Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


BRCA1 breast cancer 1, early onset [Homo sapiens (human)]

Gene Symbol BRCA1
Entrez Gene ID 672
Full Name breast cancer 1, early onset
Synonyms BRCAI, BRCC1, BROVCA1, FANCS, IRIS, PNCA4, PPP1R53, PSCP, RNF53
General protein information
Preferred Names
breast cancer type 1 susceptibility protein
Names
breast cancer type 1 susceptibility protein
RING finger protein 53
BRCA1/BRCA2-containing complex, subunit 1
protein phosphatase 1, regulatory subunit 53
breast and ovarian cancer susceptibility protein 1
breast and ovarian cancer sususceptibility protein 1
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

17

17q21

Summary This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]. lac of sum
Disorder MIM:

113705

Disorder Html: {Breast-ovarian cancer, familial, 1}, 604370 (3); {Pancreatic cancer,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu16595 NM_007297 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK In stock 22 Starting from $99.00
OHu16598 NM_007299 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu18572 NM_007294 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 22 Starting from $99.00
OHu23229 NM_007300 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu16419 NM_007298 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu16595D
Sequence Information ORF Nucleotide Sequence (Length: 5451bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-AUG-2015
Organism Homo sapiens (human)
Product breast cancer type 1 susceptibility protein isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC072418.1, U14680.1, BU617173.1 and BU679389.1. On May 16, 2009 this sequence version replaced gi:63252874. Summary: This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]. Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream translational start codon, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
4501
4561
4621
4681
4741
4801
4861
4921
4981
5041
5101
5161
5221
5281
5341
5401
ATGCTGAAAC TTCTCAACCA GAAGAAAGGG CCTTCACAGT GTCCTTTATG TAAGAATGAT 
ATAACCAAAA GGAGCCTACA AGAAAGTACG AGATTTAGTC AACTTGTTGA AGAGCTATTG
AAAATCATTT GTGCTTTTCA GCTTGACACA GGTTTGGAGT ATGCAAACAG CTATAATTTT
GCAAAAAAGG AAAATAACTC TCCTGAACAT CTAAAAGATG AAGTTTCTAT CATCCAAAGT
ATGGGCTACA GAAACCGTGC CAAAAGACTT CTACAGAGTG AACCCGAAAA TCCTTCCTTG
CAGGAAACCA GTCTCAGTGT CCAACTCTCT AACCTTGGAA CTGTGAGAAC TCTGAGGACA
AAGCAGCGGA TACAACCTCA AAAGACGTCT GTCTACATTG AATTGGGATC TGATTCTTCT
GAAGATACCG TTAATAAGGC AACTTATTGC AGTGTGGGAG ATCAAGAATT GTTACAAATC
ACCCCTCAAG GAACCAGGGA TGAAATCAGT TTGGATTCTG CAAAAAAGGC TGCTTGTGAA
TTTTCTGAGA CGGATGTAAC AAATACTGAA CATCATCAAC CCAGTAATAA TGATTTGAAC
ACCACTGAGA AGCGTGCAGC TGAGAGGCAT CCAGAAAAGT ATCAGGGTAG TTCTGTTTCA
AACTTGCATG TGGAGCCATG TGGCACAAAT ACTCATGCCA GCTCATTACA GCATGAGAAC
AGCAGTTTAT TACTCACTAA AGACAGAATG AATGTAGAAA AGGCTGAATT CTGTAATAAA
AGCAAACAGC CTGGCTTAGC AAGGAGCCAA CATAACAGAT GGGCTGGAAG TAAGGAAACA
TGTAATGATA GGCGGACTCC CAGCACAGAA AAAAAGGTAG ATCTGAATGC TGATCCCCTG
TGTGAGAGAA AAGAATGGAA TAAGCAGAAA CTGCCATGCT CAGAGAATCC TAGAGATACT
GAAGATGTTC CTTGGATAAC ACTAAATAGC AGCATTCAGA AAGTTAATGA GTGGTTTTCC
AGAAGTGATG AACTGTTAGG TTCTGATGAC TCACATGATG GGGAGTCTGA ATCAAATGCC
AAAGTAGCTG ATGTATTGGA CGTTCTAAAT GAGGTAGATG AATATTCTGG TTCTTCAGAG
AAAATAGACT TACTGGCCAG TGATCCTCAT GAGGCTTTAA TATGTAAAAG TGAAAGAGTT
CACTCCAAAT CAGTAGAGAG TAATATTGAA GACAAAATAT TTGGGAAAAC CTATCGGAAG
AAGGCAAGCC TCCCCAACTT AAGCCATGTA ACTGAAAATC TAATTATAGG AGCATTTGTT
ACTGAGCCAC AGATAATACA AGAGCGTCCC CTCACAAATA AATTAAAGCG TAAAAGGAGA
CCTACATCAG GCCTTCATCC TGAGGATTTT ATCAAGAAAG CAGATTTGGC AGTTCAAAAG
ACTCCTGAAA TGATAAATCA GGGAACTAAC CAAACGGAGC AGAATGGTCA AGTGATGAAT
ATTACTAATA GTGGTCATGA GAATAAAACA AAAGGTGATT CTATTCAGAA TGAGAAAAAT
CCTAACCCAA TAGAATCACT CGAAAAAGAA TCTGCTTTCA AAACGAAAGC TGAACCTATA
AGCAGCAGTA TAAGCAATAT GGAACTCGAA TTAAATATCC ACAATTCAAA AGCACCTAAA
AAGAATAGGC TGAGGAGGAA GTCTTCTACC AGGCATATTC ATGCGCTTGA ACTAGTAGTC
AGTAGAAATC TAAGCCCACC TAATTGTACT GAATTGCAAA TTGATAGTTG TTCTAGCAGT
GAAGAGATAA AGAAAAAAAA GTACAACCAA ATGCCAGTCA GGCACAGCAG AAACCTACAA
CTCATGGAAG GTAAAGAACC TGCAACTGGA GCCAAGAAGA GTAACAAGCC AAATGAACAG
ACAAGTAAAA GACATGACAG CGATACTTTC CCAGAGCTGA AGTTAACAAA TGCACCTGGT
TCTTTTACTA AGTGTTCAAA TACCAGTGAA CTTAAAGAAT TTGTCAATCC TAGCCTTCCA
AGAGAAGAAA AAGAAGAGAA ACTAGAAACA GTTAAAGTGT CTAATAATGC TGAAGACCCC
AAAGATCTCA TGTTAAGTGG AGAAAGGGTT TTGCAAACTG AAAGATCTGT AGAGAGTAGC
AGTATTTCAT TGGTACCTGG TACTGATTAT GGCACTCAGG AAAGTATCTC GTTACTGGAA
GTTAGCACTC TAGGGAAGGC AAAAACAGAA CCAAATAAAT GTGTGAGTCA GTGTGCAGCA
TTTGAAAACC CCAAGGGACT AATTCATGGT TGTTCCAAAG ATAATAGAAA TGACACAGAA
GGCTTTAAGT ATCCATTGGG ACATGAAGTT AACCACAGTC GGGAAACAAG CATAGAAATG
GAAGAAAGTG AACTTGATGC TCAGTATTTG CAGAATACAT TCAAGGTTTC AAAGCGCCAG
TCATTTGCTC CGTTTTCAAA TCCAGGAAAT GCAGAAGAGG AATGTGCAAC ATTCTCTGCC
CACTCTGGGT CCTTAAAGAA ACAAAGTCCA AAAGTCACTT TTGAATGTGA ACAAAAGGAA
GAAAATCAAG GAAAGAATGA GTCTAATATC AAGCCTGTAC AGACAGTTAA TATCACTGCA
GGCTTTCCTG TGGTTGGTCA GAAAGATAAG CCAGTTGATA ATGCCAAATG TAGTATCAAA
GGAGGCTCTA GGTTTTGTCT ATCATCTCAG TTCAGAGGCA ACGAAACTGG ACTCATTACT
CCAAATAAAC ATGGACTTTT ACAAAACCCA TATCGTATAC CACCACTTTT TCCCATCAAG
TCATTTGTTA AAACTAAATG TAAGAAAAAT CTGCTAGAGG AAAACTTTGA GGAACATTCA
ATGTCACCTG AAAGAGAAAT GGGAAATGAG AACATTCCAA GTACAGTGAG CACAATTAGC
CGTAATAACA TTAGAGAAAA TGTTTTTAAA GAAGCCAGCT CAAGCAATAT TAATGAAGTA
GGTTCCAGTA CTAATGAAGT GGGCTCCAGT ATTAATGAAA TAGGTTCCAG TGATGAAAAC
ATTCAAGCAG AACTAGGTAG AAACAGAGGG CCAAAATTGA ATGCTATGCT TAGATTAGGG
GTTTTGCAAC CTGAGGTCTA TAAACAAAGT CTTCCTGGAA GTAATTGTAA GCATCCTGAA
ATAAAAAAGC AAGAATATGA AGAAGTAGTT CAGACTGTTA ATACAGATTT CTCTCCATAT
CTGATTTCAG ATAACTTAGA ACAGCCTATG GGAAGTAGTC ATGCATCTCA GGTTTGTTCT
GAGACACCTG ATGACCTGTT AGATGATGGT GAAATAAAGG AAGATACTAG TTTTGCTGAA
AATGACATTA AGGAAAGTTC TGCTGTTTTT AGCAAAAGCG TCCAGAAAGG AGAGCTTAGC
AGGAGTCCTA GCCCTTTCAC CCATACACAT TTGGCTCAGG GTTACCGAAG AGGGGCCAAG
AAATTAGAGT CCTCAGAAGA GAACTTATCT AGTGAGGATG AAGAGCTTCC CTGCTTCCAA
CACTTGTTAT TTGGTAAAGT AAACAATATA CCTTCTCAGT CTACTAGGCA TAGCACCGTT
GCTACCGAGT GTCTGTCTAA GAACACAGAG GAGAATTTAT TATCATTGAA GAATAGCTTA
AATGACTGCA GTAACCAGGT AATATTGGCA AAGGCATCTC AGGAACATCA CCTTAGTGAG
GAAACAAAAT GTTCTGCTAG CTTGTTTTCT TCACAGTGCA GTGAATTGGA AGACTTGACT
GCAAATACAA ACACCCAGGA TCCTTTCTTG ATTGGTTCTT CCAAACAAAT GAGGCATCAG
TCTGAAAGCC AGGGAGTTGG TCTGAGTGAC AAGGAATTGG TTTCAGATGA TGAAGAAAGA
GGAACGGGCT TGGAAGAAAA TAATCAAGAA GAGCAAAGCA TGGATTCAAA CTTAGGTGAA
GCAGCATCTG GGTGTGAGAG TGAAACAAGC GTCTCTGAAG ACTGCTCAGG GCTATCCTCT
CAGAGTGACA TTTTAACCAC TCAGCAGAGG GATACCATGC AACATAACCT GATAAAGCTC
CAGCAGGAAA TGGCTGAACT AGAAGCTGTG TTAGAACAGC ATGGGAGCCA GCCTTCTAAC
AGCTACCCTT CCATCATAAG TGACTCTTCT GCCCTTGAGG ACCTGCGAAA TCCAGAACAA
AGCACATCAG AAAAAGCAGT ATTAACTTCA CAGAAAAGTA GTGAATACCC TATAAGCCAG
AATCCAGAAG GCCTTTCTGC TGACAAGTTT GAGGTGTCTG CAGATAGTTC TACCAGTAAA
AATAAAGAAC CAGGAGTGGA AAGGTCATCC CCTTCTAAAT GCCCATCATT AGATGATAGG
TGGTACATGC ACAGTTGCTC TGGGAGTCTT CAGAATAGAA ACTACCCATC TCAAGAGGAG
CTCATTAAGG TTGTTGATGT GGAGGAGCAA CAGCTGGAAG AGTCTGGGCC ACACGATTTG
ACGGAAACAT CTTACTTGCC AAGGCAAGAT CTAGAGGGAA CCCCTTACCT GGAATCTGGA
ATCAGCCTCT TCTCTGATGA CCCTGAATCT GATCCTTCTG AAGACAGAGC CCCAGAGTCA
GCTCGTGTTG GCAACATACC ATCTTCAACC TCTGCATTGA AAGTTCCCCA ATTGAAAGTT
GCAGAATCTG CCCAGAGTCC AGCTGCTGCT CATACTACTG ATACTGCTGG GTATAATGCA
ATGGAAGAAA GTGTGAGCAG GGAGAAGCCA GAATTGACAG CTTCAACAGA AAGGGTCAAC
AAAAGAATGT CCATGGTGGT GTCTGGCCTG ACCCCAGAAG AATTTATGCT CGTGTACAAG
TTTGCCAGAA AACACCACAT CACTTTAACT AATCTAATTA CTGAAGAGAC TACTCATGTT
GTTATGAAAA CAGATGCTGA GTTTGTGTGT GAACGGACAC TGAAATATTT TCTAGGAATT
GCGGGAGGAA AATGGGTAGT TAGCTATTTC TGGGTGACCC AGTCTATTAA AGAAAGAAAA
ATGCTGAATG AGCATGATTT TGAAGTCAGA GGAGATGTGG TCAATGGAAG AAACCACCAA
GGTCCAAAGC GAGCAAGAGA ATCCCAGGAC AGAAAGATCT TCAGGGGGCT AGAAATCTGT
TGCTATGGGC CCTTCACCAA CATGCCCACA GATCAACTGG AATGGATGGT ACAGCTGTGT
GGTGCTTCTG TGGTGAAGGA GCTTTCATCA TTCACCCTTG GCACAGGTGT CCACCCAATT
GTGGTTGTGC AGCCAGATGC CTGGACAGAG GACAATGGCT TCCATGCAAT TGGGCAGATG
TGTGAGGCAC CTGTGGTGAC CCGAGAGTGG GTGTTGGACA GTGTAGCACT CTACCAGTGC
CAGGAGCTGG ACACCTACCT GATACCCCAG ATCCCCCACA GCCACTACTTG A
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_009228.2
CDS282..5732
Misc Feature(1)61..61(+)
Misc Feature(2)273..275(+)
Misc Feature(3)1170..1661(+)
Misc Feature(4)2082..3074(+)
Misc Feature(5)5088..5312(+)
Misc Feature(6)5139..5165(+)
Misc Feature(7)5292..5306(+)
Misc Feature(8)5427..5666(+)
Misc Feature(9)5472..5510(+)
Misc Feature(10)5649..5663(+)
Exon (1)1..175
Gene:BRCA1
Gene Synonym:
Exon (2)176..274
Gene:BRCA1
Gene Synonym:
Exon (3)275..352
Gene:BRCA1
Gene Synonym:
Exon (4)353..441
Gene:BRCA1
Gene Synonym:
Exon (5)442..581
Gene:BRCA1
Gene Synonym:
Exon (6)582..687
Gene:BRCA1
Gene Synonym:
Exon (7)688..733
Gene:BRCA1
Gene Synonym:
Exon (8)734..810
Gene:BRCA1
Gene Synonym:
Exon (9)811..4236
Gene:BRCA1
Gene Synonym:
Exon (10)4237..4325
Gene:BRCA1
Gene Synonym:
Exon (11)4326..4497
Gene:BRCA1
Gene Synonym:
Exon (12)4498..4624
Gene:BRCA1
Gene Synonym:
Exon (13)4625..4815
Gene:BRCA1
Gene Synonym:
Exon (14)4816..5126
Gene:BRCA1
Gene Synonym:
Exon (15)5127..5214
Gene:BRCA1
Gene Synonym:
Exon (16)5215..5292
Gene:BRCA1
Gene Synonym:
Exon (17)5293..5333
Gene:BRCA1
Gene Synonym:
Exon (18)5334..5417
Gene:BRCA1
Gene Synonym:
Exon (19)5418..5472
Gene:BRCA1
Gene Synonym:
Exon (20)5473..5546
Gene:BRCA1
Gene Synonym:
Exon (21)5547..5607
Gene:BRCA1
Gene Synonym:
Exon (22)5608..7115
Gene:BRCA1
Gene Synonym:
Translation
Position Chain Variation Link
3 3 c, t dbSNP:569113962
9 9 c, t dbSNP:113323025
55 55 -, t dbSNP:8176075
57 57 a, g dbSNP:759523510
66 66 -, a dbSNP:35436937
76 76 c, t dbSNP:148196794
78 78 g, t dbSNP:190861568
85 85 c, t dbSNP:548750620
90 90 c, t dbSNP:759750310
95 95 c, t dbSNP:527449526
97 97 -, t dbSNP:34191881
100 100 c, t dbSNP:776813709
104 104 c, t dbSNP:766347954
105 105 g, t dbSNP:187992882
108 108 a, g dbSNP:544857747
115 115 c, t dbSNP:143160357
126 126 c, g dbSNP:529629382
139 139 a, g dbSNP:776540382
140 140 c, t dbSNP:549332987
159 159 c, t dbSNP:544342552
172 172 c, g dbSNP:774839252
179 179 a, g dbSNP:777262055
181 181 c, t dbSNP:273897661
182 182 a, g dbSNP:431825383
183 183 c, g dbSNP:772037778
184 184 a, c dbSNP:273897654
185 185 a, c dbSNP:748057929
192 192 c, g dbSNP:273900720
193 193 a, t dbSNP:273899693
194 194 a, c dbSNP:587781565
195 195 a, g dbSNP:80357287
196 196 c, g, t dbSNP:80357111
197 197 g, t dbSNP:80357475
198 198 a, g dbSNP:778775133
200 200 c, t dbSNP:754763517
202 202 c, g, t dbSNP:397509332
203 203 a, g dbSNP:780157871
205 205 c, t dbSNP:786203152
212 212 -, g dbSNP:398122648
213 213 -, cgcgttgaagaagtacaaaatgtcattaa dbSNP:80359871
213 213 a, c, t dbSNP:80356994
214 214 -, gcgttgaag dbSNP:80359887
214 214 a, g dbSNP:144792613
215 215 c, t dbSNP:149402012
216 216 a, g dbSNP:528902306
226 226 -, c dbSNP:80357811
226 226 c, t dbSNP:80357017
228 228 c, t dbSNP:80357134
230 230 a, g dbSNP:763230080
231 231 -, aatg dbSNP:80357530
236 236 a, c, t dbSNP:80356827
237 237 a, c dbSNP:80357031
238 238 c, t dbSNP:80357316
239 239 -, t dbSNP:730881457
247 247 a, c, t dbSNP:80356929
249 249 c, t dbSNP:397509299
254 254 a, c, g dbSNP:202168814
255 255 -, a dbSNP:273902778
255 255 a, g dbSNP:80357406
256 256 -, t dbSNP:397509303
258 258 -, tt dbSNP:397509304
258 258 -, t dbSNP:80357803
259 259 -, tt dbSNP:80357642
259 259 c, t dbSNP:80357438
260 260 -, a, ag, c dbSNP:80357783
260 260 -, ag dbSNP:80357713
260 260 a, c dbSNP:786202533
261 261 c, g dbSNP:372047427
262 262 -, a dbSNP:397509309
262 262 -, ag dbSNP:386833395
263 263 -, gtgtcccatct dbSNP:80357696
263 263 -, ag dbSNP:80357914
263 263 a, g dbSNP:766004110
264 264 -, tgtcccatctg dbSNP:80359877
264 264 -, a, tgtc dbSNP:80357536
264 264 c, t dbSNP:80357410
265 265 a, g dbSNP:80357198
266 266 -, tc dbSNP:397509311
267 267 -, cc dbSNP:80357633
267 267 -, tgtc dbSNP:397509310
267 267 a, c dbSNP:397509313
269 269 c, t dbSNP:80356839
272 272 -, catctg dbSNP:273902787
275 275 a, t dbSNP:80356883
279 279 -, t dbSNP:80357734
279 279 g, t dbSNP:80357370
280 280 a, g, t dbSNP:80357150
281 281 a, c, t dbSNP:398122635
283 283 -, t dbSNP:80357637
284 284 a, g dbSNP:587783040
284 284 -, g dbSNP:80357682
286 286 g, t dbSNP:273897660
288 288 a, g dbSNP:747212786
290 290 -, a dbSNP:273897662
294 294 a, c, t dbSNP:80357084
300 300 a, c, t dbSNP:80356864
300 300 -, c dbSNP:397508890
301 301 a, g dbSNP:397507189
302 302 c, g dbSNP:772226744
306 306 -, ga dbSNP:80357550
307 307 a, g dbSNP:397508897
308 308 a, t dbSNP:397508898
311 311 -, g dbSNP:80357660
312 312 a, c, g dbSNP:397508904
316 316 c, t dbSNP:199522616
318 318 -, ca dbSNP:397508907
318 318 c, t dbSNP:80357471
319 319 -, a dbSNP:80357591
319 319 a, g dbSNP:373655067
322 322 -, gt dbSNP:397508912
322 322 a, g dbSNP:80357093
325 325 c, g dbSNP:786202286
328 328 a, c, t dbSNP:80357086
329 329 -, a dbSNP:273897665
329 329 a, t dbSNP:80356956
330 330 -, tgta dbSNP:397508917
330 330 c, g, t dbSNP:80357064
331 331 a, g dbSNP:55851803
332 332 a, t dbSNP:587781632
333 333 a, g dbSNP:756948486
335 335 -, g dbSNP:80357869
339 339 a, g, t dbSNP:80357102
341 341 g, t dbSNP:80357033
343 343 -, a dbSNP:273898673
343 343 -, ta dbSNP:398122651
343 343 a, g, t dbSNP:80357116
344 344 -, a dbSNP:606231392
346 346 a, c dbSNP:273898675
351 351 -, a dbSNP:397508938
351 351 a, g dbSNP:80357382
352 352 a, g, t dbSNP:80356913
356 356 a, c, g dbSNP:80356967
357 357 c, t dbSNP:786201203
360 360 c, t dbSNP:80357234
362 362 a, c dbSNP:730881465
364 364 -, aaag dbSNP:80357697
370 370 c, g, t dbSNP:80357209
370 370 c, gtcaacttgtt dbSNP:397508957
371 371 a, c, g, t dbSNP:80356847
372 372 -, a dbSNP:80357884
378 378 ag, nnnnnnnnnnnnnnnnnnnnnn dbSNP:587782749
381 381 -, caacttgttga dbSNP:398122659
381 381 c, t dbSNP:80357350
383 383 -, a dbSNP:273899684
389 389 c, t dbSNP:780485347
390 390 g, t dbSNP:398122661
395 395 a, g, t dbSNP:756499058
398 398 a, g, t dbSNP:777491912
399 399 g, t dbSNP:80357091
401 401 a, g dbSNP:757971617
406 406 c, t dbSNP:80357097
407 407 c, g dbSNP:80356963
409 409 -, tttgtgcttttca dbSNP:80359879
409 409 c, t dbSNP:80357174
411 411 c, t dbSNP:786203939
413 413 -, tg dbSNP:587776485
413 413 g, t dbSNP:397509006
426 426 a, g dbSNP:80357110
428 428 cacag, nnnnnnn dbSNP:483353091
428 428 c, t dbSNP:146085503
430 430 -, ca dbSNP:80357738
430 430 c, g, t dbSNP:431825393
432 432 c, g, t dbSNP:80357409
442 442 a, g dbSNP:587781798
443 443 c, g, t dbSNP:80356936
445 445 c, g dbSNP:80357190
450 450 a, c dbSNP:753342801
452 452 c, g dbSNP:766484283
454 454 a, g dbSNP:28897673
456 456 a, c dbSNP:786202937
457 457 -, a dbSNP:80357950
458 458 -, ttttgc dbSNP:751091558
461 461 -, t dbSNP:80357544
464 464 a, t dbSNP:763381062
466 466 a, g dbSNP:750275408
469 469 -, a dbSNP:80357604
469 469 -, ag dbSNP:80357754
469 469 -, a dbSNP:397507214
469 469 a, c dbSNP:397509053
472 472 a, c dbSNP:80357312
474 474 a, g dbSNP:587782017
475 475 -, ataa dbSNP:587782666
478 478 a, g dbSNP:587780800
479 479 c, g, t dbSNP:587779367
480 480 c, t dbSNP:397509062
481 481 c, g dbSNP:786202620
482 482 -, tc dbSNP:80357881
486 486 a, g dbSNP:397509071
486 486 -, g dbSNP:762635795
498 498 a, g dbSNP:587782882
499 499 a, g dbSNP:587781491
506 506 g, t dbSNP:190900046
508 508 -, c dbSNP:431825397
509 509 a, t dbSNP:774583925
510 510 a, g dbSNP:80357448
512 512 a, c dbSNP:273900715
513 513 a, g dbSNP:587776489
515 515 -, t dbSNP:397509101
518 518 a, g dbSNP:786201256
520 520 a, g, t dbSNP:80357189
526 526 g, t dbSNP:764231119
529 529 a, g, t dbSNP:56055578
530 530 a, c, t dbSNP:80356888
531 531 a, t dbSNP:80357207
536 536 a, c dbSNP:80357413
537 537 a, c, t dbSNP:80357457
538 538 -, gt dbSNP:80357568
538 538 a, g dbSNP:80357357
539 539 -, tg dbSNP:397509126
546 546 -, a dbSNP:80357709
550 550 c, t dbSNP:751078452
552 552 -, ctacaga dbSNP:80357816
552 552 c, g dbSNP:587782724
553 553 c, t dbSNP:200449040
555 555 c, t dbSNP:80357372
556 556 -, a dbSNP:786203432
556 556 a, g dbSNP:786202213
560 560 c, g, t dbSNP:730881448
563 563 a, t dbSNP:777102216
564 564 c, g dbSNP:397509156
565 565 a, c dbSNP:55971303
566 566 c, t dbSNP:542687218
567 567 a, g, t dbSNP:80356991
569 569 a, c dbSNP:397507228
571 571 -, a dbSNP:397509162
577 577 -, cctt dbSNP:397509168
581 581 c, g dbSNP:748876625
582 582 -, cag dbSNP:397509175
586 586 a, c dbSNP:397507233
594 594 c, t dbSNP:41286288
595 595 c, t dbSNP:80357275
596 596 -, ca dbSNP:80357882
597 597 -, ag dbSNP:397509185
597 597 a, c, g dbSNP:28897674
603 603 c, g, t dbSNP:80357180
604 604 -, a dbSNP:483353104
606 606 -, c dbSNP:397507236
606 606 c, g dbSNP:587778115
608 608 c, g dbSNP:748923729
609 609 c, t dbSNP:80356897
610 610 -, ctaacctt dbSNP:397509190
610 610 -, ct dbSNP:80357887
610 610 -, c dbSNP:483353105
610 610 c, g dbSNP:80357045
612 612 a, t dbSNP:397509192
617 617 c, t dbSNP:779704727
618 618 a, g dbSNP:62625285
624 624 c, g dbSNP:55816927
625 625 -, t dbSNP:587781427
625 625 -, tg dbSNP:80357708
626 626 a, g dbSNP:769213707
628 628 -, g dbSNP:397509202
630 630 a, c dbSNP:80357384
633 633 -, ct dbSNP:397509206
633 633 -, c dbSNP:80357551
634 634 -, t dbSNP:80357762
635 635 a, g dbSNP:745321499
643 643 a, c dbSNP:273901743
645 645 c, t dbSNP:80357133
646 646 a, c dbSNP:587780803
647 647 a, g dbSNP:759882045
648 648 c, t dbSNP:80357325
649 649 a, g dbSNP:80357264
651 651 a, c dbSNP:777515082
652 652 -, t dbSNP:587781487
654 654 -, c dbSNP:80357872
654 654 c, t dbSNP:80356947
656 656 a, g dbSNP:752940034
660 660 -, c dbSNP:80357639
662 662 a, g dbSNP:765432756
667 667 c, g dbSNP:587782747
668 668 a, g dbSNP:34545365
669 669 -, t dbSNP:80357758
670 670 c, g dbSNP:753940026
675 675 c, t dbSNP:587781761
676 676 -, a dbSNP:397509273
676 676 a, g dbSNP:56187033
683 683 a, g dbSNP:397507250
688 688 -, g dbSNP:397509289
696 696 g, t dbSNP:397509298
697 697 a, c, t dbSNP:55688530
704 704 a, g dbSNP:768065826
707 707 c, t dbSNP:80356845
709 709 -, aacg dbSNP:397509300
710 710 a, c, t dbSNP:201536070
711 711 a, g dbSNP:80357090
712 712 a, t dbSNP:80357142
719 719 a, g dbSNP:759197544
731 731 c, t dbSNP:1799965
741 741 a, g dbSNP:80357109
743 743 c, t dbSNP:786201512
747 747 a, g dbSNP:398122703
752 752 c, g dbSNP:80357394
756 756 c, t dbSNP:397509301
763 763 c, g dbSNP:764499766
764 764 -, agggatgaaatcaggagcca dbSNP:397509302
765 765 -, nnnnnnnnnnnnnnnnnnnn dbSNP:483353106
765 765 c, t dbSNP:730881466
766 766 c, t dbSNP:201596327
777 777 a, g dbSNP:80357081
780 780 a, g dbSNP:786203797
781 781 a, g dbSNP:55680408
786 786 a, g dbSNP:398122704
790 790 g, t dbSNP:774284145
792 792 c, t dbSNP:765950064
795 795 a, g dbSNP:273902779
799 799 c, g dbSNP:431825418
801 801 g, t dbSNP:80357088
803 803 a, g dbSNP:375952040
805 805 a, g dbSNP:398122705
807 807 -, aa dbSNP:397509305
808 808 -, a dbSNP:80357537
808 808 -, a dbSNP:80357745
808 808 a, g dbSNP:397509306
810 810 a, g dbSNP:431825419
816 816 -, t dbSNP:80357941
817 817 -, c dbSNP:397509307
818 818 a, t dbSNP:397509308
823 823 a, t dbSNP:191872612
825 825 -, t dbSNP:80357824
832 832 c, t dbSNP:80357001
833 833 a, g, t dbSNP:62625298
834 834 a, g dbSNP:55975699
835 835 a, g, t dbSNP:398122708
837 837 -, gt dbSNP:80357747
839 839 a, g dbSNP:786202162
847 847 c, g dbSNP:80356990
853 853 a, g, t dbSNP:587782094
856 856 a, g dbSNP:80357396
857 857 -, tca dbSNP:786202378
857 857 g, t dbSNP:56310439
862 862 c, t dbSNP:80357351
867 867 a, g dbSNP:587782123
869 869 g, t dbSNP:730881467
871 871 -, a dbSNP:80357700
873 873 g, t dbSNP:147519994
874 874 a, t dbSNP:80356865
876 876 g, t dbSNP:28897675
877 877 -, t dbSNP:397509312
878 878 c, g dbSNP:768416164
879 879 a, g dbSNP:767720128
882 882 -, a dbSNP:397509314
883 883 a, c dbSNP:80357062
885 885 a, t dbSNP:397507256
890 890 a, g dbSNP:762867923
894 894 c, t dbSNP:273902786
895 895 a, g dbSNP:80357138
896 896 c, t dbSNP:786201338
897 897 a, g dbSNP:80357293
903 903 g, t dbSNP:80357009
905 905 a, g dbSNP:62625299
906 906 a, c, t dbSNP:587781833
907 907 g, t dbSNP:11658785
908 908 -, a, ag dbSNP:397509316
908 908 a, g dbSNP:746067447
913 913 c, g dbSNP:80357225
915 915 -, g dbSNP:80357628
918 918 a, c dbSNP:786202263
923 923 g, t dbSNP:80357321
926 926 a, g dbSNP:397509317
927 927 a, g, t dbSNP:397509318
928 928 a, c, g, t dbSNP:397509319
929 929 c, t dbSNP:397509320
930 930 a, g, t dbSNP:397509321
931 931 -, gttc dbSNP:80357707
931 931 a, g dbSNP:397509322
932 932 g, t dbSNP:80357214
934 934 -, ct dbSNP:80357955
935 935 c, t dbSNP:201441987
937 937 -, tt dbSNP:80357789
938 938 -, tt dbSNP:80357724
939 939 -, t dbSNP:397509323
939 939 c, t dbSNP:587781496
940 940 c, g dbSNP:80357392
944 944 c, g dbSNP:771076131
947 947 -, nnnnnnnnnnn dbSNP:483353107
947 947 a, g dbSNP:149867679
949 949 -, a dbSNP:80357965
950 950 c, t dbSNP:778359104
951 951 a, c, g, t dbSNP:80357244
952 952 g, t dbSNP:753099787
959 959 a, g dbSNP:779225364
960 960 g, t dbSNP:755285181
962 962 a, t dbSNP:80357331
964 964 -, agccatgtgg, gagccatgtgg, nnnnnnnnnn dbSNP:387906563
964 964 a, g dbSNP:397509327
965 965 c, t dbSNP:397509328
967 967 -, t dbSNP:397509329
967 967 c, g dbSNP:80357436
968 968 a, g dbSNP:186274774
973 973 -, a dbSNP:483353108
974 974 g, t dbSNP:762956862
975 975 -, c dbSNP:80357523
976 976 a, g dbSNP:80357482
977 977 c, t dbSNP:775477245
979 979 c, g dbSNP:80357199
982 982 -, ag dbSNP:80357792
983 983 -, ctca dbSNP:80357919
985 985 c, t dbSNP:786203027
988 988 a, g, t dbSNP:273902792
990 990 -, tcattac dbSNP:80357989
990 990 c, t dbSNP:397509330
991 991 -, ag dbSNP:80357719
991 991 -, nnnnnnn dbSNP:483353109
991 991 a, g dbSNP:80357039
1004 1004 a, c dbSNP:759366409
1006 1006 a, g dbSNP:776999497
1009 1009 g, t dbSNP:730881468
1016 1016 c, t dbSNP:771001707
1018 1018 c, g dbSNP:747172803
1019 1019 g, t dbSNP:139433219
1022 1022 -, a dbSNP:80357587
1024 1024 a, g dbSNP:772684048
1025 1025 -, ca dbSNP:786204261
1026 1026 a, g dbSNP:748675395
1029 1029 a, c, g dbSNP:80357196
1030 1030 a, t dbSNP:80356924
1031 1031 a, g dbSNP:80357103
1033 1033 a, g dbSNP:749593365
1034 1034 -, tg dbSNP:80357759
1035 1035 -, aatg dbSNP:80357806
1035 1035 -, gt dbSNP:80357670
1035 1035 g, t dbSNP:780952576
1040 1040 a, c dbSNP:80356861
1041 1041 a, g dbSNP:756859863
1042 1042 -, t dbSNP:80357726
1043 1043 -, c dbSNP:397509333
1044 1044 -, g dbSNP:273903793
1049 1049 -, a dbSNP:397509334
1051 1051 -, t dbSNP:80357622
1054 1054 g, t dbSNP:751124745
1062 1062 agc, t dbSNP:397509335
1062 1062 -, ag dbSNP:80357644
1062 1062 a, g dbSNP:55767801
1063 1063 c, g dbSNP:561998108
1063 1063 -, g dbSNP:80357953
1064 1064 -, c dbSNP:397509336
1066 1066 a, c dbSNP:80356877
1067 1067 -, a dbSNP:397509337
1067 1067 a, g dbSNP:757936216
1068 1068 c, t dbSNP:397509338
1069 1069 -, a dbSNP:80357844
1070 1070 -, g dbSNP:80357689
1074 1074 g, t dbSNP:752715574
1076 1076 -, c dbSNP:398122709
1083 1083 a, g dbSNP:80357050
1086 1086 a, g dbSNP:55874646
1089 1089 -, caaca dbSNP:80357555
1089 1089 c, t dbSNP:80357211
1091 1091 a, g dbSNP:759419385
1092 1092 -, cataacagatgggctggaagtaaggaaacatgtaatgataggcggact cccagcacagaaaaaa dbSNP:80359872
1093 1093 -, tg dbSNP:80357690
1093 1093 a, g dbSNP:776278453
1096 1096 a, g dbSNP:397507258
1099 1099 -, ga dbSNP:397509339
1101 1101 -, t dbSNP:397509340
1102 1102 a, g dbSNP:80357292
1104 1104 a, c, g dbSNP:80357252
1104 1104 -, g dbSNP:273903794
1109 1109 a, t dbSNP:45586033
1115 1115 a, g dbSNP:786201624
1116 1116 c, g dbSNP:773433679
1120 1120 -, ca dbSNP:80357610
1121 1121 -, at dbSNP:80357772
1121 1121 a, g dbSNP:1800063
1122 1122 c, t dbSNP:748156170
1124 1124 -, taatg dbSNP:786204262
1124 1124 -, c dbSNP:80357775
1125 1125 -, aa dbSNP:397509341
1125 1125 a, t dbSNP:786203732
1127 1127 c, t dbSNP:774849810
1128 1128 a, g dbSNP:397507259
1133 1133 c, g dbSNP:80357140
1134 1134 c, t dbSNP:80357176
1135 1135 a, g dbSNP:80357464
1136 1136 g, t dbSNP:80356836
1137 1137 a, g dbSNP:786201634
1138 1138 c, t dbSNP:431825420
1141 1141 a, c, t dbSNP:41286290
1148 1148 -, a dbSNP:67284603
1150 1150 -, a dbSNP:80357911
1152 1152 a, t dbSNP:397508826
1155 1155 a, g dbSNP:55842957
1156 1156 -, a dbSNP:80357569
1156 1156 -, a dbSNP:80357618
1156 1156 a, c dbSNP:587781737
1158 1158 -, g dbSNP:80357774
1161 1161 g, t dbSNP:756987689
1170 1170 a, g dbSNP:79727659
1173 1173 g, t dbSNP:80356961
1176 1176 c, t dbSNP:80357015
1179 1179 -, ct dbSNP:397508827
1179 1179 -, c dbSNP:749508254
1180 1180 a, t dbSNP:757987511
1180 1180 -, t dbSNP:397508828
1182 1182 c, t dbSNP:786201928
1183 1183 g, t dbSNP:752198747
1185 1185 g, t dbSNP:80357338
1192 1192 a, t dbSNP:765323349
1194 1194 g, t dbSNP:80357472
1198 1198 a, g dbSNP:80356908
1199 1199 a, c, g dbSNP:80356935
1203 1203 a, c, t dbSNP:397508829
1204 1204 a, g dbSNP:80357246
1205 1205 a, g dbSNP:41286292
1206 1206 c, t dbSNP:80357215
1207 1207 -, a dbSNP:80357796
1207 1207 a, g dbSNP:1799950
1208 1208 -, gaaactgcca dbSNP:397508830
1211 1211 a, g dbSNP:786202159
1212 1212 -, c dbSNP:80357836
1212 1212 c, t dbSNP:377310179
1215 1215 c, t dbSNP:767666190
1216 1216 c, t dbSNP:397508831
1218 1218 c, t dbSNP:587782790
1220 1220 -, a dbSNP:397508832
1221 1221 c, t dbSNP:80356946
1222 1222 -, cagagaatcct dbSNP:80359880
1222 1222 c, g dbSNP:397508833
1226 1226 -, gaatcctagagatactgaagatgttccttggataacactaaatagcag cattcaga dbSNP:80359875
1226 1226 -, ga dbSNP:80357897
1228 1228 -, a dbSNP:80357954
1231 1231 -, c dbSNP:397508834
1233 1233 a, t dbSNP:398122627
1237 1237 a, t dbSNP:587781769
1239 1239 -, a dbSNP:397508835
1240 1240 -, c dbSNP:397508836
1241 1241 -, c dbSNP:80357665
1242 1242 g, t dbSNP:80357139
1245 1245 -, gat dbSNP:80358325
1245 1245 a, g dbSNP:56056711
1246 1246 -, atg dbSNP:80358326
1246 1246 a, g dbSNP:80357416
1252 1252 -, c dbSNP:397508837
1255 1255 a, g dbSNP:397508838
1256 1256 a, g dbSNP:80357468
1257 1257 a, g dbSNP:373218165
1261 1261 cac, t dbSNP:273897652
1261 1261 -, c dbSNP:80357612
1261 1261 c, t dbSNP:80357235
1262 1262 -, ac dbSNP:397508839
1267 1267 -, a dbSNP:80357821
1267 1267 a, g dbSNP:80356976
1269 1269 -, a dbSNP:80357776
1270 1270 a, g dbSNP:80357398
1271 1271 a, c dbSNP:786203434
1273 1273 a, g dbSNP:763351631
1277 1277 g, t dbSNP:56128296
1278 1278 c, t dbSNP:397508840
1281 1281 a, t dbSNP:80357385
1288 1288 -, at dbSNP:431825384
1288 1288 a, g dbSNP:770090143
1292 1292 -, g dbSNP:397508841
1298 1298 -, tt dbSNP:397508842
1299 1299 -, t dbSNP:397508843
1302 1302 a, g dbSNP:111312760
1303 1303 c, g dbSNP:786203567
1305 1305 -, a dbSNP:80357985
1306 1306 -, g dbSNP:273897653
1311 1311 c, g dbSNP:562553169
1315 1315 -, tgttaggttctgatgactcacatgatggggagtctgaatcaaat dbSNP:397507183
1315 1315 -, tgttaggttctgatgactcacatgatggggagtctgaatcaaa dbSNP:397507182
1315 1315 -, tgttaggttctgatgactcacatgatggggagtctgaatcaa dbSNP:397507181
1315 1315 -, tgttaggttctgatgactcacatgatggggagtctgaatca dbSNP:397507180
1315 1315 -, tgttaggttctgatgactcacatgatggggagtctgaatc dbSNP:80359874
1315 1315 -, tgtt dbSNP:397508844
1315 1315 a, t dbSNP:777305766
1320 1320 c, g dbSNP:771837028
1326 1326 a, g dbSNP:786203145
1328 1328 -, t dbSNP:397508845
1330 1330 -, a dbSNP:748714307
1330 1330 a, t dbSNP:747727601
1333 1333 a, c, g, t dbSNP:80357068
1336 1336 a, g dbSNP:587780794
1342 1342 a, c, g dbSNP:397507184
1344 1344 -, g dbSNP:80357859
1344 1344 g, t dbSNP:273897655
1348 1348 c, t dbSNP:80356934
1349 1349 c, t dbSNP:369363742
1350 1350 c, g dbSNP:753748171
1354 1354 a, c, g dbSNP:80357481
1355 1355 a, g dbSNP:786201517
1357 1357 -, a dbSNP:397508846
1362 1362 a, g dbSNP:80357253
1365 1365 c, g dbSNP:144698700
1366 1366 c, t dbSNP:786202539
1367 1367 a, g dbSNP:149349675
1368 1368 a, g dbSNP:779974365
1371 1371 a, g dbSNP:80357301
1372 1372 -, at dbSNP:397508848
1372 1372 a, t dbSNP:730881469
1373 1373 g, t dbSNP:80357024
1374 1374 a, g dbSNP:587776478
1377 1377 c, t dbSNP:574008372
1380 1380 -, gacgttc dbSNP:80357964
1380 1380 -, g dbSNP:786204260
1381 1381 -, a dbSNP:80357514
1382 1382 c, t dbSNP:372400428
1383 1383 a, g dbSNP:587782770
1390 1390 a, g dbSNP:80357113
1391 1391 g, t dbSNP:80357197
1392 1392 g, t dbSNP:80357083
1394 1394 a, g dbSNP:786201948
1395 1395 -, g dbSNP:80357535
1396 1396 -, t dbSNP:786203103
1396 1396 g, t dbSNP:398122628
1397 1397 a, t dbSNP:751690840
1398 1398 g, t dbSNP:80357488
1399 1399 a, g dbSNP:730881442
1401 1401 a, g dbSNP:80357046
1402 1402 a, g dbSNP:397508849
1404 1404 c, t dbSNP:764186025
1405 1405 -, a dbSNP:80357809
1406 1406 -, at dbSNP:397508850
1406 1406 g, t dbSNP:80357417
1410 1410 a, g dbSNP:763051683
1415 1415 a, t dbSNP:786201160
1416 1416 -, t dbSNP:80357766
1419 1419 g, t dbSNP:397508851
1426 1426 c, t dbSNP:775869160
1427 1427 -, a dbSNP:80357576
1432 1432 -, t dbSNP:80357528
1432 1432 g, t dbSNP:80357346
1432 1432 -, t dbSNP:398122629
1433 1433 act, ga dbSNP:397508852
1435 1435 c, t dbSNP:369394098
1437 1437 -, g dbSNP:80357794
1438 1438 -, nnnn dbSNP:483353083
1440 1440 a, g dbSNP:786203753
1448 1448 c, t dbSNP:770279083
1449 1449 c, t dbSNP:759878392
1450 1450 a, c dbSNP:80357255
1453 1453 a, c dbSNP:730881470
1456 1456 c, g dbSNP:777132211
1459 1459 -, t dbSNP:397508853
1459 1459 c, t dbSNP:273897656
1459 1459 -, t dbSNP:80357683
1463 1463 -, at dbSNP:80357570
1466 1466 -, gt dbSNP:80357543
1466 1466 a, t dbSNP:397508854
1467 1467 a, t dbSNP:398122630
1469 1469 a, g dbSNP:771892131
1473 1473 c, g, t dbSNP:80356915
1475 1475 -, aa dbSNP:80357978
1476 1476 -, a dbSNP:398122631
1476 1476 a, g dbSNP:587781715
1479 1479 -, g dbSNP:397508855
1479 1479 a, g dbSNP:587782784
1480 1480 -, g dbSNP:80357597
1480 1480 -, tt dbSNP:730881458
1482 1482 c, t dbSNP:786203578
1489 1489 a, g dbSNP:778668550
1492 1492 a, c, g dbSNP:80356891
1496 1496 -, a dbSNP:80357939
1497 1497 c, g dbSNP:768054411
1500 1500 -, ag dbSNP:80357969
1501 1501 a, g dbSNP:80357181
1501 1501 -, g dbSNP:398122632
1503 1503 -, ga dbSNP:397508860
1507 1507 c, t dbSNP:80357360
1511 1511 -, a dbSNP:397508861
1514 1514 -, c dbSNP:397508862
1517 1517 -, aa dbSNP:398122633
1519 1519 g, t dbSNP:398122634
1520 1520 -, a dbSNP:80357714
1520 1520 -, a dbSNP:397508863
1521 1521 c, t dbSNP:62625300
1523 1523 a, t dbSNP:56046357
1523 1523 -, t dbSNP:80357879
1524 1524 a, g dbSNP:80357221
1526 1526 -, g dbSNP:397508865
1526 1526 -, g dbSNP:80357722
1527 1527 aaaa, gaaag dbSNP:397508866
1527 1527 -, a dbSNP:273897658
1529 1529 aa, g dbSNP:273897659
1530 1530 -, g dbSNP:397508867
1530 1530 -, a dbSNP:80357770
1531 1531 c, t dbSNP:62625301
1532 1532 -, c dbSNP:80357592
1532 1532 -, c dbSNP:397508868
1532 1532 c, t dbSNP:533802049
1533 1533 -, gggaaaacct dbSNP:397508864
1533 1533 g, t dbSNP:397508869
1536 1536 c, g, t dbSNP:80356964
1537 1537 a, g dbSNP:199540030
1539 1539 a, c, t dbSNP:80357279
1541 1541 a, g dbSNP:786201323
1543 1543 -, a dbSNP:397508870
1545 1545 a, g dbSNP:397507187
1545 1545 -, g dbSNP:397508871
1546 1546 c, g dbSNP:80357073
1556 1556 c, t dbSNP:752808917
1558 1558 a, g, t dbSNP:80357057
1559 1559 c, t dbSNP:777228325
1561 1561 g, t dbSNP:80357490
1567 1567 a, g dbSNP:55720177
1574 1574 -, t dbSNP:431825386
1579 1579 -, a dbSNP:80357505
1580 1580 -, a dbSNP:80357778
1584 1584 -, atta dbSNP:80357801
1584 1584 -, a dbSNP:80357648
1586 1586 -, tat dbSNP:80358327
1588 1588 c, t dbSNP:80357489
1590 1590 g, t dbSNP:80357304
1596 1596 a, c, t dbSNP:55906931
1597 1597 c, t dbSNP:774159828
1598 1598 a, g, t dbSNP:80357400
1599 1599 g, t dbSNP:369588942
1600 1600 g, t dbSNP:748812609
1602 1602 -, a dbSNP:80357599
1605 1605 a, g, t dbSNP:80357167
1610 1610 a, g dbSNP:775032066
1611 1611 c, t dbSNP:62625303
1612 1612 a, g dbSNP:80357376
1617 1617 -, a dbSNP:786203982
1620 1620 c, t dbSNP:80357010
1623 1623 -, gagcgtcccctcacaa dbSNP:397508872
1626 1626 a, c, t dbSNP:28897676
1627 1627 a, g dbSNP:28897677
1628 1628 -, t dbSNP:587782251
1631 1631 c, g dbSNP:786202374
1632 1632 -, c dbSNP:80357527
1637 1637 -, aaat dbSNP:80357632
1639 1639 -, a dbSNP:397508874
1642 1642 a, g dbSNP:113656989
1644 1644 -, ttaaagcgtaaaagg dbSNP:397508875
1644 1644 -, ttaaa dbSNP:80357888
1646 1646 -, aaagc dbSNP:397508876
1646 1646 a, g dbSNP:786203671
1648 1648 -, ataaattaaa dbSNP:397508873
1648 1648 -, a dbSNP:80357506
1648 1648 a, g dbSNP:62625304
1650 1650 -, c dbSNP:80357908
1650 1650 c, t dbSNP:80357445
1651 1651 -, g dbSNP:80357817
1651 1651 a, g dbSNP:56272539
1652 1652 -, t dbSNP:398122636
1653 1653 -, t dbSNP:397508878
1653 1653 a, t dbSNP:397508877
1657 1657 -, ggaga dbSNP:397508879
1658 1658 -, g dbSNP:80357947
1659 1659 a, t dbSNP:397508880
1660 1660 g, t dbSNP:80357224
1663 1663 -, c dbSNP:80357782
1663 1663 c, t dbSNP:398122637
1664 1664 c, t dbSNP:200616937
1668 1668 a, t dbSNP:777916645
1669 1669 c, g dbSNP:80357427
1670 1670 -, a dbSNP:80357735
1672 1672 g, t dbSNP:397507188
1674 1674 c, g, t dbSNP:41286294
1681 1681 c, g dbSNP:56100707
1684 1684 a, g dbSNP:397508881
1691 1691 -, t dbSNP:80357630
1695 1695 a, c dbSNP:397508882
1696 1696 -, a dbSNP:80357662
1701 1701 gcag, taaa dbSNP:397508883
1701 1701 gc, ta dbSNP:273897663
1701 1701 a, g dbSNP:80357122
1703 1703 a, g dbSNP:754970915
1704 1704 a, g dbSNP:80357453
1705 1705 -, c dbSNP:397508884
1707 1707 g, t dbSNP:754398271
1708 1708 g, t dbSNP:397508885
1709 1709 a, g dbSNP:766934857
1710 1710 a, g dbSNP:761178502
1710 1710 -, g dbSNP:397508886
1711 1711 c, t dbSNP:80357333
1713 1713 a, g dbSNP:80357273
1716 1716 c, t dbSNP:80356984
1718 1718 a, g dbSNP:762642319
1719 1719 -, aa dbSNP:431825387
1720 1720 a, g dbSNP:774959350
1721 1721 c, g dbSNP:80357493
1722 1722 -, actcctg dbSNP:80357613
1723 1723 -, ctcctga dbSNP:397508887
1725 1725 c, t dbSNP:769380445
1735 1735 -, taaatca dbSNP:397508888
1738 1738 a, g dbSNP:786204263
1740 1740 c, g, t dbSNP:142074233
1741 1741 -, a dbSNP:397508889
1741 1741 a, g dbSNP:80357173
1747 1747 c, g dbSNP:398122638
1748 1748 -, taac dbSNP:80357698
1749 1749 a, g dbSNP:398122639
1752 1752 -, caaac dbSNP:587776480
1752 1752 c, t dbSNP:80356893
1756 1756 a, c, t dbSNP:80357374
1757 1757 a, g dbSNP:372002119
1758 1758 a, g dbSNP:730881471
1761 1761 c, t dbSNP:80356904
1763 1763 -, g dbSNP:397508891
1768 1768 -, g dbSNP:398122640
1770 1770 c, t dbSNP:80356952
1771 1771 a, c dbSNP:397508892
1775 1775 a, g dbSNP:770842236
1776 1776 -, atgaatattactaatagtg dbSNP:80359881
1776 1776 a, g dbSNP:587782390
1777 1777 nnnnn, tgaatattactaatagtggtcatgagaataaaacaaaaggtgattcta t dbSNP:483353085
1782 1782 a, g dbSNP:80356981
1788 1788 -, aatagtggtcatgagaataaaacaaaaggtgattctattcagaatgag aaaaatcctaacccaatagaatcactcgaaaaagaatctgctttcaaaacgaaagctg aacctataagcagcagtataagcaatatggaactcgaattaaatatccacaattcaaa agcacctaaaaagaataggctgaggaggaagtcttctaccaggcatatt dbSNP:80359886
1788 1788 a, c dbSNP:56012641
1789 1789 -, a dbSNP:80357619
1790 1790 -, t dbSNP:753524038
1790 1790 c, t dbSNP:777595821
1791 1791 a, g dbSNP:730881472
1794 1794 a, g dbSNP:758598971
1795 1795 g, t dbSNP:397508893
1798 1798 a, c, g dbSNP:748431827
1800 1800 g, t dbSNP:397508894
1806 1806 a, c dbSNP:587783041
1809 1809 a, g dbSNP:397508895
1812 1812 a, c dbSNP:397507190
1813 1813 -, aa dbSNP:397508896
1814 1814 -, a dbSNP:80357600
1816 1816 g, t dbSNP:80356980
1827 1827 c, t dbSNP:80356898
1830 1830 a, c, t dbSNP:397507191
1835 1835 -, g dbSNP:273897664
1840 1840 -, a dbSNP:80357784
1840 1840 -, a dbSNP:397508899
1842 1842 c, t dbSNP:755122577
1843 1843 c, g, t dbSNP:80356910
1844 1844 g, t dbSNP:587780795
1845 1845 a, g dbSNP:587781315
1852 1852 c, t dbSNP:80357159
1853 1853 -, agaat dbSNP:80357640
1853 1853 a, g dbSNP:552505690
1854 1854 g, t dbSNP:730881473
1856 1856 -, a dbSNP:397508901
1856 1856 -, a dbSNP:397508900
1862 1862 c, t dbSNP:530914551
1863 1863 a, g dbSNP:397508902
1864 1864 a, g dbSNP:111539978
1868 1868 -, a dbSNP:397507192
1868 1868 a, g dbSNP:786201232
1869 1869 -, ga dbSNP:80357834
1869 1869 c, g, t dbSNP:397508903
1871 1871 a, g dbSNP:28897678
1873 1873 a, c dbSNP:80356939
1875 1875 c, g dbSNP:759108406
1881 1881 a, t dbSNP:397508905
1884 1884 -, a dbSNP:398122641
1884 1884 a, g dbSNP:397508906
1885 1885 c, t dbSNP:786202386
1886 1886 a, g dbSNP:776115545
1887 1887 a, g, t dbSNP:80356928
1896 1896 c, t dbSNP:80357153
1897 1897 -, c dbSNP:80357723
1899 1899 -, a dbSNP:398122642
1907 1907 a, c dbSNP:587783039
1908 1908 a, g dbSNP:80357454
1912 1912 c, t dbSNP:80356859
1912 1912 -, t dbSNP:80357901
1915 1915 a, g dbSNP:786203044
1917 1917 a, c dbSNP:772975110
1926 1926 c, g, t dbSNP:80357371
1928 1928 c, t dbSNP:779253414
1929 1929 a, g, t dbSNP:55650082
1931 1931 a, g dbSNP:749415463
1933 1933 a, g, t dbSNP:80357118
1937 1937 c, t dbSNP:756211343
1939 1939 g, t dbSNP:398122643
1940 1940 c, g dbSNP:80357452
1942 1942 a, g dbSNP:371631805
1945 1945 -, a dbSNP:397508908
1948 1948 c, g dbSNP:397508909
1952 1952 -, a dbSNP:80357927
1953 1953 g, t dbSNP:587781613
1957 1957 -, c dbSNP:397508910
1959 1959 a, g, t dbSNP:80357220
1961 1961 -, aaag dbSNP:80357585
1963 1963 -, agaa dbSNP:80357952
1963 1963 -, a dbSNP:397508911
1964 1964 -, gaa dbSNP:587781614
1965 1965 -, a dbSNP:80357736
1966 1966 a, g dbSNP:80357236
1967 1967 c, t dbSNP:757657445
1968 1968 a, g dbSNP:398122644
1970 1970 a, g dbSNP:587780796
1971 1971 -, c dbSNP:397508913
1973 1973 a, g dbSNP:786201548
1974 1974 a, g dbSNP:80357245
1977 1977 -, a dbSNP:80357652
1978 1978 a, g dbSNP:786203937
1979 1979 -, ga dbSNP:752474843
1979 1979 a, g dbSNP:759157605
1980 1980 a, c, t dbSNP:80357282
1982 1982 a, g, t dbSNP:760109939
1983 1983 -, gt dbSNP:767595162
1984 1984 c, t dbSNP:398122645
1986 1986 -, tct dbSNP:80358329
1986 1986 -, t dbSNP:397508914
1989 1989 a, g dbSNP:45564238
1994 1994 -, g dbSNP:397507193
1995 1995 a, c dbSNP:773212667
1996 1996 a, c dbSNP:771890863
2000 2000 -, t dbSNP:730881459
2003 2003 c, t dbSNP:786201460
2005 2005 c, t dbSNP:56039126
2006 2006 a, g, t dbSNP:1800064
2008 2008 c, t dbSNP:397508915
2010 2010 a, g, t dbSNP:80356950
2013 2013 c, t dbSNP:769044421
2015 2015 -, a dbSNP:398122646
2015 2015 a, g dbSNP:786201429
2017 2017 -, nnnn, tagt dbSNP:80357516
2018 2018 a, g dbSNP:8176154
2019 2019 a, g dbSNP:80357425
2020 2020 g, t dbSNP:770002293
2021 2021 -, cagt dbSNP:80357567
2021 2021 c, g, t dbSNP:80356838
2024 2024 g, t dbSNP:80357495
2032 2032 -, t dbSNP:80357932
2033 2033 -, t dbSNP:80357768
2033 2033 a, c, g dbSNP:80356834
2035 2035 a, g dbSNP:80356983
2037 2037 a, c, t dbSNP:80356902
2038 2038 -, c dbSNP:80357851
2038 2038 c, t dbSNP:398122647
2040 2040 c, t dbSNP:80357056
2041 2041 c, g, t dbSNP:80357121
2045 2045 c, t dbSNP:369373293
2046 2046 -, t dbSNP:397508916
2047 2047 a, g dbSNP:398122649
2051 2051 c, t dbSNP:62625305
2052 2052 a, g, t dbSNP:80357005
2052 2052 -, g dbSNP:80357933
2053 2053 a, c dbSNP:786201944
2056 2056 a, t dbSNP:80357267
2057 2057 a, g dbSNP:786202103
2059 2059 a, c dbSNP:786203965
2060 2060 a, t dbSNP:587782843
2061 2061 -, a dbSNP:397507194
2061 2061 -, a dbSNP:398122650
2062 2062 c, t dbSNP:730881474
2064 2064 c, g dbSNP:80357344
2065 2065 a, g dbSNP:786204049
2066 2066 c, t dbSNP:786203720
2067 2067 a, g dbSNP:80357105
2070 2070 a, t dbSNP:753521391
2071 2071 -, gtt dbSNP:587782739
2072 2072 g, t dbSNP:397508918
2074 2074 a, c dbSNP:80357129
2076 2076 -, a dbSNP:397508919
2078 2078 -, cagtgaagag dbSNP:397508920
2085 2085 c, g, t dbSNP:80356907
2087 2087 a, g dbSNP:755706172
2088 2088 a, g dbSNP:749896277
2089 2089 -, ta dbSNP:397508921
2092 2092 -, a dbSNP:80357885
2092 2092 -, a dbSNP:397508922
2093 2093 -, gaaa dbSNP:80357526
2093 2093 -, g dbSNP:80357753
2098 2098 -, aaaa dbSNP:397508923
2099 2099 a, g dbSNP:767530204
2100 2100 -, aa dbSNP:80357643
2100 2100 a, g, t dbSNP:80357355
2101 2101 -, a dbSNP:80357853
2101 2101 -, a dbSNP:80357522
2103 2103 -, g, t dbSNP:397508924
2103 2103 g, t dbSNP:80357166
2104 2104 -, a dbSNP:786203594
2104 2104 a, t dbSNP:80357193
2106 2106 a, g dbSNP:786203455
2107 2107 a, g dbSNP:397508925
2109 2109 c, t dbSNP:397508926
2111 2111 a, g dbSNP:28897679
2112 2112 -, a dbSNP:397507195
2112 2112 a, g dbSNP:55932871
2114 2114 c, g dbSNP:55678461
2115 2115 c, g dbSNP:587776481
2117 2117 -, ag dbSNP:773413634
2117 2117 a, g dbSNP:764009120
2120 2120 c, g dbSNP:762772420
2124 2124 c, t dbSNP:397508927
2125 2125 a, g dbSNP:80357494
2135 2135 c, g dbSNP:80357238
2136 2136 -, c dbSNP:80357922
2139 2139 c, t dbSNP:80356889
2141 2141 -, a dbSNP:80357521
2142 2142 c, t dbSNP:80357250
2145 2145 a, g dbSNP:561988641
2146 2146 c, t dbSNP:80356895
2148 2148 a, g dbSNP:80357029
2153 2153 -, gt dbSNP:397508928
2154 2154 a, g, t dbSNP:397508929
2156 2156 a, g dbSNP:776542749
2157 2157 -, g dbSNP:80357638
2157 2157 g, t dbSNP:80357391
2159 2159 -, a dbSNP:80357626
2161 2161 -, c dbSNP:397508930
2162 2162 g, t dbSNP:771519405
2168 2168 -, tg dbSNP:397508931
2175 2175 a, t dbSNP:80357082
2177 2177 a, g dbSNP:572835027
2177 2177 cc, g dbSNP:397508932
2178 2178 -, cc dbSNP:80357940
2179 2179 a, g dbSNP:730881475
2183 2183 g, t dbSNP:143920945
2188 2188 -, a dbSNP:397508933
2189 2189 a, g dbSNP:778215185
2190 2190 a, c, t dbSNP:397508934
2196 2196 g, t dbSNP:587782709
2199 2199 c, t dbSNP:273898674
2200 2200 a, c dbSNP:28897680
2203 2203 -, caag dbSNP:397508935
2206 2206 a, g dbSNP:779748579
2208 2208 -, a dbSNP:80357733
2208 2208 a, g dbSNP:587781448
2210 2210 -, aa dbSNP:273898676
2211 2211 -, a dbSNP:80357688
2214 2214 -, c dbSNP:80357554
2214 2214 c, t dbSNP:545736576
2215 2215 -, at dbSNP:397508936
2216 2216 a, t dbSNP:587782595
2217 2217 -, ta dbSNP:80357595
2217 2217 a, g, t dbSNP:4986850
2218 2218 a, g dbSNP:756748588
2219 2219 -, ca dbSNP:80357773
2219 2219 c, t dbSNP:80356835
2221 2221 a, g dbSNP:431825388
2222 2222 c, t dbSNP:1799949
2223 2223 a, g, t dbSNP:28897681
2226 2226 -, a dbSNP:397508937
2226 2226 a, g dbSNP:80357441
2230 2230 c, t dbSNP:730881476
2238 2238 -, a dbSNP:483353086
2238 2238 c, g dbSNP:775424259
2241 2241 -, aa dbSNP:431825389
2243 2243 a, g dbSNP:273898677
2245 2245 -, t dbSNP:80357880
2245 2245 g, t dbSNP:80357298
2249 2249 a, g dbSNP:4986844
2250 2250 -, aa dbSNP:80357814
2257 2257 c, t dbSNP:759655692
2259 2259 c, g dbSNP:587781420
2260 2260 a, g dbSNP:80357192
2261 2261 g, t dbSNP:786201649
2263 2263 a, c, t dbSNP:80357182
2265 2265 -, a, nnn dbSNP:80357871
2266 2266 -, tt dbSNP:397508939
2270 2270 g, t dbSNP:273898678
2271 2271 -, aa dbSNP:398122653
2271 2271 a, g dbSNP:747046197
2274 2274 c, t dbSNP:786202015
2278 2278 c, g dbSNP:80357233
2280 2280 a, g dbSNP:568312345
2282 2282 -, t dbSNP:273898679
2283 2283 a, t dbSNP:730881477
2288 2288 a, t dbSNP:730881478
2293 2293 g, t dbSNP:748550848
2294 2294 g, t dbSNP:779227326
2295 2295 -, aaagaatttgtcaa dbSNP:397508941
2295 2295 -, a dbSNP:80357715
2295 2295 a, g, t dbSNP:80357147
2296 2296 -, a dbSNP:606231389
2297 2297 -, a dbSNP:397508942
2298 2298 a, g, t dbSNP:80356875
2306 2306 -, c dbSNP:397508943
2307 2307 a, g dbSNP:4986845
2309 2309 a, t dbSNP:756729124
2311 2311 c, t dbSNP:751104940
2314 2314 -, g dbSNP:397508944
2315 2315 c, t dbSNP:273898680
2316 2316 -, ct dbSNP:397508945
2316 2316 -, c dbSNP:80357668
2320 2320 c, t dbSNP:80356912
2323 2323 a, g dbSNP:80357335
2328 2328 -, gaaaaagaagagaa dbSNP:273898681
2328 2328 -, g dbSNP:80357566
2328 2328 g, t dbSNP:80357058
2332 2332 -, aagaa dbSNP:397508946
2333 2333 -, agaag dbSNP:80357507
2333 2333 -, agaa dbSNP:397508947
2334 2334 -, gaaga dbSNP:80357755
2334 2334 g, t dbSNP:80357426
2335 2335 -, aagag dbSNP:80357771
2336 2336 -, a dbSNP:397508948
2337 2337 -, gagaa dbSNP:80357539
2337 2337 g, t dbSNP:397508949
2339 2339 -, g dbSNP:80357944
2342 2342 -, a dbSNP:80357982
2343 2343 -, c dbSNP:80357936
2343 2343 c, g dbSNP:587781781
2346 2346 -, g dbSNP:80357860
2347 2347 a, c dbSNP:397507196
2350 2350 -, ca dbSNP:80357654
2350 2350 -, c dbSNP:80357793
2351 2351 -, ag dbSNP:397508950
2352 2352 -, gtta dbSNP:397508951
2354 2354 -, t, tt dbSNP:397507197
2354 2354 -, t dbSNP:80357574
2355 2355 -, ct dbSNP:80357930
2355 2355 a, g, t dbSNP:56329598
2356 2356 -, aa dbSNP:397508952
2357 2357 -, a dbSNP:80357802
2357 2357 a, g dbSNP:200521980
2358 2358 c, g, t dbSNP:80357415
2362 2362 c, g, t dbSNP:80357051
2367 2367 -, aat dbSNP:769088801
2370 2370 a, g dbSNP:786203435
2371 2371 a, c dbSNP:786204220
2372 2372 c, g, t dbSNP:4986846
2376 2376 -, g dbSNP:80357909
2378 2378 a, c dbSNP:786202757
2381 2381 -, c dbSNP:397508953
2381 2381 -, c dbSNP:80357650
2382 2382 a, g dbSNP:760810832
2385 2385 c, g, t dbSNP:80357114
2386 2386 -, ga dbSNP:398122654
2386 2386 a, g, t dbSNP:730881479
2388 2388 -, ctcat dbSNP:397508954
2392 2392 c, t dbSNP:587781684
2393 2393 -, gt dbSNP:80357602
2396 2396 -, ta dbSNP:80357557
2399 2399 g, t dbSNP:730881480
2403 2403 -, g dbSNP:80357960
2403 2403 g, t dbSNP:41286296
2408 2408 c, g dbSNP:80356884
2409 2409 -, g dbSNP:80357583
2409 2409 g, t dbSNP:772617029
2413 2413 -, t dbSNP:80357681
2415 2415 c, t dbSNP:80356999
2421 2421 a, c, g dbSNP:397507198
2422 2422 a, c dbSNP:80356869
2423 2423 -, aa dbSNP:80357657
2426 2426 a, t dbSNP:273898682
2430 2430 a, g dbSNP:768904580
2433 2433 g, t dbSNP:80357449
2434 2434 a, g dbSNP:80357085
2435 2435 a, g dbSNP:201875054
2436 2436 -, ag dbSNP:80357780
2436 2436 a, g dbSNP:398122655
2438 2438 -, t dbSNP:786204264
2439 2439 -, a dbSNP:80357786
2439 2439 a, g, t dbSNP:80357194
2442 2442 a, g dbSNP:398122656
2446 2446 a, t dbSNP:372366481
2448 2448 -, t dbSNP:397508956
2449 2449 a, c, t dbSNP:80357063
2450 2450 -, agagagtagcagtatttca, c dbSNP:397508955
2451 2451 c, t dbSNP:16940
2452 2452 c, t dbSNP:730881481
2454 2454 -, g dbSNP:80357957
2455 2455 c, t dbSNP:80357467
2461 2461 a, g dbSNP:730881482
2462 2462 a, t dbSNP:397508958
2465 2465 -, a dbSNP:397508959
2469 2469 g, t dbSNP:397507199
2469 2469 -, t dbSNP:80357725
2470 2470 a, g dbSNP:587778116
2471 2471 a, t dbSNP:80357444
2472 2472 -, tg dbSNP:431825390
2473 2473 a, g dbSNP:730881483
2474 2474 c, t dbSNP:777404687
2477 2477 -, tc dbSNP:80357515
2478 2478 a, c, g, t dbSNP:80356945
2481 2481 a, g dbSNP:757933953
2482 2482 a, c, t dbSNP:587776482
2487 2487 a, g dbSNP:80356948
2488 2488 a, c, t dbSNP:562370358
2490 2490 -, tc dbSNP:397508960
2490 2490 g, t dbSNP:80357399
2491 2491 -, cgttact dbSNP:80357820
2491 2491 c, t dbSNP:55914168
2492 2492 a, g dbSNP:372017932
2494 2494 a, t dbSNP:397508961
2495 2495 -, a dbSNP:80357990
2496 2496 -, c dbSNP:397508962
2496 2496 c, t dbSNP:483353087
2497 2497 c, t dbSNP:760864137
2497 2497 -, t dbSNP:397508963
2499 2499 -, g dbSNP:80357739
2499 2499 -, g dbSNP:397508964
2501 2501 a, g dbSNP:750594744
2502 2502 a, g dbSNP:80357060
2508 2508 a, g dbSNP:41286298
2512 2512 g, t dbSNP:774730386
2516 2516 -, g dbSNP:80357913
2521 2521 c, t dbSNP:7502059
2526 2526 -, a dbSNP:398122657
2527 2527 c, t dbSNP:80357364
2529 2529 -, ga dbSNP:80357695
2529 2529 a, g, t dbSNP:62625306
2529 2529 -, g dbSNP:397508965
2530 2530 -, aa dbSNP:80357546
2532 2532 c, t dbSNP:398122658
2533 2533 -, c dbSNP:80357850
2536 2536 a, g dbSNP:587782027
2537 2537 a, t dbSNP:80357203
2538 2538 -, aaat dbSNP:786202684
2541 2541 -, tg dbSNP:80357999
2543 2543 a, g, t dbSNP:80357381
2545 2545 -, tg dbSNP:80357706
2546 2546 -, gagt dbSNP:80357674
2547 2547 -, ag dbSNP:786202919
2549 2549 -, t dbSNP:770460699
2550 2550 c, g, t dbSNP:80356982
2551 2551 -, ag dbSNP:80357664
2552 2552 a, c, g dbSNP:55746541
2553 2553 c, t dbSNP:397508966
2556 2556 a, g dbSNP:80357144
2559 2559 a, g, t dbSNP:80357240
2560 2560 a, c dbSNP:273899683
2561 2561 a, g dbSNP:772960140
2563 2563 c, t dbSNP:398122660
2564 2564 -, t dbSNP:397507200
2565 2565 a, g dbSNP:786204151
2566 2566 a, g dbSNP:397507201
2568 2568 a, t dbSNP:28897682
2569 2569 -, a dbSNP:397508967
2573 2573 -, c dbSNP:80357524
2574 2574 a, t dbSNP:397508968
2577 2577 g, t dbSNP:80357186
2578 2578 -, g dbSNP:80357503
2580 2580 -, a dbSNP:397508969
2580 2580 c, t dbSNP:786202054
2583 2583 -, a dbSNP:80357598
2584 2584 c, t dbSNP:730881484
2587 2587 a, g dbSNP:80357108
2590 2590 -, g dbSNP:80357679
2596 2596 c, g dbSNP:192655097
2597 2597 -, c dbSNP:80357669
2598 2598 a, g dbSNP:56082113
2607 2607 a, g dbSNP:758180755
2608 2608 -, g dbSNP:80357799
2612 2612 c, t dbSNP:786201415
2613 2613 g, t dbSNP:80357328
2614 2614 -, a dbSNP:80357830
2614 2614 a, t dbSNP:80357249
2615 2615 -, c dbSNP:80357970
2616 2616 -, a dbSNP:80357631
2617 2617 -, ca dbSNP:80357800
2617 2617 a, c dbSNP:28897683
2617 2617 -, c dbSNP:80357740
2621 2621 a, c dbSNP:397508970
2622 2622 a, g dbSNP:80357185
2623 2623 -, gct dbSNP:80358331
2626 2626 -, tt dbSNP:397508971
2627 2627 -, t dbSNP:397508972
2627 2627 -, t dbSNP:80357658
2629 2629 -, aa dbSNP:273899685
2632 2632 a, g dbSNP:750645074
2636 2636 a, t dbSNP:767666029
2637 2637 -, aagtatccat dbSNP:397508973
2640 2640 c, g dbSNP:786202215
2641 2641 a, g dbSNP:757383244
2643 2643 c, t dbSNP:751656678
2644 2644 -, nnnnnnnnnnnnnnnnn dbSNP:483353078
2644 2644 a, g dbSNP:765157365
2646 2646 -, g dbSNP:587780798
2647 2647 -, aa dbSNP:273899686
2653 2653 -, a dbSNP:80357863
2653 2653 a, c dbSNP:564375670
2655 2655 -, c dbSNP:80357607
2657 2657 -, ca dbSNP:397508974
2658 2658 -, a dbSNP:397508975
2658 2658 a, g, t dbSNP:377475866
2661 2661 c, t dbSNP:1800709
2662 2662 a, g dbSNP:80357337
2663 2663 a, g dbSNP:773013395
2665 2665 a, g dbSNP:28897684
2667 2667 a, g dbSNP:80357435
2671 2671 a, g dbSNP:56051266
2673 2673 a, g dbSNP:747649874
2674 2674 c, t dbSNP:397508976
2676 2676 a, g dbSNP:786203523
2681 2681 a, g dbSNP:80357195
2685 2685 g, t dbSNP:80356951
2691 2691 a, g dbSNP:398122662
2691 2691 -, g dbSNP:397508977
2696 2696 -, t dbSNP:397508979
2696 2696 -, t dbSNP:397508978
2697 2697 -, a dbSNP:80357835
2698 2698 -, a dbSNP:397508980
2701 2701 -, ctcag dbSNP:397508981
2701 2701 -, gc dbSNP:80357968
2701 2701 c, t dbSNP:80357315
2703 2703 c, t dbSNP:80357131
2704 2704 -, ttgat dbSNP:397508982
2704 2704 a, c, t dbSNP:768001441
2706 2706 c, t dbSNP:80356892
2708 2708 c, g, t dbSNP:80356832
2709 2709 c, t dbSNP:779895958
2712 2712 c, t dbSNP:397508983
2718 2718 a, g dbSNP:373207084
2720 2720 a, g dbSNP:556684572
2722 2722 g, t dbSNP:80357098
2724 2724 a, g dbSNP:80356927
2726 2726 -, ggtttcaa dbSNP:80357675
2728 2728 c, t dbSNP:757440752
2730 2730 g, t dbSNP:80357285
2731 2731 c, g, t dbSNP:80357003
2732 2732 -, a dbSNP:80357756
2733 2733 a, t dbSNP:587782628
2734 2734 -, a dbSNP:397508984
2736 2736 c, t dbSNP:41286300
2737 2737 a, g dbSNP:80356911
2740 2740 a, g dbSNP:397508985
2743 2743 a, c, g dbSNP:80356925
2744 2744 -, gtca dbSNP:80357603
2748 2748 a, g dbSNP:753256448
2751 2751 -, cc dbSNP:80357962
2752 2752 -, c, t dbSNP:80357948
2752 2752 a, c, g, t dbSNP:799917
2752 2752 c, tt dbSNP:397508986
2753 2753 a, g dbSNP:587782608
2756 2756 -, t dbSNP:80357912
2757 2757 -, t dbSNP:397508987
2761 2761 -, a dbSNP:587781423
2765 2765 a, g dbSNP:754222140
2770 2770 a, g dbSNP:786203689
2772 2772 a, g dbSNP:80357230
2774 2774 a, g dbSNP:730881451
2775 2775 a, g, t dbSNP:80357251
2778 2778 ac, ga dbSNP:730881460
2778 2778 c, g dbSNP:587782370
2781 2781 a, g, t dbSNP:397508988
2783 2783 -, a dbSNP:397508989
2784 2784 a, g, t dbSNP:184374817
2786 2786 -, tgc dbSNP:80357513
2788 2788 c, t dbSNP:431825391
2790 2790 a, g dbSNP:80357120
2794 2794 -, t dbSNP:786203592
2794 2794 -, t dbSNP:398122663
2796 2796 c, t dbSNP:762310583
2797 2797 -, ct dbSNP:397508990
2797 2797 c, g dbSNP:587782134
2798 2798 -, a dbSNP:80357541
2799 2799 -, a, g dbSNP:397508991
2802 2802 c, t dbSNP:80357480
2805 2805 -, t dbSNP:397508992
2806 2806 c, t dbSNP:769712441
2808 2808 a, g dbSNP:80357200
2809 2809 g, t dbSNP:80356874
2810 2810 -, g dbSNP:80357659
2810 2810 g, t dbSNP:786201677
2811 2811 -, t dbSNP:397508993
2814 2814 c, t dbSNP:137998759
2815 2815 -, taaa dbSNP:80357518
2815 2815 c, t dbSNP:397508994
2816 2816 -, aaag dbSNP:80357891
2817 2817 a, c, t dbSNP:80357170
2819 2819 -, gaaa dbSNP:80357596
2819 2819 -, ga dbSNP:397508995
2819 2819 g, t dbSNP:587781771
2821 2821 -, aa dbSNP:80357971
2822 2822 -, a dbSNP:397508996
2823 2823 -, caaa dbSNP:397508998
2823 2823 c, t dbSNP:397508997
2824 2824 a, g dbSNP:587781914
2825 2825 -, aa dbSNP:80357636
2826 2826 -, a dbSNP:398122664
2826 2826 -, a dbSNP:273899687
2826 2826 a, t dbSNP:80357188
2829 2829 -, a dbSNP:397508999
2829 2829 c, g dbSNP:770583134
2830 2830 -, a dbSNP:80357549
2830 2830 c, t dbSNP:587776484
2831 2831 -, a dbSNP:606231390
2832 2832 a, g dbSNP:80357420
2834 2834 -, a dbSNP:397509000
2840 2840 -, tt dbSNP:80357899
2842 2842 -, tt dbSNP:397509001
2842 2842 c, t dbSNP:397507202
2845 2845 a, g dbSNP:747287311
2846 2846 a, c, g dbSNP:398122665
2847 2847 -, at dbSNP:80357717
2849 2849 -, t dbSNP:80357594
2850 2850 c, g, t dbSNP:80357035
2853 2853 c, t dbSNP:397509002
2854 2854 a, g dbSNP:397507203
2859 2859 -, gaag dbSNP:80357731
2862 2862 g, t dbSNP:80356978
2864 2864 -, aaatc dbSNP:80357712
2865 2865 -, aatc dbSNP:80357917
2866 2866 -, atcaa dbSNP:397509003
2866 2866 -, a dbSNP:80357685
2866 2866 -, a dbSNP:80357614
2866 2866 a, t dbSNP:80357127
2867 2867 -, tcaa dbSNP:80357605
2868 2868 -, c dbSNP:397509005
2868 2868 c, t dbSNP:397509004
2872 2872 a, g dbSNP:431825392
2873 2873 a, g dbSNP:1800740
2875 2875 a, g dbSNP:397507204
2878 2878 a, g dbSNP:199954851
2879 2879 a, t dbSNP:273899688
2880 2880 g, t dbSNP:80357419
2883 2883 -, tc dbSNP:80357540
2884 2884 -, ct dbSNP:397509007
2885 2885 -, t dbSNP:397509008
2886 2886 a, t dbSNP:398122666
2888 2888 -, a dbSNP:80357942
2888 2888 -, t dbSNP:398122667
2889 2889 -, a dbSNP:397509009
2890 2890 c, t dbSNP:587781492
2892 2892 a, c dbSNP:397509010
2894 2894 g, t dbSNP:398122668
2897 2897 c, t dbSNP:755516286
2898 2898 a, g dbSNP:80357361
2899 2899 c, t dbSNP:80357008
2901 2901 c, t dbSNP:80357377
2902 2902 -, a dbSNP:80357703
2904 2904 -, acag dbSNP:80357822
2905 2905 c, g, t dbSNP:80357460
2906 2906 -, a dbSNP:80357812
2907 2907 -, gtta dbSNP:80357661
2910 2910 a, g dbSNP:760877199
2913 2913 a, c, g dbSNP:4986847
2914 2914 -, t dbSNP:398122669
2915 2915 c, t dbSNP:786201104
2922 2922 a, g dbSNP:80356995
2923 2923 a, g dbSNP:202004680
2929 2929 c, t dbSNP:80357256
2931 2931 g, t dbSNP:763639161
2934 2934 a, g dbSNP:762589415
2936 2936 -, tggt dbSNP:80357840
2938 2938 -, gt dbSNP:397509011
2938 2938 a, g dbSNP:80356941
2939 2939 -, t dbSNP:80357998
2940 2940 c, t dbSNP:80357223
2945 2945 -, a dbSNP:397509012
2946 2946 -, gata dbSNP:80357832
2948 2948 -, taag dbSNP:397509013
2948 2948 g, t dbSNP:730881485
2952 2952 -, cc dbSNP:730882056
2952 2952 cc, g dbSNP:273899689
2954 2954 a, g dbSNP:80356851
2958 2958 g, t dbSNP:80357077
2959 2959 a, g dbSNP:745954644
2962 2962 a, g dbSNP:776512377
2970 2970 -, t dbSNP:397509014
2971 2971 a, g dbSNP:770769275
2972 2972 a, t dbSNP:80357458
2974 2974 c, gta dbSNP:386134270
2974 2974 -, gta dbSNP:80358332
2974 2974 -, gt dbSNP:397509015
2974 2974 c, g dbSNP:746727823
2975 2975 -, t dbSNP:80357519
2976 2976 -, at dbSNP:397509016
2980 2980 -, aa dbSNP:80357984
2980 2980 a, g dbSNP:778118145
2984 2984 -, aggctctagg dbSNP:397509017
2986 2986 a, g dbSNP:730881486
2988 2988 -, t dbSNP:397509018
2996 2996 -, tt dbSNP:397509019
3000 3000 c, t dbSNP:730881452
3002 3002 a, c, g dbSNP:559190752
3003 3003 -, tcatc dbSNP:80357819
3004 3004 -, t dbSNP:397507205
3004 3004 a, c dbSNP:80357295
3005 3005 a, g dbSNP:748285767
3006 3006 -, tctca dbSNP:80357961
3008 3008 -, t dbSNP:80357929
3009 3009 c, t dbSNP:80356973
3010 3010 -, a dbSNP:397509020
3011 3011 -, a dbSNP:80357693
3012 3012 -, ttcag dbSNP:397509021
3012 3012 a, c, t dbSNP:80356878
3016 3016 a, g dbSNP:779153035
3017 3017 a, c dbSNP:587782743
3019 3019 a, g dbSNP:397509022
3021 3021 a, c dbSNP:786203786
3023 3023 c, t dbSNP:201190540
3024 3024 a, g dbSNP:80356955
3025 3025 a, g dbSNP:780367532
3027 3027 -, a dbSNP:80357559
3028 3028 c, t dbSNP:730881443
3029 3029 -, tg dbSNP:80357890
3038 3038 c, t dbSNP:786202249
3039 3039 a, t dbSNP:273899690
3042 3042 -, tc dbSNP:398122670
3045 3045 a, g dbSNP:587781641
3049 3049 a, g dbSNP:756559408
3050 3050 -, a dbSNP:80357893
3050 3050 a, c dbSNP:431825394
3051 3051 a, c dbSNP:80357478
3053 3053 c, t dbSNP:786203804
3054 3054 g, t dbSNP:397509023
3055 3055 a, g dbSNP:587782721
3055 3055 -, g dbSNP:80357573
3057 3057 c, g dbSNP:80357080
3060 3060 -, tt dbSNP:80357611
3060 3060 c, t dbSNP:763845063
3061 3061 -, t dbSNP:397509024
3061 3061 a, c, t dbSNP:80356872
3062 3062 a, c dbSNP:730881487
3063 3063 c, t dbSNP:80357497
3070 3070 -, cc dbSNP:397509025
3070 3070 c, t dbSNP:141465583
3071 3071 a, g dbSNP:273899691
3074 3074 g, t dbSNP:80357115
3074 3074 -, t dbSNP:80357741
3075 3075 a, c, t dbSNP:80356970
3076 3076 a, g dbSNP:80356985
3078 3078 -, a dbSNP:730881439
3080 3080 -, a dbSNP:80357876
3083 3083 a, t dbSNP:587780799
3084 3084 a, c dbSNP:776568544
3085 3085 -, c dbSNP:730881461
3092 3092 -, t dbSNP:397509026
3092 3092 -, t dbSNP:80357627
3095 3095 -, c dbSNP:397509027
3103 3103 a, c, t dbSNP:397507206
3106 3106 c, t dbSNP:4986848
3107 3107 -, t dbSNP:397509028
3108 3108 a, g dbSNP:397509029
3109 3109 c, t dbSNP:760588785
3113 3113 -, aactaaa dbSNP:397509030
3114 3114 -, actaaatgtaagaaaaa dbSNP:397509031
3119 3119 -, a dbSNP:34725869
3119 3119 a, g dbSNP:772854836
3120 3120 a, c, t dbSNP:144853230
3120 3120 -, t dbSNP:80357502
3121 3121 -, gt dbSNP:397507207
3127 3127 a, g dbSNP:786202898
3130 3130 -, aa dbSNP:80357829
3130 3130 -, a dbSNP:397509032
3135 3135 ct, ta dbSNP:273899692
3135 3135 a, c, t dbSNP:80356848
3138 3138 -, gaggaa dbSNP:80358333
3138 3138 a, g dbSNP:80357124
3139 3139 -, a dbSNP:80357991
3140 3140 g, t dbSNP:748410422
3142 3142 -, a dbSNP:80357601
3143 3143 a, g dbSNP:774644946
3144 3144 a, g dbSNP:786202665
3145 3145 -, a dbSNP:80357846
3148 3148 -, tt dbSNP:80357617
3149 3149 c, t dbSNP:786201587
3150 3150 c, g dbSNP:786202534
3152 3152 a, g dbSNP:786201784
3153 3153 -, g dbSNP:80357937
3156 3156 -, catt dbSNP:80357994
3158 3158 -, ttca dbSNP:80357749
3160 3160 c, g dbSNP:80357168
3162 3162 a, c, g dbSNP:56321129
3164 3164 a, g dbSNP:1800704
3166 3166 a, c dbSNP:273899696
3169 3169 -, ct dbSNP:80357510
3177 3177 -, ga dbSNP:397507208
3180 3180 a, g, t dbSNP:80356933
3181 3181 a, c, t dbSNP:80357020
3184 3184 -, g dbSNP:80357746
3186 3186 a, g dbSNP:80357154
3187 3187 -, tgaga dbSNP:80357866
3189 3189 g, t dbSNP:80357004
3192 3192 -, nnnnn, tgaga dbSNP:80357856
3193 3193 -, tgaga dbSNP:80357547
3195 3195 a, g dbSNP:80357311
3200 3200 a, g dbSNP:781435355
3205 3205 c, t dbSNP:786202070
3206 3206 -, a dbSNP:786202906
3211 3211 a, g dbSNP:757579891
3212 3212 a, c, g dbSNP:397509033
3214 3214 c, t dbSNP:397509034
3215 3215 a, c dbSNP:786201258
3220 3220 a, g dbSNP:80357386
3222 3222 c, t dbSNP:80357049
3223 3223 a, g, t dbSNP:80357459
3224 3224 -, taataacatta dbSNP:80357647
3226 3226 a, g dbSNP:753286589
3231 3231 a, g, t dbSNP:786203979
3233 3233 a, t dbSNP:786204265
3237 3237 a, g, t dbSNP:273899698
3240 3240 -, taacattagagaaa dbSNP:80357967
3244 3244 -, t dbSNP:273899699
3245 3245 -, t dbSNP:606231391
3246 3246 c, t dbSNP:766381694
3247 3247 -, ttaaag dbSNP:80357920
3248 3248 -, t dbSNP:397507209
3248 3248 -, t dbSNP:80357841
3252 3252 g, t dbSNP:80357161
3253 3253 a, c, g, t dbSNP:16941
3254 3254 agcc, ga dbSNP:273899700
3259 3259 a, g dbSNP:4986852
3262 3262 c, g dbSNP:397509035
3265 3265 -, gcaatattaa dbSNP:397509036
3265 3265 a, g dbSNP:767217821
3267 3267 a, g dbSNP:587782630
3269 3269 -, tattaatgaa dbSNP:730881462
3270 3270 a, g dbSNP:80357271
3280 3280 c, t dbSNP:397509037
3283 3283 a, g, t dbSNP:80356899
3284 3284 c, t dbSNP:80356837
3285 3285 -, t dbSNP:397509038
3291 3291 a, g dbSNP:398122671
3292 3292 c, g dbSNP:397509039
3294 3294 a, g dbSNP:768995134
3295 3295 -, a dbSNP:397509040
3295 3295 a, g dbSNP:398122672
3297 3297 -, g dbSNP:397509042
3297 3297 -, g dbSNP:397509041
3297 3297 g, t dbSNP:786203587
3298 3298 -, g dbSNP:80357769
3303 3303 a, g dbSNP:749417532
3304 3304 -, nnnn dbSNP:587777910
3304 3304 -, g dbSNP:397509043
3307 3307 c, g dbSNP:587781588
3308 3308 -, c dbSNP:397509044
3309 3309 -, agta dbSNP:397509045
3309 3309 a, g dbSNP:80357479
3310 3310 a, g dbSNP:587776487
3311 3311 c, t dbSNP:746394738
3314 3314 -, t dbSNP:397507210
3318 3318 g, t dbSNP:80357424
3319 3319 a, c dbSNP:80357184
3321 3321 -, a dbSNP:80357702
3323 3323 -, a dbSNP:397509046
3325 3325 g, t dbSNP:397507211
3328 3328 cc, g dbSNP:273899701
3330 3330 a, t dbSNP:273899702
3333 3333 -, g dbSNP:80357511
3334 3334 -, g dbSNP:80357883
3344 3344 -, t dbSNP:398122673
3349 3349 c, g dbSNP:397507212
3351 3351 -, g dbSNP:397509047
3351 3351 a, g dbSNP:41293445
3353 3353 a, g dbSNP:528254652
3354 3354 -, c dbSNP:80357923
3358 3358 a, g dbSNP:757632961
3360 3360 a, g dbSNP:80357263
3361 3361 c, g dbSNP:786202155
3365 3365 c, g dbSNP:778607600
3366 3366 -, a dbSNP:273899703
3367 3367 c, g dbSNP:80357313
3368 3368 -, ag dbSNP:80357635
3368 3368 a, t dbSNP:397509048
3378 3378 c, t dbSNP:754597283
3379 3379 a, t dbSNP:80357145
3382 3382 a, g dbSNP:753440254
3384 3384 a, g dbSNP:779459487
3387 3387 a, c, g dbSNP:397507213
3388 3388 c, t dbSNP:786203958
3393 3393 -, a dbSNP:80357517
3394 3394 -, a dbSNP:80357625
3395 3395 -, a, ga dbSNP:80357624
3396 3396 -, ga dbSNP:80357764
3397 3397 -, t dbSNP:80357858
3397 3397 a, c, g, t dbSNP:80357006
3400 3400 c, g dbSNP:80357172
3402 3402 -, g dbSNP:397509049
3403 3403 a, t dbSNP:80356901
3407 3407 g, t dbSNP:767544239
3408 3408 c, t dbSNP:80357402
3410 3410 a, g, t dbSNP:369925993
3415 3415 a, g dbSNP:751368643
3416 3416 g, t dbSNP:764458412
3417 3417 g, t dbSNP:587778117
3419 3419 -, c dbSNP:397509050
3425 3425 -, a dbSNP:397509051
3426 3426 a, c, t dbSNP:80357485
3426 3426 -, c dbSNP:80357533
3427 3427 a, g dbSNP:273899704
3428 3428 -, aa dbSNP:80357686
3428 3428 -, nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:483353088
3429 3429 -, a dbSNP:397509052
3429 3429 a, t dbSNP:587782864
3432 3432 -, ct dbSNP:80357992
3436 3436 -, c dbSNP:80357815
3436 3436 c, t dbSNP:80357201
3442 3442 a, g dbSNP:41293447
3445 3445 a, g dbSNP:80356900
3448 3448 a, g, t dbSNP:80357135
3449 3449 a, t dbSNP:80357317
3453 3453 a, c dbSNP:80357288
3454 3454 -, a dbSNP:397509054
3456 3456 c, t dbSNP:45599040
3459 3459 g, t dbSNP:80357106
3460 3460 -, aaat dbSNP:80357763
3463 3463 -, taaa dbSNP:397509055
3463 3463 -, ta dbSNP:786202791
3465 3465 -, aaaaa dbSNP:80357680
3466 3466 -, aaaa dbSNP:80357575
3467 3467 -, aaa dbSNP:80358334
3467 3467 a, c, g dbSNP:41293449
3468 3468 -, aagc dbSNP:80357777
3468 3468 -, aag dbSNP:80358335
3469 3469 -, agca dbSNP:80357701
3469 3469 -, a dbSNP:80357692
3469 3469 -, ag dbSNP:80357525
3469 3469 -, a dbSNP:397509056
3470 3470 -, a dbSNP:80357996
3470 3470 a, g dbSNP:775885098
3471 3471 -, caag dbSNP:80357903
3471 3471 c, t dbSNP:80357089
3473 3473 -, agaa dbSNP:397509057
3473 3473 -, a dbSNP:80357966
3479 3479 g, t dbSNP:80357421
3480 3480 g, t dbSNP:80357278
3482 3482 -, agaa dbSNP:397509058
3483 3483 -, g dbSNP:273899705
3484 3484 -, aag dbSNP:80358336
3486 3486 -, aag dbSNP:587782821
3486 3486 c, g dbSNP:55909400
3487 3487 g, t dbSNP:786203153
3491 3491 -, t dbSNP:80357785
3492 3492 c, t dbSNP:397507215
3494 3494 -, ga dbSNP:397509059
3494 3494 g, t dbSNP:80357334
3495 3495 a, t dbSNP:80356949
3497 3497 c, t dbSNP:772383323
3497 3497 -, t dbSNP:80357827
3498 3498 -, gt dbSNP:80357945
3498 3498 a, c, g dbSNP:748894760
3499 3499 -, ttaat dbSNP:397509060
3499 3499 -, tt dbSNP:80357843
3502 3502 -, a dbSNP:80357865
3502 3502 a, g dbSNP:80356919
3505 3505 -, ca dbSNP:80357892
3507 3507 g, t dbSNP:80356867
3512 3512 c, t dbSNP:786203431
3515 3515 -, tc dbSNP:80357828
3517 3517 -, c dbSNP:397509061
3517 3517 c, t dbSNP:80356887
3521 3521 c, t dbSNP:781319410
3529 3529 c, g dbSNP:80357405
3530 3530 -, a dbSNP:80357900
3530 3530 a, g dbSNP:757237039
3532 3532 at, ta dbSNP:786203428
3534 3534 a, g dbSNP:530464947
3536 3536 c, t dbSNP:764013144
3537 3537 -, tt dbSNP:80357577
3538 3538 a, g, t dbSNP:80356971
3540 3540 g, t dbSNP:80357018
3541 3541 a, t dbSNP:762744684
3542 3542 a, g dbSNP:752875919
3543 3543 c, g, t dbSNP:80357136
3546 3546 a, c, t dbSNP:431825395
3547 3547 c, g dbSNP:80357329
3549 3549 a, g dbSNP:771479616
3550 3550 c, t dbSNP:80357297
3551 3551 a, g dbSNP:786202900
3553 3553 -, g dbSNP:397509063
3555 3555 a, c dbSNP:587781765
3556 3556 -, g dbSNP:397509064
3556 3556 g, t dbSNP:80357228
3557 3557 -, t dbSNP:273899706
3558 3558 -, agt dbSNP:80358337
3558 3558 a, g dbSNP:2227945
3560 3560 -, t dbSNP:397509065
3564 3564 c, g dbSNP:80357101
3566 3566 a, g dbSNP:80356843
3568 3568 c, g, t dbSNP:80357434
3568 3568 c, ta dbSNP:397509066
3570 3570 c, t dbSNP:80357369
3571 3571 a, g dbSNP:773638815
3572 3572 a, g, t dbSNP:80356922
3573 3573 g, t dbSNP:431825396
3575 3575 c, t dbSNP:786201222
3576 3576 -, tgtt dbSNP:397509067
3577 3577 a, c, g dbSNP:80357247
3582 3582 -, g dbSNP:80357808
3588 3588 c, t dbSNP:80357272
3589 3589 c, t dbSNP:587782752
3590 3590 -, t dbSNP:397509069
3590 3590 -, t dbSNP:397509068
3594 3594 a, g dbSNP:80357175
3602 3602 -, a dbSNP:80357857
3603 3603 c, g dbSNP:80357484
3608 3608 -, t dbSNP:397509070
3612 3612 g, t dbSNP:397509072
3617 3617 -, aaag dbSNP:80357781
3617 3617 aaa, c dbSNP:273899707
3618 3618 -, aaggaagata dbSNP:786203694
3619 3619 -, aggaagatact dbSNP:80357910
3619 3619 -, aggaagatac dbSNP:397509073
3621 3621 -, gaagatactag dbSNP:80357877
3621 3621 -, g dbSNP:397509074
3621 3621 g, t dbSNP:786203438
3625 3625 -, a dbSNP:80357509
3627 3627 a, g dbSNP:769456095
3628 3628 c, t dbSNP:80356918
3631 3631 g, t dbSNP:397509075
3634 3634 -, tt dbSNP:397509076
3636 3636 c, g dbSNP:745418679
3643 3643 -, a dbSNP:397509077
3643 3643 -, a dbSNP:397507216
3645 3645 -, gacat dbSNP:397509078
3648 3648 a, t dbSNP:273899708
3649 3649 a, t dbSNP:780869838
3650 3650 g, t dbSNP:183119644
3651 3651 a, t dbSNP:730882164
3653 3653 a, g dbSNP:786202844
3654 3654 g, t dbSNP:397509079
3655 3655 a, g dbSNP:80357206
3658 3658 a, g dbSNP:746949187
3666 3666 a, g dbSNP:777796838
3667 3667 a, t dbSNP:80357027
3671 3671 -, t dbSNP:761143251
3671 3671 -, t dbSNP:80357621
3675 3675 a, c dbSNP:587782188
3680 3680 -, cg dbSNP:397509080
3681 3681 a, g dbSNP:56336919
3682 3682 c, t dbSNP:80357032
3684 3684 c, t dbSNP:80357296
3688 3688 -, aa dbSNP:80357956
3688 3688 a, g dbSNP:16942
3689 3689 -, ag dbSNP:730882057
3689 3689 ag, t dbSNP:273899709
3693 3693 g, t dbSNP:397509081
3695 3695 g, t dbSNP:587779368
3700 3700 a, g dbSNP:80356975
3709 3709 -, ct dbSNP:80357845
3709 3709 c, t dbSNP:755209182
3711 3711 -, nnnn dbSNP:483353089
3714 3714 c, t dbSNP:754014157
3715 3715 -, aa dbSNP:397509082
3716 3716 c, t dbSNP:766447664
3718 3718 -, t dbSNP:397509083
3719 3719 -, t dbSNP:587782824
3720 3720 -, a dbSNP:80357663
3720 3720 a, g dbSNP:369982706
3721 3721 -, c dbSNP:273900710
3721 3721 c, t dbSNP:80357290
3722 3722 c, t dbSNP:786202722
3723 3723 -, c dbSNP:397509084
3724 3724 a, g dbSNP:28897685
3726 3726 -, a dbSNP:80357531
3727 3727 a, c, t dbSNP:80356944
3733 3733 -, tt dbSNP:80357562
3733 3733 a, t dbSNP:397509085
3736 3736 -, ctcaggg dbSNP:397509086
3736 3736 c, t dbSNP:587782458
3738 3738 c, t dbSNP:62625307
3739 3739 -, ag dbSNP:398122674
3740 3740 c, g, t dbSNP:56214134
3741 3741 a, g dbSNP:55725337
3743 3743 g, t dbSNP:80356830
3747 3747 c, g, t dbSNP:62625308
3748 3748 a, g dbSNP:55930959
3752 3752 -, a dbSNP:80357980
3752 3752 a, g dbSNP:537737635
3753 3753 a, c, g dbSNP:80357294
3755 3755 a, g dbSNP:750113197
3759 3759 a, g, t dbSNP:80357455
3760 3760 -, a dbSNP:80357926
3761 3761 aa, gaaatt dbSNP:397509087
3762 3762 -, a dbSNP:80357512
3762 3762 a, g dbSNP:80357152
3763 3763 -, a dbSNP:606231393
3764 3764 -, a dbSNP:397509088
3765 3765 g, t dbSNP:273900711
3765 3765 -, t dbSNP:387906564
3766 3766 -, t dbSNP:397509089
3766 3766 g, t dbSNP:786203884
3766 3766 -, t dbSNP:80357571
3767 3767 -, a dbSNP:80357729
3767 3767 a, g dbSNP:770579978
3768 3768 -, g dbSNP:397509090
3769 3769 -, ag dbSNP:80357589
3776 3776 a, g dbSNP:148038877
3780 3780 a, g, t dbSNP:80356923
3782 3782 -, ga dbSNP:80357805
3782 3782 a, g, t dbSNP:398122675
3784 3784 a, g dbSNP:786203310
3785 3785 c, g dbSNP:758329415
3787 3787 g, t dbSNP:397509091
3788 3788 -, a dbSNP:80357902
3789 3789 -, a, t dbSNP:80357831
3789 3789 c, t dbSNP:273900712
3790 3790 c, g dbSNP:398122676
3792 3792 a, g, t dbSNP:80356894
3795 3795 a, g dbSNP:80356921
3797 3797 c, g dbSNP:80356876
3798 3798 -, g dbSNP:786202963
3799 3799 a, g, t dbSNP:766572561
3801 3801 g, t dbSNP:80357310
3802 3802 a, c dbSNP:273900713
3804 3804 -, gag dbSNP:587781779
3804 3804 g, t dbSNP:80357356
3811 3811 -, nnnn, ttcc dbSNP:80357797
3812 3812 -, c dbSNP:398122677
3816 3816 -, ttcc dbSNP:80357671
3821 3821 -, a dbSNP:35999570
3821 3821 a, t dbSNP:730881488
3823 3823 -, a dbSNP:397507217
3824 3824 c, t dbSNP:786201623
3825 3825 c, t dbSNP:767958299
3828 3828 c, t dbSNP:786201581
3829 3829 g, t dbSNP:80357162
3831 3831 c, t dbSNP:41293451
3833 3833 -, t dbSNP:397509092
3835 3835 -, gtaa dbSNP:397509093
3837 3837 a, g dbSNP:774679104
3838 3838 a, g dbSNP:80357141
3839 3839 -, a dbSNP:80357873
3839 3839 a, g dbSNP:368690455
3840 3840 -, gtaaa dbSNP:80357609
3840 3840 a, g dbSNP:763354142
3842 3842 a, g dbSNP:587780862
3844 3844 -, acaa dbSNP:397509094
3844 3844 -, a dbSNP:397509095
3846 3846 -, aatatacc dbSNP:80357552
3846 3846 -, aa dbSNP:80357666
3848 3848 g, t dbSNP:28897687
3850 3850 -, t dbSNP:80357564
3851 3851 -, ta dbSNP:777371832
3851 3851 a, g dbSNP:80357388
3853 3853 c, g, t dbSNP:28897688
3854 3854 c, t dbSNP:140777892
3855 3855 c, tct dbSNP:273900714
3855 3855 -, t dbSNP:397509096
3856 3856 -, c dbSNP:397509097
3857 3857 a, t dbSNP:730881453
3858 3858 c, t dbSNP:80356903
3862 3862 -, ctactaggcatagcaccgt dbSNP:80359882
3862 3862 a, c, g dbSNP:80357143
3863 3863 c, t dbSNP:772759939
3864 3864 a, g dbSNP:80357037
3876 3876 -, a dbSNP:80357578
3876 3876 a, g dbSNP:587776488
3878 3878 c, t dbSNP:778655093
3879 3879 a, g dbSNP:80357191
3886 3886 c, g dbSNP:80357099
3887 3887 c, t dbSNP:587780801
3888 3888 a, g, t dbSNP:28897686
3890 3890 c, g dbSNP:145903082
3891 3891 c, t dbSNP:757215735
3893 3893 a, t dbSNP:397509098
3895 3895 -, tgtc dbSNP:80357963
3896 3896 -, gtct dbSNP:80357868
3896 3896 -, gt dbSNP:397509099
3896 3896 c, g dbSNP:752122039
3898 3898 a, c, g dbSNP:397509100
3899 3899 -, t dbSNP:80357687
3899 3899 -, ta dbSNP:80357520
3899 3899 g, t dbSNP:80356852
3899 3899 -, t dbSNP:431825398
3900 3900 -, t dbSNP:80357986
3900 3900 a, g dbSNP:80357362
3901 3901 -, ag dbSNP:80357645
3901 3901 -, tt dbSNP:80357928
3902 3902 -, ga dbSNP:397509102
3903 3903 -, aa dbSNP:397509103
3904 3904 -, a dbSNP:80357848
3906 3906 -, a dbSNP:80357704
3907 3907 -, ca dbSNP:730881440
3908 3908 a, g dbSNP:786202803
3909 3909 -, ga dbSNP:80357579
3910 3910 -, ag dbSNP:80357993
3911 3911 -, ggagaatt dbSNP:397509104
3911 3911 c, gg dbSNP:397507218
3911 3911 -, gg dbSNP:80357810
3912 3912 g, t dbSNP:397509105
3914 3914 -, ga dbSNP:397509106
3914 3914 a, g, t dbSNP:431825399
3916 3916 a, c dbSNP:483353090
3917 3917 -, t dbSNP:80357798
3918 3918 -, a dbSNP:80357849
3919 3919 -, t dbSNP:397509107
3920 3920 a, g dbSNP:753081589
3922 3922 c, g, t dbSNP:397507219
3922 3922 -, t dbSNP:80357545
3923 3923 a, g, t dbSNP:80356831
3925 3925 a, c, t dbSNP:80357269
3934 3934 -, a dbSNP:80357767
3937 3937 c, g, t dbSNP:80357160
3938 3938 c, g, t dbSNP:200648498
3940 3940 c, t dbSNP:587782190
3943 3943 a, g dbSNP:273900716
3944 3944 c, g, t dbSNP:140588714
3947 3947 c, g, t dbSNP:786202569
3953 3953 -, t dbSNP:397509108
3954 3954 -, t dbSNP:397509109
3955 3955 a, g dbSNP:772703445
3956 3956 a, c dbSNP:786201893
3957 3957 c, t dbSNP:80357208
3958 3958 a, g dbSNP:431825400
3960 3960 -, g dbSNP:80357616
3960 3960 -, g dbSNP:397509110
3962 3962 -, t dbSNP:397509111
3962 3962 a, c dbSNP:372396487
3963 3963 a, g dbSNP:80357280
3965 3965 -, a dbSNP:397507220
3969 3969 c, g dbSNP:397509112
3970 3970 -, c dbSNP:80357878
3970 3970 c, t dbSNP:730881489
3975 3975 a, g dbSNP:80357036
3979 3979 aggc, ctcag dbSNP:273900717
3981 3981 -, cag dbSNP:80358338
3981 3981 -, ca dbSNP:80357584
3981 3981 c, t dbSNP:80356866
3982 3982 a, c dbSNP:80357483
3984 3984 -, g dbSNP:397509113
3985 3985 a, t dbSNP:80357217
3988 3988 a, g dbSNP:80357047
3991 3991 a, g dbSNP:80357499
3992 3992 -, ac dbSNP:397507221
3992 3992 -, c dbSNP:397507222
3992 3992 c, t dbSNP:776070899
3996 3996 -, agtg dbSNP:80357842
3996 3996 -, a dbSNP:80357855
3997 3997 c, g dbSNP:142383077
3998 3998 -, tgag dbSNP:80357889
4002 4002 -, g dbSNP:273900718
4007 4007 -, aaaat dbSNP:80357560
4008 4008 a, g, t dbSNP:80357254
4009 4009 -, aa dbSNP:80357918
4009 4009 a, c dbSNP:431825401
4011 4011 -, c dbSNP:397509114
4012 4012 a, g dbSNP:781212379
4014 4014 c, t dbSNP:786203823
4014 4014 -, t dbSNP:587780802
4016 4016 -, t dbSNP:397509115
4017 4017 c, g dbSNP:397507223
4018 4018 a, c, t dbSNP:80357213
4020 4020 -, agct dbSNP:397509116
4021 4021 c, g dbSNP:776996813
4031 4031 -, ttc dbSNP:80358339
4033 4033 a, c, t dbSNP:80357440
4035 4035 c, t dbSNP:80357038
4037 4037 g, t dbSNP:398122678
4040 4040 c, t dbSNP:730881454
4041 4041 -, ag dbSNP:80357646
4041 4041 a, g dbSNP:786203580
4043 4043 a, t dbSNP:273900719
4044 4044 g, t dbSNP:80357461
4048 4048 -, t dbSNP:80357634
4050 4050 -, g dbSNP:397509117
4054 4054 -, a dbSNP:397509118
4054 4054 a, t dbSNP:431825402
4056 4056 -, tt dbSNP:80357678
4058 4058 c, g dbSNP:786202068
4066 4066 -, a dbSNP:397509119
4067 4067 -, taca dbSNP:397509120
4069 4069 a, c, t dbSNP:80357257
4071 4071 -, aaca dbSNP:80357864
4072 4072 -, a dbSNP:80357504
4076 4076 c, t dbSNP:753210219
4077 4077 c, t dbSNP:80357318
4078 4078 a, g dbSNP:765729710
4080 4080 a, g dbSNP:80356954
4081 4081 a, t dbSNP:759916956
4084 4084 a, c, g dbSNP:80357500
4092 4092 a, g dbSNP:397509121
4094 4094 g, t dbSNP:750107618
4095 4095 a, g dbSNP:431825403
4096 4096 a, g dbSNP:587782634
4098 4098 c, t dbSNP:80356855
4102 4102 a, c, g dbSNP:386833394
4104 4104 a, t dbSNP:80357343
4105 4105 a, c, t dbSNP:80357042
4106 4106 -, a dbSNP:80357979
4107 4107 -, c dbSNP:397509122
4107 4107 c, t dbSNP:80357262
4109 4109 -, aa dbSNP:587782834
4110 4110 a, t dbSNP:587782241
4112 4112 -, g dbSNP:80357987
4113 4113 -, a dbSNP:80357904
4115 4115 a, g dbSNP:761424661
4120 4120 a, g dbSNP:730881444
4121 4121 -, g dbSNP:397509123
4122 4122 -, t dbSNP:397509124
4129 4129 a, g dbSNP:773709174
4131 4131 c, t dbSNP:397507224
4133 4133 a, c, g dbSNP:70953658
4135 4135 g, t dbSNP:730881490
4139 4139 -, t dbSNP:397509125
4141 4141 -, g dbSNP:397509127
4142 4142 -, tctg dbSNP:397509128
4151 4151 c, g dbSNP:80356886
4152 4152 a, c, g dbSNP:12946486
4155 4155 a, g, t dbSNP:80357021
4158 4158 c, t dbSNP:786201646
4161 4161 a, g dbSNP:762908108
4166 4166 a, c, g dbSNP:80356828
4168 4168 a, t dbSNP:775339017
4171 4171 a, g dbSNP:55639854
4172 4172 -, tga dbSNP:397509129
4172 4172 a, t dbSNP:769589630
4174 4174 a, t dbSNP:745638837
4175 4175 -, a dbSNP:80357711
4176 4176 -, gaa dbSNP:80358340
4176 4176 a, g dbSNP:80357407
4177 4177 -, aa dbSNP:273900721
4178 4178 -, aaga dbSNP:431825404
4179 4179 a, g dbSNP:28897689
4180 4180 a, g dbSNP:80357210
4181 4181 -, ag dbSNP:80357727
4183 4183 -, g dbSNP:397509130
4185 4185 a, c dbSNP:80357231
4186 4186 c, t dbSNP:80357345
4187 4187 a, g dbSNP:758515222
4188 4188 g, t dbSNP:748674194
4189 4189 -, g dbSNP:397509131
4190 4190 -, g dbSNP:483353092
4190 4190 c, t dbSNP:779507799
4191 4191 c, t dbSNP:139858874
4192 4192 -, t dbSNP:80357779
4192 4192 a, t dbSNP:397509132
4194 4194 a, g, t dbSNP:80357202
4197 4197 -, gaaaa dbSNP:397509133
4197 4197 g, t dbSNP:80357178
4201 4201 a, c dbSNP:767246037
4202 4202 -, taatcaa dbSNP:397509134
4202 4202 -, taat dbSNP:398122679
4203 4203 -, aat dbSNP:80358341
4205 4205 -, tcaa dbSNP:80357508
4206 4206 -, caag dbSNP:397509135
4211 4211 a, g dbSNP:786201475
4212 4212 a, g, t dbSNP:397509136
4213 4213 a, g dbSNP:397507225
4214 4214 a, g dbSNP:80356846
4215 4215 c, g, t dbSNP:80357456
4221 4221 a, c, g dbSNP:80357218
4222 4222 c, t dbSNP:763596987
4223 4223 a, g dbSNP:374192364
4224 4224 a, g dbSNP:775463394
4225 4225 -, a dbSNP:80357737
4228 4228 c, t dbSNP:398122680
4231 4231 a, c dbSNP:765156052
4232 4232 -, ct dbSNP:397509137
4232 4232 c, t dbSNP:786201566
4234 4234 g, t dbSNP:398122681
4234 4234 -, t dbSNP:397509138
4236 4236 a, g dbSNP:431825405
4239 4239 g, t dbSNP:786202998
4246 4246 c, t dbSNP:762028824
4250 4250 -, atct dbSNP:397509139
4250 4250 -, tg dbSNP:80357529
4251 4251 -, atct dbSNP:80357935
4251 4251 a, c, g dbSNP:774593602
4253 4253 a, g dbSNP:147448807
4253 4253 -, g dbSNP:80357861
4255 4255 a, g dbSNP:55848034
4256 4256 -, tg dbSNP:80357804
4256 4256 -, tt dbSNP:398122682
4256 4256 a, t dbSNP:397509140
4257 4257 g, t dbSNP:80357259
4260 4260 -, ag dbSNP:80357787
4262 4262 -, tg dbSNP:80357691
4263 4263 g, t dbSNP:80357397
4266 4266 a, g dbSNP:576828558
4267 4267 c, g dbSNP:80356986