
SMARCA2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SMARCA2
Entrez Gene ID 6595
Full Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms BAF190, BRM, NCBRS, SNF2, SNF2L2, SNF2LA, SWI2, Sth1p, hBRM, hSNF2a
General protein information
Preferred Names
probable global transcription activator SNF2L2
probable global transcription activator SNF2L2
protein brahma homolog
SNF2/SWI2-like protein 2
BRG1-associated factor 190B
ATP-dependent helicase SMARCA2
sucrose nonfermenting 2-like protein 2
global transcription activator homologous sequence
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]. lac of sum
Disorder MIM:


Disorder Html:

The following SMARCA2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SMARCA2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu21520 NM_139045 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu20836 NM_001289396 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu20408 NM_001289398 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu20836 NM_003070 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu21587 NM_001289397 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu21006 NM_001289399 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu21257 NM_001289400 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu21520
Accession Version NM_139045.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4719bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product probable global transcription activator SNF2L2 isoform b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL359076.16, BC040029.1, BC068252.1, X72889.1, BC066596.1 and AK094076.1. On Jan 17, 2014 this sequence version replaced gi:48255897. Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]. Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1, resulting in a shorter protein (isoform a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)220..222(+)
Misc Feature(2)340..744(+)
Misc Feature(3)736..846(+)
Misc Feature(4)745..747(+)
Misc Feature(5)1207..1209(+)
Misc Feature(6)1207..1209(+)
Misc Feature(7)1528..1746(+)
Misc Feature(8)1981..1983(+)
Misc Feature(9)1984..2118(+)
Misc Feature(10)1984..1986(+)
Misc Feature(11)1993..1995(+)
Misc Feature(12)2065..2067(+)
Misc Feature(13)2101..2103(+)
Misc Feature(14)2140..2142(+)
Misc Feature(15)2146..2148(+)
Misc Feature(16)2173..2175(+)
Misc Feature(17)2176..2178(+)
Misc Feature(18)2401..3288(+)
Misc Feature(19)2452..2871(+)
Misc Feature(20)2476..2490(+)
Misc Feature(21)2773..2784(+)
Misc Feature(22)2773..2784(+)
Misc Feature(23)3088..3090(+)
Misc Feature(24)3211..3213(+)
Misc Feature(25)3217..3219(+)
Misc Feature(26)3340..3738(+)
Misc Feature(27)3442..3606(+)
Misc Feature(28)3622..3708(+)
Misc Feature(29)3997..4200(+)
Misc Feature(30)4219..>4407(+)
Misc Feature(31)4303..4341(+)
Misc Feature(32)4351..4353(+)
Misc Feature(33)4366..4686(+)
Misc Feature(34)4420..4422(+)
Misc Feature(35)4423..4425(+)
Misc Feature(36)4459..4632(+)
Misc Feature(37)4702..4704(+)
Misc Feature(38)4714..4716(+)
Misc Feature(39)4750..4752(+)
Misc Feature(40)4831..4833(+)
Misc Feature(41)4834..4836(+)
Misc Feature(42)4852..4854(+)
Misc Feature(43)4858..4860(+)
Misc Feature(44)4870..4872(+)
Misc Feature(45)4870..4872(+)
Misc Feature(46)4882..4884(+)
Misc Feature(47)4882..4884(+)
Exon (1)1..186
Gene Synonym:
Exon (2)187..447
Gene Synonym:
Exon (3)448..577
Gene Synonym:
Exon (4)578..1012
Gene Synonym:
Exon (5)1013..1268
Gene Synonym:
Exon (6)1269..1395
Gene Synonym:
Exon (7)1396..1569
Gene Synonym:
Exon (8)1570..1743
Gene Synonym:
Exon (9)1744..1914
Gene Synonym:
Exon (10)1915..1968
Gene Synonym:
Exon (11)1969..2099
Gene Synonym:
Exon (12)2100..2157
Gene Synonym:
Exon (13)2158..2258
Gene Synonym:
Exon (14)2259..2406
Gene Synonym:
Exon (15)2407..2570
Gene Synonym:
Exon (16)2571..2637
Gene Synonym:
Exon (17)2638..2748
Gene Synonym:
Exon (18)2749..2991
Gene Synonym:
Exon (19)2992..3105
Gene Synonym:
Exon (20)3106..3213
Gene Synonym:
Exon (21)3214..3300
Gene Synonym:
Exon (22)3301..3347
Gene Synonym:
Exon (23)3348..3514
Gene Synonym:
Exon (24)3515..3678
Gene Synonym:
Exon (25)3679..3906
Gene Synonym:
Exon (26)3907..3984
Gene Synonym:
Exon (27)3985..4203
Gene Synonym:
Exon (28)4204..4421
Gene Synonym:
Exon (29)4422..4527
Gene Synonym:
Exon (30)4528..4629
Gene Synonym:
Exon (31)4630..4762
Gene Synonym:
Exon (32)4763..4905
Gene Synonym:
Exon (33)4906..5826
Gene Synonym:
Position Chain Variation Link
14 14 c, t dbSNP:553559954
22 22 a, g dbSNP:760367150
34 34 a, g dbSNP:573381890
60 60 c, g dbSNP:767774585
87 87 g, t dbSNP:752884948
100 100 a, t dbSNP:541889733
146 146 c, g dbSNP:555452359
161 161 c, t dbSNP:184465681
165 165 c, t dbSNP:544243749
193 193 c, t dbSNP:368879989
196 196 a, g dbSNP:370082404
218 218 a, g dbSNP:10964468
231 231 a, g dbSNP:775432878
234 234 c, t dbSNP:762840154
244 244 a, g dbSNP:772087302
248 248 c, t dbSNP:773325366
249 249 a, g dbSNP:149689575
253 253 c, t dbSNP:145516397
255 255 c, t dbSNP:754052480
270 270 a, g dbSNP:760000638
272 272 c, t dbSNP:543241889
273 273 a, c, g dbSNP:148865068
277 277 c, t dbSNP:777207780
284 284 a, c dbSNP:776972919
285 285 a, t dbSNP:756655795
288 288 c, t dbSNP:780915633
312 312 -, ccagga dbSNP:776268690
319 319 c, t dbSNP:146990134
325 325 a, c, t dbSNP:562820489
326 326 c, t dbSNP:749279138
334 334 g, t dbSNP:768632343
335 335 c, g dbSNP:774085434
339 339 c, t dbSNP:760818868
340 340 a, g dbSNP:374826893
347 347 a, g dbSNP:777024299
352 352 a, g dbSNP:531812409
359 359 c, t dbSNP:765745579
361 361 a, g dbSNP:775986079
376 376 a, g dbSNP:763439455
379 379 a, g dbSNP:191818866
381 381 c, g dbSNP:751953852
395 395 c, t dbSNP:764338204
396 396 a, g dbSNP:10964470
397 397 a, t dbSNP:138129490
398 398 c, t dbSNP:755744610
399 399 a, c, g dbSNP:10964471
404 404 c, g dbSNP:754667442
409 409 a, t dbSNP:778927818
411 411 a, g dbSNP:752638398
430 430 a, t dbSNP:143478968
432 432 a, g dbSNP:529054959
434 434 a, c dbSNP:746149405
450 450 c, t dbSNP:769108800
453 453 c, t dbSNP:148086416
454 454 a, g dbSNP:762444118
463 463 c, g dbSNP:772570058
464 464 a, c dbSNP:201962378
466 466 c, g dbSNP:141861118
468 468 c, t dbSNP:181403075
472 472 c, g dbSNP:753566360
478 478 g, t dbSNP:751197799
486 486 c, t dbSNP:370078162
489 489 c, t dbSNP:765136584
499 499 a, t dbSNP:752428364
501 501 c, t dbSNP:758202044
502 502 a, g dbSNP:777868389
508 508 a, g dbSNP:751493659
513 513 c, t dbSNP:756297297
526 526 a, c dbSNP:779970953
527 527 a, c dbSNP:749577820
532 532 c, g dbSNP:768751465
533 533 c, t dbSNP:779121655
534 534 a, g dbSNP:564889539
538 538 a, g dbSNP:748471352
542 542 g, t dbSNP:533959336
543 543 c, t dbSNP:773736788
546 546 a, t dbSNP:150630640
547 547 c, g, t dbSNP:374114848
559 559 a, g dbSNP:759299457
575 575 a, g dbSNP:764802549
580 580 c, t dbSNP:767365351
585 585 a, g dbSNP:372393164
595 595 c, g, t dbSNP:755042247
602 602 c, t dbSNP:267602196
608 608 a, g dbSNP:752964642
611 611 a, c dbSNP:758603765
612 612 c, t dbSNP:564538281
613 613 c, t dbSNP:778176567
620 620 a, g dbSNP:747378712
622 622 a, g dbSNP:201403629
626 626 c, g dbSNP:781572572
634 634 a, g dbSNP:746348659
637 637 c, t dbSNP:769229718
654 654 c, t dbSNP:775121008
662 662 a, g dbSNP:200749632
670 670 a, c dbSNP:187402350
680 680 c, t dbSNP:774084308
681 681 a, g dbSNP:375996388
683 683 g, t dbSNP:767299222
684 684 a, g dbSNP:61736900
685 685 g, t dbSNP:760635852
693 693 a, c dbSNP:753064421
694 694 c, g dbSNP:548490250
704 704 c, t dbSNP:149394378
705 705 a, c, g, t dbSNP:146359524
706 706 c, g dbSNP:550716951
714 714 c, g dbSNP:750943048
722 722 c, g dbSNP:376294726
724 724 a, g dbSNP:779781841
735 735 a, c dbSNP:148002538
739 739 a, c, t dbSNP:768229159
746 746 a, g dbSNP:539475818
748 748 a, c dbSNP:771809195
750 750 c, t dbSNP:773045029
772 772 a, g dbSNP:760594090
783 783 a, g dbSNP:144501382
789 789 c, t dbSNP:546427851
800 800 c, g dbSNP:763043275
802 802 a, c dbSNP:764118923
813 813 c, t dbSNP:751821597
819 819 c, t dbSNP:747247552
820 820 a, g dbSNP:767831539
824 824 c, t dbSNP:750798867
825 825 a, g dbSNP:199724104
831 831 a, g dbSNP:567348902
834 834 c, t dbSNP:780724512
837 837 a, t dbSNP:754353178
839 839 c, t dbSNP:535106964
854 854 c, t dbSNP:146164750
861 861 a, t dbSNP:747810652
867 867 -, gca dbSNP:775161492
867 867 a, g dbSNP:554962671
871 871 -, caa dbSNP:762758875
873 873 a, g dbSNP:13296982
874 874 -, caacagcagcagcaacag dbSNP:757162806
874 874 -, caacagcagcag dbSNP:763968534
877 877 -, cagcagcagcaacagcagcag dbSNP:748496168
877 877 -, cagcagcagcaacagcag dbSNP:753907033
877 877 -, cagcagcagcaacag dbSNP:755171359
885 885 -, caa dbSNP:778261622
886 886 -, caa dbSNP:747578881
887 887 -, gc dbSNP:771561232
888 888 -, cag, cagcagcag dbSNP:745316697
888 888 a, g dbSNP:13296987
889 889 -, cagcagcagcagcag dbSNP:763994276
889 889 -, cagcagcag dbSNP:775167281
889 889 -, cagcag dbSNP:762478166
889 889 -, cag dbSNP:781477472
891 891 a, g dbSNP:62639301
896 896 -, ag dbSNP:767388089
896 896 a, c dbSNP:145170448
899 899 -, a dbSNP:765203753
899 899 a, c dbSNP:147609454
903 903 a, g dbSNP:142219087
905 905 -, a dbSNP:757850599
905 905 a, c dbSNP:62534884
908 908 -, a dbSNP:779405725
908 908 a, c dbSNP:184126259
909 909 a, g dbSNP:774478658
910 910 -, cagcagcagcagcagcagcaa dbSNP:774133062
911 911 -, gcc dbSNP:772031527
911 911 -, a dbSNP:761550852
911 911 a, c dbSNP:145635937
912 912 a, g dbSNP:578143503
914 914 -, ag dbSNP:773178214
914 914 a, g dbSNP:767788014
915 915 -, cagcagcagcagcaa dbSNP:760511909
915 915 a, g dbSNP:149130789
916 916 a, c dbSNP:750557515
917 917 -, a dbSNP:765416329
917 917 a, c dbSNP:143245740
918 918 -, cagcagcagcaa dbSNP:764352411
922 922 -, cagcagcaa dbSNP:751992423
923 923 a, c dbSNP:560604623
924 924 -, cagcaa dbSNP:781661613
925 925 -, cagcaa dbSNP:750984628
926 926 a, c dbSNP:761147990
927 927 -, gca dbSNP:113070757
927 927 a, g, t dbSNP:574062756
928 928 -, caa dbSNP:756562013
930 930 -, cagcagccgcag, g, gcag, gcagcag, gcagcagcag dbSNP:768322744
930 930 a, g dbSNP:754442970
933 933 a, g dbSNP:755526312
936 936 a, g dbSNP:764906078
938 938 a, c, t dbSNP:752254994
939 939 a, g dbSNP:10964525
945 945 a, g dbSNP:746603045
947 947 -, gcc dbSNP:775654167
947 947 a, c dbSNP:757085248
950 950 a, c, t dbSNP:780944879
951 951 a, g dbSNP:374998669
952 952 c, g dbSNP:775227031
953 953 a, c, t dbSNP:562886418
954 954 a, g dbSNP:368685869
956 956 a, t dbSNP:760953290
958 958 c, t dbSNP:766904459
966 966 a, g dbSNP:530795662
969 969 a, g dbSNP:368518933
972 972 a, g, t dbSNP:62639302
975 975 a, g dbSNP:371645507
981 981 c, g dbSNP:763480725
982 982 c, t dbSNP:751275713
983 983 c, t dbSNP:756891197
984 984 a, g dbSNP:781034714
985 985 a, g dbSNP:745669287
987 987 c, g dbSNP:755849046
990 990 c, t dbSNP:187483148
995 995 a, g dbSNP:533021915
1002 1002 c, g, t dbSNP:546265657
1004 1004 c, g dbSNP:747298941
1006 1006 c, t dbSNP:771281007
1010 1010 c, g dbSNP:776934202
1097 1097 c, t dbSNP:779687095
1109 1109 a, c dbSNP:753868549
1154 1154 c, t dbSNP:377206552
1155 1155 c, t dbSNP:778841627
1158 1158 g, t dbSNP:747096590
1165 1165 c, t dbSNP:771084741
1172 1172 c, t dbSNP:572114958
1179 1179 c, g dbSNP:368952400
1183 1183 c, g dbSNP:770243967
1185 1185 -, gca dbSNP:764440329
1200 1200 c, t dbSNP:775705639
1201 1201 c, t dbSNP:200539576
1204 1204 a, c dbSNP:763586101
1206 1206 a, c dbSNP:747888418
1207 1207 a, g dbSNP:774784509
1210 1210 a, c dbSNP:761338427
1236 1236 c, t dbSNP:766977472
1239 1239 c, t dbSNP:750120946
1240 1240 a, g dbSNP:760227940
1249 1249 c, t dbSNP:766260810
1273 1273 c, t dbSNP:753441708
1279 1279 c, t dbSNP:775965236
1290 1290 c, t dbSNP:369717922
1299 1299 a, g dbSNP:765208658
1302 1302 a, g dbSNP:138782877
1309 1309 a, t dbSNP:763050158
1312 1312 c, t dbSNP:763966056
1317 1317 c, t dbSNP:751417007
1332 1332 a, g dbSNP:372569895
1344 1344 c, g dbSNP:138404604
1353 1353 c, t dbSNP:766651421
1354 1354 g, t dbSNP:753807887
1362 1362 a, g dbSNP:375637363
1374 1374 g, t dbSNP:755058498
1382 1382 a, g dbSNP:779034923
1391 1391 a, g dbSNP:537327734
1398 1398 c, g dbSNP:778367535
1402 1402 c, g dbSNP:1142229
1407 1407 a, g, t dbSNP:751814191
1410 1410 g, t dbSNP:372968761
1424 1424 g, t dbSNP:745500947
1429 1429 g, t dbSNP:769617219
1431 1431 c, t dbSNP:779677622
1434 1434 a, g dbSNP:377165505
1436 1436 c, t dbSNP:768424662
1442 1442 a, c dbSNP:774354241
1446 1446 a, g dbSNP:761727722
1452 1452 c, g dbSNP:771891440
1455 1455 c, t dbSNP:142963920
1458 1458 c, g dbSNP:759725873
1482 1482 a, c dbSNP:765477393
1486 1486 a, g dbSNP:765886779
1488 1488 a, t dbSNP:146138142
1509 1509 c, t dbSNP:763035033
1518 1518 c, g dbSNP:764443050
1547 1547 a, g dbSNP:752101801
1551 1551 a, g dbSNP:140011686
1553 1553 -, g dbSNP:35724685
1580 1580 a, g dbSNP:374927642
1581 1581 c, t dbSNP:747645751
1584 1584 g, t dbSNP:7020514
1585 1585 a, g dbSNP:148805100
1596 1596 c, t dbSNP:758309121
1610 1610 a, g dbSNP:777703083
1632 1632 c, t dbSNP:563391701
1641 1641 a, c dbSNP:577005527
1644 1644 a, g dbSNP:144434753
1648 1648 c, g dbSNP:749504067
1650 1650 c, g dbSNP:768798608
1652 1652 c, g dbSNP:774448114
1656 1656 a, g dbSNP:187300214
1665 1665 a, c dbSNP:768076156
1707 1707 a, g dbSNP:773855885
1710 1710 a, g dbSNP:761327709
1732 1732 a, c dbSNP:576817778
1733 1733 a, g dbSNP:367813930
1759 1759 a, g dbSNP:1142230
1773 1773 a, g dbSNP:376510836
1785 1785 a, g dbSNP:148410896
1821 1821 a, c, t dbSNP:145129640
1824 1824 c, t dbSNP:751020630
1833 1833 a, g dbSNP:761322286
1847 1847 a, g dbSNP:767419753
1851 1851 a, g dbSNP:750318792
1867 1867 c, g dbSNP:756130502
1869 1869 a, g dbSNP:779686717
1886 1886 -, aga dbSNP:766734761
1892 1892 -, g dbSNP:753422190
1895 1895 -, gag dbSNP:778376765
1896 1896 -, gag dbSNP:754525705
1897 1897 a, c dbSNP:753721830
1898 1898 a, g dbSNP:758647013
1901 1901 a, g dbSNP:778157524
1902 1902 a, g dbSNP:747020539
1906 1906 a, g dbSNP:757410444
1908 1908 a, g dbSNP:781391587
1913 1913 a, t dbSNP:746339615
1932 1932 a, g dbSNP:766165829
1933 1933 c, g dbSNP:776706794
1934 1934 a, t dbSNP:759607496
1937 1937 g, t dbSNP:765102502
1939 1939 a, g dbSNP:752581041
1943 1943 a, t dbSNP:757380188
1951 1951 a, c dbSNP:767800251
1954 1954 a, g dbSNP:750412544
1958 1958 c, t dbSNP:768235436
1959 1959 a, g dbSNP:371544356
1972 1972 a, g dbSNP:752942963
2013 2013 c, g dbSNP:758790369
2017 2017 -, ca dbSNP:777628731
2028 2028 c, t dbSNP:202136878
2040 2040 a, g, t dbSNP:369716405
2043 2043 c, g, t dbSNP:201735133
2046 2046 a, g dbSNP:749874224
2049 2049 a, g dbSNP:13288443
2052 2052 a, g dbSNP:111606727
2058 2058 c, t dbSNP:373497659
2076 2076 c, t dbSNP:140464170
2081 2081 a, g dbSNP:112486521
2103 2103 c, t dbSNP:771077074
2112 2112 c, t dbSNP:144414155
2147 2147 -, a dbSNP:770922572
2147 2147 a, g dbSNP:759815639
2161 2161 a, g dbSNP:573842744
2166 2166 a, g dbSNP:762958063
2174 2174 a, c dbSNP:769137549
2175 2175 c, t dbSNP:774994293
2184 2184 a, g dbSNP:151212782
2190 2190 c, t dbSNP:778552092
2205 2205 a, c dbSNP:140384223
2207 2207 a, t dbSNP:760360553
2220 2220 c, t dbSNP:765966954
2235 2235 a, g dbSNP:372686049
2247 2247 a, g dbSNP:754444522
2249 2249 a, t dbSNP:150383522
2265 2265 -, a dbSNP:768905279
2274 2274 c, t dbSNP:149890563
2275 2275 a, g, t dbSNP:536427030
2294 2294 a, t dbSNP:759070815
2298 2298 a, g dbSNP:764893355
2299 2299 c, t dbSNP:774925342
2300 2300 a, g dbSNP:762457016
2307 2307 c, t dbSNP:763658497
2315 2315 c, t dbSNP:751437756
2322 2322 c, t dbSNP:757266468
2331 2331 c, t dbSNP:556117096
2332 2332 a, g dbSNP:750259032
2340 2340 c, t dbSNP:576198452
2343 2343 a, c dbSNP:369051102
2344 2344 a, g dbSNP:376376092
2348 2348 c, t dbSNP:199989401
2349 2349 a, g dbSNP:748169431
2352 2352 c, g dbSNP:758541653
2356 2356 c, g dbSNP:778051219
2358 2358 a, g dbSNP:147739329
2364 2364 a, g dbSNP:771503484
2370 2370 a, t dbSNP:776812446
2371 2371 c, g dbSNP:373755812
2373 2373 c, t dbSNP:199549400
2376 2376 c, g dbSNP:565609955
2388 2388 a, g dbSNP:571665517
2390 2390 a, c dbSNP:775121610
2391 2391 c, g, t dbSNP:762650134
2415 2415 a, c dbSNP:749703040
2430 2430 c, t dbSNP:766248287
2433 2433 c, t dbSNP:753721769
2434 2434 c, t dbSNP:376431348
2437 2437 c, t dbSNP:763222938
2442 2442 c, t dbSNP:764391439
2454 2454 c, t dbSNP:149169822
2466 2466 c, t dbSNP:140551438
2477 2477 c, g dbSNP:281875198
2486 2486 a, g dbSNP:281875203
2489 2489 c, t dbSNP:281875191
2490 2490 c, t dbSNP:781189636
2506 2506 c, g dbSNP:750906629
2517 2517 c, t dbSNP:756652635
2518 2518 c, t dbSNP:780356266
2522 2522 c, t dbSNP:749671236
2526 2526 a, g dbSNP:768236759
2529 2529 c, g dbSNP:778629078
2541 2541 c, t dbSNP:747819047
2547 2547 c, t dbSNP:145668742
2551 2551 c, g dbSNP:771591197
2565 2565 c, t dbSNP:374332187
2577 2577 a, g dbSNP:762052268
2597 2597 a, t dbSNP:767651487
2621 2621 g, t dbSNP:773214888
2641 2641 a, t dbSNP:776724364
2650 2650 a, g dbSNP:760040942
2651 2651 c, t dbSNP:765677153
2667 2667 a, c, t dbSNP:753039711
2679 2679 a, g dbSNP:764614189
2694 2694 c, t dbSNP:751237964
2697 2697 a, c, g dbSNP:138319318
2712 2712 c, t dbSNP:749920754
2736 2736 c, t dbSNP:756017570
2758 2758 a, c dbSNP:746162998
2772 2772 g, t dbSNP:367639859
2773 2773 c, g dbSNP:281875206
2775 2775 c, t dbSNP:142930412
2776 2776 a, g dbSNP:281875199
2778 2778 a, c dbSNP:281875193
2783 2783 a, g dbSNP:281875202
2785 2785 c, g, t dbSNP:281875207
2793 2793 a, g dbSNP:763516456
2807 2807 a, g dbSNP:143351615
2809 2809 c, g dbSNP:369724771
2817 2817 a, g dbSNP:748816612
2844 2844 c, g, t dbSNP:772545457
2851 2851 a, t dbSNP:750030974
2862 2862 g, t dbSNP:760423459
2863 2863 c, g dbSNP:281875194
2864 2864 g, t dbSNP:281875185
2865 2865 c, g dbSNP:148360213
2870 2870 c, t dbSNP:281875188
2871 2871 a, g dbSNP:773251995
2883 2883 a, g dbSNP:754852921
2895 2895 c, t dbSNP:201306504
2904 2904 c, t dbSNP:752699040
2923 2923 a, g dbSNP:758180728
2925 2925 a, g dbSNP:777677528
2939 2939 a, g dbSNP:746049324
2955 2955 a, g dbSNP:146829604
2970 2970 a, g dbSNP:779946367
2994 2994 a, g dbSNP:148034194
3000 3000 a, g dbSNP:575633661
3024 3024 a, c dbSNP:755091981
3030 3030 a, g dbSNP:779181733
3034 3034 c, t dbSNP:545254683
3036 3036 a, g dbSNP:772663673
3037 3037 c, t dbSNP:281875190
3049 3049 a, c dbSNP:773392525
3059 3059 c, t dbSNP:281875200
3060 3060 a, t dbSNP:281875205
3070 3070 c, t dbSNP:747406208
3081 3081 a, g dbSNP:150917593
3099 3099 c, t dbSNP:776253499
3117 3117 a, g dbSNP:774327721
3129 3129 c, t dbSNP:761701446
3130 3130 a, g dbSNP:375473288
3141 3141 g, t dbSNP:750274702
3150 3150 c, t dbSNP:759780647
3151 3151 c, t dbSNP:139445919
3152 3152 g, t dbSNP:752930993
3153 3153 a, g dbSNP:758491724
3154 3154 c, t dbSNP:529597798
3155 3155 a, t dbSNP:78915420
3158 3158 a, g dbSNP:200463125
3159 3159 c, t dbSNP:752079008
3169 3169 a, g dbSNP:757796739
3177 3177 c, g dbSNP:781490181
3192 3192 c, t dbSNP:746247256
3200 3200 a, g dbSNP:201946220
3226 3226 a, g dbSNP:772067696
3228 3228 g, t dbSNP:773271162
3273 3273 c, t dbSNP:746994208
3279 3279 a, g dbSNP:770820842
3282 3282 c, t dbSNP:776325490
3290 3290 a, c dbSNP:763188415
3300 3300 a, g dbSNP:764240763
3315 3315 a, g dbSNP:762066303
3316 3316 c, t dbSNP:772105451
3332 3332 a, g dbSNP:773308898
3348 3348 a, g dbSNP:763845550
3350 3350 c, t dbSNP:751328072
3357 3357 c, g dbSNP:756712773
3365 3365 c, t dbSNP:551055917
3381 3381 a, g dbSNP:201232457
3384 3384 c, g dbSNP:756105872
3387 3387 c, t dbSNP:369919125
3391 3391 c, t dbSNP:199759640
3392 3392 a, g dbSNP:779591664
3406 3406 c, t dbSNP:372318006
3410 3410 a, g dbSNP:746451934
3413 3413 c, t dbSNP:747313863
3414 3414 a, g, t dbSNP:770885495
3432 3432 a, g dbSNP:746313189
3438 3438 c, t dbSNP:770440833
3450 3450 a, g dbSNP:775933014
3453 3453 c, g, t dbSNP:143428093
3456 3456 c, t dbSNP:764614129
3462 3462 c, t dbSNP:774121131
3477 3477 c, t dbSNP:761561959
3487 3487 c, t dbSNP:766894963
3489 3489 a, g dbSNP:147154246
3496 3496 c, g dbSNP:755946240
3504 3504 a, g dbSNP:140418138
3507 3507 c, t dbSNP:753839466
3535 3535 c, t dbSNP:281875192
3536 3536 c, g dbSNP:281875197
3537 3537 c, t dbSNP:144342163
3549 3549 a, g dbSNP:749769765
3552 3552 a, g dbSNP:769305970
3562 3562 c, g dbSNP:751020063
3566 3566 c, t dbSNP:377073211
3569 3569 a, g dbSNP:748548278
3585 3585 a, t dbSNP:772384108
3594 3594 g, t dbSNP:187902778
3617 3617 a, g dbSNP:387907194
3626 3626 c, t dbSNP:281875195
3639 3639 c, t dbSNP:760369452
3658 3658 a, c dbSNP:281875204
3660 3660 c, t dbSNP:62534896
3695 3695 a, t dbSNP:281875240
3697 3697 c, g dbSNP:281875184
3698 3698 a, g, t dbSNP:281875187
3707 3707 a, g dbSNP:281875186
3708 3708 c, t dbSNP:763906020
3723 3723 c, t dbSNP:751419673
3732 3732 c, g, t dbSNP:148467601
3735 3735 a, g dbSNP:754177529
3736 3736 c, t dbSNP:755071816
3746 3746 a, g dbSNP:765281364
3750 3750 c, t dbSNP:753217386
3760 3760 a, g dbSNP:758850623
3768 3768 a, g dbSNP:142044676
3777 3777 c, t dbSNP:78868042
3784 3784 c, g dbSNP:281875196
3792 3792 c, t dbSNP:757686565
3808 3808 c, t dbSNP:757528279
3824 3824 c, t dbSNP:281875189
3826 3826 g, t dbSNP:281875239
3827 3827 g, t dbSNP:200774838
3836 3836 a, g dbSNP:281875201
3856 3856 g, t dbSNP:780812007
3859 3859 c, t dbSNP:281875238
3870 3870 c, t dbSNP:778806706
3873 3873 a, g dbSNP:769321041
3886 3886 g, t dbSNP:10137
3894 3894 a, g, t dbSNP:6601
3924 3924 a, c, g dbSNP:140458185
3927 3927 c, t dbSNP:748144678
3928 3928 a, g dbSNP:771961397
3935 3935 c, t dbSNP:773172570
3951 3951 a, t dbSNP:532483020
3955 3955 c, t dbSNP:759746608
3959 3959 a, g dbSNP:765383428
3973 3973 g, t dbSNP:1803765
3975 3975 c, t dbSNP:775850187
3990 3990 a, g dbSNP:370403102
3999 3999 c, g dbSNP:758048445
4002 4002 a, g dbSNP:777556670
4009 4009 a, g dbSNP:747015369
4014 4014 a, c, t dbSNP:770599118
4017 4017 c, t dbSNP:749460548
4018 4018 c, t dbSNP:768875248
4021 4021 a, g dbSNP:774351704
4023 4023 c, g, t dbSNP:763135326
4024 4024 c, t dbSNP:772201119
4026 4026 a, g dbSNP:773572356
4029 4029 a, g dbSNP:144212700
4038 4038 c, t dbSNP:560377974
4047 4047 a, g dbSNP:373570064
4059 4059 a, g dbSNP:759207053
4062 4062 a, g dbSNP:764977538
4065 4065 c, t dbSNP:61736902
4092 4092 a, c dbSNP:757958573
4101 4101 a, g dbSNP:770913956
4104 4104 c, g dbSNP:751409386
4116 4116 a, g dbSNP:141291951
4117 4117 c, g dbSNP:757237749
4125 4125 a, g dbSNP:780788702
4161 4161 c, g, t dbSNP:745662991
4166 4166 a, t dbSNP:779096421
4170 4170 c, t dbSNP:748421639
4185 4185 a, g dbSNP:772015906
4194 4194 a, g dbSNP:78274023
4209 4209 c, t dbSNP:779830008
4212 4212 a, g dbSNP:749281899
4228 4228 c, g dbSNP:373954302
4239 4239 a, g dbSNP:774311921
4248 4248 a, g dbSNP:760924689
4251 4251 a, g, t dbSNP:150227062
4259 4259 a, g dbSNP:759521062
4281 4281 c, t dbSNP:368433894
4288 4288 a, c, g dbSNP:753162708
4289 4289 c, t dbSNP:138891880
4295 4295 -, aag dbSNP:749210211
4300 4300 -, t dbSNP:772095624
4302 4302 g, t dbSNP:751758557
4303 4303 a, g dbSNP:757704280
4306 4306 a, g, t dbSNP:780692657
4307 4307 -, t dbSNP:777899372
4308 4308 -, tttatat dbSNP:747265570
4310 4310 a, t dbSNP:755545561
4311 4311 a, c dbSNP:61736901
4322 4322 c, g dbSNP:779745375
4328 4328 a, g dbSNP:371901993
4329 4329 c, t dbSNP:749193780
4331 4331 a, g dbSNP:768731403
4336 4336 -, ccg dbSNP:771118775
4339 4339 a, g, t dbSNP:148991905
4353 4353 a, g dbSNP:771960930
4369 4369 a, c dbSNP:776696051
4386 4386 c, t dbSNP:759832527
4387 4387 a, g dbSNP:769712929
4388 4388 c, g dbSNP:775559354
4395 4395 c, t dbSNP:763381660
4396 4396 a, g dbSNP:764576819
4401 4401 g, t dbSNP:752116307
4422 4422 a, t dbSNP:757469673
4425 4425 a, c, g dbSNP:547998868
4426 4426 c, g dbSNP:370103754
4435 4435 c, t dbSNP:756457254
4442 4442 a, c dbSNP:772427840
4450 4450 a, t dbSNP:780302127
4465 4465 a, g dbSNP:748909914
4499 4499 a, g dbSNP:768201532
4506 4506 a, t dbSNP:552366704
4507 4507 a, g dbSNP:751123179
4533 4533 a, g dbSNP:746908663
4541 4541 a, c dbSNP:770780957
4543 4543 c, t dbSNP:776686939
4545 4545 c, t dbSNP:138542624
4548 4548 a, g dbSNP:368897344
4552 4552 a, c dbSNP:774671393
4553 4553 a, g dbSNP:762145223
4556 4556 a, g dbSNP:767644249
4557 4557 c, t dbSNP:750471446
4558 4558 c, g dbSNP:760878072
4563 4563 a, c, t dbSNP:766785817
4569 4569 a, g dbSNP:570310321
4579 4579 a, g dbSNP:372383208
4581 4581 a, c dbSNP:1803766
4582 4582 a, g dbSNP:752298477
4584 4584 c, g dbSNP:758062226
4593 4593 g, t dbSNP:777200742
4594 4594 a, c dbSNP:766303305
4603 4603 c, g dbSNP:770522085
4608 4608 a, g dbSNP:184913034
4623 4623 a, g dbSNP:547025156
4626 4626 c, t dbSNP:769659898
4632 4632 c, t dbSNP:773278155
4641 4641 c, t dbSNP:747291340
4647 4647 c, t dbSNP:111380592
4662 4662 a, g dbSNP:375477038
4667 4667 a, c dbSNP:759970929
4668 4668 c, g dbSNP:774885198
4675 4675 c, t dbSNP:776023642
4676 4676 a, g dbSNP:763271526
4677 4677 a, g dbSNP:751453496
4679 4679 a, g dbSNP:751123196
4680 4680 c, g dbSNP:201825831
4684 4684 a, t dbSNP:147135956
4688 4688 c, g dbSNP:138684090
4689 4689 a, c, g dbSNP:755741712
4695 4695 c, g dbSNP:749281827
4699 4699 a, g dbSNP:754784283
4703 4703 a, g dbSNP:778794928
4720 4720 -, gaagaggag dbSNP:755930490
4722 4722 -, g dbSNP:779975980
4722 4722 a, c dbSNP:747142822
4723 4723 -, gag dbSNP:753887922
4729 4729 a, g dbSNP:771190439
4735 4735 a, g dbSNP:776786160
4738 4738 c, g dbSNP:573118021
4739 4739 a, t dbSNP:769899879
4741 4741 -, gaa dbSNP:754943076
4741 4741 a, g dbSNP:775935502
4747 4747 c, g dbSNP:542031893
4748 4748 a, g dbSNP:561660690
4749 4749 c, g dbSNP:764304058
4750 4750 g, t dbSNP:575273198
4751 4751 c, t dbSNP:762148677
4752 4752 a, g dbSNP:543880790
4758 4758 c, t dbSNP:77070978
4759 4759 a, g dbSNP:755656104
4762 4762 a, g dbSNP:766018422
4763 4763 c, g dbSNP:760341915
4768 4768 a, t dbSNP:770706675
4770 4770 a, c, g dbSNP:776487920
4776 4776 c, g dbSNP:549166022
4781 4781 a, c dbSNP:752628897
4786 4786 a, c dbSNP:762808945
4799 4799 a, c dbSNP:763807117
4806 4806 c, g dbSNP:2296212
4811 4811 g, t dbSNP:757101488
4813 4813 c, t dbSNP:139124915
4814 4814 a, g dbSNP:201798443
4816 4816 a, g dbSNP:755047549
4818 4818 c, t dbSNP:374750495
4827 4827 a, t dbSNP:149931024
4840 4840 c, t dbSNP:760161604
4841 4841 c, t dbSNP:778494811
4846 4846 c, t dbSNP:747368303
4847 4847 a, g dbSNP:537631853
4850 4850 c, g dbSNP:776318468
4853 4853 a, t dbSNP:745526649
4856 4856 c, t dbSNP:769286681
4860 4860 -, c dbSNP:770026358
4867 4867 c, g dbSNP:144110632
4872 4872 c, t dbSNP:762587234
4873 4873 a, g dbSNP:764005673
4883 4883 c, g dbSNP:753771608
4885 4885 a, g dbSNP:61736899
4887 4887 c, t dbSNP:761563170
4891 4891 a, c, g dbSNP:778660870
4893 4893 a, g dbSNP:61761955
4899 4899 c, t dbSNP:143522467
4902 4902 a, t dbSNP:751838059
4903 4903 c, t dbSNP:367755009
4904 4904 a, g dbSNP:138760068
4905 4905 a, t dbSNP:747562199
4911 4911 a, g, t dbSNP:190172342
4920 4920 a, t dbSNP:780488557
4928 4928 c, t dbSNP:753433101
4929 4929 a, g dbSNP:146702999
4930 4930 c, g dbSNP:778603688
4932 4932 a, t dbSNP:372976069
4934 4934 a, g dbSNP:771664849
4939 4939 c, t dbSNP:777544424
4945 4945 a, g dbSNP:747001194
4945 4945 -, g dbSNP:769137081
4947 4947 a, g dbSNP:192980752
4950 4950 c, g dbSNP:561093327
4955 4955 a, t dbSNP:371424653
4957 4957 c, t dbSNP:768982865
4959 4959 -, c dbSNP:773743943
4964 4964 a, g dbSNP:774759394
4966 4966 a, g dbSNP:761766784
4967 4967 a, g dbSNP:377168669
4970 4970 c, t dbSNP:758742198
4977 4977 c, g dbSNP:369265928
4981 4981 c, t dbSNP:766666410
4985 4985 c, t dbSNP:574547210
4988 4988 c, t dbSNP:755395260
4999 4999 c, t dbSNP:185669620
5006 5006 c, t dbSNP:563359861
5021 5021 c, t dbSNP:370531788
5035 5035 g, t dbSNP:189476291
5042 5042 a, c dbSNP:749591740
5050 5050 a, g dbSNP:552166560
5079 5079 a, c, t dbSNP:75720779
5087 5087 a, c dbSNP:746707359
5096 5096 -, atc dbSNP:771295558
5121 5121 a, g dbSNP:779055220
5122 5122 c, t dbSNP:180701505
5133 5133 a, g dbSNP:768360622
5140 5140 a, g dbSNP:776210464
5141 5141 c, t dbSNP:548597702
5146 5146 a, g dbSNP:139076728
5154 5154 a, g dbSNP:537230683
5157 5157 c, t dbSNP:367814078
5173 5173 -, aaac dbSNP:779056668
5204 5204 c, t dbSNP:373674996
5205 5205 c, g dbSNP:550688759
5211 5211 c, g dbSNP:530276913
5213 5213 a, t dbSNP:747681965
5219 5219 c, t dbSNP:539464457
5225 5225 c, t dbSNP:185399613
5242 5242 -, t dbSNP:3215772
5244 5244 g, t dbSNP:553292247
5261 5261 c, t dbSNP:572256579
5265 5265 c, g dbSNP:550337302
5276 5276 g, t dbSNP:143996657
5284 5284 a, t dbSNP:574612087
5288 5288 a, g dbSNP:769251512
5291 5291 -, t dbSNP:541329338
5323 5323 a, g dbSNP:370180389
5372 5372 a, g dbSNP:17387924
5389 5389 a, g dbSNP:762925046
5396 5396 -, tttt dbSNP:564489275
5418 5418 c, t dbSNP:557888524
5428 5428 -, taatagg dbSNP:772015935
5451 5451 a, g dbSNP:766145312
5468 5468 c, t dbSNP:774187192
5473 5473 a, g dbSNP:746530217
5478 5478 c, t dbSNP:759183108
5481 5481 a, g dbSNP:563386522
5493 5493 -, tgatc dbSNP:746730143
5517 5517 a, c dbSNP:764421852
5520 5520 a, g dbSNP:369158564
5548 5548 c, t dbSNP:763644880
5561 5561 c, t dbSNP:7048532
5574 5574 a, g dbSNP:768145842
5575 5575 a, t dbSNP:539115422
5631 5631 a, g dbSNP:545815855
5639 5639 c, t dbSNP:45616134
5653 5653 g, t dbSNP:757455388
5657 5657 a, g dbSNP:1061478
5667 5667 c, t dbSNP:28374302
5687 5687 c, t dbSNP:758943491
5721 5721 a, g dbSNP:541644134
5773 5773 a, c dbSNP:74587303
5791 5791 g, t dbSNP:562222393
5801 5801 a, g dbSNP:188397000
5802 5802 -, aaag dbSNP:747090054
5817 5817 c, g dbSNP:553367571

Target ORF information:

RefSeq Version NM_139045
Organism Homo sapiens (human)
Definition Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20836
Accession Version NM_001289396.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4773bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product probable global transcription activator SNF2L2 isoform a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL359076.16, X72889.1, BC068252.1, AK299683.1, BC066596.1 and AK094076.1. On Jan 17, 2014 this sequence version replaced gi:530390098. Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]. Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1 and 3 encode the same protein (isoform a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X72889.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142586, SAMEA2145240 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)207..209(+)
Misc Feature(2)327..731(+)
Misc Feature(3)723..833(+)
Misc Feature(4)732..734(+)
Misc Feature(5)1194..1196(+)
Misc Feature(6)1515..1733(+)
Misc Feature(7)1971..2105(+)
Misc Feature(8)2388..3275(+)
Misc Feature(9)2439..2858(+)
Misc Feature(10)2463..2477(+)
Misc Feature(11)2760..2771(+)
Misc Feature(12)2760..2771(+)
Misc Feature(13)3198..3200(+)
Misc Feature(14)3204..3206(+)
Misc Feature(15)3327..3725(+)
Misc Feature(16)3429..3593(+)
Misc Feature(17)3609..3695(+)
Misc Feature(18)3984..4187(+)
Misc Feature(19)4206..>4466(+)
Misc Feature(20)4290..4466(+)
Misc Feature(21)4353..4727(+)
Misc Feature(22)4500..4673(+)
Misc Feature(23)4743..4745(+)
Misc Feature(24)4755..4757(+)
Misc Feature(25)4791..4793(+)
Misc Feature(26)4911..4913(+)
Misc Feature(27)4923..4925(+)
Exon (1)1..173
Gene Synonym:
Exon (2)174..434
Gene Synonym:
Exon (3)435..564
Gene Synonym:
Exon (4)565..999
Gene Synonym:
Exon (5)1000..1255
Gene Synonym:
Exon (6)1256..1382
Gene Synonym:
Exon (7)1383..1556
Gene Synonym:
Exon (8)1557..1730
Gene Synonym:
Exon (9)1731..1901
Gene Synonym:
Exon (10)1902..1955
Gene Synonym:
Exon (11)1956..2086
Gene Synonym:
Exon (12)2087..2144
Gene Synonym:
Exon (13)2145..2245
Gene Synonym:
Exon (14)2246..2393
Gene Synonym:
Exon (15)2394..2557
Gene Synonym:
Exon (16)2558..2624
Gene Synonym:
Exon (17)2625..2735
Gene Synonym:
Exon (18)2736..2978
Gene Synonym:
Exon (19)2979..3092
Gene Synonym:
Exon (20)3093..3200
Gene Synonym:
Exon (21)3201..3287
Gene Synonym:
Exon (22)3288..3334
Gene Synonym:
Exon (23)3335..3501
Gene Synonym:
Exon (24)3502..3665
Gene Synonym:
Exon (25)3666..3893
Gene Synonym:
Exon (26)3894..3971
Gene Synonym:
Exon (27)3972..4190
Gene Synonym:
Exon (28)4191..4408
Gene Synonym:
Exon (29)4409..4462
Gene Synonym:
Exon (30)4463..4568
Gene Synonym:
Exon (31)4569..4670
Gene Synonym:
Exon (32)4671..4803
Gene Synonym:
Exon (33)4804..4946
Gene Synonym:
Exon (34)4947..5867
Gene Synonym:
Position Chain Variation Link
10 10 a, t dbSNP:535437472
14 14 -, gg dbSNP:368825881
16 16 a, g dbSNP:188661346
31 31 c, t dbSNP:575567853
32 32 a, g dbSNP:142126867
35 35 a, g dbSNP:563435740
50 50 c, t dbSNP:191909868
59 59 -, gaac dbSNP:757376420
59 59 -, g dbSNP:751687458
63 63 c, t dbSNP:773084923
70 70 a, g dbSNP:751513695
92 92 c, t dbSNP:546058762
93 93 a, g dbSNP:377739827
96 96 a, t dbSNP:151131549
121 121 a, g dbSNP:754928346
140 140 a, g dbSNP:112292332
151 151 c, t dbSNP:548326140
153 153 c, g dbSNP:561689823
180 180 c, t dbSNP:368879989
183 183 a, g dbSNP:370082404
205 205 a, g dbSNP:10964468
218 218 a, g dbSNP:775432878
221 221 c, t dbSNP:762840154
231 231 a, g dbSNP:772087302
235 235 c, t dbSNP:773325366
236 236 a, g dbSNP:149689575
240 240 c, t dbSNP:145516397
242 242 c, t dbSNP:754052480
257 257 a, g dbSNP:760000638
259 259 c, t dbSNP:543241889
260 260 a, c, g dbSNP:148865068
264 264 c, t dbSNP:777207780
271 271 a, c dbSNP:776972919
272 272 a, t dbSNP:756655795
275 275 c, t dbSNP:780915633
299 299 -, ccagga dbSNP:776268690
306 306 c, t dbSNP:146990134
312 312 a, c, t dbSNP:562820489
313 313 c, t dbSNP:749279138
321 321 g, t dbSNP:768632343
322 322 c, g dbSNP:774085434
326 326 c, t dbSNP:760818868
327 327 a, g dbSNP:374826893
334 334 a, g dbSNP:777024299
339 339 a, g dbSNP:531812409
346 346 c, t dbSNP:765745579
348 348 a, g dbSNP:775986079
363 363 a, g dbSNP:763439455
366 366 a, g dbSNP:191818866
368 368 c, g dbSNP:751953852
382 382 c, t dbSNP:764338204
383 383 a, g dbSNP:10964470
384 384 a, t dbSNP:138129490
385 385 c, t dbSNP:755744610
386 386 a, c, g dbSNP:10964471
391 391 c, g dbSNP:754667442
396 396 a, t dbSNP:778927818
398 398 a, g dbSNP:752638398
417 417 a, t dbSNP:143478968
419 419 a, g dbSNP:529054959
421 421 a, c dbSNP:746149405
437 437 c, t dbSNP:769108800
440 440 c, t dbSNP:148086416
441 441 a, g dbSNP:762444118
450 450 c, g dbSNP:772570058
451 451 a, c dbSNP:201962378
453 453 c, g dbSNP:141861118
455 455 c, t dbSNP:181403075
459 459 c, g dbSNP:753566360
465 465 g, t dbSNP:751197799
473 473 c, t dbSNP:370078162
476 476 c, t dbSNP:765136584
486 486 a, t dbSNP:752428364
488 488 c, t dbSNP:758202044
489 489 a, g dbSNP:777868389
495 495 a, g dbSNP:751493659
500 500 c, t dbSNP:756297297
513 513 a, c dbSNP:779970953
514 514 a, c dbSNP:749577820
519 519 c, g dbSNP:768751465
520 520 c, t dbSNP:779121655
521 521 a, g dbSNP:564889539
525 525 a, g dbSNP:748471352
529 529 g, t dbSNP:533959336
530 530 c, t dbSNP:773736788
533 533 a, t dbSNP:150630640
534 534 c, g, t dbSNP:374114848
546 546 a, g dbSNP:759299457
562 562 a, g dbSNP:764802549
567 567 c, t dbSNP:767365351
572 572 a, g dbSNP:372393164
582 582 c, g, t dbSNP:755042247
589 589 c, t dbSNP:267602196
595 595 a, g dbSNP:752964642
598 598 a, c dbSNP:758603765
599 599 c, t dbSNP:564538281
600 600 c, t dbSNP:778176567
607 607 a, g dbSNP:747378712
609 609 a, g dbSNP:201403629
613 613 c, g dbSNP:781572572
621 621 a, g dbSNP:746348659
624 624 c, t dbSNP:769229718
641 641 c, t dbSNP:775121008
649 649 a, g dbSNP:200749632
657 657 a, c dbSNP:187402350
667 667 c, t dbSNP:774084308
668 668 a, g dbSNP:375996388
670 670 g, t dbSNP:767299222
671 671 a, g dbSNP:61736900
672 672 g, t dbSNP:760635852
680 680 a, c dbSNP:753064421
681 681 c, g dbSNP:548490250
691 691 c, t dbSNP:149394378
692 692 a, c, g, t dbSNP:146359524
693 693 c, g dbSNP:550716951
701 701 c, g dbSNP:750943048
709 709 c, g dbSNP:376294726
711 711 a, g dbSNP:779781841
722 722 a, c dbSNP:148002538
726 726 a, c, t dbSNP:768229159
733 733 a, g dbSNP:539475818
735 735 a, c dbSNP:771809195
737 737 c, t dbSNP:773045029
759 759 a, g dbSNP:760594090
770 770 a, g dbSNP:144501382
776 776 c, t dbSNP:546427851
787 787 c, g dbSNP:763043275
789 789 a, c dbSNP:764118923
800 800 c, t dbSNP:751821597
806 806 c, t dbSNP:747247552
807 807 a, g dbSNP:767831539
811 811 c, t dbSNP:750798867
812 812 a, g dbSNP:199724104
818 818 a, g dbSNP:567348902
821 821 c, t dbSNP:780724512
824 824 a, t dbSNP:754353178
826 826 c, t dbSNP:535106964
841 841 c, t dbSNP:146164750
848 848 a, t dbSNP:747810652
854 854 -, gca dbSNP:775161492
854 854 a, g dbSNP:554962671
858 858 -, caa dbSNP:762758875
860 860 a, g dbSNP:13296982
861 861 -, caacagcagcagcaacag dbSNP:757162806
861 861 -, caacagcagcag dbSNP:763968534
864 864 -, cagcagcagcaacagcagcag dbSNP:748496168
864 864 -, cagcagcagcaacagcag dbSNP:753907033
864 864 -, cagcagcagcaacag dbSNP:755171359
872 872 -, caa dbSNP:778261622
873 873 -, caa dbSNP:747578881
874 874 -, gc dbSNP:771561232
875 875 -, cag, cagcagcag dbSNP:745316697
875 875 a, g dbSNP:13296987
876 876 -, cagcagcagcagcag dbSNP:763994276
876 876 -, cagcagcag dbSNP:775167281
876 876 -, cagcag dbSNP:762478166
876 876 -, cag dbSNP:781477472
878 878 a, g dbSNP:62639301
883 883 -, ag dbSNP:767388089
883 883 a, c dbSNP:145170448
886 886 -, a dbSNP:765203753
886 886 a, c dbSNP:147609454
890 890 a, g dbSNP:142219087
892 892 -, a dbSNP:757850599
892 892 a, c dbSNP:62534884
895 895 -, a dbSNP:779405725
895 895 a, c dbSNP:184126259
896 896 a, g dbSNP:774478658
897 897 -, cagcagcagcagcagcagcaa dbSNP:774133062
898 898 -, gcc dbSNP:772031527
898 898 -, a dbSNP:761550852
898 898 a, c dbSNP:145635937
899 899 a, g dbSNP:578143503
901 901 -, ag dbSNP:773178214
901 901 a, g dbSNP:767788014
902 902 -, cagcagcagcagcaa dbSNP:760511909
902 902 a, g dbSNP:149130789
903 903 a, c dbSNP:750557515
904 904 -, a dbSNP:765416329
904 904 a, c dbSNP:143245740
905 905 -, cagcagcagcaa dbSNP:764352411
909 909 -, cagcagcaa dbSNP:751992423
910 910 a, c dbSNP:560604623
911 911 -, cagcaa dbSNP:781661613
912 912 -, cagcaa dbSNP:750984628
913 913 a, c dbSNP:761147990
914 914 -, gca dbSNP:113070757
914 914 a, g, t dbSNP:574062756
915 915 -, caa dbSNP:756562013
917 917 -, cagcagccgcag, g, gcag, gcagcag, gcagcagcag dbSNP:768322744
917 917 a, g dbSNP:754442970
920 920 a, g dbSNP:755526312
923 923 a, g dbSNP:764906078
925 925 a, c, t dbSNP:752254994
926 926 a, g dbSNP:10964525
932 932 a, g dbSNP:746603045
934 934 -, gcc dbSNP:775654167
934 934 a, c dbSNP:757085248
937 937 a, c, t dbSNP:780944879
938 938 a, g dbSNP:374998669
939 939 c, g dbSNP:775227031
940 940 a, c, t dbSNP:562886418
941 941 a, g dbSNP:368685869
943 943 a, t dbSNP:760953290
945 945 c, t dbSNP:766904459
953 953 a, g dbSNP:530795662
956 956 a, g dbSNP:368518933
959 959 a, g, t dbSNP:62639302
962 962 a, g dbSNP:371645507
968 968 c, g dbSNP:763480725
969 969 c, t dbSNP:751275713
970 970 c, t dbSNP:756891197
971 971 a, g dbSNP:781034714
972 972 a, g dbSNP:745669287
974 974 c, g dbSNP:755849046
977 977 c, t dbSNP:187483148
982 982 a, g dbSNP:533021915
989 989 c, g, t dbSNP:546265657
991 991 c, g dbSNP:747298941
993 993 c, t dbSNP:771281007
997 997 c, g dbSNP:776934202
1084 1084 c, t dbSNP:779687095
1096 1096 a, c dbSNP:753868549
1141 1141 c, t dbSNP:377206552
1142 1142 c, t dbSNP:778841627
1145 1145 g, t dbSNP:747096590
1152 1152 c, t dbSNP:771084741
1159 1159 c, t dbSNP:572114958
1166 1166 c, g dbSNP:368952400
1170 1170 c, g dbSNP:770243967
1172 1172 -, gca dbSNP:764440329
1187 1187 c, t dbSNP:775705639
1188 1188 c, t dbSNP:200539576
1191 1191 a, c dbSNP:763586101
1193 1193 a, c dbSNP:747888418
1194 1194 a, g dbSNP:774784509
1197 1197 a, c dbSNP:761338427
1223 1223 c, t dbSNP:766977472
1226 1226 c, t dbSNP:750120946
1227 1227 a, g dbSNP:760227940
1236 1236 c, t dbSNP:766260810
1260 1260 c, t dbSNP:753441708
1266 1266 c, t dbSNP:775965236
1277 1277 c, t dbSNP:369717922
1286 1286 a, g dbSNP:765208658
1289 1289 a, g dbSNP:138782877
1296 1296 a, t dbSNP:763050158
1299 1299 c, t dbSNP:763966056
1304 1304 c, t dbSNP:751417007
1319 1319 a, g dbSNP:372569895
1331 1331 c, g dbSNP:138404604
1340 1340 c, t dbSNP:766651421
1341 1341 g, t dbSNP:753807887
1349 1349 a, g dbSNP:375637363
1361 1361 g, t dbSNP:755058498
1369 1369 a, g dbSNP:779034923
1378 1378 a, g dbSNP:537327734
1385 1385 c, g dbSNP:778367535
1389 1389 c, g dbSNP:1142229
1394 1394 a, g, t dbSNP:751814191
1397 1397 g, t dbSNP:372968761
1411 1411 g, t dbSNP:745500947
1416 1416 g, t dbSNP:769617219
1418 1418 c, t dbSNP:779677622
1421 1421 a, g dbSNP:377165505
1423 1423 c, t dbSNP:768424662
1429 1429 a, c dbSNP:774354241
1433 1433 a, g dbSNP:761727722
1439 1439 c, g dbSNP:771891440
1442 1442 c, t dbSNP:142963920
1445 1445 c, g dbSNP:759725873
1469 1469 a, c dbSNP:765477393
1473 1473 a, g dbSNP:765886779
1475 1475 a, t dbSNP:146138142
1496 1496 c, t dbSNP:763035033
1505 1505 c, g dbSNP:764443050
1534 1534 a, g dbSNP:752101801
1538 1538 a, g dbSNP:140011686
1540 1540 -, g dbSNP:35724685
1567 1567 a, g dbSNP:374927642
1568 1568 c, t dbSNP:747645751
1571 1571 g, t dbSNP:7020514
1572 1572 a, g dbSNP:148805100
1583 1583 c, t dbSNP:758309121
1597 1597 a, g dbSNP:777703083
1619 1619 c, t dbSNP:563391701
1628 1628 a, c dbSNP:577005527
1631 1631 a, g dbSNP:144434753
1635 1635 c, g dbSNP:749504067
1637 1637 c, g dbSNP:768798608
1639 1639 c, g dbSNP:774448114
1643 1643 a, g dbSNP:187300214
1652 1652 a, c dbSNP:768076156
1694 1694 a, g dbSNP:773855885
1697 1697 a, g dbSNP:761327709
1719 1719 a, c dbSNP:576817778
1720 1720 a, g dbSNP:367813930
1746 1746 a, g dbSNP:1142230
1760 1760 a, g dbSNP:376510836
1772 1772 a, g dbSNP:148410896
1808 1808 a, c, t dbSNP:145129640
1811 1811 c, t dbSNP:751020630
1820 1820 a, g dbSNP:761322286
1834 1834 a, g dbSNP:767419753
1838 1838 a, g dbSNP:750318792
1854 1854 c, g dbSNP:756130502
1856 1856 a, g dbSNP:779686717
1873 1873 -, aga dbSNP:766734761
1879 1879 -, g dbSNP:753422190
1882 1882 -, gag dbSNP:778376765
1883 1883 -, gag dbSNP:754525705
1884 1884 a, c dbSNP:753721830
1885 1885 a, g dbSNP:758647013
1888 1888 a, g dbSNP:778157524
1889 1889 a, g dbSNP:747020539
1893 1893 a, g dbSNP:757410444
1895 1895 a, g dbSNP:781391587
1900 1900 a, t dbSNP:746339615
1919 1919 a, g dbSNP:766165829
1920 1920 c, g dbSNP:776706794
1921 1921 a, t dbSNP:759607496
1924 1924 g, t dbSNP:765102502
1926 1926 a, g dbSNP:752581041
1930 1930 a, t dbSNP:757380188
1938 1938 a, c dbSNP:767800251
1941 1941 a, g dbSNP:750412544
1945 1945 c, t dbSNP:768235436
1946 1946 a, g dbSNP:371544356
1959 1959 a, g dbSNP:752942963
2000 2000 c, g dbSNP:758790369
2004 2004 -, ca dbSNP:777628731
2015 2015 c, t dbSNP:202136878
2027 2027 a, g, t dbSNP:369716405
2030 2030 c, g, t dbSNP:201735133
2033 2033 a, g dbSNP:749874224
2036 2036 a, g dbSNP:13288443
2039 2039 a, g dbSNP:111606727
2045 2045 c, t dbSNP:373497659
2063 2063 c, t dbSNP:140464170
2068 2068 a, g dbSNP:112486521
2090 2090 c, t dbSNP:771077074
2099 2099 c, t dbSNP:144414155
2134 2134 -, a dbSNP:770922572
2134 2134 a, g dbSNP:759815639
2148 2148 a, g dbSNP:573842744
2153 2153 a, g dbSNP:762958063
2161 2161 a, c dbSNP:769137549
2162 2162 c, t dbSNP:774994293
2171 2171 a, g dbSNP:151212782
2177 2177 c, t dbSNP:778552092
2192 2192 a, c dbSNP:140384223
2194 2194 a, t dbSNP:760360553
2207 2207 c, t dbSNP:765966954
2222 2222 a, g dbSNP:372686049
2234 2234 a, g dbSNP:754444522
2236 2236 a, t dbSNP:150383522
2252 2252 -, a dbSNP:768905279
2261 2261 c, t dbSNP:149890563
2262 2262 a, g, t dbSNP:536427030
2281 2281 a, t dbSNP:759070815
2285 2285 a, g dbSNP:764893355
2286 2286 c, t dbSNP:774925342
2287 2287 a, g dbSNP:762457016
2294 2294 c, t dbSNP:763658497
2302 2302 c, t dbSNP:751437756
2309 2309 c, t dbSNP:757266468
2318 2318 c, t dbSNP:556117096
2319 2319 a, g dbSNP:750259032
2327 2327 c, t dbSNP:576198452
2330 2330 a, c dbSNP:369051102
2331 2331 a, g dbSNP:376376092
2335 2335 c, t dbSNP:199989401
2336 2336 a, g dbSNP:748169431
2339 2339 c, g dbSNP:758541653
2343 2343 c, g dbSNP:778051219
2345 2345 a, g dbSNP:147739329
2351 2351 a, g dbSNP:771503484
2357 2357 a, t dbSNP:776812446
2358 2358 c, g dbSNP:373755812
2360 2360 c, t dbSNP:199549400
2363 2363 c, g dbSNP:565609955
2375 2375 a, g dbSNP:571665517
2377 2377 a, c dbSNP:775121610
2378 2378 c, g, t dbSNP:762650134
2402 2402 a, c dbSNP:749703040
2417 2417 c, t dbSNP:766248287
2420 2420 c, t dbSNP:753721769
2421 2421 c, t dbSNP:376431348
2424 2424 c, t dbSNP:763222938
2429 2429 c, t dbSNP:764391439
2441 2441 c, t dbSNP:149169822
2453 2453 c, t dbSNP:140551438
2464 2464 c, g dbSNP:281875198
2473 2473 a, g dbSNP:281875203
2476 2476 c, t dbSNP:281875191
2477 2477 c, t dbSNP:781189636
2493 2493 c, g dbSNP:750906629
2504 2504 c, t dbSNP:756652635
2505 2505 c, t dbSNP:780356266
2509 2509 c, t dbSNP:749671236
2513 2513 a, g dbSNP:768236759
2516 2516 c, g dbSNP:778629078
2528 2528 c, t dbSNP:747819047
2534 2534 c, t dbSNP:145668742
2538 2538 c, g dbSNP:771591197
2552 2552 c, t dbSNP:374332187
2564 2564 a, g dbSNP:762052268
2584 2584 a, t dbSNP:767651487
2608 2608 g, t dbSNP:773214888
2628 2628 a, t dbSNP:776724364
2637 2637 a, g dbSNP:760040942
2638 2638 c, t dbSNP:765677153
2654 2654 a, c, t dbSNP:753039711
2666 2666 a, g dbSNP:764614189
2681 2681 c, t dbSNP:751237964
2684 2684 a, c, g dbSNP:138319318
2699 2699 c, t dbSNP:749920754
2723 2723 c, t dbSNP:756017570
2745 2745 a, c dbSNP:746162998
2759 2759 g, t dbSNP:367639859
2760 2760 c, g dbSNP:281875206
2762 2762 c, t dbSNP:142930412
2763 2763 a, g dbSNP:281875199
2765 2765 a, c dbSNP:281875193
2770 2770 a, g dbSNP:281875202
2772 2772 c, g, t dbSNP:281875207
2780 2780 a, g dbSNP:763516456
2794 2794 a, g dbSNP:143351615
2796 2796 c, g dbSNP:369724771
2804 2804 a, g dbSNP:748816612
2831 2831 c, g, t dbSNP:772545457
2838 2838 a, t dbSNP:750030974
2849 2849 g, t dbSNP:760423459
2850 2850 c, g dbSNP:281875194
2851 2851 g, t dbSNP:281875185
2852 2852 c, g dbSNP:148360213
2857 2857 c, t dbSNP:281875188
2858 2858 a, g dbSNP:773251995
2870 2870 a, g dbSNP:754852921
2882 2882 c, t dbSNP:201306504
2891 2891 c, t dbSNP:752699040
2910 2910 a, g dbSNP:758180728
2912 2912 a, g dbSNP:777677528
2926 2926 a, g dbSNP:746049324
2942 2942 a, g dbSNP:146829604
2957 2957 a, g dbSNP:779946367
2981 2981 a, g dbSNP:148034194
2987 2987 a, g dbSNP:575633661
3011 3011 a, c dbSNP:755091981
3017 3017 a, g dbSNP:779181733
3021 3021 c, t dbSNP:545254683
3023 3023 a, g dbSNP:772663673
3024 3024 c, t dbSNP:281875190
3036 3036 a, c dbSNP:773392525
3046 3046 c, t dbSNP:281875200
3047 3047 a, t dbSNP:281875205
3057 3057 c, t dbSNP:747406208
3068 3068 a, g dbSNP:150917593
3086 3086 c, t dbSNP:776253499
3104 3104 a, g dbSNP:774327721
3116 3116 c, t dbSNP:761701446
3117 3117 a, g dbSNP:375473288
3128 3128 g, t dbSNP:750274702
3137 3137 c, t dbSNP:759780647
3138 3138 c, t dbSNP:139445919
3139 3139 g, t dbSNP:752930993
3140 3140 a, g dbSNP:758491724
3141 3141 c, t dbSNP:529597798
3142 3142 a, t dbSNP:78915420
3145 3145 a, g dbSNP:200463125
3146 3146 c, t dbSNP:752079008
3156 3156 a, g dbSNP:757796739
3164 3164 c, g dbSNP:781490181
3179 3179 c, t dbSNP:746247256
3187 3187 a, g dbSNP:201946220
3213 3213 a, g dbSNP:772067696
3215 3215 g, t dbSNP:773271162
3260 3260 c, t dbSNP:746994208
3266 3266 a, g dbSNP:770820842
3269 3269 c, t dbSNP:776325490
3277 3277 a, c dbSNP:763188415
3287 3287 a, g dbSNP:764240763
3302 3302 a, g dbSNP:762066303
3303 3303 c, t dbSNP:772105451
3319 3319 a, g dbSNP:773308898
3335 3335 a, g dbSNP:763845550
3337 3337 c, t dbSNP:751328072
3344 3344 c, g dbSNP:756712773
3352 3352 c, t dbSNP:551055917
3368 3368 a, g dbSNP:201232457
3371 3371 c, g dbSNP:756105872
3374 3374 c, t dbSNP:369919125
3378 3378 c, t dbSNP:199759640
3379 3379 a, g dbSNP:779591664
3393 3393 c, t dbSNP:372318006
3397 3397 a, g dbSNP:746451934
3400 3400 c, t dbSNP:747313863
3401 3401 a, g, t dbSNP:770885495
3419 3419 a, g dbSNP:746313189
3425 3425 c, t dbSNP:770440833
3437 3437 a, g dbSNP:775933014
3440 3440 c, g, t dbSNP:143428093
3443 3443 c, t dbSNP:764614129
3449 3449 c, t dbSNP:774121131
3464 3464 c, t dbSNP:761561959
3474 3474 c, t dbSNP:766894963
3476 3476 a, g dbSNP:147154246
3483 3483 c, g dbSNP:755946240
3491 3491 a, g dbSNP:140418138
3494 3494 c, t dbSNP:753839466
3522 3522 c, t dbSNP:281875192
3523 3523 c, g dbSNP:281875197
3524 3524 c, t dbSNP:144342163
3536 3536 a, g dbSNP:749769765
3539 3539 a, g dbSNP:769305970
3549 3549 c, g dbSNP:751020063
3553 3553 c, t dbSNP:377073211
3556 3556 a, g dbSNP:748548278
3572 3572 a, t dbSNP:772384108
3581 3581 g, t dbSNP:187902778
3604 3604 a, g dbSNP:387907194
3613 3613 c, t dbSNP:281875195
3626 3626 c, t dbSNP:760369452
3645 3645 a, c dbSNP:281875204
3647 3647 c, t dbSNP:62534896
3682 3682 a, t dbSNP:281875240
3684 3684 c, g dbSNP:281875184
3685 3685 a, g, t dbSNP:281875187
3694 3694 a, g dbSNP:281875186
3695 3695 c, t dbSNP:763906020
3710 3710 c, t dbSNP:751419673
3719 3719 c, g, t dbSNP:148467601
3722 3722 a, g dbSNP:754177529
3723 3723 c, t dbSNP:755071816
3733 3733 a, g dbSNP:765281364
3737 3737 c, t dbSNP:753217386
3747 3747 a, g dbSNP:758850623
3755 3755 a, g dbSNP:142044676
3764 3764 c, t dbSNP:78868042
3771 3771 c, g dbSNP:281875196
3779 3779 c, t dbSNP:757686565
3795 3795 c, t dbSNP:757528279
3811 3811 c, t dbSNP:281875189
3813 3813 g, t dbSNP:281875239
3814 3814 g, t dbSNP:200774838
3823 3823 a, g dbSNP:281875201
3843 3843 g, t dbSNP:780812007
3846 3846 c, t dbSNP:281875238
3857 3857 c, t dbSNP:778806706
3860 3860 a, g dbSNP:769321041
3873 3873 g, t dbSNP:10137
3881 3881 a, g, t dbSNP:6601
3911 3911 a, c, g dbSNP:140458185
3914 3914 c, t dbSNP:748144678
3915 3915 a, g dbSNP:771961397
3922 3922 c, t dbSNP:773172570
3938 3938 a, t dbSNP:532483020
3942 3942 c, t dbSNP:759746608
3946 3946 a, g dbSNP:765383428
3960 3960 g, t dbSNP:1803765
3962 3962 c, t dbSNP:775850187
3977 3977 a, g dbSNP:370403102
3986 3986 c, g dbSNP:758048445
3989 3989 a, g dbSNP:777556670
3996 3996 a, g dbSNP:747015369
4001 4001 a, c, t dbSNP:770599118
4004 4004 c, t dbSNP:749460548
4005 4005 c, t dbSNP:768875248
4008 4008 a, g dbSNP:774351704
4010 4010 c, g, t dbSNP:763135326
4011 4011 c, t dbSNP:772201119
4013 4013 a, g dbSNP:773572356
4016 4016 a, g dbSNP:144212700
4025 4025 c, t dbSNP:560377974
4034 4034 a, g dbSNP:373570064
4046 4046 a, g dbSNP:759207053
4049 4049 a, g dbSNP:764977538
4052 4052 c, t dbSNP:61736902
4079 4079 a, c dbSNP:757958573
4088 4088 a, g dbSNP:770913956
4091 4091 c, g dbSNP:751409386
4103 4103 a, g dbSNP:141291951
4104 4104 c, g dbSNP:757237749
4112 4112 a, g dbSNP:780788702
4148 4148 c, g, t dbSNP:745662991
4153 4153 a, t dbSNP:779096421
4157 4157 c, t dbSNP:748421639
4172 4172 a, g dbSNP:772015906
4181 4181 a, g dbSNP:78274023
4196 4196 c, t dbSNP:779830008
4199 4199 a, g dbSNP:749281899
4215 4215 c, g dbSNP:373954302
4226 4226 a, g dbSNP:774311921
4235 4235 a, g dbSNP:760924689
4238 4238 a, g, t dbSNP:150227062
4246 4246 a, g dbSNP:759521062
4268 4268 c, t dbSNP:368433894
4275 4275 a, c, g dbSNP:753162708
4276 4276 c, t dbSNP:138891880
4282 4282 -, aag dbSNP:749210211
4287 4287 -, t dbSNP:772095624
4289 4289 g, t dbSNP:751758557
4290 4290 a, g dbSNP:757704280
4293 4293 a, g, t dbSNP:780692657
4294 4294 -, t dbSNP:777899372
4295 4295 -, tttatat dbSNP:747265570
4297 4297 a, t dbSNP:755545561
4298 4298 a, c dbSNP:61736901
4309 4309 c, g dbSNP:779745375
4315 4315 a, g dbSNP:371901993
4316 4316 c, t dbSNP:749193780
4318 4318 a, g dbSNP:768731403
4323 4323 -, ccg dbSNP:771118775
4326 4326 a, g, t dbSNP:148991905
4340 4340 a, g dbSNP:771960930
4356 4356 a, c dbSNP:776696051
4373 4373 c, t dbSNP:759832527
4374 4374 a, g dbSNP:769712929
4375 4375 c, g dbSNP:775559354
4382 4382 c, t dbSNP:763381660
4383 4383 a, g dbSNP:764576819
4388 4388 g, t dbSNP:752116307
4410 4410 c, t dbSNP:768679129
4411 4411 a, g dbSNP:774515107
4415 4415 c, t dbSNP:373924332
4416 4416 a, g dbSNP:143797398
4419 4419 a, g dbSNP:773662441
4426 4426 g, t dbSNP:761089345
4427 4427 a, g dbSNP:558384854
4435 4435 a, g dbSNP:776394320
4436 4436 c, t dbSNP:759294870
4438 4438 c, t dbSNP:764781379
4440 4440 c, t dbSNP:752254761
4444 4444 g, t dbSNP:757912247
4456 4456 c, g dbSNP:3793510
4463 4463 a, t dbSNP:757469673
4466 4466 a, c, g dbSNP:547998868
4467 4467 c, g dbSNP:370103754
4476 4476 c, t dbSNP:756457254
4483 4483 a, c dbSNP:772427840
4491 4491 a, t dbSNP:780302127
4506 4506 a, g dbSNP:748909914
4540 4540 a, g dbSNP:768201532
4547 4547 a, t dbSNP:552366704
4548 4548 a, g dbSNP:751123179
4574 4574 a, g dbSNP:746908663
4582 4582 a, c dbSNP:770780957
4584 4584 c, t dbSNP:776686939
4586 4586 c, t dbSNP:138542624
4589 4589 a, g dbSNP:368897344
4593 4593 a, c dbSNP:774671393
4594 4594 a, g dbSNP:762145223
4597 4597 a, g dbSNP:767644249
4598 4598 c, t dbSNP:750471446
4599 4599 c, g dbSNP:760878072
4604 4604 a, c, t dbSNP:766785817
4610 4610 a, g dbSNP:570310321
4620 4620 a, g dbSNP:372383208
4622 4622 a, c dbSNP:1803766
4623 4623 a, g dbSNP:752298477
4625 4625 c, g dbSNP:758062226
4634 4634 g, t dbSNP:777200742
4635 4635 a, c dbSNP:766303305
4644 4644 c, g dbSNP:770522085
4649 4649 a, g dbSNP:184913034
4664 4664 a, g dbSNP:547025156
4667 4667 c, t dbSNP:769659898
4673 4673 c, t dbSNP:773278155
4682 4682 c, t dbSNP:747291340
4688 4688 c, t dbSNP:111380592
4703 4703 a, g dbSNP:375477038
4708 4708 a, c dbSNP:759970929
4709 4709 c, g dbSNP:774885198
4716 4716 c, t dbSNP:776023642
4717 4717 a, g dbSNP:763271526
4718 4718 a, g dbSNP:751453496
4720 4720 a, g dbSNP:751123196
4721 4721 c, g dbSNP:201825831
4725 4725 a, t dbSNP:147135956
4729 4729 c, g dbSNP:138684090
4730 4730 a, c, g dbSNP:755741712
4736 4736 c, g dbSNP:749281827
4740 4740 a, g dbSNP:754784283
4744 4744 a, g dbSNP:778794928
4761 4761 -, gaagaggag dbSNP:755930490
4763 4763 -, g dbSNP:779975980
4763 4763 a, c dbSNP:747142822
4764 4764 -, gag dbSNP:753887922
4770 4770 a, g dbSNP:771190439
4776 4776 a, g dbSNP:776786160
4779 4779 c, g dbSNP:573118021
4780 4780 a, t dbSNP:769899879
4782 4782 -, gaa dbSNP:754943076
4782 4782 a, g dbSNP:775935502
4788 4788 c, g dbSNP:542031893
4789 4789 a, g dbSNP:561660690
4790 4790 c, g dbSNP:764304058
4791 4791 g, t dbSNP:575273198
4792 4792 c, t dbSNP:762148677
4793 4793 a, g dbSNP:543880790
4799 4799 c, t dbSNP:77070978
4800 4800 a, g dbSNP:755656104
4803 4803 a, g dbSNP:766018422
4804 4804 c, g dbSNP:760341915
4809 4809 a, t dbSNP:770706675
4811 4811 a, c, g dbSNP:776487920
4817 4817 c, g dbSNP:549166022
4822 4822 a, c dbSNP:752628897
4827 4827 a, c dbSNP:762808945
4840 4840 a, c dbSNP:763807117
4847 4847 c, g dbSNP:2296212
4852 4852 g, t dbSNP:757101488
4854 4854 c, t dbSNP:139124915
4855 4855 a, g dbSNP:201798443
4857 4857 a, g dbSNP:755047549
4859 4859 c, t dbSNP:374750495
4868 4868 a, t dbSNP:149931024
4881 4881 c, t dbSNP:760161604
4882 4882 c, t dbSNP:778494811
4887 4887 c, t dbSNP:747368303
4888 4888 a, g dbSNP:537631853
4891 4891 c, g dbSNP:776318468
4894 4894 a, t dbSNP:745526649
4897 4897 c, t dbSNP:769286681
4901 4901 -, c dbSNP:770026358
4908 4908 c, g dbSNP:144110632
4913 4913 c, t dbSNP:762587234
4914 4914 a, g dbSNP:764005673
4924 4924 c, g dbSNP:753771608
4926 4926 a, g dbSNP:61736899
4928 4928 c, t dbSNP:761563170
4932 4932 a, c, g dbSNP:778660870
4934 4934 a, g dbSNP:61761955
4940 4940 c, t dbSNP:143522467
4943 4943 a, t dbSNP:751838059
4944 4944 c, t dbSNP:367755009
4945 4945 a, g dbSNP:138760068
4946 4946 a, t dbSNP:747562199
4952 4952 a, g, t dbSNP:190172342
4961 4961 a, t dbSNP:780488557
4969 4969 c, t dbSNP:753433101
4970 4970 a, g dbSNP:146702999
4971 4971 c, g dbSNP:778603688
4973 4973 a, t dbSNP:372976069
4975 4975 a, g dbSNP:771664849
4980 4980 c, t dbSNP:777544424
4986 4986 a, g dbSNP:747001194
4986 4986 -, g dbSNP:769137081
4988 4988 a, g dbSNP:192980752
4991 4991 c, g dbSNP:561093327
4996 4996 a, t dbSNP:371424653
4998 4998 c, t dbSNP:768982865
5000 5000 -, c dbSNP:773743943
5005 5005 a, g dbSNP:774759394
5007 5007 a, g dbSNP:761766784
5008 5008 a, g dbSNP:377168669
5011 5011 c, t dbSNP:758742198
5018 5018 c, g dbSNP:369265928
5022 5022 c, t dbSNP:766666410
5026 5026 c, t dbSNP:574547210
5029 5029 c, t dbSNP:755395260
5040 5040 c, t dbSNP:185669620
5047 5047 c, t dbSNP:563359861
5062 5062 c, t dbSNP:370531788
5076 5076 g, t dbSNP:189476291
5083 5083 a, c dbSNP:749591740
5091 5091 a, g dbSNP:552166560
5120 5120 a, c, t dbSNP:75720779
5128 5128 a, c dbSNP:746707359
5137 5137 -, atc dbSNP:771295558
5162 5162 a, g dbSNP:779055220
5163 5163 c, t dbSNP:180701505
5174 5174 a, g dbSNP:768360622
5181 5181 a, g dbSNP:776210464
5182 5182 c, t dbSNP:548597702
5187 5187 a, g dbSNP:139076728
5195 5195 a, g dbSNP:537230683
5198 5198 c, t dbSNP:367814078
5214 5214 -, aaac dbSNP:779056668
5245 5245 c, t dbSNP:373674996
5246 5246 c, g dbSNP:550688759
5252 5252 c, g dbSNP:530276913
5254 5254 a, t dbSNP:747681965
5260 5260 c, t dbSNP:539464457
5266 5266 c, t dbSNP:185399613
5283 5283 -, t dbSNP:3215772
5285 5285 g, t dbSNP:553292247
5302 5302 c, t dbSNP:572256579
5306 5306 c, g dbSNP:550337302
5317 5317 g, t dbSNP:143996657
5325 5325 a, t dbSNP:574612087
5329 5329 a, g dbSNP:769251512
5332 5332 -, t dbSNP:541329338
5364 5364 a, g dbSNP:370180389
5413 5413 a, g dbSNP:17387924
5430 5430 a, g dbSNP:762925046
5437 5437 -, tttt dbSNP:564489275
5459 5459 c, t dbSNP:557888524
5469 5469 -, taatagg dbSNP:772015935
5492 5492 a, g dbSNP:766145312
5509 5509 c, t dbSNP:774187192
5514 5514 a, g dbSNP:746530217
5519 5519 c, t dbSNP:759183108
5522 5522 a, g dbSNP:563386522
5534 5534 -, tgatc dbSNP:746730143
5558 5558 a, c dbSNP:764421852
5561 5561 a, g dbSNP:369158564
5589 5589 c, t dbSNP:763644880
5602 5602 c, t dbSNP:7048532
5615 5615 a, g dbSNP:768145842
5616 5616 a, t dbSNP:539115422
5672 5672 a, g dbSNP:545815855
5680 5680 c, t dbSNP:45616134
5694 5694 g, t dbSNP:757455388
5698 5698 a, g dbSNP:1061478
5708 5708 c, t dbSNP:28374302
5728 5728 c, t dbSNP:758943491
5762 5762 a, g dbSNP:541644134
5814 5814 a, c dbSNP:74587303
5832 5832 g, t dbSNP:562222393
5842 5842 a, g dbSNP:188397000
5843 5843 -, aaag dbSNP:747090054
5858 5858 c, g dbSNP:553367571

Target ORF information:

RefSeq Version NM_001289396
Organism Homo sapiens (human)
Definition Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20408
Accession Version NM_001289398.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 747bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product probable global transcription activator SNF2L2 isoform d
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI758293.1, DA084762.1, DA823500.1, CD513892.1, CD107405.1, AL138755.13 and CA313181.1. Summary: The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]. Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded protein (isoform d) has a shorter and distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)104..106(+)
Misc Feature(2)227..>415(+)
Misc Feature(3)311..349(+)
Misc Feature(4)374..694(+)
Misc Feature(5)467..640(+)
Exon (1)1..211
Gene Synonym:
Exon (2)212..429
Gene Synonym:
Exon (3)430..535
Gene Synonym:
Exon (4)536..637
Gene Synonym:
Exon (5)638..770
Gene Synonym:
Exon (6)771..913
Gene Synonym:
Exon (7)914..1834
Gene Synonym:
Position Chain Variation Link
11 11 c, t dbSNP:115767108
30 30 a, c dbSNP:764715863
33 33 a, g dbSNP:547508194
82 82 a, g dbSNP:567994789
111 111 a, g dbSNP:760367411
119 119 c, t dbSNP:763701366
129 129 c, t dbSNP:567201346
184 184 c, t dbSNP:754146028
188 188 c, t dbSNP:536353650
189 189 a, g dbSNP:555849385
190 190 a, t dbSNP:576006873
217 217 c, t dbSNP:779830008
220 220 a, g dbSNP:749281899
236 236 c, g dbSNP:373954302
247 247 a, g dbSNP:774311921
256 256 a, g dbSNP:760924689
259 259 a, g, t dbSNP:150227062
267 267 a, g dbSNP:759521062
289 289 c, t dbSNP:368433894
296 296 a, c, g dbSNP:753162708
297 297 c, t dbSNP:138891880
303 303 -, aag dbSNP:749210211
308 308 -, t dbSNP:772095624
310 310 g, t dbSNP:751758557
311 311 a, g dbSNP:757704280
314 314 a, g, t dbSNP:780692657
315 315 -, t dbSNP:777899372
316 316 -, tttatat dbSNP:747265570
318 318 a, t dbSNP:755545561
319 319 a, c dbSNP:61736901
330 330 c, g dbSNP:779745375
336 336 a, g dbSNP:371901993
337 337 c, t dbSNP:749193780
339 339 a, g dbSNP:768731403
344 344 -, ccg dbSNP:771118775
347 347 a, g, t dbSNP:148991905
361 361 a, g dbSNP:771960930
377 377 a, c dbSNP:776696051
394 394 c, t dbSNP:759832527
395 395 a, g dbSNP:769712929
396 396 c, g dbSNP:775559354
403 403 c, t dbSNP:763381660
404 404 a, g dbSNP:764576819
409 409 g, t dbSNP:752116307
430 430 a, t dbSNP:757469673
433 433 a, c, g dbSNP:547998868
434 434 c, g dbSNP:370103754
443 443 c, t dbSNP:756457254
450 450 a, c dbSNP:772427840
458 458 a, t dbSNP:780302127
473 473 a, g dbSNP:748909914
507 507 a, g dbSNP:768201532
514 514 a, t dbSNP:552366704
515 515 a, g dbSNP:751123179
541 541 a, g dbSNP:746908663
549 549 a, c dbSNP:770780957
551 551 c, t dbSNP:776686939
553 553 c, t dbSNP:138542624
556 556 a, g dbSNP:368897344
560 560 a, c dbSNP:774671393
561 561 a, g dbSNP:762145223
564 564 a, g dbSNP:767644249
565 565 c, t dbSNP:750471446
566 566 c, g dbSNP:760878072
571 571 a, c, t dbSNP:766785817
577 577 a, g dbSNP:570310321
587 587 a, g dbSNP:372383208
589 589 a, c dbSNP:1803766
590 590 a, g dbSNP:752298477
592 592 c, g dbSNP:758062226
601 601 g, t dbSNP:777200742
602 602 a, c dbSNP:766303305
611 611 c, g dbSNP:770522085
616 616 a, g dbSNP:184913034
631 631 a, g dbSNP:547025156
634 634 c, t dbSNP:769659898
640 640 c, t dbSNP:773278155
649 649 c, t dbSNP:747291340
655 655 c, t dbSNP:111380592
670 670 a, g dbSNP:375477038
675 675 a, c dbSNP:759970929
676 676 c, g dbSNP:774885198
683 683 c, t dbSNP:776023642
684 684 a, g dbSNP:763271526
685 685 a, g dbSNP:751453496
687 687 a, g dbSNP:751123196
688 688 c, g dbSNP:201825831
692 692 a, t dbSNP:147135956
696 696 c, g dbSNP:138684090
697 697 a, c, g dbSNP:755741712
703 703 c, g dbSNP:749281827
707 707 a, g dbSNP:754784283
711 711 a, g dbSNP:778794928
728 728 -, gaagaggag dbSNP:755930490
730 730 -, g dbSNP:779975980
730 730 a, c dbSNP:747142822
731 731 -, gag dbSNP:753887922
737 737 a, g dbSNP:771190439
743 743 a, g dbSNP:776786160
746 746 c, g dbSNP:573118021
747 747 a, t dbSNP:769899879
749 749 -, gaa dbSNP:754943076
749 749 a, g dbSNP:775935502
755 755 c, g dbSNP:542031893
756 756 a, g dbSNP:561660690
757 757 c, g dbSNP:764304058
758 758 g, t dbSNP:575273198
759 759 c, t dbSNP:762148677
760 760 a, g dbSNP:543880790
766 766 c, t dbSNP:77070978
767 767 a, g dbSNP:755656104
770 770 a, g dbSNP:766018422
771 771 c, g dbSNP:760341915
776 776 a, t dbSNP:770706675
778 778 a, c, g dbSNP:776487920
784 784 c, g dbSNP:549166022
789 789 a, c dbSNP:752628897
794 794 a, c dbSNP:762808945
807 807 a, c dbSNP:763807117
814 814 c, g dbSNP:2296212
819 819 g, t dbSNP:757101488
821 821 c, t dbSNP:139124915
822 822 a, g dbSNP:201798443
824 824 a, g dbSNP:755047549
826 826 c, t dbSNP:374750495
835 835 a, t dbSNP:149931024
848 848 c, t dbSNP:760161604
849 849 c, t dbSNP:778494811
854 854 c, t dbSNP:747368303
855 855 a, g dbSNP:537631853
858 858 c, g dbSNP:776318468
861 861 a, t dbSNP:745526649
864 864 c, t dbSNP:769286681
868 868 -, c dbSNP:770026358
875 875 c, g dbSNP:144110632
880 880 c, t dbSNP:762587234
881 881 a, g dbSNP:764005673
891 891 c, g dbSNP:753771608
893 893 a, g dbSNP:61736899
895 895 c, t dbSNP:761563170
899 899 a, c, g dbSNP:778660870
901 901 a, g dbSNP:61761955
907 907 c, t dbSNP:143522467
910 910 a, t dbSNP:751838059
911 911 c, t dbSNP:367755009
912 912 a, g dbSNP:138760068
913 913 a, t dbSNP:747562199
919 919 a, g, t dbSNP:190172342
928 928 a, t dbSNP:780488557
936 936 c, t dbSNP:753433101
937 937 a, g dbSNP:146702999
938 938 c, g dbSNP:778603688
940 940 a, t dbSNP:372976069
942 942 a, g dbSNP:771664849
947 947 c, t dbSNP:777544424
953 953 a, g dbSNP:747001194
953 953 -, g dbSNP:769137081
955 955 a, g dbSNP:192980752
958 958 c, g dbSNP:561093327
963 963 a, t dbSNP:371424653
965 965 c, t dbSNP:768982865
967 967 -, c dbSNP:773743943
972 972 a, g dbSNP:774759394
974 974 a, g dbSNP:761766784
975 975 a, g dbSNP:377168669
978 978 c, t dbSNP:758742198
985 985 c, g dbSNP:369265928
989 989 c, t dbSNP:766666410
993 993 c, t dbSNP:574547210
996 996 c, t dbSNP:755395260
1007 1007 c, t dbSNP:185669620
1014 1014 c, t dbSNP:563359861
1029 1029 c, t dbSNP:370531788
1043 1043 g, t dbSNP:189476291
1050 1050 a, c dbSNP:749591740
1058 1058 a, g dbSNP:552166560
1087 1087 a, c, t dbSNP:75720779
1095 1095 a, c dbSNP:746707359
1104 1104 -, atc dbSNP:771295558
1129 1129 a, g dbSNP:779055220
1130 1130 c, t dbSNP:180701505
1141 1141 a, g dbSNP:768360622
1148 1148 a, g dbSNP:776210464
1149 1149 c, t dbSNP:548597702
1154 1154 a, g dbSNP:139076728
1162 1162 a, g dbSNP:537230683
1165 1165 c, t dbSNP:367814078
1181 1181 -, aaac dbSNP:779056668
1212 1212 c, t