
FOXL2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol FOXL2
Entrez Gene ID 668
Full Name forkhead box L2
General protein information
Preferred Names
forkhead box protein L2
forkhead box protein L2
forkhead transcription factor FOXL2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jun 2009]. lac of sum
Disorder MIM:


Disorder Html: Blepharophimosis, epicanthus inversus, and ptosis, type 1, 110100

mRNA and Protein(s)

mRNA Protein Name
NM_023067 NP_075555 forkhead box protein L2

Homo sapiens (human) FOXL2 NP_075555.1
Pan troglodytes (chimpanzee) FOXL2 XP_526323.2
Macaca mulatta (Rhesus monkey) LOC717906 XP_001109917.2
Bos taurus (cattle) FOXL2 NP_001026920.1
Mus musculus (house mouse) Foxl2 NP_036150.1
Rattus norvegicus (Norway rat) Foxl2 XP_003750619.1
Danio rerio (zebrafish) LOC100149117 XP_001922861.1


ID Name Evidence
GO:0005634 nucleus IDA
GO:0005667 transcription factor complex ISS


ID Name Evidence
GO:0003677 DNA binding IDA
GO:0003677 DNA binding TAS
GO:0003690 double-stranded DNA binding ISS
GO:0003700 sequence-specific DNA binding transcription factor activity ISS
GO:0003700 sequence-specific DNA binding transcription factor activity NAS
GO:0003705 sequence-specific enhancer binding RNA polymerase II transcription factor activity ISS
GO:0005515 protein binding IPI
GO:0008134 transcription factor binding ISS
GO:0008301 DNA bending activity ISS
GO:0030331 estrogen receptor binding ISS
GO:0031624 ubiquitin conjugating enzyme binding IPI
GO:0043028 caspase regulator activity IMP
GO:0043565 sequence-specific DNA binding IEA


ID Name Evidence
GO:0001541 ovarian follicle development IMP
GO:0001541 ovarian follicle development ISS
GO:0002074 extraocular skeletal muscle development IMP
GO:0006309 DNA fragmentation involved in apoptotic nuclear change IMP
GO:0006351 transcription, DNA-dependent ISS
GO:0006351 transcription, DNA-dependent NAS
GO:0006917 induction of apoptosis ISS
GO:0007389 pattern specification process ISS
GO:0019101 female somatic sex determination ISS
GO:0030154 cell differentiation NAS
GO:0042703 menstruation IMP
GO:0043065 positive regulation of apoptosis IMP
GO:0043280 positive regulation of caspase activity IMP
GO:0045892 negative regulation of transcription, DNA-dependent IDA
GO:0045893 positive regulation of transcription, DNA-dependent ISS
GO:0045944 positive regulation of transcription from RNA polymerase II promoter ISS
GO:0048048 embryonic eye morphogenesis ISS
GO:0051090 regulation of sequence-specific DNA binding transcription factor activity ISS
GO:0060014 granulosa cell differentiation IEA
GO:0060026 convergent extension ISS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following FOXL2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the FOXL2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_023067 Homo sapiens forkhead box L2 (FOXL2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu20709
Accession Version NM_023067.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1131bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 04-MAY-2014
Organism Homo sapiens (human)
Product forkhead box protein L2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC092947.12. This sequence is a reference standard in the RefSeqGene project. On Jun 10, 2009 this sequence version replaced gi:42716284. Summary: This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jun 2009]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)317..319(+)
Misc Feature(2)578..811(+)
Misc Feature(3)686..790(+)
Misc Feature(4)1205..1207(+)
Exon (1)1..2917
Gene Synonym:
Position Chain Variation Link
32 32 c, g dbSNP:563265663
78 78 a, c, g dbSNP:192325010
82 82 c, g dbSNP:574415705
141 141 c, t dbSNP:561023238
168 168 a, g dbSNP:145924266
187 187 a, g dbSNP:11924939
255 255 a, g dbSNP:558805988
259 259 c, g dbSNP:539109610
273 273 c, t dbSNP:576439625
299 299 c, t dbSNP:556654191
335 335 c, g dbSNP:755181359
358 358 a, g dbSNP:754194513
374 374 a, g dbSNP:768686586
377 377 c, t dbSNP:746906405
378 378 a, g dbSNP:200169078
385 385 a, g dbSNP:567696496
391 391 a, g dbSNP:771930968
394 394 a, c dbSNP:745676338
399 399 a, c dbSNP:778422326
400 400 a, g dbSNP:756989770
404 404 c, g dbSNP:748722930
407 407 c, g dbSNP:547635156
410 410 a, g dbSNP:755652331
412 412 c, t dbSNP:534227199
416 416 c, g dbSNP:766877029
432 432 a, g dbSNP:758686820
435 435 c, g dbSNP:571473577
450 450 c, t dbSNP:750858476
456 456 a, g dbSNP:765356990
457 457 a, g dbSNP:762137688
458 458 c, g dbSNP:754146874
459 459 c, t dbSNP:764223750
467 467 c, g dbSNP:760855121
469 469 c, t dbSNP:775497730
472 472 a, t dbSNP:772110470
473 473 a, g dbSNP:759236439
475 475 a, g dbSNP:774248061
491 491 a, g dbSNP:770458047
500 500 c, g dbSNP:111967494
503 503 c, g dbSNP:748930135
504 504 a, g dbSNP:777426254
508 508 a, g dbSNP:551580060
516 516 a, g dbSNP:769236782
517 517 a, c dbSNP:569790915
526 526 a, g dbSNP:780524081
528 528 a, g dbSNP:758992234
529 529 c, t dbSNP:750720022
532 532 g, t dbSNP:369525308
536 536 c, g dbSNP:757581241
538 538 g, t dbSNP:754052452
539 539 c, g dbSNP:764419952
544 544 a, c, g dbSNP:187147226
547 547 a, g dbSNP:368729164
548 548 a, g dbSNP:767338413
552 552 c, t dbSNP:759561035
557 557 a, g dbSNP:774187704
560 560 aagccggacccggcgcagaagcccccgtactc, gcgct dbSNP:672601357
563 563 c, t dbSNP:770712111
572 572 a, g dbSNP:762750401
575 575 c, t dbSNP:104893737
583 583 c, t dbSNP:756632722
586 586 a, g dbSNP:769492668
592 592 c, g dbSNP:747633105
601 601 a, g dbSNP:780718325
604 604 c, t dbSNP:768080893
616 616 c, g dbSNP:746334419
621 621 g, t dbSNP:779297637
622 622 a, c dbSNP:555936408
623 623 a, g dbSNP:387906920
629 629 c, g dbSNP:757571219
652 652 c, g, t dbSNP:778131069
661 661 c, t dbSNP:371946395
668 668 a, g dbSNP:752795632
669 669 g, t dbSNP:28937884
672 672 c, t dbSNP:200435826
685 685 a, g dbSNP:755036343
691 691 c, t dbSNP:751457510
709 709 c, t dbSNP:766231441
713 713 a, c, t dbSNP:121908358
746 746 c, g dbSNP:773039280
761 761 a, g dbSNP:143464338
772 772 a, g dbSNP:200719486
773 773 a, g dbSNP:761413467
795 795 a, g dbSNP:776167736
805 805 a, g dbSNP:768151902
808 808 a, g dbSNP:746502857
817 817 c, t dbSNP:567666541
819 819 c, g dbSNP:774921882
826 826 c, t dbSNP:374360876
835 835 a, g dbSNP:749651371
839 839 a, g dbSNP:778325069
846 846 a, c dbSNP:756579701
856 856 c, g, t dbSNP:781285704
863 863 a, c dbSNP:755018932
880 880 a, g dbSNP:751648653
883 883 a, g dbSNP:766317905
887 887 c, g dbSNP:758370933
889 889 a, c dbSNP:750388967
903 903 a, c dbSNP:764960739
904 904 c, t dbSNP:761606348
905 905 c, g dbSNP:776277339
913 913 c, g dbSNP:763716595
914 914 c, t dbSNP:760223092
916 916 a, c dbSNP:774916125
919 919 c, t dbSNP:61750361
920 920 c, g dbSNP:749775902
923 923 a, g dbSNP:529612732
931 931 a, c dbSNP:770228060
940 940 c, t dbSNP:560949046
954 954 c, g dbSNP:7432551
961 961 c, t dbSNP:572394953
978 978 a, g dbSNP:121908359
982 982 a, c dbSNP:768808919
984 984 c, t dbSNP:747079191
1004 1004 c, t dbSNP:104893739
1027 1027 a, g dbSNP:779956639
1032 1032 c, g dbSNP:758494065
1052 1052 c, g dbSNP:750300712
1065 1065 c, t dbSNP:565208053
1072 1072 c, t dbSNP:545210276
1073 1073 c, t dbSNP:104893741
1090 1090 -, agcggctgcagcagctgcggctgcagccgc dbSNP:752956127
1090 1090 -, agc dbSNP:779509486
1093 1093 -, ggctgcagc dbSNP:757864848
1102 1102 (agctgcggctgcagc(3)) dbSNP:387906322
1103 1103 a, g dbSNP:757038357
1113 1113 c, t dbSNP:753630377
1119 1119 -, agcggctgcagcagctgcggctgcagccgc dbSNP:387906321
1123 1123 c, t dbSNP:763784340
1131 1131 a, g dbSNP:760287518
1132 1132 c, t dbSNP:752428575
1136 1136 a, g dbSNP:767088367
1138 1138 a, c dbSNP:759132275
1145 1145 a, g dbSNP:773788619
1164 1164 c, g dbSNP:770489949
1165 1165 a, g dbSNP:762215312
1171 1171 g, t dbSNP:776899007
1174 1174 c, t dbSNP:769094486
1180 1180 a, g dbSNP:374564346
1184 1184 c, g dbSNP:780266238
1188 1188 c, t dbSNP:113777439
1190 1190 a, t dbSNP:28937885
1195 1195 a, t dbSNP:746011336
1208 1208 a, g dbSNP:778804135
1209 1209 c, t dbSNP:757195166
1217 1217 c, t dbSNP:753641620
1222 1222 c, t dbSNP:777394919
1226 1226 a, g dbSNP:755962207
1234 1234 c, t dbSNP:752235830
1239 1239 a, g dbSNP:767284567
1240 1240 c, g dbSNP:104893738
1248 1248 c, t dbSNP:759113804
1249 1249 a, g dbSNP:751172837
1257 1257 a, c dbSNP:765807161
1260 1260 c, t dbSNP:762185841
1267 1267 a, c dbSNP:777214841
1276 1276 g, t dbSNP:370950963
1277 1277 -, ggccgcacccccgcctc dbSNP:672601359
1279 1279 a, g dbSNP:761101971
1285 1285 c, g dbSNP:775682252
1294 1294 g, t dbSNP:772334138
1384 1384 a, c dbSNP:745922482
1392 1392 c, g dbSNP:774457946
1400 1400 a, g dbSNP:771076307
1401 1401 -, tcagccctgccagcccagc dbSNP:672601358
1411 1411 c, g dbSNP:749134732
1412 1412 c, g dbSNP:777781753
1414 1414 c, g dbSNP:755800719
1416 1416 c, t dbSNP:748024139
1418 1418 c, g dbSNP:138198451
1426 1426 g, t dbSNP:754717039
1432 1432 c, g, t dbSNP:375761943
1434 1434 g, t dbSNP:765755255
1437 1437 a, c dbSNP:757937453
1443 1443 a, g dbSNP:372479512
1445 1445 c, g dbSNP:764726083
1447 1447 g, t dbSNP:140230355
1454 1454 g, t dbSNP:775878472
1455 1455 c, g dbSNP:767699025
1461 1461 c, t dbSNP:759719444
1462 1462 c, t dbSNP:774580207
1463 1463 c, g dbSNP:201840174
1471 1471 c, t dbSNP:183837821
1489 1489 c, t dbSNP:146709691
1498 1498 c, t dbSNP:377175851
1505 1505 c, t dbSNP:747934526
1517 1517 a, g dbSNP:781092852
1519 1519 a, c, g dbSNP:143272886
1521 1521 a, g dbSNP:779760007
1524 1524 a, c dbSNP:201314625
1525 1525 -, gc dbSNP:36043610
1529 1529 -, c dbSNP:35625854
1530 1530 a, c dbSNP:757838701
1536 1536 c, g dbSNP:750005331
1540 1540 a, c, g dbSNP:367789389
1541 1541 a, g dbSNP:756650462
1551 1551 a, g dbSNP:753238372
1561 1561 a, t dbSNP:199498438
1563 1563 a, g dbSNP:759909934
1564 1564 c, g, t dbSNP:766692254
1565 1565 c, g dbSNP:762929517
1567 1567 g, t dbSNP:773390956
1571 1571 a, g dbSNP:769794895
1575 1575 g, t dbSNP:761793502
1577 1577 a, g dbSNP:776721117
1583 1583 -, gga dbSNP:772904769
1585 1585 a, t dbSNP:768497108
1600 1600 a, g dbSNP:369818928
1610 1610 c, t dbSNP:551689992
1626 1626 c, t dbSNP:538054141
1634 1634 c, g dbSNP:569438765
1671 1671 g, t dbSNP:549571680
1725 1725 c, t dbSNP:529812777
1770 1770 c, t dbSNP:567245375
1779 1779 c, g dbSNP:547396660
1794 1794 a, g dbSNP:114204440
1831 1831 c, t dbSNP:185607481
1847 1847 c, t dbSNP:763760223
1853 1853 a, g dbSNP:762514887
1855 1855 c, t dbSNP:374179510
1863 1863 c, g dbSNP:775294487
1888 1888 g, t dbSNP:545366458
1889 1889 g, t dbSNP:531357118
1890 1890 a, c dbSNP:562710463
1910 1910 c, g dbSNP:778058896
1953 1953 c, g dbSNP:542718212
1957 1957 a, c dbSNP:372084005
1980 1980 c, g dbSNP:574101318
2002 2002 a, g dbSNP:571486112
2015 2015 c, g dbSNP:769532247
2021 2021 a, g dbSNP:181248112
2032 2032 g, t dbSNP:540216839
2066 2066 c, t dbSNP:188432473
2074 2074 a, t dbSNP:577655196
2126 2126 c, g dbSNP:557984777
2140 2140 c, t dbSNP:115665190
2153 2153 a, g dbSNP:367850391
2163 2163 c, t dbSNP:185086382
2168 2168 a, c dbSNP:180829214
2181 2181 a, g dbSNP:531903461
2215 2215 a, g dbSNP:563149210
2300 2300 g, t dbSNP:535700712
2309 2309 c, g dbSNP:190825750
2316 2316 -, aa dbSNP:35050049
2328 2328 a, g dbSNP:79322565
2329 2329 -, a, aa dbSNP:555195919
2339 2339 -, a dbSNP:201782101
2412 2412 a, g dbSNP:547557411
2420 2420 c, t dbSNP:72976936
2431 2431 c, t dbSNP:571264165
2456 2456 c, g dbSNP:551343367
2474 2474 -, t dbSNP:139209636
2484 2484 a, g dbSNP:531647312
2527 2527 -, t dbSNP:761518975
2538 2538 a, c dbSNP:529657655
2544 2544 c, g dbSNP:148908196
2548 2548 a, c dbSNP:778894197
2551 2551 a, t dbSNP:375253939
2599 2599 a, g dbSNP:542785115
2612 2612 a, g dbSNP:529086394
2652 2652 c, t dbSNP:560987302
2749 2749 a, g dbSNP:560202998
2753 2753 a, g dbSNP:185469812
2804 2804 c, t dbSNP:2291251
2852 2852 a, t dbSNP:76490864
2869 2869 -, g dbSNP:535856383
2896 2896 a, c dbSNP:544551456

Target ORF information:

RefSeq Version NM_023067
Organism Homo sapiens (human)
Definition Homo sapiens forkhead box L2 (FOXL2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


FOXL2-induced follistatin attenuates activin A-stimulated cell proliferation in human granulosa cell tumors
Biochem. Biophys. Res. Commun. 443 (2), 537-542 (2014)
Cheng JC, Chang HM, Qiu X, Fang L and Leung PC.


Impact of a second opinion using expression and molecular analysis of FOXL2 for sex cord-stromal tumors. A study of the GINECO group & the TMRO network
Gynecol. Oncol. 132 (1), 181-187 (2014)
Maillet D, Goulvent T, Rimokh R, Vacher-Lavenu MC, Pautier P, Alexandre J, Pujade-Laurraine E, Devouassoux-Shisheboran M, Treilleux I, Ray-Coquard I and Savina A.


Identification of the forkhead transcriptional factor 2 (FOXL2) gene mutations in four Chinese families with blepharophimosis syndrome
Mol. Vis. 19, 2298-2305 (2013)
Zhang L, Wang L, Han R, Guan L, Fan B, Liu M, Ying M, Peng H and Li N.


Adult granulosa cell tumours (GCT): clinicopathological outcomes including FOXL2 mutational status and expression
Gynecol. Oncol. 131 (2), 325-329 (2013)
Rosario R, Wilson M, Cheng WT, Payne K, Cohen PA, Fong P and Shelling AN.


Luteinized thecomas (thecomatosis) associated with sclerosing peritonitis exhibit positive staining with sex cord markers steroidogenic factor-1 (SF-1) and FOXL2
Am. J. Surg. Pathol. 37 (9), 1458-1459 (2013)
McCluggage WG, Staats PN, Gilks CB, Clement PB and Young RH.


The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome
Nat. Genet. 27 (2), 159-166 (2001)
Crisponi L, Deiana M, Loi A, Chiappe F, Uda M, Amati P, Bisceglia L, Zelante L, Nagaraja R, Porcu S, Ristaldi MS, Marzella R, Rocchi M, Nicolino M, Lienhardt-Roussie A, Nivelon A, Verloes A, Schlessinger D, Gasparini P, Bonneau D, Cao A and Pilia G.


Unified nomenclature for the winged helix/forkhead transcription factors
Genes Dev. 14 (2), 142-146 (2000)
Kaestner KH, Knochel W and Martinez DE.


High-resolution human/goat comparative map of the goat polled/intersex syndrome (PIS): the human homologue is contained in a human YAC from HSA3q23
Genomics 56 (1), 31-39 (1999)
Vaiman D, Schibler L, Oustry-Vaiman A, Pailhoux E, Goldammer T, Stevanovic M, Furet JP, Schwerin M, Cotinot C, Fellous M and Cribiu EP.


Blepharophimosis, Ptosis, and Epicanthus Inversus
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
De Baere,E.


Further evidence for the location of the BPES gene at 3q2
J. Med. Genet. 28 (10), 725 (1991)
de Die-Smulders,C.E., Engelen,J.J., Donk,J.M. and Fryns,J.P.
