
SMPD1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SMPD1
Entrez Gene ID 6609
Full Name sphingomyelin phosphodiesterase 1, acid lysosomal
General protein information
Preferred Names
sphingomyelin phosphodiesterase
sphingomyelin phosphodiesterase
acid sphingomyelinase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]. lac of sum
Disorder MIM:


Disorder Html: Niemann-Pick disease, type A, 257200 (3); Niemann-Pick disease, type

mRNA and Protein(s)

mRNA Protein Name
XM_011520303 XP_011518605 sphingomyelin phosphodiesterase isoform X1
XM_005253075 XP_005253132 sphingomyelin phosphodiesterase isoform X2
XM_011520304 XP_011518606 sphingomyelin phosphodiesterase isoform X3
NM_000543 NP_000534 sphingomyelin phosphodiesterase isoform 1 precursor
NM_001007593 NP_001007594 sphingomyelin phosphodiesterase isoform 2 precursor

hsa00600 Sphingolipid metabolism
hsa04142 Lysosome
hsa01100 Metabolic pathways
hsa04071 Sphingolipid signaling pathway
HUMAN_PWY3DJ-11281 sphingomyelin metabolism/ceramide salvage
R-HSA-1430728 Metabolism
R-HSA-556833 Metabolism of lipids and lipoproteins
R-HSA-1660662 Glycosphingolipid metabolism
R-HSA-428157 Sphingolipid metabolism
Pathway Interaction Database
il2_pi3kpathway IL2 signaling events mediated by PI3K
trail_pathway TRAIL signaling pathway
ceramide_pathway Ceramide signaling pathway
faspathway FAS (CD95) signaling pathway
tnfpathway TNF receptor signaling pathway
WP34 Ovarian Infertility Genes

Homo sapiens (human) SMPD1 NP_000534.3
Pan troglodytes (chimpanzee) SMPD1 XP_508253.2
Macaca mulatta (Rhesus monkey) SMPD1 XP_001110212.1
Canis lupus familiaris (dog) SMPD1 XP_542452.1
Bos taurus (cattle) SMPD1 NP_001068655.1
Mus musculus (house mouse) Smpd1 NP_035551.1
Rattus norvegicus (Norway rat) Smpd1 NP_001006998.1
Gallus gallus (chicken) SMPD1 XP_003640663.2
Danio rerio (zebrafish) smpd1 XP_683907.1
Drosophila melanogaster (fruit fly) CG3376 NP_611904.1
Caenorhabditis elegans asm-2 NP_509894.2
Xenopus (Silurana) tropicalis (western clawed frog) LOC100487433 XP_002943546.1


ID Name Evidence
GO:0005615 extracellular space IEA
GO:0005764 lysosome IEA
GO:0042599 lamellar body IEA


ID Name Evidence
GO:0004767 sphingomyelin phosphodiesterase activity IEA
GO:0016798 hydrolase activity, acting on glycosyl bonds IEA


ID Name Evidence
GO:0006684 sphingomyelin metabolic process TAS
GO:0006685 sphingomyelin catabolic process IEA
GO:0007165 signal transduction TAS
GO:0007399 nervous system development TAS
GO:0008152 metabolic process IEA
GO:0008219 cell death IEA
GO:0042220 response to cocaine IEA
GO:0042493 response to drug IEA
GO:0043065 positive regulation of apoptosis IEA
GO:0046513 ceramide biosynthetic process IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SMPD1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SMPD1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu60647 XM_011520303 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu44952 XM_005253075 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00
OHu60648 XM_011520304 PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
NM_000543 Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu16724 NM_001007593 Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu60647
Accession Version XM_011520303.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1764bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)563..784(+)
Misc Feature(2)905..1660(+)
Misc Feature(3)920..1549(+)
Misc Feature(4)920..1549(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1393 1393 c, t dbSNP:751301389
1395 1395 c, t dbSNP:759242012
1398 1398 c, t dbSNP:143612450
1399 1399 a, g dbSNP:148067213
1401 1401 a, c dbSNP:756127736
1402 1402 c, t dbSNP:371340833
1403 1403 a, g dbSNP:753809177
1409 1409 a, t dbSNP:373629757
1411 1411 c, g dbSNP:779027887
1414 1414 c, g dbSNP:375912494
1415 1415 a, g dbSNP:746106776
1417 1417 a, g dbSNP:772238207
1419 1419 c, g dbSNP:574634445
1433 1433 c, t dbSNP:120074126
1434 1434 a, g dbSNP:767492080
1436 1436 a, g dbSNP:753011073
1445 1445 a, c dbSNP:760930408
1452 1452 c, t dbSNP:281860669
1454 1454 c, g, t dbSNP:140688153
1455 1455 c, g dbSNP:766945871
1459 1459 g, t dbSNP:373816332
1460 1460 c, t dbSNP:757848411
1463 1463 c, t dbSNP:779528546
1465 1465 g, t dbSNP:398123475
1468 1468 a, g dbSNP:754326223
1475 1475 c, t dbSNP:281860670
1478 1478 -, gctgga dbSNP:281860674
1479 1479 a, g dbSNP:750887448
1480 1480 a, c dbSNP:267607073
1493 1493 c, g, t dbSNP:120074127
1494 1494 a, g dbSNP:377609894
1501 1501 a, g dbSNP:769400504
1503 1503 c, g, t dbSNP:559092380
1508 1508 a, t dbSNP:775720719
1509 1509 a, g dbSNP:747143343
1511 1511 c, g dbSNP:374018137
1515 1515 a, g dbSNP:201953350
1517 1517 a, c dbSNP:281865156
1518 1518 a, c dbSNP:768851981
1523 1523 a, g dbSNP:777032252
1526 1526 a, g, t dbSNP:144624998
1537 1537 c, t dbSNP:765658453
1548 1548 -, at dbSNP:748411156
1548 1548 a, c dbSNP:281860673
1549 1549 c, t dbSNP:570284983
1552 1552 a, g dbSNP:763521056
1564 1564 a, g dbSNP:766738652
1570 1570 a, c dbSNP:745864955
1572 1572 a, c dbSNP:267607074
1582 1582 c, g dbSNP:531223061
1586 1586 -, ct dbSNP:398123476
1592 1592 c, t dbSNP:182812968
1593 1593 a, g dbSNP:763566905
1596 1596 c, t dbSNP:753508874
1597 1597 a, g dbSNP:138588535
1600 1600 a, g dbSNP:778770153
1603 1603 c, t dbSNP:745587850
1604 1604 c, g dbSNP:769703665
1617 1617 a, c, t dbSNP:267607075
1624 1624 g, t dbSNP:281860665
1626 1626 c, t dbSNP:141641266
1634 1634 a, t dbSNP:398123477
1639 1639 c, t dbSNP:554647710
1640 1640 a, g dbSNP:144873307
1641 1641 a, g dbSNP:768903533
1645 1645 c, t dbSNP:776805089
1658 1658 c, t dbSNP:769904764
1659 1659 a, g, t dbSNP:120074117
1663 1663 ac, gt dbSNP:281860675
1663 1663 a, g dbSNP:749498245
1664 1664 c, t dbSNP:771336819
1683 1683 a, c, g dbSNP:774651673
1686 1686 c, t dbSNP:563263776
1687 1687 c, g, t dbSNP:149423664
1688 1688 a, g dbSNP:1050239
1692 1692 g, t dbSNP:764772735
1695 1695 c, t dbSNP:200652683
1699 1699 c, t dbSNP:540422105
1700 1700 a, g dbSNP:140806787
1705 1705 c, g dbSNP:368806984
1713 1713 a, g dbSNP:754979734
1716 1716 a, t dbSNP:142787001
1719 1719 a, c dbSNP:752679988
1722 1722 a, t dbSNP:371837210
1723 1723 c, t dbSNP:756192072
1724 1724 a, g dbSNP:571736560
1727 1727 c, t dbSNP:147258619
1729 1729 a, g dbSNP:749496647
1733 1733 a, c dbSNP:771071195
1738 1738 c, t dbSNP:376815723
1748 1748 a, g dbSNP:746285905
1752 1752 c, t dbSNP:772417462
1753 1753 a, g dbSNP:140770832
1755 1755 c, g dbSNP:35122256
1761 1761 c, t dbSNP:769209179
1764 1764 a, c, t dbSNP:199915216
1765 1765 a, g dbSNP:552841217
1786 1786 a, g dbSNP:778746534
1790 1790 c, t dbSNP:398123478
1791 1791 a, g dbSNP:113467489
1792 1792 a, c dbSNP:774163596
1793 1793 g, t dbSNP:756031857
1794 1794 -, a dbSNP:770962157
1798 1798 c, t dbSNP:201659696
1800 1800 a, g dbSNP:753894999
1802 1802 -, ggc dbSNP:776759986
1811 1811 a, c dbSNP:757312268
1814 1814 a, g dbSNP:373079063
1819 1819 a, g dbSNP:377371222
1825 1825 c, t dbSNP:746058509
1826 1826 a, g dbSNP:758811926
1832 1832 c, t dbSNP:780415152
1834 1834 c, t dbSNP:747500595
1837 1837 c, g dbSNP:140271880
1838 1838 c, g dbSNP:772613617
1841 1841 -, gt dbSNP:759389193
1841 1841 a, g, t dbSNP:149939736
1842 1842 c, t dbSNP:770561559
1847 1847 c, t dbSNP:774190691
1848 1848 a, g dbSNP:546768091
1854 1854 a, g dbSNP:767240635
1856 1856 a, g dbSNP:775318803
1858 1858 c, t dbSNP:369787650
1859 1859 a, g dbSNP:201127799
1862 1862 a, g dbSNP:753766103
1864 1864 g, t dbSNP:757364674
1868 1868 c, t dbSNP:765278505
1874 1874 c, t dbSNP:35475253
1875 1875 a, g dbSNP:750665692
1876 1876 a, g dbSNP:767055403
1878 1878 a, c dbSNP:758576984
1891 1891 c, t dbSNP:780285591
1900 1900 a, g dbSNP:747342458
1901 1901 a, g dbSNP:120074119
1906 1906 c, t dbSNP:145079534
1910 1910 c, t dbSNP:202192013
1912 1912 c, t dbSNP:781756741
1913 1913 g, t dbSNP:748635475
1914 1914 c, t dbSNP:373940701
1915 1915 a, g dbSNP:35098198
1929 1929 a, c, t dbSNP:35785620
1930 1930 a, g dbSNP:774989668
1932 1932 a, c dbSNP:760582719
1937 1937 c, t dbSNP:375570126
1938 1938 a, g dbSNP:189116118
1948 1948 c, t dbSNP:200974033
1960 1960 a, g dbSNP:761689892
1961 1961 a, c dbSNP:138531908
1967 1967 a, g dbSNP:750433951
1970 1970 c, t dbSNP:763099671
1971 1971 a, g dbSNP:370129081
1980 1980 g, t dbSNP:751726525
1992 1992 -, gcc dbSNP:769777506
1994 1994 -, cgc dbSNP:120074118
1994 1994 c, t dbSNP:375915127
1995 1995 a, g dbSNP:140269316
1996 1996 a, c dbSNP:528414255
2005 2005 a, g dbSNP:370828368
2021 2021 c, t dbSNP:534009149
2032 2032 c, g dbSNP:778574286
2038 2038 g, t dbSNP:745425820
2041 2041 c, g dbSNP:771476083
2043 2043 a, c dbSNP:779792544
2048 2048 c, t dbSNP:200332161
2050 2050 a, g dbSNP:768517998
2051 2051 c, t dbSNP:776370511
2061 2061 -, agggcccc dbSNP:760099707
2065 2065 a, c dbSNP:755013749
2067 2067 c, t dbSNP:761741269
2070 2070 a, g dbSNP:769660920
2074 2074 c, t dbSNP:773121287
2077 2077 a, c, g dbSNP:763161789
2083 2083 a, g dbSNP:751858669
2088 2088 a, g dbSNP:759631410
2095 2095 a, g dbSNP:768029083
2099 2099 a, t dbSNP:1803159
2102 2102 -, a dbSNP:775215131
2107 2107 a, g dbSNP:8164
2114 2114 a, g dbSNP:756706052
2136 2136 a, c dbSNP:1803160
2145 2145 a, g dbSNP:138499616
2153 2153 c, t dbSNP:12273714
2156 2156 a, t dbSNP:142942704
2186 2186 a, g dbSNP:1803158
2201 2201 a, c dbSNP:564466538
2264 2264 c, g dbSNP:770932397
2279 2279 a, c, g, t dbSNP:1801044
2334 2334 c, g dbSNP:528743699
2343 2343 -, t dbSNP:35636371
2356 2356 a, c, g dbSNP:12278115
2365 2365 c, t dbSNP:561965709
2402 2402 a, g dbSNP:373270465

Target ORF information:

RefSeq Version XM_011520303
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu44952
Accession Version XM_005253075.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1527bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578820705. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)563..784(+)
Misc Feature(2)905..1783(+)
Misc Feature(3)920..1681(+)
Misc Feature(4)920..1681(+)
Misc Feature(5)1070..>1687(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1404 1404 a, g dbSNP:372287825
1409 1409 -, ct dbSNP:786204514
1413 1413 c, t dbSNP:748628930
1419 1419 a, t dbSNP:537295857
1423 1423 c, t dbSNP:376871416
1426 1426 c, t dbSNP:745317640
1430 1430 a, c, t dbSNP:369088417
1431 1431 a, g dbSNP:559088058
1433 1433 c, t dbSNP:371738717
1442 1442 c, t dbSNP:281860666
1446 1446 a, g dbSNP:776442314
1447 1447 c, t dbSNP:761658091
1450 1450 a, g dbSNP:120074121
1452 1452 a, g dbSNP:120074123
1463 1463 c, t dbSNP:570674743
1464 1464 a, g dbSNP:750345585
1468 1468 c, g dbSNP:758543204
1475 1475 g, t dbSNP:120074125
1489 1489 c, t dbSNP:766418804
1494 1494 c, t dbSNP:751781760
1495 1495 a, g dbSNP:755182589
1499 1499 c, g dbSNP:781441787
1501 1501 c, g, t dbSNP:376494095
1502 1502 a, g dbSNP:756594690
1505 1505 a, g dbSNP:778484457
1506 1506 c, g dbSNP:749780080
1510 1510 a, g dbSNP:771755385
1520 1520 c, t dbSNP:534811569
1524 1524 g, t dbSNP:200838486
1525 1525 a, c, g dbSNP:768283171
1530 1530 a, g dbSNP:761723108
1531 1531 a, g dbSNP:34555120
1532 1532 -, cttca dbSNP:763664013
1532 1532 c, g dbSNP:773176344
1533 1533 g, t dbSNP:762858594
1534 1534 a, t dbSNP:766472784
1538 1538 a, g dbSNP:751622021
1550 1550 c, t dbSNP:755160837
1551 1551 a, g dbSNP:767722360
1565 1565 c, t dbSNP:120074126
1566 1566 a, g dbSNP:767492080
1568 1568 a, g dbSNP:753011073
1577 1577 a, c dbSNP:760930408
1584 1584 c, t dbSNP:281860669
1586 1586 c, g, t dbSNP:140688153
1587 1587 c, g dbSNP:766945871
1591 1591 g, t dbSNP:373816332
1592 1592 c, t dbSNP:757848411
1595 1595 c, t dbSNP:779528546
1597 1597 g, t dbSNP:398123475
1600 1600 a, g dbSNP:754326223
1607 1607 c, t dbSNP:281860670
1610 1610 -, gctgga dbSNP:281860674
1611 1611 a, g dbSNP:750887448
1612 1612 a, c dbSNP:267607073
1625 1625 c, g, t dbSNP:120074127
1626 1626 a, g dbSNP:377609894
1633 1633 a, g dbSNP:769400504
1635 1635 c, g, t dbSNP:559092380
1640 1640 a, t dbSNP:775720719
1641 1641 a, g dbSNP:747143343
1643 1643 c, g dbSNP:374018137
1647 1647 a, g dbSNP:201953350
1649 1649 a, c dbSNP:281865156
1650 1650 a, c dbSNP:768851981
1655 1655 a, g dbSNP:777032252
1658 1658 a, g, t dbSNP:144624998
1669 1669 c, t dbSNP:765658453
1680 1680 -, at dbSNP:748411156
1680 1680 a, c dbSNP:281860673
1681 1681 c, t dbSNP:570284983
1684 1684 a, g dbSNP:763521056
1696 1696 a, g dbSNP:766738652
1702 1702 a, c dbSNP:745864955
1704 1704 a, c dbSNP:267607074
1714 1714 c, g dbSNP:531223061
1718 1718 -, ct dbSNP:398123476
1724 1724 c, t dbSNP:182812968
1725 1725 a, g dbSNP:763566905
1728 1728 c, t dbSNP:753508874
1729 1729 a, g dbSNP:138588535
1732 1732 a, g dbSNP:778770153
1735 1735 c, t dbSNP:745587850
1736 1736 c, g dbSNP:769703665
1749 1749 a, c, t dbSNP:267607075
1756 1756 g, t dbSNP:281860665
1758 1758 c, t dbSNP:141641266
1766 1766 a, t dbSNP:398123477
1771 1771 c, t dbSNP:554647710
1772 1772 a, g dbSNP:144873307
1773 1773 a, g dbSNP:768903533
1777 1777 c, t dbSNP:776805089
1786 1786 c, t dbSNP:781427826
1789 1789 -, c dbSNP:746881346
1794 1794 c, t dbSNP:546102017
1810 1810 c, t dbSNP:769904764
1811 1811 a, g, t dbSNP:120074117
1815 1815 ac, gt dbSNP:281860675
1815 1815 a, g dbSNP:749498245
1816 1816 c, t dbSNP:771336819
1835 1835 a, c, g dbSNP:774651673
1838 1838 c, t dbSNP:563263776
1839 1839 c, g, t dbSNP:149423664
1840 1840 a, g dbSNP:1050239
1844 1844 g, t dbSNP:764772735
1847 1847 c, t dbSNP:200652683
1851 1851 c, t dbSNP:540422105
1852 1852 a, g dbSNP:140806787
1857 1857 c, g dbSNP:368806984
1865 1865 a, g dbSNP:754979734
1868 1868 a, t dbSNP:142787001
1871 1871 a, c dbSNP:752679988
1874 1874 a, t dbSNP:371837210
1875 1875 c, t dbSNP:756192072
1876 1876 a, g dbSNP:571736560
1879 1879 c, t dbSNP:147258619
1881 1881 a, g dbSNP:749496647
1885 1885 a, c dbSNP:771071195
1890 1890 c, t dbSNP:376815723
1900 1900 a, g dbSNP:746285905
1904 1904 c, t dbSNP:772417462
1905 1905 a, g dbSNP:140770832
1907 1907 c, g dbSNP:35122256
1913 1913 c, t dbSNP:769209179
1916 1916 a, c, t dbSNP:199915216
1917 1917 a, g dbSNP:552841217
1938 1938 a, g dbSNP:778746534
1942 1942 c, t dbSNP:398123478
1943 1943 a, g dbSNP:113467489
1944 1944 a, c dbSNP:774163596
1945 1945 g, t dbSNP:756031857
1946 1946 -, a dbSNP:770962157
1950 1950 c, t dbSNP:201659696
1952 1952 a, g dbSNP:753894999
1954 1954 -, ggc dbSNP:776759986
1963 1963 a, c dbSNP:757312268
1966 1966 a, g dbSNP:373079063
1971 1971 a, g dbSNP:377371222
1977 1977 c, t dbSNP:746058509
1978 1978 a, g dbSNP:758811926
1984 1984 c, t dbSNP:780415152
1986 1986 c, t dbSNP:747500595
1989 1989 c, g dbSNP:140271880
1990 1990 c, g dbSNP:772613617
1993 1993 -, gt dbSNP:759389193
1993 1993 a, g, t dbSNP:149939736
1994 1994 c, t dbSNP:770561559
1999 1999 c, t dbSNP:774190691
2000 2000 a, g dbSNP:546768091
2006 2006 a, g dbSNP:767240635
2008 2008 a, g dbSNP:775318803
2010 2010 c, t dbSNP:369787650
2011 2011 a, g dbSNP:201127799
2014 2014 a, g dbSNP:753766103
2016 2016 g, t dbSNP:757364674
2020 2020 c, t dbSNP:765278505
2026 2026 c, t dbSNP:35475253
2027 2027 a, g dbSNP:750665692
2028 2028 a, g dbSNP:767055403
2030 2030 a, c dbSNP:758576984
2043 2043 c, t dbSNP:780285591
2052 2052 a, g dbSNP:747342458
2053 2053 a, g dbSNP:120074119
2058 2058 c, t dbSNP:145079534
2062 2062 c, t dbSNP:202192013
2064 2064 c, t dbSNP:781756741
2065 2065 g, t dbSNP:748635475
2066 2066 c, t dbSNP:373940701
2067 2067 a, g dbSNP:35098198
2081 2081 a, c, t dbSNP:35785620
2082 2082 a, g dbSNP:774989668
2084 2084 a, c dbSNP:760582719
2089 2089 c, t dbSNP:375570126
2090 2090 a, g dbSNP:189116118
2100 2100 c, t dbSNP:200974033
2112 2112 a, g dbSNP:761689892
2113 2113 a, c dbSNP:138531908
2119 2119 a, g dbSNP:750433951
2122 2122 c, t dbSNP:763099671
2123 2123 a, g dbSNP:370129081
2132 2132 g, t dbSNP:751726525
2144 2144 -, gcc dbSNP:769777506
2146 2146 -, cgc dbSNP:120074118
2146 2146 c, t dbSNP:375915127
2147 2147 a, g dbSNP:140269316
2148 2148 a, c dbSNP:528414255
2157 2157 a, g dbSNP:370828368
2173 2173 c, t dbSNP:534009149
2184 2184 c, g dbSNP:778574286
2190 2190 g, t dbSNP:745425820
2193 2193 c, g dbSNP:771476083
2195 2195 a, c dbSNP:779792544
2200 2200 c, t dbSNP:200332161
2202 2202 a, g dbSNP:768517998
2203 2203 c, t dbSNP:776370511

Target ORF information:

RefSeq Version XM_005253075
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60648
Accession Version XM_011520304.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1395bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)563..784(+)
Misc Feature(2)905..1651(+)
Misc Feature(3)920..1549(+)
Misc Feature(4)920..1549(+)
Position Chain Variation Link
3 3 a, g dbSNP:757295687
6 6 -, cccggggcagggcgggggcagggagagggggcggaatcggggcggt dbSNP:150897792
18 18 c, t dbSNP:767543462
44 44 c, g dbSNP:185097277
56 56 a, g dbSNP:577729042
57 57 c, g dbSNP:762079020
70 70 c, g dbSNP:2682090
81 81 g, t dbSNP:559944130
86 86 g, t dbSNP:368203665
137 137 a, g dbSNP:113418824
166 166 c, t dbSNP:372965365
167 167 a, g dbSNP:114874902
181 181 c, g dbSNP:750731731
201 201 c, t dbSNP:147605872
202 202 g, t dbSNP:563116210
221 221 c, t dbSNP:533338773
225 225 a, g dbSNP:756519374
233 233 a, g dbSNP:374470369
248 248 a, t dbSNP:780468153
249 249 a, g dbSNP:200242748
252 252 -, g dbSNP:767291057
252 252 c, t dbSNP:769497058
253 253 g, t dbSNP:772795398
254 254 c, g, t dbSNP:79282481
255 255 c, g dbSNP:751332494
258 258 g, t dbSNP:759490845
260 260 a, t dbSNP:767402489
264 264 g, t dbSNP:375247947
269 269 a, t dbSNP:756206676
271 271 c, g dbSNP:549375319
281 281 c, t dbSNP:754050017
282 282 g, t dbSNP:757482767
286 286 a, g dbSNP:779446238
287 287 a, g dbSNP:375787350
292 292 c, t dbSNP:772706305
298 298 a, g dbSNP:780646835
301 301 a, g dbSNP:747502862
302 302 -, c dbSNP:281860663
303 303 c, t dbSNP:769252257
305 305 c, t dbSNP:772745537
306 306 a, g, t dbSNP:199836262
319 319 a, g dbSNP:774163288
324 324 g, t dbSNP:373013062
334 334 c, t dbSNP:767287886
337 337 c, t dbSNP:775473869
338 338 a, g dbSNP:11544727
344 344 g, t dbSNP:760627709
348 348 a, g dbSNP:764126465
354 354 a, g dbSNP:144465428
356 356 a, g dbSNP:538153468
363 363 a, g dbSNP:765485028
365 365 a, g dbSNP:750834930
371 371 a, g dbSNP:758894722
374 374 a, g dbSNP:766822201
376 376 a, t dbSNP:747512813
378 378 -, c dbSNP:750157176
378 378 c, g dbSNP:755490852
381 381 c, t dbSNP:556155962
382 382 c, g dbSNP:577769499
386 386 c, t dbSNP:376159116
388 388 a, c dbSNP:748793138
394 394 a, g dbSNP:786204506
397 397 a, g dbSNP:142178073
398 398 a, g dbSNP:774047252
400 400 -, cc dbSNP:755988781
401 401 -, ctggtg dbSNP:753614903
401 401 c, g dbSNP:201367689
402 402 -, tgg dbSNP:747472271
404 404 -, cgc dbSNP:767539123
404 404 c, g, t dbSNP:141685473
405 405 -, tgctgg dbSNP:775860642
405 405 c, t dbSNP:1050228
406 406 -, gctggc dbSNP:3838786
406 406 c, t dbSNP:61729852
407 407 -, c dbSNP:761696094
408 408 -, tggcgctgg dbSNP:767338533
409 409 -, ggcgc dbSNP:773261292
411 411 a, c, t dbSNP:78250081
411 411 cgctggcgctggcgctggc, t dbSNP:71467507
417 417 c, t dbSNP:377374691
420 420 c, t dbSNP:760549042
423 423 c, t dbSNP:200577287
424 424 a, g, t dbSNP:571806745
429 429 a, c dbSNP:776573567
431 431 a, c dbSNP:761899078
433 433 g, t dbSNP:150867628
436 436 -, gctggc dbSNP:558809956
436 436 -, ctggct dbSNP:766205523
436 436 g, t dbSNP:200763765
437 437 c, t dbSNP:758665343
440 440 c, g dbSNP:766902025
441 441 -, gctggc, gctggcgctggc dbSNP:71056748
442 442 c, g, t dbSNP:751904073
445 445 -, gtct dbSNP:281860676
445 445 -, gc, gcgc dbSNP:753484058
446 446 g, t dbSNP:781675416
450 450 a, g, t dbSNP:748589919
453 453 c, g dbSNP:778362370
457 457 a, g dbSNP:745567072
460 460 c, t dbSNP:375248757
464 464 c, t dbSNP:779741971
472 472 a, g dbSNP:368143181
474 474 a, c dbSNP:768487612
475 475 a, g dbSNP:199586053
480 480 c, t dbSNP:776692908
494 494 c, t dbSNP:139716279
496 496 c, t dbSNP:770037147
498 498 a, c dbSNP:773406166
499 499 a, g, t dbSNP:11544728
509 509 a, g dbSNP:375224040
510 510 c, t dbSNP:751876017
511 511 c, t dbSNP:759887657
520 520 a, t dbSNP:767768022
521 521 a, c, t dbSNP:753287070
524 524 a, g dbSNP:778415447
527 527 a, g dbSNP:560531338
530 530 a, c dbSNP:758047855
532 532 c, t dbSNP:575601110
534 534 a, g dbSNP:201647015
540 540 g, t dbSNP:768566892
546 546 c, t dbSNP:777543129
551 551 a, g, t dbSNP:368200803
552 552 g, t dbSNP:769808075
557 557 c, g dbSNP:773457550
563 563 c, t dbSNP:763060513
589 589 a, g dbSNP:144428799
590 590 c, t dbSNP:774701073
593 593 a, g dbSNP:759645398
595 595 c, g dbSNP:146630228
599 599 a, g dbSNP:369746362
603 603 a, g dbSNP:373475928
608 608 a, g, t dbSNP:527767942
610 610 g, t dbSNP:757958025
611 611 a, c dbSNP:779430680
612 612 c, t dbSNP:751269562
624 624 c, t dbSNP:745865811
625 625 c, t dbSNP:772349606
626 626 a, g dbSNP:775743387
627 627 a, g dbSNP:747223735
628 628 c, t dbSNP:769052880
634 634 c, t dbSNP:543145636
635 635 c, t dbSNP:140202512
636 636 a, c, g dbSNP:149770879
638 638 a, g dbSNP:142215226
641 641 a, g dbSNP:199913218
646 646 c, t dbSNP:767122852
647 647 a, g dbSNP:202206564
652 652 -, c dbSNP:727504165
666 666 a, t dbSNP:755805263
669 669 g, t dbSNP:747531830
671 671 c, t dbSNP:370048730
688 688 g, t dbSNP:371141815
691 691 c, t dbSNP:778655099
692 692 a, g, t dbSNP:189859589
704 704 a, g dbSNP:556385880
715 715 c, t dbSNP:780081189
718 718 g, t dbSNP:747284877
719 719 a, c, g dbSNP:768820000
722 722 a, g dbSNP:748395897
728 728 a, g dbSNP:770350207
729 729 -, tgg dbSNP:752225278
730 730 a, c, g dbSNP:773650118
731 731 a, g dbSNP:763512845
733 733 -, gga dbSNP:757974084
739 739 a, g dbSNP:148944108
746 746 c, t dbSNP:143719170
747 747 a, g dbSNP:760433840
760 760 c, t dbSNP:763771413
770 770 a, g dbSNP:369566518
773 773 c, t dbSNP:727504166
778 778 a, c, t dbSNP:765073144
784 784 a, c dbSNP:758313663
786 786 c, t dbSNP:780134410
790 790 c, t dbSNP:751600918
802 802 -, c dbSNP:781535659
802 802 a, g dbSNP:755201121
803 803 a, c dbSNP:781334934
816 816 -, t dbSNP:786204733
819 819 c, t dbSNP:748390729
821 821 a, c, t dbSNP:147607780
827 827 a, t dbSNP:535997620
831 831 a, t dbSNP:749780769
832 832 c, t dbSNP:142147633
835 835 -, tt dbSNP:746454813
836 836 -, tt dbSNP:786204694
840 840 c, t dbSNP:775143399
849 849 c, t dbSNP:760203204
850 850 a, g dbSNP:768265842
856 856 -, c dbSNP:756366019
857 857 a, c, t dbSNP:74053349
857 857 -, c dbSNP:780407264
862 862 a, c dbSNP:764993348
865 865 -, acccc dbSNP:749458864
865 865 a, g dbSNP:750187574
866 866 a, c dbSNP:762912222
867 867 c, t dbSNP:766240926
871 871 -, tag dbSNP:768895532
871 871 c, t dbSNP:751653824
871 871 -, t dbSNP:727504167
873 873 -, c dbSNP:748165078
874 874 -, c dbSNP:774608488
876 876 c, t dbSNP:755111215
880 880 -, ag dbSNP:772265533
881 881 a, g dbSNP:767630492
882 882 c, t dbSNP:752904145
894 894 c, t dbSNP:756310076
897 897 a, t dbSNP:778029738
902 902 c, t dbSNP:749595299
903 903 a, g dbSNP:757850587
904 904 c, t dbSNP:779618003
907 907 c, t dbSNP:746370637
910 910 c, g dbSNP:768317292
916 916 c, t dbSNP:776180872
925 925 a, c, g dbSNP:200443318
932 932 g, t dbSNP:772889728
934 934 c, t dbSNP:7951904
940 940 c, g dbSNP:766150536
949 949 a, g dbSNP:774341345
954 954 c, t dbSNP:759439337
955 955 a, g dbSNP:202032347
958 958 a, c dbSNP:752782100
974 974 c, t dbSNP:756294464
978 978 c, t dbSNP:764317969
987 987 a, g dbSNP:141387770
989 989 a, c, t dbSNP:199832734
990 990 a, g dbSNP:746421946
992 992 a, g dbSNP:758887994
994 994 c, t dbSNP:780602613
1005 1005 c, t dbSNP:747630243
1006 1006 a, g dbSNP:374604948
1007 1007 c, t dbSNP:772977296
1010 1010 a, g dbSNP:748936934
1012 1012 a, g dbSNP:2682091
1017 1017 a, g dbSNP:2634197
1027 1027 c, t dbSNP:149476159
1028 1028 a, g dbSNP:120074122
1031 1031 c, t dbSNP:370178721
1033 1033 c, t dbSNP:760865854
1035 1035 a, g dbSNP:764072877
1037 1037 a, g dbSNP:587779408
1039 1039 c, t dbSNP:762102363
1040 1040 a, g, t dbSNP:200763423
1045 1045 c, t dbSNP:765716943
1046 1046 a, c dbSNP:750779804
1051 1051 a, g dbSNP:374458858
1055 1055 c, g dbSNP:398123479
1057 1057 c, t dbSNP:752000778
1060 1060 a, g dbSNP:143939609
1063 1063 c, t dbSNP:777233772
1065 1065 c, t dbSNP:139882665
1078 1078 a, g dbSNP:770523185
1086 1086 a, t dbSNP:120074120
1092 1092 a, g dbSNP:745616876
1094 1094 c, g dbSNP:200681698
1100 1100 a, c dbSNP:775563981
1102 1102 a, c dbSNP:760493995
1104 1104 c, t dbSNP:543834713
1105 1105 a, c, t dbSNP:35933246
1106 1106 a, g dbSNP:202244080
1111 1111 a, c, t dbSNP:61876771
1118 1118 a, g dbSNP:763437061
1134 1134 a, g dbSNP:727504168
1142 1142 a, c dbSNP:199955808
1145 1145 a, g, t dbSNP:752148586
1147 1147 -, tccccgca dbSNP:281860677
1153 1153 c, t dbSNP:777288780
1160 1160 c, g dbSNP:529881058
1167 1167 a, c dbSNP:376259993
1170 1170 a, c, g dbSNP:1803161
1171 1171 c, t dbSNP:745502097
1178 1178 a, c dbSNP:120074128
1182 1182 a, t dbSNP:779687063
1184 1184 c, t dbSNP:541061793
1185 1185 a, g dbSNP:35824453
1188 1188 c, t dbSNP:150815128
1192 1192 c, g dbSNP:371688255
1194 1194 a, c, t dbSNP:776745690
1195 1195 c, t dbSNP:536760557
1198 1198 c, t dbSNP:368353322
1199 1199 a, g dbSNP:2723669
1205 1205 a, c, g dbSNP:570353618
1207 1207 a, g dbSNP:201134693
1209 1209 c, t dbSNP:120074124
1211 1211 a, g dbSNP:199873765
1223 1223 c, t dbSNP:767952915
1234 1234 a, g dbSNP:753187556
1235 1235 c, t dbSNP:149991096
1245 1245 c, t dbSNP:756827709
1246 1246 g, t dbSNP:764694813
1248 1248 c, t dbSNP:750136188
1251 1251 a, t dbSNP:12575136
1253 1253 c, g dbSNP:757934797
1256 1256 a, g dbSNP:779927660
1264 1264 a, g dbSNP:746711794
1269 1269 c, t dbSNP:1050233
1271 1271 -, tgt dbSNP:398123480
1271 1271 c, g dbSNP:761308217
1282 1282 c, t dbSNP:781339776
1285 1285 c, t dbSNP:572772760
1289 1289 -, c dbSNP:772960412
1289 1289 c, t dbSNP:142476839
1293 1293 a, c, g, t dbSNP:202081954
1294 1294 -, c dbSNP:387906289
1297 1297 c, t dbSNP:774790917
1299 1299 c, t dbSNP:759950370
1304 1304 a, c, g dbSNP:281860667
1308 1308 a, g dbSNP:761144309
1316 1316 c, t dbSNP:764745599
1317 1317 c, t dbSNP:749859100
1319 1319 c, t dbSNP:369841281
1320 1320 a, c, g dbSNP:200242334
1324 1324 g, t dbSNP:281860668
1335 1335 c, t dbSNP:373508268
1336 1336 a, g, t dbSNP:781107025
1342 1342 c, t dbSNP:555187617
1345 1345 a, g dbSNP:777942302
1352 1352 g, t dbSNP:201550531
1353 1353 a, c dbSNP:771028947
1354 1354 a, g, t dbSNP:144408432
1356 1356 c, t dbSNP:772473982
1360 1360 a, g dbSNP:775780219
1369 1369 c, t dbSNP:72896268
1370 1370 a, g dbSNP:768976098
1376 1376 c, t dbSNP:772788648
1379 1379 c, t dbSNP:370198638
1380 1380 a, g dbSNP:148892841
1383 1383 -, c dbSNP:760674901
1393 1393 c, t dbSNP:751301389
1395 1395 c, t dbSNP:759242012
1398 1398 c, t dbSNP:143612450
1399 1399 a, g dbSNP:148067213
1401 1401 a, c dbSNP:756127736
1402 1402 c, t dbSNP:371340833
1403 1403 a, g dbSNP:753809177
1409 1409 a, t dbSNP:373629757
1411 1411 c, g dbSNP:779027887
1414 1414 c, g dbSNP:375912494
1415 1415 a, g dbSNP:746106776
1417 1417 a, g dbSNP:772238207
1419 1419 c, g dbSNP:574634445
1433 1433 c, t dbSNP:120074126
1434 1434 a, g dbSNP:767492080
1436 1436 a, g dbSNP:753011073
1445 1445 a, c dbSNP:760930408
1452 1452 c, t dbSNP:281860669
1454 1454 c, g, t dbSNP:140688153
1455 1455 c, g dbSNP:766945871
1459 1459 g, t dbSNP:373816332
1460 1460 c, t dbSNP:757848411
1463 1463 c, t dbSNP:779528546
1465 1465 g, t dbSNP:398123475
1468 1468 a, g dbSNP:754326223
1475 1475 c, t dbSNP:281860670
1478 1478 -, gctgga dbSNP:281860674
1479 1479 a, g dbSNP:750887448
1480 1480 a, c dbSNP:267607073
1493 1493 c, g, t dbSNP:120074127
1494 1494 a, g dbSNP:377609894
1501 1501 a, g dbSNP:769400504
1503 1503 c, g, t dbSNP:559092380
1508 1508 a, t dbSNP:775720719
1509 1509 a, g dbSNP:747143343
1511 1511 c, g dbSNP:374018137
1515 1515 a, g dbSNP:201953350
1517 1517 a, c dbSNP:281865156
1518 1518 a, c dbSNP:768851981
1523 1523 a, g dbSNP:777032252
1526 1526 a, g, t dbSNP:144624998
1537 1537 c, t dbSNP:765658453
1548 1548 -, at dbSNP:748411156
1548 1548 a, c dbSNP:281860673
1549 1549 c, t dbSNP:570284983
1552 1552 a, g dbSNP:763521056
1564 1564 a, g dbSNP:766738652
1570 1570 a, c dbSNP:745864955
1572 1572 a, c dbSNP:267607074
1582 1582 c, g dbSNP:531223061
1586 1586 -, ct dbSNP:398123476
1592 1592 c, t dbSNP:182812968
1593 1593 a, g dbSNP:763566905
1596 1596 c, t dbSNP:753508874
1597 1597 a, g dbSNP:138588535
1600 1600 a, g dbSNP:778770153
1603 1603 c, t dbSNP:745587850
1604 1604 c, g dbSNP:769703665
1617 1617 a, c, t dbSNP:267607075
1624 1624 g, t dbSNP:281860665
1626 1626 c, t dbSNP:141641266
1634 1634 a, t dbSNP:398123477
1639 1639 c, t dbSNP:554647710
1640 1640 a, g dbSNP:144873307
1641 1641 a, g dbSNP:768903533
1645 1645 c, t dbSNP:776805089
1654 1654 c, t dbSNP:781427826
1657 1657 -, c dbSNP:746881346
1662 1662 c, t dbSNP:546102017
1678 1678 c, t dbSNP:769904764
1679 1679 a, g, t dbSNP:120074117
1683 1683 ac, gt dbSNP:281860675
1683 1683 a, g dbSNP:749498245
1684 1684 c, t dbSNP:771336819
1703 1703 a, c, g dbSNP:774651673
1706 1706 c, t dbSNP:563263776
1707 1707 c, g, t dbSNP:149423664
1708 1708 a, g dbSNP:1050239
1712 1712 g, t dbSNP:764772735
1715 1715 c, t dbSNP:200652683
1719 1719 c, t dbSNP:540422105
1720 1720 a, g dbSNP:140806787
1725 1725 c, g dbSNP:368806984
1733 1733 a, g dbSNP:754979734
1736 1736 a, t dbSNP:142787001
1739 1739 a, c dbSNP:752679988
1742 1742 a, t dbSNP:371837210
1743 1743 c, t dbSNP:756192072
1744 1744 a, g dbSNP:571736560
1747 1747 c, t dbSNP:147258619
1749 1749 a, g dbSNP:749496647
1753 1753 a, c dbSNP:771071195
1758 1758 c, t dbSNP:376815723
1768 1768 a, g dbSNP:746285905
1772 1772 c, t dbSNP:772417462
1773 1773 a, g dbSNP:140770832
1775 1775 c, g dbSNP:35122256
1781 1781 c, t dbSNP:769209179
1784 1784 a, c, t dbSNP:199915216
1785 1785 a, g dbSNP:552841217
1806 1806 a, g dbSNP:778746534
1810 1810 c, t dbSNP:398123478
1811 1811 a, g dbSNP:113467489
1812 1812 a, c dbSNP:774163596
1813 1813 g, t dbSNP:756031857
1814 1814 -, a dbSNP:770962157
1818 1818 c, t dbSNP:201659696
1820 1820 a, g dbSNP:753894999
1822 1822 -, ggc dbSNP:776759986
1831 1831 a, c dbSNP:757312268
1834 1834 a, g dbSNP:373079063
1839 1839 a, g dbSNP:377371222
1845 1845 c, t dbSNP:746058509
1846 1846 a, g dbSNP:758811926
1852 1852 c, t dbSNP:780415152
1854 1854 c, t dbSNP:747500595
1857 1857 c, g dbSNP:140271880
1858 1858 c, g dbSNP:772613617
1861 1861 -, gt dbSNP:759389193
1861 1861 a, g, t dbSNP:149939736
1862 1862 c, t dbSNP:770561559
1867 1867 c, t dbSNP:774190691
1868 1868 a, g dbSNP:546768091
1874 1874 a, g dbSNP:767240635
1876 1876 a, g dbSNP:775318803
1878 1878 c, t dbSNP:369787650
1879 1879 a, g dbSNP:201127799
1882 1882 a, g dbSNP:753766103
1884 1884 g, t dbSNP:757364674
1888 1888 c, t dbSNP:765278505
1894 1894 c, t dbSNP:35475253
1895 1895 a, g dbSNP:750665692
1896 1896 a, g dbSNP:767055403
1898 1898 a, c dbSNP:758576984
1911 1911 c, t dbSNP:780285591
1920 1920 a, g dbSNP:747342458
1921 1921 a, g dbSNP:120074119
1926 1926 c, t dbSNP:145079534
1930 1930 c, t dbSNP:202192013
1932 1932 c, t dbSNP:781756741
1933 1933 g, t dbSNP:748635475
1934 1934 c, t dbSNP:373940701
1935 1935 a, g dbSNP:35098198
1949 1949 a, c, t dbSNP:35785620
1950 1950 a, g dbSNP:774989668
1952 1952 a, c dbSNP:760582719
1957 1957 c, t dbSNP:375570126
1958 1958 a, g dbSNP:189116118
1968 1968 c, t dbSNP:200974033
1980 1980 a, g dbSNP:761689892
1981 1981 a, c dbSNP:138531908
1987 1987 a, g dbSNP:750433951
1990 1990 c, t dbSNP:763099671
1991 1991 a, g dbSNP:370129081
2000 2000 g, t dbSNP:751726525
2012 2012 -, gcc dbSNP:769777506
2014 2014 -, cgc dbSNP:120074118
2014 2014 c, t dbSNP:375915127
2015 2015 a, g dbSNP:140269316
2016 2016 a, c dbSNP:528414255
2025 2025 a, g dbSNP:370828368

Target ORF information:

RefSeq Version XM_011520304
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal (SMPD1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18710
Accession Version NM_000543.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1896bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product sphingomyelin phosphodiesterase isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI599208.1, AB209775.1, M59916.1 and AA746054.1. This sequence is a reference standard in the RefSeqGene project. On Jul 17, 2010 this sequence version replaced gi:56117839. Summary: The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB209775.1, X59960.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)84..86(+)
Misc Feature(2)447..449(+)
Misc Feature(3)450..671(+)
Misc Feature(4)531..533(+)
Misc Feature(5)549..584(+)
Misc Feature(6)792..1679(+)
Misc Feature(7)807..1568(+)
Misc Feature(8)807..1568(+)
Misc Feature(9)852..869(+)
Misc Feature(10)870..941(+)
Misc Feature(11)957..1748(+)
Misc Feature(12)1194..1196(+)
Misc Feature(13)1344..1484(+)
Misc Feature(14)1941..1955(+)
Misc Feature(15)1971..2012(+)
Exon (1)1..503
Gene Synonym:
Exon (2)504..1276
Gene Synonym:
Exon (3)1277..1448
Gene Synonym:
Exon (4)1449..1525
Gene Synonym:
Exon (5)1526..1671
Gene Synonym:
Exon (6)1672..2472
Gene Synonym:
Position Chain Variation Link
24 24 a, g dbSNP:113418824
53 53 c, t dbSNP:372965365
54 54 a, g dbSNP:114874902
68 68 c, g dbSNP:750731731
88 88 c, t dbSNP:147605872
89 89 g, t dbSNP:563116210
108 108 c, t dbSNP:533338773
112 112 a, g dbSNP:756519374
120 120 a, g dbSNP:374470369
135 135 a, t dbSNP:780468153
136 136 a, g dbSNP:200242748
139 139 -, g dbSNP:767291057
139 139 c, t dbSNP:769497058
140 140 g, t dbSNP:772795398
141 141 c, g, t dbSNP:79282481
142 142 c, g dbSNP:751332494
145 145 g, t dbSNP:759490845
147 147 a, t dbSNP:767402489
151 151 g, t dbSNP:375247947
156 156 a, t dbSNP:756206676
158 158 c, g dbSNP:549375319
168 168 c, t dbSNP:754050017
169 169 g, t dbSNP:757482767
173 173 a, g dbSNP:779446238
174 174 a, g dbSNP:375787350
179 179 c, t dbSNP:772706305
185 185 a, g dbSNP:780646835
188 188 a, g dbSNP:747502862
189 189 -, c dbSNP:281860663
190 190 c, t dbSNP:769252257
192 192 c, t dbSNP:772745537
193 193 a, g, t dbSNP:199836262
206 206 a, g dbSNP:774163288
211 211 g, t dbSNP:373013062
221 221 c, t dbSNP:767287886
224 224 c, t dbSNP:775473869
225 225 a, g dbSNP:11544727
231 231 g, t dbSNP:760627709
235 235 a, g dbSNP:764126465
241 241 a, g dbSNP:144465428
243 243 a, g dbSNP:538153468
250 250 a, g dbSNP:765485028
252 252 a, g dbSNP:750834930
258 258 a, g dbSNP:758894722
261 261 a, g dbSNP:766822201
263 263 a, t dbSNP:747512813
265 265 -, c dbSNP:750157176
265 265 c, g dbSNP:755490852
268 268 c, t dbSNP:556155962
269 269 c, g dbSNP:577769499
273 273 c, t dbSNP:376159116
275 275 a, c dbSNP:748793138
281 281 a, g dbSNP:786204506
284 284 a, g dbSNP:142178073
285 285 a, g dbSNP:774047252
287 287 -, cc dbSNP:755988781
288 288 -, ctggtg dbSNP:753614903
288 288 c, g dbSNP:201367689
289 289 -, tgg dbSNP:747472271
291 291 -, cgc dbSNP:767539123
291 291 c, g, t dbSNP:141685473
292 292 -, tgctgg dbSNP:775860642
292 292 c, t dbSNP:1050228
293 293 -, gctggc dbSNP:3838786
293 293 c, t dbSNP:61729852
294 294 -, c dbSNP:761696094
295 295 -, tggcgctgg dbSNP:767338533
296 296 -, ggcgc dbSNP:773261292
298 298 a, c, t dbSNP:78250081
298 298 cgctggcgctggcgctggc, t dbSNP:71467507
304 304 c, t dbSNP:377374691
307 307 c, t dbSNP:760549042
310 310 c, t dbSNP:200577287
311 311 a, g, t dbSNP:571806745
316 316 a, c dbSNP:776573567
318 318 a, c dbSNP:761899078
320 320 g, t dbSNP:150867628
323 323 -, gctggc dbSNP:558809956
323 323 -, ctggct dbSNP:766205523
323 323 g, t dbSNP:200763765
324 324 c, t dbSNP:758665343
327 327 c, g dbSNP:766902025
328 328 -, gctggc, gctggcgctggc dbSNP:71056748
329 329 c, g, t dbSNP:751904073
332 332 -, gtct dbSNP:281860676
332 332 -, gc, gcgc dbSNP:753484058
333 333 g, t dbSNP:781675416
337 337 a, g, t dbSNP:748589919
340 340 c, g dbSNP:778362370
344 344 a, g dbSNP:745567072
347 347 c, t dbSNP:375248757
351 351 c, t dbSNP:779741971
359 359 a, g dbSNP:368143181
361 361 a, c dbSNP:768487612
362 362 a, g dbSNP:199586053
367 367 c, t dbSNP:776692908
381 381 c, t dbSNP:139716279
383 383 c, t dbSNP:770037147
385 385 a, c dbSNP:773406166
386 386 a, g, t dbSNP:11544728
396 396 a, g dbSNP:375224040
397 397 c, t dbSNP:751876017
398 398 c, t dbSNP:759887657
407 407 a, t dbSNP:767768022
408 408 a, c, t dbSNP:753287070
411 411 a, g dbSNP:778415447
414 414 a, g dbSNP:560531338
417 417 a, c dbSNP:758047855
419 419 c, t dbSNP:575601110
421 421 a, g dbSNP:201647015
427 427 g, t dbSNP:768566892
433 433 c, t dbSNP:777543129
438 438 a, g, t dbSNP:368200803
439 439 g, t dbSNP:769808075
444 444 c, g dbSNP:773457550
450 450 c, t dbSNP:763060513
476 476 a, g dbSNP:144428799
477 477 c, t dbSNP:774701073
480 480 a, g dbSNP:759645398
482 482 c, g dbSNP:146630228
486 486 a, g dbSNP:369746362
490 490 a, g dbSNP:373475928
495 495 a, g, t dbSNP:527767942
497 497 g, t dbSNP:757958025
498 498 a, c dbSNP:779430680
499 499 c, t dbSNP:751269562
511 511 c, t dbSNP:745865811
512 512 c, t dbSNP:772349606
513 513 a, g dbSNP:775743387
514 514 a, g dbSNP:747223735
515 515 c, t dbSNP:769052880
521 521 c, t dbSNP:543145636
522 522 c, t dbSNP:140202512
523 523 a, c, g dbSNP:149770879
525 525 a, g dbSNP:142215226
528 528 a, g dbSNP:199913218
533 533 c, t dbSNP:767122852
534 534 a, g dbSNP:202206564
539 539 -, c dbSNP:727504165
553 553 a, t dbSNP:755805263
556 556 g, t dbSNP:747531830
558 558 c, t dbSNP:370048730
575 575 g, t dbSNP:371141815
578 578 c, t dbSNP:778655099
579 579 a, g, t dbSNP:189859589
591 591 a, g dbSNP:556385880
602 602 c, t dbSNP:780081189
605 605 g, t dbSNP:747284877
606 606 a, c, g dbSNP:768820000
609 609 a, g dbSNP:748395897
615 615 a, g dbSNP:770350207
616 616 -, tgg dbSNP:752225278
617 617 a, c, g dbSNP:773650118
618 618 a, g dbSNP:763512845
620 620 -, gga dbSNP:757974084
626 626 a, g dbSNP:148944108
633 633 c, t dbSNP:143719170
634 634 a, g dbSNP:760433840
647 647 c, t dbSNP:763771413
657 657 a, g dbSNP:369566518
660 660 c, t dbSNP:727504166
665 665 a, c, t dbSNP:765073144
671 671 a, c dbSNP:758313663
673 673 c, t dbSNP:780134410
677 677 c, t dbSNP:751600918
689 689 -, c dbSNP:781535659
689 689 a, g dbSNP:755201121
690 690 a, c dbSNP:781334934
703 703 -, t dbSNP:786204733
706 706 c, t dbSNP:748390729
708 708 a, c, t dbSNP:147607780
714 714 a, t dbSNP:535997620
718 718 a, t dbSNP:749780769
719 719 c, t dbSNP:142147633
722 722 -, tt dbSNP:746454813
723 723 -, tt dbSNP:786204694
727 727 c, t dbSNP:775143399
736 736 c, t dbSNP:760203204
737 737 a, g dbSNP:768265842
743 743 -, c dbSNP:756366019
744 744 a, c, t dbSNP:74053349
744 744 -, c dbSNP:780407264
749 749 a, c dbSNP:764993348
752 752 -, acccc dbSNP:749458864
752 752 a, g dbSNP:750187574
753 753 a, c dbSNP:762912222
754 754 c, t dbSNP:766240926
758 758 -, tag dbSNP:768895532
758 758 c, t dbSNP:751653824
758 758 -, t dbSNP:727504167
760 760 -, c dbSNP:748165078
761 761 -, c dbSNP:774608488
763 763 c, t dbSNP:755111215
767 767 -, ag dbSNP:772265533
768 768 a, g dbSNP:767630492
769 769 c, t dbSNP:752904145
781 781 c, t dbSNP:756310076
784 784 a, t dbSNP:778029738
789 789 c, t dbSNP:749595299
790 790 a, g dbSNP:757850587
791 791 c, t dbSNP:779618003
794 794 c, t dbSNP:746370637
797 797 c, g dbSNP:768317292
803 803 c, t dbSNP:776180872
812 812 a, c, g dbSNP:200443318
819 819 g, t dbSNP:772889728
821 821 c, t dbSNP:7951904
827 827 c, g dbSNP:766150536
836 836 a, g dbSNP:774341345
841 841 c, t dbSNP:759439337
842 842 a, g dbSNP:202032347
845 845 a, c dbSNP:752782100
861 861 c, t dbSNP:756294464
865 865 c, t dbSNP:764317969
874 874 a, g dbSNP:141387770
876 876 a, c, t dbSNP:199832734
877 877 a, g dbSNP:746421946
879 879 a, g dbSNP:758887994
881 881 c, t dbSNP:780602613
892 892 c, t dbSNP:747630243
893 893 a, g dbSNP:374604948
894 894 c, t dbSNP:772977296
897 897 a, g dbSNP:748936934
899 899 a, g dbSNP:2682091
904 904 a, g dbSNP:2634197
914 914 c, t dbSNP:149476159
915 915 a, g dbSNP:120074122
918 918 c, t dbSNP:370178721
920 920 c, t dbSNP:760865854
922 922 a, g dbSNP:764072877
924 924 a, g dbSNP:587779408
926 926 c, t dbSNP:762102363
927 927 a, g, t dbSNP:200763423
932 932 c, t dbSNP:765716943
933 933 a, c dbSNP:750779804
938 938 a, g dbSNP:374458858
942 942 c, g dbSNP:398123479
944 944 c, t dbSNP:752000778
947 947 a, g dbSNP:143939609
950 950 c, t dbSNP:777233772
952 952 c, t dbSNP:139882665
965 965 a, g dbSNP:770523185
973 973 a, t dbSNP:120074120
979 979 a, g dbSNP:745616876
981 981 c, g dbSNP:200681698
987 987 a, c dbSNP:775563981
989 989 a, c dbSNP:760493995
991 991 c, t dbSNP:543834713
992 992 a, c, t dbSNP:35933246
993 993 a, g dbSNP:202244080
998 998 a, c, t dbSNP:61876771
1005 1005 a, g dbSNP:763437061
1021 1021 a, g dbSNP:727504168
1029 1029 a, c dbSNP:199955808
1032 1032 a, g, t dbSNP:752148586
1034 1034 -, tccccgca dbSNP:281860677
1040 1040 c, t dbSNP:777288780
1047 1047 c, g dbSNP:529881058
1054 1054 a, c dbSNP:376259993
1057 1057 a, c, g dbSNP:1803161
1058 1058 c, t dbSNP:745502097
1065 1065 a, c dbSNP:120074128
1069 1069 a, t dbSNP:779687063
1071 1071 c, t dbSNP:541061793
1072 1072 a, g dbSNP:35824453
1075 1075 c, t dbSNP:150815128
1079 1079 c, g dbSNP:371688255
1081 1081 a, c, t dbSNP:776745690
1082 1082 c, t dbSNP:536760557
1085 1085 c, t dbSNP:368353322
1086 1086 a, g dbSNP:2723669
1092 1092 a, c, g dbSNP:570353618
1094 1094 a, g dbSNP:201134693
1096 1096 c, t dbSNP:120074124
1098 1098 a, g dbSNP:199873765
1110 1110 c, t dbSNP:767952915
1121 1121 a, g dbSNP:753187556
1122 1122 c, t dbSNP:149991096
1132 1132 c, t dbSNP:756827709
1133 1133 g, t dbSNP:764694813
1135 1135 c, t dbSNP:750136188
1138 1138 a, t dbSNP:12575136
1140 1140 c, g dbSNP:757934797
1143 1143 a, g dbSNP:779927660
1151 1151 a, g dbSNP:746711794
1156 1156 c, t dbSNP:1050233
1158 1158 -, tgt dbSNP:398123480
1158 1158 c, g dbSNP:761308217
1169 1169 c, t dbSNP:781339776
1172 1172 c, t dbSNP:572772760
1176 1176 -, c dbSNP:772960412
1176 1176 c, t dbSNP:142476839
1180 1180 a, c, g, t dbSNP:202081954
1181 1181 -, c dbSNP:387906289
1184 1184 c, t dbSNP:774790917
1186 1186 c, t dbSNP:759950370
1191 1191 a, c, g dbSNP:281860667
1195 1195 a, g dbSNP:761144309
1203 1203 c, t dbSNP:764745599
1204 1204 c, t dbSNP:749859100
1206 1206 c, t dbSNP:369841281
1207 1207 a, c, g dbSNP:200242334
1211 1211 g, t dbSNP:281860668
1222 1222 c, t dbSNP:373508268
1223 1223 a, g, t dbSNP:781107025
1229 1229 c, t dbSNP:555187617
1232 1232 a, g dbSNP:777942302
1239 1239 g, t dbSNP:201550531
1240 1240 a, c dbSNP:771028947
1241 1241 a, g, t dbSNP:144408432
1243 1243 c, t dbSNP:772473982
1247 1247 a, g dbSNP:775780219
1256 1256 c, t dbSNP:72896268
1257 1257 a, g dbSNP:768976098
1263 1263 c, t dbSNP:772788648
1266 1266 c, t dbSNP:370198638
1267 1267 a, g dbSNP:148892841
1270 1270 -, c dbSNP:760674901
1291 1291 a, g dbSNP:372287825
1296 1296 -, ct dbSNP:786204514
1300 1300 c, t dbSNP:748628930
1306 1306 a, t dbSNP:537295857
1310 1310 c, t dbSNP:376871416
1313 1313 c, t dbSNP:745317640
1317 1317 a, c, t dbSNP:369088417
1318 1318 a, g dbSNP:559088058
1320 1320 c, t dbSNP:371738717
1329 1329 c, t dbSNP:281860666
1333 1333 a, g dbSNP:776442314
1334 1334 c, t dbSNP:761658091
1337 1337 a, g dbSNP:120074121
1339 1339 a, g dbSNP:120074123
1350 1350 c, t dbSNP:570674743
1351 1351 a, g dbSNP:750345585
1355 1355 c, g dbSNP:758543204
1362 1362 g, t dbSNP:120074125
1376 1376 c, t dbSNP:766418804
1381 1381 c, t dbSNP:751781760
1382 1382 a, g dbSNP:755182589
1386 1386 c, g dbSNP:781441787
1388 1388 c, g, t dbSNP:376494095
1389 1389 a, g dbSNP:756594690
1392 1392 a, g dbSNP:778484457
1393 1393 c, g dbSNP:749780080
1397 1397 a, g dbSNP:771755385
1407 1407 c, t dbSNP:534811569
1411 1411 g, t dbSNP:200838486