Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

SMPD1 sphingomyelin phosphodiesterase 1, acid lysosomal [Homo sapiens (human)]

Gene Symbol SMPD1
Entrez Gene ID 6609
Full Name sphingomyelin phosphodiesterase 1, acid lysosomal
General protein information
Preferred Names
sphingomyelin phosphodiesterase
sphingomyelin phosphodiesterase
acid sphingomyelinase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]. lac of sum
Disorder MIM:


Disorder Html: Niemann-Pick disease, type A, 257200 (3); Niemann-Pick disease, type
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu60647 XM_011520303 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu44952 XM_005253075 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu60648 XM_011520304 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu18710 NM_000543 Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00
OHu16724 NM_001007593 Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu60647D
Sequence Information ORF Nucleotide Sequence (Length: 1764bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)563..784(+)
Misc Feature(2)905..1660(+)
Misc Feature(3)920..1549(+)
Misc Feature(4)920..1549(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1393 1393 c, t dbSNP:751301389
1395 1395 c, t dbSNP:759242012
1398 1398 c, t dbSNP:143612450
1399 1399 a, g dbSNP:148067213
1401 1401 a, c dbSNP:756127736
1402 1402 c, t dbSNP:371340833
1403 1403 a, g dbSNP:753809177
1409 1409 a, t dbSNP:373629757
1411 1411 c, g dbSNP:779027887
1414 1414 c, g dbSNP:375912494
1415 1415 a, g dbSNP:746106776
1417 1417 a, g dbSNP:772238207
1419 1419 c, g dbSNP:574634445
1433 1433 c, t dbSNP:120074126
1434 1434 a, g dbSNP:767492080
1436 1436 a, g dbSNP:753011073
1445 1445 a, c dbSNP:760930408
1452 1452 c, t dbSNP:281860669
1454 1454 c, g, t dbSNP:140688153
1455 1455 c, g dbSNP:766945871
1459 1459 g, t dbSNP:373816332
1460 1460 c, t dbSNP:757848411
1463 1463 c, t dbSNP:779528546
1465 1465 g, t dbSNP:398123475
1468 1468 a, g dbSNP:754326223
1475 1475 c, t dbSNP:281860670
1478 1478 -, gctgga dbSNP:281860674
1479 1479 a, g dbSNP:750887448
1480 1480 a, c dbSNP:267607073
1493 1493 c, g, t dbSNP:120074127
1494 1494 a, g dbSNP:377609894
1501 1501 a, g dbSNP:769400504
1503 1503 c, g, t dbSNP:559092380
1508 1508 a, t dbSNP:775720719
1509 1509 a, g dbSNP:747143343
1511 1511 c, g dbSNP:374018137
1515 1515 a, g dbSNP:201953350
1517 1517 a, c dbSNP:281865156
1518 1518 a, c dbSNP:768851981
1523 1523 a, g dbSNP:777032252
1526 1526 a, g, t dbSNP:144624998
1537 1537 c, t dbSNP:765658453
1548 1548 -, at dbSNP:748411156
1548 1548 a, c dbSNP:281860673
1549 1549 c, t dbSNP:570284983
1552 1552 a, g dbSNP:763521056
1564 1564 a, g dbSNP:766738652
1570 1570 a, c dbSNP:745864955
1572 1572 a, c dbSNP:267607074
1582 1582 c, g dbSNP:531223061
1586 1586 -, ct dbSNP:398123476
1592 1592 c, t dbSNP:182812968
1593 1593 a, g dbSNP:763566905
1596 1596 c, t dbSNP:753508874
1597 1597 a, g dbSNP:138588535
1600 1600 a, g dbSNP:778770153
1603 1603 c, t dbSNP:745587850
1604 1604 c, g dbSNP:769703665
1617 1617 a, c, t dbSNP:267607075
1624 1624 g, t dbSNP:281860665
1626 1626 c, t dbSNP:141641266
1634 1634 a, t dbSNP:398123477
1639 1639 c, t dbSNP:554647710
1640 1640 a, g dbSNP:144873307
1641 1641 a, g dbSNP:768903533
1645 1645 c, t dbSNP:776805089
1658 1658 c, t dbSNP:769904764
1659 1659 a, g, t dbSNP:120074117
1663 1663 ac, gt dbSNP:281860675
1663 1663 a, g dbSNP:749498245
1664 1664 c, t dbSNP:771336819
1683 1683 a, c, g dbSNP:774651673
1686 1686 c, t dbSNP:563263776
1687 1687 c, g, t dbSNP:149423664
1688 1688 a, g dbSNP:1050239
1692 1692 g, t dbSNP:764772735
1695 1695 c, t dbSNP:200652683
1699 1699 c, t dbSNP:540422105
1700 1700 a, g dbSNP:140806787
1705 1705 c, g dbSNP:368806984
1713 1713 a, g dbSNP:754979734
1716 1716 a, t dbSNP:142787001
1719 1719 a, c dbSNP:752679988
1722 1722 a, t dbSNP:371837210
1723 1723 c, t dbSNP:756192072
1724 1724 a, g dbSNP:571736560
1727 1727 c, t dbSNP:147258619
1729 1729 a, g dbSNP:749496647
1733 1733 a, c dbSNP:771071195
1738 1738 c, t dbSNP:376815723
1748 1748 a, g dbSNP:746285905
1752 1752 c, t dbSNP:772417462
1753 1753 a, g dbSNP:140770832
1755 1755 c, g dbSNP:35122256
1761 1761 c, t dbSNP:769209179
1764 1764 a, c, t dbSNP:199915216
1765 1765 a, g dbSNP:552841217
1786 1786 a, g dbSNP:778746534
1790 1790 c, t dbSNP:398123478
1791 1791 a, g dbSNP:113467489
1792 1792 a, c dbSNP:774163596
1793 1793 g, t dbSNP:756031857
1794 1794 -, a dbSNP:770962157
1798 1798 c, t dbSNP:201659696
1800 1800 a, g dbSNP:753894999
1802 1802 -, ggc dbSNP:776759986
1811 1811 a, c dbSNP:757312268
1814 1814 a, g dbSNP:373079063
1819 1819 a, g dbSNP:377371222
1825 1825 c, t dbSNP:746058509
1826 1826 a, g dbSNP:758811926
1832 1832 c, t dbSNP:780415152
1834 1834 c, t dbSNP:747500595
1837 1837 c, g dbSNP:140271880
1838 1838 c, g dbSNP:772613617
1841 1841 -, gt dbSNP:759389193
1841 1841 a, g, t dbSNP:149939736
1842 1842 c, t dbSNP:770561559
1847 1847 c, t dbSNP:774190691
1848 1848 a, g dbSNP:546768091
1854 1854 a, g dbSNP:767240635
1856 1856 a, g dbSNP:775318803
1858 1858 c, t dbSNP:369787650
1859 1859 a, g dbSNP:201127799
1862 1862 a, g dbSNP:753766103
1864 1864 g, t dbSNP:757364674
1868 1868 c, t dbSNP:765278505
1874 1874 c, t dbSNP:35475253
1875 1875 a, g dbSNP:750665692
1876 1876 a, g dbSNP:767055403
1878 1878 a, c dbSNP:758576984
1891 1891 c, t dbSNP:780285591
1900 1900 a, g dbSNP:747342458
1901 1901 a, g dbSNP:120074119
1906 1906 c, t dbSNP:145079534
1910 1910 c, t dbSNP:202192013
1912 1912 c, t dbSNP:781756741
1913 1913 g, t dbSNP:748635475
1914 1914 c, t dbSNP:373940701
1915 1915 a, g dbSNP:35098198
1929 1929 a, c, t dbSNP:35785620
1930 1930 a, g dbSNP:774989668
1932 1932 a, c dbSNP:760582719
1937 1937 c, t dbSNP:375570126
1938 1938 a, g dbSNP:189116118
1948 1948 c, t dbSNP:200974033
1960 1960 a, g dbSNP:761689892
1961 1961 a, c dbSNP:138531908
1967 1967 a, g dbSNP:750433951
1970 1970 c, t dbSNP:763099671
1971 1971 a, g dbSNP:370129081
1980 1980 g, t dbSNP:751726525
1992 1992 -, gcc dbSNP:769777506
1994 1994 -, cgc dbSNP:120074118
1994 1994 c, t dbSNP:375915127
1995 1995 a, g dbSNP:140269316
1996 1996 a, c dbSNP:528414255
2005 2005 a, g dbSNP:370828368
2021 2021 c, t dbSNP:534009149
2032 2032 c, g dbSNP:778574286
2038 2038 g, t dbSNP:745425820
2041 2041 c, g dbSNP:771476083
2043 2043 a, c dbSNP:779792544
2048 2048 c, t dbSNP:200332161
2050 2050 a, g dbSNP:768517998
2051 2051 c, t dbSNP:776370511
2061 2061 -, agggcccc dbSNP:760099707
2065 2065 a, c dbSNP:755013749
2067 2067 c, t dbSNP:761741269
2070 2070 a, g dbSNP:769660920
2074 2074 c, t dbSNP:773121287
2077 2077 a, c, g dbSNP:763161789
2083 2083 a, g dbSNP:751858669
2088 2088 a, g dbSNP:759631410
2095 2095 a, g dbSNP:768029083
2099 2099 a, t dbSNP:1803159
2102 2102 -, a dbSNP:775215131
2107 2107 a, g dbSNP:8164
2114 2114 a, g dbSNP:756706052
2136 2136 a, c dbSNP:1803160
2145 2145 a, g dbSNP:138499616
2153 2153 c, t dbSNP:12273714
2156 2156 a, t dbSNP:142942704
2186 2186 a, g dbSNP:1803158
2201 2201 a, c dbSNP:564466538
2264 2264 c, g dbSNP:770932397
2279 2279 a, c, g, t dbSNP:1801044
2334 2334 c, g dbSNP:528743699
2343 2343 -, t dbSNP:35636371
2356 2356 a, c, g dbSNP:12278115
2365 2365 c, t dbSNP:561965709
2402 2402 a, g dbSNP:373270465

Target ORF information:

RefSeq Version XM_011520303
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu44952D
Sequence Information ORF Nucleotide Sequence (Length: 1527bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578820705. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)563..784(+)
Misc Feature(2)905..1783(+)
Misc Feature(3)920..1681(+)
Misc Feature(4)920..1681(+)
Misc Feature(5)1070..>1687(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1404 1404 a, g dbSNP:372287825
1409 1409 -, ct dbSNP:786204514
1413 1413 c, t dbSNP:748628930
1419 1419 a, t dbSNP:537295857
1423 1423 c, t dbSNP:376871416
1426 1426 c, t dbSNP:745317640
1430 1430 a, c, t dbSNP:369088417
1431 1431 a, g dbSNP:559088058
1433 1433 c, t dbSNP:371738717
1442 1442 c, t dbSNP:281860666
1446 1446 a, g dbSNP:776442314
1447 1447 c, t dbSNP:761658091
1450 1450 a, g dbSNP:120074121
1452 1452 a, g dbSNP:120074123
1463 1463 c, t dbSNP:570674743
1464 1464 a, g dbSNP:750345585
1468 1468 c, g dbSNP:758543204
1475 1475 g, t dbSNP:120074125
1489 1489 c, t dbSNP:766418804
1494 1494 c, t dbSNP:751781760
1495 1495 a, g dbSNP:755182589
1499 1499 c, g dbSNP:781441787
1501 1501 c, g, t dbSNP:376494095
1502 1502 a, g dbSNP:756594690
1505 1505 a, g dbSNP:778484457
1506 1506 c, g dbSNP:749780080
1510 1510 a, g dbSNP:771755385
1520 1520 c, t dbSNP:534811569
1524 1524 g, t dbSNP:200838486
1525 1525 a, c, g dbSNP:768283171
1530 1530 a, g dbSNP:761723108
1531 1531 a, g dbSNP:34555120
1532 1532 -, cttca dbSNP:763664013
1532 1532 c, g dbSNP:773176344
1533 1533 g, t dbSNP:762858594
1534 1534 a, t dbSNP:766472784
1538 1538 a, g dbSNP:751622021
1550 1550 c, t dbSNP:755160837
1551 1551 a, g dbSNP:767722360
1565 1565 c, t dbSNP:120074126
1566 1566 a, g dbSNP:767492080
1568 1568 a, g dbSNP:753011073
1577 1577 a, c dbSNP:760930408
1584 1584 c, t dbSNP:281860669
1586 1586 c, g, t dbSNP:140688153
1587 1587 c, g dbSNP:766945871
1591 1591 g, t dbSNP:373816332
1592 1592 c, t dbSNP:757848411
1595 1595 c, t dbSNP:779528546
1597 1597 g, t dbSNP:398123475
1600 1600 a, g dbSNP:754326223
1607 1607 c, t dbSNP:281860670
1610 1610 -, gctgga dbSNP:281860674
1611 1611 a, g dbSNP:750887448
1612 1612 a, c dbSNP:267607073
1625 1625 c, g, t dbSNP:120074127
1626 1626 a, g dbSNP:377609894
1633 1633 a, g dbSNP:769400504
1635 1635 c, g, t dbSNP:559092380
1640 1640 a, t dbSNP:775720719
1641 1641 a, g dbSNP:747143343
1643 1643 c, g dbSNP:374018137
1647 1647 a, g dbSNP:201953350
1649 1649 a, c dbSNP:281865156
1650 1650 a, c dbSNP:768851981
1655 1655 a, g dbSNP:777032252
1658 1658 a, g, t dbSNP:144624998
1669 1669 c, t dbSNP:765658453
1680 1680 -, at dbSNP:748411156
1680 1680 a, c dbSNP:281860673
1681 1681 c, t dbSNP:570284983
1684 1684 a, g dbSNP:763521056
1696 1696 a, g dbSNP:766738652
1702 1702 a, c dbSNP:745864955
1704 1704 a, c dbSNP:267607074
1714 1714 c, g dbSNP:531223061
1718 1718 -, ct dbSNP:398123476
1724 1724 c, t dbSNP:182812968
1725 1725 a, g dbSNP:763566905
1728 1728 c, t dbSNP:753508874
1729 1729 a, g dbSNP:138588535
1732 1732 a, g dbSNP:778770153
1735 1735 c, t dbSNP:745587850
1736 1736 c, g dbSNP:769703665
1749 1749 a, c, t dbSNP:267607075
1756 1756 g, t dbSNP:281860665
1758 1758 c, t dbSNP:141641266
1766 1766 a, t dbSNP:398123477
1771 1771 c, t dbSNP:554647710
1772 1772 a, g dbSNP:144873307
1773 1773 a, g dbSNP:768903533
1777 1777 c, t dbSNP:776805089
1786 1786 c, t dbSNP:781427826
1789 1789 -, c dbSNP:746881346
1794 1794 c, t dbSNP:546102017
1810 1810 c, t dbSNP:769904764
1811 1811 a, g, t dbSNP:120074117
1815 1815 ac, gt dbSNP:281860675
1815 1815 a, g dbSNP:749498245
1816 1816 c, t dbSNP:771336819
1835 1835 a, c, g dbSNP:774651673
1838 1838 c, t dbSNP:563263776
1839 1839 c, g, t dbSNP:149423664
1840 1840 a, g dbSNP:1050239
1844 1844 g, t dbSNP:764772735
1847 1847 c, t dbSNP:200652683
1851 1851 c, t dbSNP:540422105
1852 1852 a, g dbSNP:140806787
1857 1857 c, g dbSNP:368806984
1865 1865 a, g dbSNP:754979734
1868 1868 a, t dbSNP:142787001
1871 1871 a, c dbSNP:752679988
1874 1874 a, t dbSNP:371837210
1875 1875 c, t dbSNP:756192072
1876 1876 a, g dbSNP:571736560
1879 1879 c, t dbSNP:147258619
1881 1881 a, g dbSNP:749496647
1885 1885 a, c dbSNP:771071195
1890 1890 c, t dbSNP:376815723
1900 1900 a, g dbSNP:746285905
1904 1904 c, t dbSNP:772417462
1905 1905 a, g dbSNP:140770832
1907 1907 c, g dbSNP:35122256
1913 1913 c, t dbSNP:769209179
1916 1916 a, c, t dbSNP:199915216
1917 1917 a, g dbSNP:552841217
1938 1938 a, g dbSNP:778746534
1942 1942 c, t dbSNP:398123478
1943 1943 a, g dbSNP:113467489
1944 1944 a, c dbSNP:774163596
1945 1945 g, t dbSNP:756031857
1946 1946 -, a dbSNP:770962157
1950 1950 c, t dbSNP:201659696
1952 1952 a, g dbSNP:753894999
1954 1954 -, ggc dbSNP:776759986
1963 1963 a, c dbSNP:757312268
1966 1966 a, g dbSNP:373079063
1971 1971 a, g dbSNP:377371222
1977 1977 c, t dbSNP:746058509
1978 1978 a, g dbSNP:758811926
1984 1984 c, t dbSNP:780415152
1986 1986 c, t dbSNP:747500595
1989 1989 c, g dbSNP:140271880
1990 1990 c, g dbSNP:772613617
1993 1993 -, gt dbSNP:759389193
1993 1993 a, g, t dbSNP:149939736
1994 1994 c, t dbSNP:770561559
1999 1999 c, t dbSNP:774190691
2000 2000 a, g dbSNP:546768091
2006 2006 a, g dbSNP:767240635
2008 2008 a, g dbSNP:775318803
2010 2010 c, t dbSNP:369787650
2011 2011 a, g dbSNP:201127799
2014 2014 a, g dbSNP:753766103
2016 2016 g, t dbSNP:757364674
2020 2020 c, t dbSNP:765278505
2026 2026 c, t dbSNP:35475253
2027 2027 a, g dbSNP:750665692
2028 2028 a, g dbSNP:767055403
2030 2030 a, c dbSNP:758576984
2043 2043 c, t dbSNP:780285591
2052 2052 a, g dbSNP:747342458
2053 2053 a, g dbSNP:120074119
2058 2058 c, t dbSNP:145079534
2062 2062 c, t dbSNP:202192013
2064 2064 c, t dbSNP:781756741
2065 2065 g, t dbSNP:748635475
2066 2066 c, t dbSNP:373940701
2067 2067 a, g dbSNP:35098198
2081 2081 a, c, t dbSNP:35785620
2082 2082 a, g dbSNP:774989668
2084 2084 a, c dbSNP:760582719
2089 2089 c, t dbSNP:375570126
2090 2090 a, g dbSNP:189116118
2100 2100 c, t dbSNP:200974033
2112 2112 a, g dbSNP:761689892
2113 2113 a, c dbSNP:138531908
2119 2119 a, g dbSNP:750433951
2122 2122 c, t dbSNP:763099671
2123 2123 a, g dbSNP:370129081
2132 2132 g, t dbSNP:751726525
2144 2144 -, gcc dbSNP:769777506
2146 2146 -, cgc dbSNP:120074118
2146 2146 c, t dbSNP:375915127
2147 2147 a, g dbSNP:140269316
2148 2148 a, c dbSNP:528414255
2157 2157 a, g dbSNP:370828368
2173 2173 c, t dbSNP:534009149
2184 2184 c, g dbSNP:778574286
2190 2190 g, t dbSNP:745425820
2193 2193 c, g dbSNP:771476083
2195 2195 a, c dbSNP:779792544
2200 2200 c, t dbSNP:200332161
2202 2202 a, g dbSNP:768517998
2203 2203 c, t dbSNP:776370511

Target ORF information:

RefSeq Version XM_005253075
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu60648D
Sequence Information ORF Nucleotide Sequence (Length: 1395bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)563..784(+)
Misc Feature(2)905..1651(+)
Misc Feature(3)920..1549(+)
Misc Feature(4)920..1549(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1393 1393 c, t dbSNP:751301389
1395 1395 c, t dbSNP:759242012
1398 1398 c, t dbSNP:143612450
1399 1399 a, g dbSNP:148067213
1401 1401 a, c dbSNP:756127736
1402 1402 c, t dbSNP:371340833
1403 1403 a, g dbSNP:753809177
1409 1409 a, t dbSNP:373629757
1411 1411 c, g dbSNP:779027887
1414 1414 c, g dbSNP:375912494
1415 1415 a, g dbSNP:746106776
1417 1417 a, g dbSNP:772238207
1419 1419 c, g dbSNP:574634445
1433 1433 c, t dbSNP:120074126
1434 1434 a, g dbSNP:767492080
1436 1436 a, g dbSNP:753011073
1445 1445 a, c dbSNP:760930408
1452 1452 c, t dbSNP:281860669
1454 1454 c, g, t dbSNP:140688153
1455 1455 c, g dbSNP:766945871
1459 1459 g, t dbSNP:373816332
1460 1460 c, t dbSNP:757848411
1463 1463 c, t dbSNP:779528546
1465 1465 g, t dbSNP:398123475
1468 1468 a, g dbSNP:754326223
1475 1475 c, t dbSNP:281860670
1478 1478 -, gctgga dbSNP:281860674
1479 1479 a, g dbSNP:750887448
1480 1480 a, c dbSNP:267607073
1493 1493 c, g, t dbSNP:120074127
1494 1494 a, g dbSNP:377609894
1501 1501 a, g dbSNP:769400504
1503 1503 c, g, t dbSNP:559092380
1508 1508 a, t dbSNP:775720719
1509 1509 a, g dbSNP:747143343
1511 1511 c, g dbSNP:374018137
1515 1515 a, g dbSNP:201953350
1517 1517 a, c dbSNP:281865156
1518 1518 a, c dbSNP:768851981
1523 1523 a, g dbSNP:777032252
1526 1526 a, g, t dbSNP:144624998
1537 1537 c, t dbSNP:765658453
1548 1548 -, at dbSNP:748411156
1548 1548 a, c dbSNP:281860673
1549 1549 c, t dbSNP:570284983
1552 1552 a, g dbSNP:763521056
1564 1564 a, g dbSNP:766738652
1570 1570 a, c dbSNP:745864955
1572 1572 a, c dbSNP:267607074
1582 1582 c, g dbSNP:531223061
1586 1586 -, ct dbSNP:398123476
1592 1592 c, t dbSNP:182812968
1593 1593 a, g dbSNP:763566905
1596 1596 c, t dbSNP:753508874
1597 1597 a, g dbSNP:138588535
1600 1600 a, g dbSNP:778770153
1603 1603 c, t dbSNP:745587850
1604 1604 c, g dbSNP:769703665
1617 1617 a, c, t dbSNP:267607075
1624 1624 g, t dbSNP:281860665
1626 1626 c, t dbSNP:141641266
1634 1634 a, t dbSNP:398123477
1639 1639 c, t dbSNP:554647710
1640 1640 a, g dbSNP:144873307
1641 1641 a, g dbSNP:768903533
1645 1645 c, t dbSNP:776805089
1654 1654 c, t dbSNP:781427826
1657 1657 -, c dbSNP:746881346
1662 1662 c, t dbSNP:546102017
1678 1678 c, t dbSNP:769904764
1679 1679 a, g, t dbSNP:120074117
1683 1683 ac, gt dbSNP:281860675
1683 1683 a, g dbSNP:749498245
1684 1684 c, t dbSNP:771336819
1703 1703 a, c, g dbSNP:774651673
1706 1706 c, t dbSNP:563263776
1707 1707 c, g, t dbSNP:149423664
1708 1708 a, g dbSNP:1050239
1712 1712 g, t dbSNP:764772735
1715 1715 c, t dbSNP:200652683
1719 1719 c, t dbSNP:540422105
1720 1720 a, g dbSNP:140806787
1725 1725 c, g dbSNP:368806984
1733 1733 a, g dbSNP:754979734
1736 1736 a, t dbSNP:142787001
1739 1739 a, c dbSNP:752679988
1742 1742 a, t dbSNP:371837210
1743 1743 c, t dbSNP:756192072
1744 1744 a, g dbSNP:571736560
1747 1747 c, t dbSNP:147258619
1749 1749 a, g dbSNP:749496647
1753 1753 a, c dbSNP:771071195
1758 1758 c, t dbSNP:376815723
1768 1768 a, g dbSNP:746285905
1772 1772 c, t dbSNP:772417462
1773 1773 a, g dbSNP:140770832
1775 1775 c, g dbSNP:35122256
1781 1781 c, t dbSNP:769209179
1784 1784 a, c, t dbSNP:199915216
1785 1785 a, g dbSNP:552841217
1806 1806 a, g dbSNP:778746534
1810 1810 c, t dbSNP:398123478
1811 1811 a, g dbSNP:113467489
1812 1812 a, c dbSNP:774163596
1813 1813 g, t dbSNP:756031857
1814 1814 -, a dbSNP:770962157
1818 1818 c, t dbSNP:201659696
1820 1820 a, g dbSNP:753894999
1822 1822 -, ggc dbSNP:776759986
1831 1831 a, c dbSNP:757312268
1834 1834 a, g dbSNP:373079063
1839 1839 a, g dbSNP:377371222
1845 1845 c, t dbSNP:746058509
1846 1846 a, g dbSNP:758811926
1852 1852 c, t dbSNP:780415152
1854 1854 c, t dbSNP:747500595
1857 1857 c, g dbSNP:140271880
1858 1858 c, g dbSNP:772613617
1861 1861 -, gt dbSNP:759389193
1861 1861 a, g, t dbSNP:149939736
1862 1862 c, t dbSNP:770561559
1867 1867 c, t dbSNP:774190691
1868 1868 a, g dbSNP:546768091
1874 1874 a, g dbSNP:767240635
1876 1876 a, g dbSNP:775318803
1878 1878 c, t dbSNP:369787650
1879 1879 a, g dbSNP:201127799
1882 1882 a, g dbSNP:753766103
1884 1884 g, t dbSNP:757364674
1888 1888 c, t dbSNP:765278505
1894 1894 c, t dbSNP:35475253
1895 1895 a, g dbSNP:750665692
1896 1896 a, g dbSNP:767055403
1898 1898 a, c dbSNP:758576984
1911 1911 c, t dbSNP:780285591
1920 1920 a, g dbSNP:747342458
1921 1921 a, g dbSNP:120074119
1926 1926 c, t dbSNP:145079534
1930 1930 c, t dbSNP:202192013
1932 1932 c, t dbSNP:781756741
1933 1933 g, t dbSNP:748635475
1934 1934 c, t dbSNP:373940701
1935 1935 a, g dbSNP:35098198
1949 1949 a, c, t dbSNP:35785620
1950 1950 a, g dbSNP:774989668
1952 1952 a, c dbSNP:760582719
1957 1957 c, t dbSNP:375570126
1958 1958 a, g dbSNP:189116118
1968 1968 c, t dbSNP:200974033
1980 1980 a, g dbSNP:761689892
1981 1981 a, c dbSNP:138531908
1987 1987 a, g dbSNP:750433951
1990 1990 c, t dbSNP:763099671
1991 1991 a, g dbSNP:370129081
2000 2000 g, t dbSNP:751726525
2012 2012 -, gcc dbSNP:769777506
2014 2014 -, cgc dbSNP:120074118
2014 2014 c, t dbSNP:375915127
2015 2015 a, g dbSNP:140269316
2016 2016 a, c dbSNP:528414255
2025 2025 a, g dbSNP:370828368

Target ORF information:

RefSeq Version XM_011520304
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu18710D
Sequence Information ORF Nucleotide Sequence (Length: 1896bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI599208.1, AB209775.1, M59916.1 and AA746054.1. This sequence is a reference standard in the RefSeqGene project. On Jul 17, 2010 this sequence version replaced gi:56117839. Summary: The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB209775.1, X59960.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)84..86(+)
Misc Feature(2)447..449(+)
Misc Feature(3)450..671(+)
Misc Feature(4)531..533(+)
Misc Feature(5)549..584(+)
Misc Feature(6)792..1679(+)
Misc Feature(7)807..1568(+)
Misc Feature(8)807..1568(+)
Misc Feature(9)852..869(+)
Misc Feature(10)870..941(+)
Misc Feature(11)957..1748(+)
Misc Feature(12)1194..1196(+)
Misc Feature(13)1344..1484(+)
Misc Feature(14)1941..1955(+)
Misc Feature(15)1971..2012(+)
Exon (1)1..503
Gene Synonym:
Exon (2)504..1276
Gene Synonym:
Exon (3)1277..1448
Gene Synonym:
Exon (4)1449..1525
Gene Synonym:
Exon (5)1526..1671
Gene Synonym:
Exon (6)1672..2472
Gene Synonym:
Position Chain Variation Link
24 24 a, g dbSNP:113418824
53 53 c, t dbSNP:372965365
54 54 a, g dbSNP:114874902
68 68 c, g dbSNP:750731731
88 88 c, t dbSNP:147605872
89 89 g, t dbSNP:563116210
108 108 c, t dbSNP:533338773
112 112 a, g dbSNP:756519374
120 120 a, g dbSNP:374470369
135 135 a, t dbSNP:780468153
136 136 a, g dbSNP:200242748
139 139 -, g dbSNP:767291057
139 139 c, t dbSNP:769497058
140 140 g, t dbSNP:772795398
141 141 c, g, t dbSNP:79282481
142 142 c, g dbSNP:751332494
145 145 g, t dbSNP:759490845
147 147 a, t dbSNP:767402489
151 151 g, t dbSNP:375247947
156 156 a, t dbSNP:756206676
158 158 c, g dbSNP:549375319
168 168 c, t dbSNP:754050017
169 169 g, t dbSNP:757482767
173 173 a, g dbSNP:779446238
174 174 a, g dbSNP:375787350
179 179 c, t dbSNP:772706305
185 185 a, g dbSNP:780646835
188 188 a, g dbSNP:747502862
189 189 -, c dbSNP:281860663
190 190 c, t dbSNP:769252257
192 192 c, t dbSNP:772745537
193 193 a, g, t dbSNP:199836262
206 206 a, g dbSNP:774163288
211 211 g, t dbSNP:373013062
221 221 c, t dbSNP:767287886
224 224 c, t dbSNP:775473869
225 225 a, g dbSNP:11544727
231 231 g, t dbSNP:760627709
235 235 a, g dbSNP:764126465
241 241 a, g dbSNP:144465428
243 243 a, g dbSNP:538153468
250 250 a, g dbSNP:765485028
252 252 a, g dbSNP:750834930
258 258 a, g dbSNP:758894722
261 261 a, g dbSNP:766822201
263 263 a, t dbSNP:747512813
265 265 -, c dbSNP:750157176
265 265 c, g dbSNP:755490852
268 268 c, t dbSNP:556155962
269 269 c, g dbSNP:577769499
273 273 c, t dbSNP:376159116
275 275 a, c dbSNP:748793138
281 281 a, g dbSNP:786204506
284 284 a, g dbSNP:142178073
285 285 a, g dbSNP:774047252
287 287 -, cc dbSNP:755988781
288 288 -, ctggtg dbSNP:753614903
288 288 c, g dbSNP:201367689
289 289 -, tgg dbSNP:747472271
291 291 -, cgc dbSNP:767539123
291 291 c, g, t dbSNP:141685473
292 292 -, tgctgg dbSNP:775860642
292 292 c, t dbSNP:1050228
293 293 -, gctggc dbSNP:3838786
293 293 c, t dbSNP:61729852
294 294 -, c dbSNP:761696094
295 295 -, tggcgctgg dbSNP:767338533
296 296 -, ggcgc dbSNP:773261292
298 298 a, c, t dbSNP:78250081
298 298 cgctggcgctggcgctggc, t dbSNP:71467507
304 304 c, t dbSNP:377374691
307 307 c, t dbSNP:760549042
310 310 c, t dbSNP:200577287
311 311 a, g, t dbSNP:571806745
316 316 a, c dbSNP:776573567
318 318 a, c dbSNP:761899078
320 320 g, t dbSNP:150867628
323 323 -, gctggc dbSNP:558809956
323 323 -, ctggct dbSNP:766205523
323 323 g, t dbSNP:200763765
324 324 c, t dbSNP:758665343
327 327 c, g dbSNP:766902025
328 328 -, gctggc, gctggcgctggc dbSNP:71056748
329 329 c, g, t dbSNP:751904073
332 332 -, gtct dbSNP:281860676
332 332 -, gc, gcgc dbSNP:753484058
333 333 g, t dbSNP:781675416
337 337 a, g, t dbSNP:748589919
340 340 c, g dbSNP:778362370
344 344 a, g dbSNP:745567072
347 347 c, t dbSNP:375248757
351 351 c, t dbSNP:779741971
359 359 a, g dbSNP:368143181
361 361 a, c dbSNP:768487612
362 362 a, g dbSNP:199586053
367 367 c, t dbSNP:776692908
381 381 c, t dbSNP:139716279
383 383 c, t dbSNP:770037147
385 385 a, c dbSNP:773406166
386 386 a, g, t dbSNP:11544728
396 396 a, g dbSNP:375224040
397 397 c, t dbSNP:751876017
398 398 c, t dbSNP:759887657
407 407 a, t dbSNP:767768022
408 408 a, c, t dbSNP:753287070
411 411 a, g dbSNP:778415447
414 414 a, g dbSNP:560531338
417 417 a, c dbSNP:758047855
419 419 c, t dbSNP:575601110
421 421 a, g dbSNP:201647015
427 427 g, t dbSNP:768566892
433 433 c, t dbSNP:777543129
438 438 a, g, t dbSNP:368200803
439 439 g, t dbSNP:769808075
444 444 c, g dbSNP:773457550
450 450 c, t dbSNP:763060513
476 476 a, g dbSNP:144428799
477 477 c, t dbSNP:774701073
480 480 a, g dbSNP:759645398
482 482 c, g dbSNP:146630228
486 486 a, g dbSNP:369746362
490 490 a, g dbSNP:373475928
495 495 a, g, t dbSNP:527767942
497 497 g, t dbSNP:757958025
498 498 a, c dbSNP:779430680
499 499 c, t dbSNP:751269562
511 511 c, t dbSNP:745865811
512 512 c, t dbSNP:772349606
513 513 a, g dbSNP:775743387
514 514 a, g dbSNP:747223735
515 515 c, t dbSNP:769052880
521 521 c, t dbSNP:543145636
522 522 c, t dbSNP:140202512
523 523 a, c, g dbSNP:149770879
525 525 a, g dbSNP:142215226
528 528 a, g dbSNP:199913218
533 533 c, t dbSNP:767122852
534 534 a, g dbSNP:202206564
539 539 -, c dbSNP:727504165
553 553 a, t dbSNP:755805263
556 556 g, t dbSNP:747531830
558 558 c, t dbSNP:370048730
575 575 g, t dbSNP:371141815
578 578 c, t dbSNP:778655099
579 579 a, g, t dbSNP:189859589
591 591 a, g dbSNP:556385880
602 602 c, t dbSNP:780081189
605 605 g, t dbSNP:747284877
606 606 a, c, g dbSNP:768820000
609 609 a, g dbSNP:748395897
615 615 a, g dbSNP:770350207
616 616 -, tgg dbSNP:752225278
617 617 a, c, g dbSNP:773650118
618 618 a, g dbSNP:763512845
620 620 -, gga dbSNP:757974084
626 626 a, g dbSNP:148944108
633 633 c, t dbSNP:143719170
634 634 a, g dbSNP:760433840
647 647 c, t dbSNP:763771413
657 657 a, g dbSNP:369566518
660 660 c, t dbSNP:727504166
665 665 a, c, t dbSNP:765073144
671 671 a, c dbSNP:758313663
673 673 c, t dbSNP:780134410
677 677 c, t dbSNP:751600918
689 689 -, c dbSNP:781535659
689 689 a, g dbSNP:755201121
690 690 a, c dbSNP:781334934
703 703 -, t dbSNP:786204733
706 706 c, t dbSNP:748390729
708 708 a, c, t dbSNP:147607780
714 714 a, t dbSNP:535997620
718 718 a, t dbSNP:749780769
719 719 c, t dbSNP:142147633
722 722 -, tt dbSNP:746454813
723 723 -, tt dbSNP:786204694
727 727 c, t dbSNP:775143399
736 736 c, t dbSNP:760203204
737 737 a, g dbSNP:768265842
743 743 -, c dbSNP:756366019
744 744 a, c, t dbSNP:74053349
744 744 -, c dbSNP:780407264
749 749 a, c dbSNP:764993348
752 752 -, acccc dbSNP:749458864
752 752 a, g dbSNP:750187574
753 753 a, c dbSNP:762912222
754 754 c, t dbSNP:766240926
758 758 -, tag dbSNP:768895532
758 758 c, t dbSNP:751653824
758 758 -, t dbSNP:727504167
760 760 -, c dbSNP:748165078
761 761 -, c dbSNP:774608488
763 763 c, t dbSNP:755111215
767 767 -, ag dbSNP:772265533
768 768 a, g dbSNP:767630492
769 769 c, t dbSNP:752904145
781 781 c, t dbSNP:756310076
784 784 a, t dbSNP:778029738
789 789 c, t dbSNP:749595299
790 790 a, g dbSNP:757850587
791 791 c, t dbSNP:779618003
794 794 c, t dbSNP:746370637
797 797 c, g dbSNP:768317292
803 803 c, t dbSNP:776180872
812 812 a, c, g dbSNP:200443318
819 819 g, t dbSNP:772889728
821 821 c, t dbSNP:7951904
827 827 c, g dbSNP:766150536
836 836 a, g dbSNP:774341345
841 841 c, t dbSNP:759439337
842 842 a, g dbSNP:202032347
845 845 a, c dbSNP:752782100
861 861 c, t dbSNP:756294464
865 865 c, t dbSNP:764317969
874 874 a, g dbSNP:141387770
876 876 a, c, t dbSNP:199832734
877 877 a, g dbSNP:746421946
879 879 a, g dbSNP:758887994
881 881 c, t dbSNP:780602613
892 892 c, t dbSNP:747630243
893 893 a, g dbSNP:374604948
894 894 c, t dbSNP:772977296
897 897 a, g dbSNP:748936934
899 899 a, g dbSNP:2682091
904 904 a, g dbSNP:2634197
914 914 c, t dbSNP:149476159
915 915 a, g dbSNP:120074122
918 918 c, t dbSNP:370178721
920 920 c, t dbSNP:760865854
922 922 a, g dbSNP:764072877
924 924 a, g dbSNP:587779408
926 926 c, t dbSNP:762102363
927 927 a, g, t dbSNP:200763423
932 932 c, t dbSNP:765716943
933 933 a, c dbSNP:750779804
938 938 a, g dbSNP:374458858
942 942 c, g dbSNP:398123479
944 944 c, t dbSNP:752000778
947 947 a, g dbSNP:143939609
950 950 c, t dbSNP:777233772
952 952 c, t dbSNP:139882665
965 965 a, g dbSNP:770523185
973 973 a, t dbSNP:120074120
979 979 a, g dbSNP:745616876
981 981 c, g dbSNP:200681698
987 987 a, c dbSNP:775563981
989 989 a, c dbSNP:760493995
991 991 c, t dbSNP:543834713
992 992 a, c, t dbSNP:35933246
993 993 a, g dbSNP:202244080
998 998 a, c, t dbSNP:61876771
1005 1005 a, g dbSNP:763437061
1021 1021 a, g dbSNP:727504168
1029 1029 a, c dbSNP:199955808
1032 1032 a, g, t dbSNP:752148586
1034 1034 -, tccccgca dbSNP:281860677
1040 1040 c, t dbSNP:777288780
1047 1047 c, g dbSNP:529881058
1054 1054 a, c dbSNP:376259993
1057 1057 a, c, g dbSNP:1803161
1058 1058 c, t dbSNP:745502097
1065 1065 a, c dbSNP:120074128
1069 1069 a, t dbSNP:779687063
1071 1071 c, t dbSNP:541061793
1072 1072 a, g dbSNP:35824453
1075 1075 c, t dbSNP:150815128
1079 1079 c, g dbSNP:371688255
1081 1081 a, c, t dbSNP:776745690
1082 1082 c, t dbSNP:536760557
1085 1085 c, t dbSNP:368353322
1086 1086 a, g dbSNP:2723669
1092 1092 a, c, g dbSNP:570353618
1094 1094 a, g dbSNP:201134693
1096 1096 c, t dbSNP:120074124
1098 1098 a, g dbSNP:199873765
1110 1110 c, t dbSNP:767952915
1121 1121 a, g dbSNP:753187556
1122 1122 c, t dbSNP:149991096
1132 1132 c, t dbSNP:756827709
1133 1133 g, t dbSNP:764694813
1135 1135 c, t dbSNP:750136188
1138 1138 a, t dbSNP:12575136
1140 1140 c, g dbSNP:757934797
1143 1143 a, g dbSNP:779927660
1151 1151 a, g dbSNP:746711794
1156 1156 c, t dbSNP:1050233
1158 1158 -, tgt dbSNP:398123480
1158 1158 c, g dbSNP:761308217
1169 1169 c, t dbSNP:781339776
1172 1172 c, t dbSNP:572772760
1176 1176 -, c dbSNP:772960412
1176 1176 c, t dbSNP:142476839
1180 1180 a, c, g, t dbSNP:202081954
1181 1181 -, c dbSNP:387906289
1184 1184 c, t dbSNP:774790917
1186 1186 c, t dbSNP:759950370
1191 1191 a, c, g dbSNP:281860667
1195 1195 a, g dbSNP:761144309
1203 1203 c, t dbSNP:764745599
1204 1204 c, t dbSNP:749859100
1206 1206 c, t dbSNP:369841281
1207 1207 a, c, g dbSNP:200242334
1211 1211 g, t dbSNP:281860668
1222 1222 c, t dbSNP:373508268
1223 1223 a, g, t dbSNP:781107025
1229 1229 c, t dbSNP:555187617
1232 1232 a, g dbSNP:777942302
1239 1239 g, t dbSNP:201550531
1240 1240 a, c dbSNP:771028947
1241 1241 a, g, t dbSNP:144408432
1243 1243 c, t dbSNP:772473982
1247 1247 a, g dbSNP:775780219
1256 1256 c, t dbSNP:72896268
1257 1257 a, g dbSNP:768976098
1263 1263 c, t dbSNP:772788648
1266 1266 c, t dbSNP:370198638
1267 1267 a, g dbSNP:148892841
1270 1270 -, c dbSNP:760674901
1291 1291 a, g dbSNP:372287825
1296 1296 -, ct dbSNP:786204514
1300 1300 c, t dbSNP:748628930
1306 1306 a, t dbSNP:537295857
1310 1310 c, t dbSNP:376871416
1313 1313 c, t dbSNP:745317640
1317 1317 a, c, t dbSNP:369088417
1318 1318 a, g dbSNP:559088058
1320 1320 c, t dbSNP:371738717
1329 1329 c, t dbSNP:281860666
1333 1333 a, g dbSNP:776442314
1334 1334 c, t dbSNP:761658091
1337 1337 a, g dbSNP:120074121
1339 1339 a, g dbSNP:120074123
1350 1350 c, t dbSNP:570674743
1351 1351 a, g dbSNP:750345585
1355 1355 c, g dbSNP:758543204
1362 1362 g, t dbSNP:120074125
1376 1376 c, t dbSNP:766418804
1381 1381 c, t dbSNP:751781760
1382 1382 a, g dbSNP:755182589
1386 1386 c, g dbSNP:781441787
1388 1388 c, g, t dbSNP:376494095
1389 1389 a, g dbSNP:756594690
1392 1392 a, g dbSNP:778484457
1393 1393 c, g dbSNP:749780080
1397 1397 a, g dbSNP:771755385
1407 1407 c, t dbSNP:534811569
1411 1411 g, t dbSNP:200838486
1412 1412 a, c, g dbSNP:768283171
1417 1417 a, g dbSNP:761723108
1418 1418 a, g dbSNP:34555120
1419 1419 -, cttca dbSNP:763664013
1419 1419 c, g dbSNP:773176344
1420 1420 g, t dbSNP:762858594
1421 1421 a, t dbSNP:766472784
1425 1425 a, g dbSNP:751622021
1437 1437 c, t dbSNP:755160837
1438 1438 a, g dbSNP:767722360
1452 1452 c, t dbSNP:120074126
1453 1453 a, g dbSNP:767492080
1455 1455 a, g dbSNP:753011073
1464 1464 a, c dbSNP:760930408
1471 1471 c, t dbSNP:281860669
1473 1473 c, g, t dbSNP:140688153
1474 1474 c, g dbSNP:766945871
1478 1478 g, t dbSNP:373816332
1479 1479 c, t dbSNP:757848411
1482 1482 c, t dbSNP:779528546
1484 1484 g, t dbSNP:398123475
1487 1487 a, g dbSNP:754326223
1494 1494 c, t dbSNP:281860670
1497 1497 -, gctgga dbSNP:281860674
1498 1498 a, g dbSNP:750887448
1499 1499 a, c dbSNP:267607073
1512 1512 c, g, t dbSNP:120074127
1513 1513 a, g dbSNP:377609894
1520 1520 a, g dbSNP:769400504
1522 1522 c, g, t dbSNP:559092380
1527 1527 a, t dbSNP:775720719
1528 1528 a, g dbSNP:747143343
1530 1530 c, g dbSNP:374018137
1534 1534 a, g dbSNP:201953350
1536 1536 a, c dbSNP:281865156
1537 1537 a, c dbSNP:768851981
1542 1542 a, g dbSNP:777032252
1545 1545 a, g, t dbSNP:144624998
1556 1556 c, t dbSNP:765658453
1567 1567 -, at dbSNP:748411156
1567 1567 a, c dbSNP:281860673
1568 1568 c, t dbSNP:570284983
1571 1571 a, g dbSNP:763521056
1583 1583 a, g dbSNP:766738652
1589 1589 a, c dbSNP:745864955
1591 1591 a, c dbSNP:267607074
1601 1601 c, g dbSNP:531223061
1605 1605 -, ct dbSNP:398123476
1611 1611 c, t dbSNP:182812968
1612 1612 a, g dbSNP:763566905
1615 1615 c, t dbSNP:753508874
1616 1616 a, g dbSNP:138588535
1619 1619 a, g dbSNP:778770153
1622 1622 c, t dbSNP:745587850
1623 1623 c, g dbSNP:769703665
1636 1636 a, c, t dbSNP:267607075
1643 1643 g, t dbSNP:281860665
1645 1645 c, t dbSNP:141641266
1653 1653 a, t dbSNP:398123477
1658 1658 c, t dbSNP:554647710
1659 1659 a, g dbSNP:144873307
1660 1660 a, g dbSNP:768903533
1664 1664 c, t dbSNP:776805089
1677 1677 c, t dbSNP:769904764
1678 1678 a, g, t dbSNP:120074117
1682 1682 ac, gt dbSNP:281860675
1682 1682 a, g dbSNP:749498245
1683 1683 c, t dbSNP:771336819
1702 1702 a, c, g dbSNP:774651673
1705 1705 c, t dbSNP:563263776
1706 1706 c, g, t dbSNP:149423664
1707 1707 a, g dbSNP:1050239
1711 1711 g, t dbSNP:764772735
1714 1714 c, t dbSNP:200652683
1718 1718 c, t dbSNP:540422105
1719 1719 a, g dbSNP:140806787
1724 1724 c, g dbSNP:368806984
1732 1732 a, g dbSNP:754979734
1735 1735 a, t dbSNP:142787001
1738 1738 a, c dbSNP:752679988
1741 1741 a, t dbSNP:371837210
1742 1742 c, t dbSNP:756192072
1743 1743 a, g dbSNP:571736560
1746 1746 c, t dbSNP:147258619
1748 1748 a, g dbSNP:749496647
1752 1752 a, c dbSNP:771071195
1757 1757 c, t dbSNP:376815723
1767 1767 a, g dbSNP:746285905
1771 1771 c, t dbSNP:772417462
1772 1772 a, g dbSNP:140770832
1774 1774 c, g dbSNP:35122256
1780 1780 c, t dbSNP:769209179
1783 1783 a, c, t dbSNP:199915216
1784 1784 a, g dbSNP:552841217
1805 1805 a, g dbSNP:778746534
1809 1809 c, t dbSNP:398123478
1810 1810 a, g dbSNP:113467489
1811 1811 a, c dbSNP:774163596
1812 1812 g, t dbSNP:756031857
1813 1813 -, a dbSNP:770962157
1817 1817 c, t dbSNP:201659696
1819 1819 a, g dbSNP:753894999
1821 1821 -, ggc dbSNP:776759986
1830 1830 a, c dbSNP:757312268
1833 1833 a, g dbSNP:373079063
1838 1838 a, g dbSNP:377371222
1844 1844 c, t dbSNP:746058509
1845 1845 a, g dbSNP:758811926
1851 1851 c, t dbSNP:780415152
1853 1853 c, t dbSNP:747500595
1856 1856 c, g dbSNP:140271880
1857 1857 c, g dbSNP:772613617
1860 1860 -, gt dbSNP:759389193
1860 1860 a, g, t dbSNP:149939736
1861 1861 c, t dbSNP:770561559
1866 1866 c, t dbSNP:774190691
1867 1867 a, g dbSNP:546768091
1873 1873 a, g dbSNP:767240635
1875 1875 a, g dbSNP:775318803
1877 1877 c, t dbSNP:369787650
1878 1878 a, g dbSNP:201127799
1881 1881 a, g dbSNP:753766103
1883 1883 g, t dbSNP:757364674
1887 1887 c, t dbSNP:765278505
1893 1893 c, t dbSNP:35475253
1894 1894 a, g dbSNP:750665692
1895 1895 a, g dbSNP:767055403
1897 1897 a, c dbSNP:758576984
1910 1910 c, t dbSNP:780285591
1919 1919 a, g dbSNP:747342458
1920 1920 a, g dbSNP:120074119
1925 1925 c, t dbSNP:145079534
1929 1929 c, t dbSNP:202192013
1931 1931 c, t dbSNP:781756741
1932 1932 g, t dbSNP:748635475
1933 1933 c, t dbSNP:373940701
1934 1934 a, g dbSNP:35098198
1948 1948 a, c, t dbSNP:35785620
1949 1949 a, g dbSNP:774989668
1951 1951 a, c dbSNP:760582719
1956 1956 c, t dbSNP:375570126
1957 1957 a, g dbSNP:189116118
1967 1967 c, t dbSNP:200974033
1979 1979 a, g dbSNP:761689892
1980 1980 a, c dbSNP:138531908
1986 1986 a, g dbSNP:750433951
1989 1989 c, t dbSNP:763099671
1990 1990 a, g dbSNP:370129081
1999 1999 g, t dbSNP:751726525
2011 2011 -, gcc dbSNP:769777506
2013 2013 -, cgc dbSNP:120074118
2013 2013 c, t dbSNP:375915127
2014 2014 a, g dbSNP:140269316
2015 2015 a, c dbSNP:528414255
2024 2024 a, g dbSNP:370828368
2040 2040 c, t dbSNP:534009149
2051 2051 c, g dbSNP:778574286
2057 2057 g, t dbSNP:745425820
2060 2060 c, g dbSNP:771476083
2062 2062 a, c dbSNP:779792544
2067 2067 c, t dbSNP:200332161
2069 2069 a, g dbSNP:768517998
2070 2070 c, t dbSNP:776370511
2080 2080 -, agggcccc dbSNP:760099707
2084 2084 a, c dbSNP:755013749
2086 2086 c, t dbSNP:761741269
2089 2089 a, g dbSNP:769660920
2093 2093 c, t dbSNP:773121287
2096 2096 a, c, g dbSNP:763161789
2102 2102 a, g dbSNP:751858669
2107 2107 a, g dbSNP:759631410
2114 2114 a, g dbSNP:768029083
2118 2118 a, t dbSNP:1803159
2121 2121 -, a dbSNP:775215131
2126 2126 a, g dbSNP:8164
2133 2133 a, g dbSNP:756706052
2155 2155 a, c dbSNP:1803160
2164 2164 a, g dbSNP:138499616
2172 2172 c, t dbSNP:12273714
2175 2175 a, t dbSNP:142942704
2205 2205 a, g dbSNP:1803158
2220 2220 a, c dbSNP:564466538
2283 2283 c, g dbSNP:770932397
2298 2298 a, c, g, t dbSNP:1801044
2353 2353 c, g dbSNP:528743699
2362 2362 -, t dbSNP:35636371
2375 2375 a, c, g dbSNP:12278115
2384 2384 c, t dbSNP:561965709
2421 2421 a, g dbSNP:373270465

Target ORF information:

RefSeq Version NM_000543
Organism Homo sapiens (human)
Definition Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu16724D
Sequence Information ORF Nucleotide Sequence (Length: 1893bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI599208.1, AB209775.1, M59916.1 and AA746054.1. On Jul 17, 2010 this sequence version replaced gi:56117841. Summary: The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded protein (isoform 2) is one amino acid shorter than isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK292388.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1970526, SAMEA2142363 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)84..86(+)
Misc Feature(2)450..668(+)
Misc Feature(3)789..1676(+)
Misc Feature(4)804..1565(+)
Misc Feature(5)804..1565(+)
Misc Feature(6)954..1745(+)
Exon (1)1..503
Gene Synonym:
Exon (2)504..1273
Gene Synonym:
Exon (3)1274..1445
Gene Synonym:
Exon (4)1446..1522
Gene Synonym:
Exon (5)1523..1668
Gene Synonym:
Exon (6)1669..2469
Gene Synonym: