1783 g, t dbSNP:754704279
1785 1785 c, g dbSNP:778716973
1786 1786 c, t dbSNP:11568521
1797 1797 c, g dbSNP:748111365
1803 1803 c, t dbSNP:370593952
1804 1804 a, g dbSNP:551153027
1806 1806 a, t dbSNP:746506858
1807 1807 -, c dbSNP:761090705
1811 1811 c, g dbSNP:563142575
1813 1813 c, t dbSNP:200479243
1815 1815 c, t dbSNP:763424726
1816 1816 c, g dbSNP:768925240
1818 1818 a, c dbSNP:774820478
1819 1819 a, g dbSNP:762419076
1823 1823 -, acac dbSNP:386134225
1824 1824 c, t dbSNP:768082057
1832 1832 a, g dbSNP:28383482
1835 1835 c, t dbSNP:760636939
1843 1843 c, g dbSNP:145792427
1850 1850 g, t dbSNP:201307440
1852 1852 a, g dbSNP:11568524
1854 1854 g, t dbSNP:148233131
1867 1867 a, t dbSNP:767208303
1878 1878 c, t dbSNP:765430049
1879 1879 a, g dbSNP:141181092
1885 1885 a, t dbSNP:758158685
1895 1895 a, t dbSNP:764068991
1907 1907 a, g dbSNP:150775371
1909 1909 c, t dbSNP:11568525
1910 1910 c, g dbSNP:780575908
1915 1915 a, g dbSNP:745329092
1940 1940 a, g dbSNP:375467859
1942 1942 c, t dbSNP:534520165
1943 1943 a, g dbSNP:554373076
1949 1949 a, c dbSNP:375789371
1954 1954 c, g dbSNP:772583485
1955 1955 a, g dbSNP:773583158
1956 1956 c, g dbSNP:747472119
1959 1959 a, g dbSNP:771409459
1970 1970 -, a dbSNP:766918304
1971 1971 a, g dbSNP:776630689
1976 1976 c, t dbSNP:759657193
1978 1978 a, g dbSNP:535360220
1985 1985 c, t dbSNP:1045020
2012 2012 a, g dbSNP:565654675
2027 2027 -, a dbSNP:142209594
2027 2027 -, a dbSNP:60522531
2027 2027 a, c dbSNP:139072908
2028 2028 -, a dbSNP:398084481
2029 2029 -, a dbSNP:397999277
2029 2029 a, g dbSNP:113943881
2031 2031 -, g dbSNP:201329220
2032 2032 c, g dbSNP:200713706
2100 2100 a, g dbSNP:370616549
2105 2105 c, t dbSNP:774936630
2134 2134 a, g dbSNP:557809028
2141 2141 g, t dbSNP:138380116
2176 2176 a, t dbSNP:113139850
2192 2192 c, g dbSNP:539999867
2203 2203 a, g dbSNP:554549824
2209 2209 g, t dbSNP:116252376
2219 2219 a, t dbSNP:190955191
2227 2227 a, c dbSNP:374638128
2240 2240 a, t dbSNP:542523868
2254 2254 c, t dbSNP:183289645
2353 2353 -, g dbSNP:776206187
2385 2385 c, g dbSNP:538561603
2408 2408 c, t dbSNP:187964154
2422 2422 a, g dbSNP:760545883
2424 2424 c, t dbSNP:572377511
2472 2472 c, g dbSNP:137938350
2482 2482 a, g dbSNP:142531910
2530 2530 g, t dbSNP:564562623
2538 2538 c, g dbSNP:146004611
2567 2567 c, t dbSNP:562881143
2616 2616 g, t dbSNP:148673968
2690 2690 a, g dbSNP:748444428
2770 2770 g, t dbSNP:543260969
2781 2781 c, t dbSNP:274548
2849 2849 g, t dbSNP:564958389
2877 2877 -, t dbSNP:752046465
2878 2878 (t)16, 18 dbSNP:4646307
2881 2881 c, t dbSNP:143842799
2894 2894 -, ta dbSNP:746348980
2894 2894 a, t dbSNP:72795171
2895 2895 a, t dbSNP:200950736
2897 2897 -, c dbSNP:144261584
2897 2897 a, c dbSNP:14701
2947 2947 a, g dbSNP:373404698
2961 2961 c, t dbSNP:778326538
2975 2975 -, agtgccaaaaac dbSNP:148749750
3000 3000 a, g dbSNP:138469584
3004 3004 a, t dbSNP:548845880
3080 3080 c, t dbSNP:62385689
3117 3117 g, t dbSNP:79274129
3133 3133 c, t dbSNP:192176261
3152 3152 a, g dbSNP:529124788
3182 3182 c, t dbSNP:184494469
3222 3222 a, g dbSNP:187971062
3278 3278 a, t dbSNP:274547

Target ORF information:

RefSeq Version NM_003060
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu39679
Accession Version NM_001308122.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1746bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 13-MAY-2015
Organism Homo sapiens (human)
Product solute carrier family 22 member 5 isoform a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA567722.1, AB291606.1, AK128610.1 and BM693015.1. On Apr 28, 2015 this sequence version replaced gi:578810508. Summary: Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]. Transcript Variant: This variant (1, also known as OCTN2VT) represents the longer transcript and encodes the longer isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB291606.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2145240, SAMEA2145774 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)85..87(+)
Misc Feature(2)298..1896(+)
Misc Feature(3)748..1866(+)
Misc Feature(4)772..1758(+)
Exon (1)1..657
Gene Synonym:
Exon (2)658..729
Gene Synonym:
Exon (3)730..833
Gene Synonym:
Exon (4)834..988
Gene Synonym:
Exon (5)989..1160
Gene Synonym:
Exon (6)1161..1287
Gene Synonym:
Exon (7)1288..1388
Gene Synonym:
Exon (8)1389..1603
Gene Synonym:
Exon (9)1604..1786
Gene Synonym:
Exon (10)1787..1922
Gene Synonym:
Exon (11)1923..3349
Gene Synonym:
Position Chain Variation Link
1640 1640 -, g dbSNP:786205079

Target ORF information:

RefSeq Version NM_001308122
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
