
CDKL5 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CDKL5
Entrez Gene ID 6792
Full Name cyclin-dependent kinase-like 5
Synonyms EIEE2, ISSX, STK9
General protein information
Preferred Names
cyclin-dependent kinase-like 5
cyclin-dependent kinase-like 5
serine/threonine kinase 9
serine/threonine-protein kinase 9
cyclin dependent kinase 5 transcript
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Epileptic encephalopathy, early infantile, 2, 300672 (3);

The following CDKL5 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CDKL5 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu60791 XM_011545569 PREDICTED: Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu60792 XM_011545570 PREDICTED: Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu25494 NM_003159 Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant I, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu25494 NM_001037343 Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant II, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu60791
Accession Version XM_011545569.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3165bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cyclin-dependent kinase-like 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)283..1143(+)
Misc Feature(2)289..1143(+)
Misc Feature(3)307..891(+)
Misc Feature(4)307..711(+)
Misc Feature(5)427..891(+)
Misc Feature(6)706..780(+)
Position Chain Variation Link
32 32 c, g dbSNP:770287183
39 39 a, g dbSNP:373175008
62 62 c, t dbSNP:773641641
64 64 c, t dbSNP:786204994
125 125 c, t dbSNP:778858217
140 140 a, c dbSNP:771019923
168 168 c, g dbSNP:370866731
215 215 a, g dbSNP:750094933
224 224 a, g dbSNP:758128193
229 229 g, t dbSNP:372701493
234 234 a, c dbSNP:751146225
238 238 c, g dbSNP:754557968
246 246 g, t dbSNP:780970781
248 248 a, t dbSNP:79219416
259 259 a, t dbSNP:138539908
265 265 a, g dbSNP:767844474
269 269 c, t dbSNP:746036179
291 291 -, t dbSNP:267608415
303 303 a, g dbSNP:772299455
310 310 c, g dbSNP:267608418
311 311 a, g dbSNP:786204962
314 314 a, g dbSNP:587783406
317 317 -, g dbSNP:267608420
325 325 a, g dbSNP:587783130
343 343 a, g dbSNP:786204991
345 345 a, g dbSNP:140332992
357 357 a, g dbSNP:760485617
359 359 a, g dbSNP:763985235
371 371 c, t dbSNP:122460159
373 373 a, t dbSNP:587783071
377 377 a, g dbSNP:267608429
415 415 -, gaaa dbSNP:267608433
419 419 c, t dbSNP:774865696
420 420 a, g dbSNP:759058148
427 427 c, t dbSNP:62653623
432 432 a, g dbSNP:148697943
435 435 -, t dbSNP:62643608
443 443 c, t dbSNP:267608435
444 444 g, t dbSNP:145496868
446 446 a, g dbSNP:267608436
451 451 c, t dbSNP:267608437
459 459 -, ggaaaac dbSNP:786204977
463 463 a, g dbSNP:587783072
466 466 -, att dbSNP:786204960
467 467 a, c, t dbSNP:62641235
468 468 a, t dbSNP:267608439
472 472 g, t dbSNP:587783073
481 481 -, gaag dbSNP:267608441
491 491 a, g, t dbSNP:776025230
500 500 -, g dbSNP:587783109
500 500 g, t dbSNP:587783402
501 501 a, g dbSNP:764954859
502 502 a, t dbSNP:587783074
527 527 -, aa dbSNP:786204982
543 543 c, t dbSNP:138125282
556 556 a, g dbSNP:12689931
572 572 a, t dbSNP:587783076
579 579 a, t dbSNP:762793871
585 585 a, g dbSNP:786204955
591 591 a, g dbSNP:766151719
603 603 a, t dbSNP:587783077
604 604 c, t dbSNP:267608453
608 608 g, t dbSNP:587783078
627 627 c, g dbSNP:372825651
632 632 a, g dbSNP:267608468
652 652 c, t dbSNP:267608472
657 657 c, t dbSNP:786204957
665 665 c, t dbSNP:587783081
673 673 c, t dbSNP:587783082
677 677 a, t dbSNP:267608477
679 679 a, g dbSNP:746608623
689 689 a, g dbSNP:768320636
690 690 c, t dbSNP:776078892
701 701 a, g dbSNP:587783083
705 705 c, g dbSNP:762265641
707 707 g, t dbSNP:122460157
710 710 a, g dbSNP:786204985
725 725 a, c, g dbSNP:757402424
729 729 c, t dbSNP:765303813
732 732 a, g dbSNP:750878642
738 738 a, c dbSNP:758844150
758 758 -, ca dbSNP:786204987
763 763 -, gt dbSNP:786204988
765 765 a, c dbSNP:267608490
777 777 a, t dbSNP:61749700
778 778 a, c, g, t dbSNP:587783084
780 780 g, t dbSNP:786204989
784 784 a, c, t dbSNP:267608493
785 785 a, c, g dbSNP:267606715
786 786 a, g dbSNP:369535258
791 791 c, t dbSNP:61749704
794 794 a, c dbSNP:587783085
801 801 -, actt dbSNP:587783111
801 801 -, a dbSNP:267608497
808 808 a, g dbSNP:765304446
825 825 c, g dbSNP:786204958
829 829 a, g dbSNP:587783086
830 830 a, g dbSNP:267608500
839 839 c, t dbSNP:267608501
840 840 a, g dbSNP:750492179
854 854 c, t dbSNP:587783087
855 855 c, t dbSNP:763478005
859 859 g, t dbSNP:267608505
874 874 c, t dbSNP:587783405
878 878 c, g dbSNP:587783088
888 888 c, t dbSNP:751883002
908 908 a, c dbSNP:786204963
911 911 c, t dbSNP:267608511
912 912 c, t dbSNP:370073267
916 916 -, tttta dbSNP:786204990
926 926 a, g dbSNP:752118445
932 932 g, t dbSNP:267608515
939 939 a, g dbSNP:755330309
952 952 c, t dbSNP:587783089
971 971 c, g dbSNP:766475539
993 993 c, t dbSNP:752286259
994 994 c, t dbSNP:374585296
1053 1053 -, ta dbSNP:267608528
1060 1060 -, c dbSNP:587783112
1090 1090 -, ttggacccag dbSNP:61750250
1098 1098 a, g dbSNP:773523708
1104 1104 a, c dbSNP:762927814
1107 1107 a, c dbSNP:267608532
1110 1110 c, t dbSNP:766511365
1115 1115 c, t dbSNP:267606713
1119 1119 -, a dbSNP:267608537
1124 1124 a, g dbSNP:267606714
1136 1136 -, c dbSNP:267608542
1138 1138 a, g dbSNP:751995225
1140 1140 a, g dbSNP:760048639
1155 1155 -, ga dbSNP:267608546
1156 1156 c, t dbSNP:267608547
1166 1166 a, g dbSNP:767817521
1188 1188 c, t dbSNP:142665931
1189 1189 c, g dbSNP:760930296
1196 1196 a, g dbSNP:764589907
1197 1197 c, t dbSNP:17853543
1198 1198 a, t dbSNP:753370169
1203 1203 c, t dbSNP:756986206
1209 1209 -, gtctcaccacagatctaacagc dbSNP:786204964
1209 1209 a, g dbSNP:764793934
1213 1213 c, g, t dbSNP:749986393
1220 1220 a, g dbSNP:780119476
1228 1228 a, g dbSNP:371313385
1238 1238 g, t dbSNP:199916668
1239 1239 c, t dbSNP:754663076
1240 1240 c, t dbSNP:267608561
1246 1246 c, g dbSNP:781052780
1252 1252 a, g dbSNP:587783150
1255 1255 c, g dbSNP:749420859
1265 1265 a, g dbSNP:189400843
1267 1267 c, g dbSNP:774594152
1272 1272 -, c dbSNP:786204965
1272 1272 c, t dbSNP:144204039
1273 1273 a, g dbSNP:772194937
1280 1280 c, t dbSNP:775860922
1280 1280 -, t dbSNP:267608565
1283 1283 -, c dbSNP:267608566
1287 1287 c, t dbSNP:761253221
1289 1289 a, g dbSNP:755167459
1291 1291 g, t dbSNP:786204966
1299 1299 c, t dbSNP:777079786
1302 1302 a, g dbSNP:781401272
1303 1303 a, g dbSNP:764955063
1312 1312 c, t dbSNP:750150096
1317 1317 a, g, t dbSNP:148302590
1323 1323 a, t dbSNP:141452495
1335 1335 a, g dbSNP:754963806
1337 1337 g, t dbSNP:780808984
1354 1354 a, c dbSNP:752455644
1360 1360 a, g dbSNP:755949561
1364 1364 a, g dbSNP:779090061
1368 1368 a, g dbSNP:746152862
1389 1389 a, t dbSNP:772076629
1397 1397 a, c dbSNP:267608611
1406 1406 a, t dbSNP:747428764
1410 1410 a, g dbSNP:769239677
1414 1414 -, ctt dbSNP:759725174
1426 1426 a, g dbSNP:777046046
1431 1431 a, c dbSNP:762247736
1435 1435 a, g dbSNP:770340766
1439 1439 c, g dbSNP:267608618
1444 1444 a, g dbSNP:772931688
1448 1448 -, ag dbSNP:786204967
1467 1467 a, c, t dbSNP:762708691
1479 1479 a, c dbSNP:267608620
1487 1487 c, t dbSNP:377263491
1498 1498 c, t dbSNP:751110235
1505 1505 a, c dbSNP:759005252
1512 1512 -, c dbSNP:267608623
1525 1525 c, t dbSNP:587783151
1529 1529 a, c dbSNP:767464855
1531 1531 c, t dbSNP:61753977
1533 1533 c, t dbSNP:150844616
1539 1539 a, t dbSNP:139329419
1540 1540 c, t dbSNP:750590534
1541 1541 g, t dbSNP:758671947
1542 1542 -, c dbSNP:786204968
1546 1546 -, gaaagctctcaaagcaaag dbSNP:587783113
1546 1546 -, ga dbSNP:587783398
1568 1568 c, g dbSNP:779960805
1576 1576 c, t dbSNP:786204969
1579 1579 a, g dbSNP:4825262
1582 1582 a, g dbSNP:747081232
1583 1583 a, g, t dbSNP:267608629
1587 1587 a, c dbSNP:748731763
1588 1588 a, g dbSNP:770224409
1590 1590 a, g dbSNP:773733498
1598 1598 a, g dbSNP:748907380
1601 1601 a, c, g dbSNP:267608631
1618 1618 -, a dbSNP:786204970
1621 1621 -, c dbSNP:769967695
1623 1623 c, t dbSNP:773921712
1632 1632 c, t dbSNP:143992148
1633 1633 -, t dbSNP:786204971
1643 1643 c, g dbSNP:778294301
1647 1647 c, t dbSNP:372655753
1648 1648 a, g dbSNP:775336608
1652 1652 -, ccaagg dbSNP:774479468
1653 1653 a, c dbSNP:760623086
1656 1656 -, ggccaa dbSNP:587783114
1679 1679 c, g dbSNP:754063912
1701 1701 a, c dbSNP:587783152
1724 1724 c, t dbSNP:201893287
1727 1727 c, t dbSNP:779325312
1728 1728 a, g dbSNP:369561849
1735 1735 a, t dbSNP:766602493
1749 1749 c, t dbSNP:751789670
1751 1751 -, t dbSNP:786204972
1755 1755 a, g dbSNP:755082123
1765 1765 g, t dbSNP:781427744
1781 1781 c, t dbSNP:748615147
1787 1787 c, g dbSNP:756720478
1792 1792 a, g dbSNP:778464010
1797 1797 a, c dbSNP:201786426
1801 1801 a, g dbSNP:749639424
1815 1815 a, g dbSNP:147300538
1833 1833 a, t dbSNP:774046085
1837 1837 a, g dbSNP:587783153
1849 1849 c, t dbSNP:267608643
1850 1850 a, g dbSNP:745508309
1863 1863 a, g dbSNP:771556342
1864 1864 c, t dbSNP:775006943
1871 1871 c, g dbSNP:587783145
1872 1872 -, a dbSNP:587783115
1873 1873 c, t dbSNP:373370734
1874 1874 a, g dbSNP:763991639
1876 1876 c, t dbSNP:267608395
1879 1879 a, g dbSNP:587783400
1885 1885 a, g dbSNP:376341076
1893 1893 c, t dbSNP:765011302
1902 1902 a, g dbSNP:751738489
1909 1909 g, t dbSNP:267608644
1912 1912 c, t dbSNP:755177112
1914 1914 a, g dbSNP:767662661
1922 1922 c, t dbSNP:199897804
1923 1923 a, g dbSNP:371603866
1926 1926 a, g dbSNP:778407047
1931 1931 c, t dbSNP:749822712
1932 1932 g, t dbSNP:757573258
1956 1956 a, c, g dbSNP:779156340
1963 1963 c, t dbSNP:201209961
1968 1968 c, t dbSNP:267608645
1969 1969 a, g dbSNP:372629988
1983 1983 c, t dbSNP:768214366
1985 1985 -, g dbSNP:786204974
1987 1987 c, t dbSNP:776627003
1996 1996 -, a dbSNP:587783116
1996 1996 a, c dbSNP:761662406
1998 1998 -, c dbSNP:587783401
1998 1998 c, g dbSNP:141478957
2001 2001 a, c, t dbSNP:772909747
2004 2004 c, t dbSNP:767825838
2018 2018 a, g dbSNP:375650421
2019 2019 a, g dbSNP:587783154
2028 2028 c, t dbSNP:764272402
2055 2055 -, c dbSNP:786204975
2059 2059 a, c, g dbSNP:77097064
2070 2070 c, g dbSNP:754311008
2087 2087 -, tt dbSNP:587783117
2093 2093 c, t dbSNP:144878564
2094 2094 -, ta dbSNP:267608646
2108 2108 a, c dbSNP:779298697
2110 2110 -, g dbSNP:587783118
2111 2111 c, g dbSNP:750727784
2150 2150 a, g dbSNP:773251215
2155 2155 c, t dbSNP:267608647
2157 2157 a, g dbSNP:762828342
2183 2183 g, t dbSNP:770913092
2185 2185 c, t dbSNP:775783994
2187 2187 c, t dbSNP:760988585
2217 2217 -, c dbSNP:267608649
2217 2217 -, c dbSNP:267608648
2223 2223 c, g dbSNP:763419895
2233 2233 c, t dbSNP:753899592
2241 2241 a, g, t dbSNP:761995288
2246 2246 ag, nnnnnnnnnnnnnnnnnn dbSNP:672601303
2260 2260 c, t dbSNP:764423452
2267 2267 -, c dbSNP:267608651
2268 2268 a, g dbSNP:774307489
2278 2278 a, g dbSNP:747196703
2287 2287 a, g dbSNP:374518046
2306 2306 -, ac dbSNP:786204978
2308 2308 c, g dbSNP:776965205
2310 2310 a, g, t dbSNP:761789190
2319 2319 c, t dbSNP:17853544
2340 2340 a, t dbSNP:773642754
2344 2344 c, t dbSNP:17855594
2349 2349 -, ca dbSNP:587783119
2353 2353 a, g dbSNP:267608653
2358 2358 a, g, t dbSNP:200333632
2365 2365 c, t dbSNP:367674558
2401 2401 a, g dbSNP:55803460
2406 2406 -, ag dbSNP:587783120
2416 2416 c, g, t dbSNP:747554139
2419 2419 a, c, g dbSNP:775950681
2421 2421 a, g dbSNP:142079769
2442 2442 c, t dbSNP:753606345
2444 2444 a, g dbSNP:748459878
2455 2455 -, a dbSNP:587783121
2457 2457 a, g dbSNP:770193102
2466 2466 a, t dbSNP:727503846
2470 2470 a, g dbSNP:758383464
2472 2472 c, t dbSNP:779674798
2509 2509 a, c dbSNP:786204954
2524 2524 -, gaga dbSNP:587783122
2526 2526 -, ga dbSNP:267608654
2544 2544 -, g dbSNP:62643614
2548 2548 a, t dbSNP:761091421
2561 2561 -, agaa dbSNP:587783123
2564 2564 -, agaaa dbSNP:267608655
2573 2573 a, c dbSNP:35478150
2579 2579 c, t dbSNP:746661602
2598 2598 a, g dbSNP:189269000
2615 2615 a, g dbSNP:181987256
2701 2701 a, g dbSNP:754699773
2702 2702 c, t dbSNP:62643617
2712 2712 c, t dbSNP:727503847
2713 2713 a, c, g dbSNP:140313320
2718 2718 c, t dbSNP:757497935
2719 2719 c, g dbSNP:779041423
2733 2733 a, c, g dbSNP:145401225
2737 2737 c, t dbSNP:267608659
2769 2769 c, t dbSNP:371902632
2788 2788 c, t dbSNP:780609419
2789 2789 a, g dbSNP:376429571
2790 2790 c, g dbSNP:146488512
2793 2793 -, c dbSNP:587783124
2793 2793 c, t dbSNP:369377144
2794 2794 a, g dbSNP:747764150
2806 2806 c, g dbSNP:372839442
2809 2809 c, g dbSNP:772791378
2810 2810 c, t dbSNP:762517975
2818 2818 c, t dbSNP:17857094
2822 2822 c, g dbSNP:747470282
2824 2824 c, t dbSNP:122460158
2828 2828 -, c dbSNP:267608660
2853 2853 -, a dbSNP:267608661
2855 2855 -, a dbSNP:786204980
2864 2864 c, t dbSNP:755573510
2865 2865 a, g dbSNP:781774964
2871 2871 a, c dbSNP:748502843
2873 2873 -, a dbSNP:587783125
2875 2875 a, c dbSNP:770346971
2876 2876 a, g dbSNP:772853668
2879 2879 c, g, t dbSNP:587783156
2880 2880 a, g dbSNP:748905018
2891 2891 a, t dbSNP:770426025
2896 2896 -, c dbSNP:267608662
2896 2896 c, t dbSNP:773760466
2897 2897 a, g dbSNP:759083770
2911 2911 a, g dbSNP:767416919
2917 2917 c, t dbSNP:267608663
2920 2920 c, t dbSNP:587783158
2932 2932 -, t dbSNP:587783126
2959 2959 -, ct dbSNP:61753251
2976 2976 c, t dbSNP:201473442
2977 2977 a, g dbSNP:398123694
2993 2993 a, g dbSNP:200809878
2995 2995 c, t dbSNP:587783159
2997 2997 a, g dbSNP:373448935
3001 3001 c, t dbSNP:750605227
3003 3003 c, t dbSNP:777919249
3004 3004 a, g dbSNP:763110247
3008 3008 c, t dbSNP:587783157
3028 3028 c, t dbSNP:786204981
3039 3039 c, t dbSNP:201714912
3040 3040 a, c, g dbSNP:369009993
3043 3043 a, g dbSNP:769931918
3062 3062 a, g dbSNP:773644857
3063 3063 c, g dbSNP:587783160
3068 3068 a, g dbSNP:149345562
3071 3071 a, g dbSNP:774743991
3080 3080 c, t dbSNP:568161022
3081 3081 c, t dbSNP:759862340
3084 3084 a, g dbSNP:767180920
3090 3090 a, t dbSNP:752464218
3091 3091 a, c, t dbSNP:267608664
3108 3108 a, g dbSNP:369383134
3117 3117 a, g dbSNP:757292432
3144 3144 a, c dbSNP:587783403
3154 3154 a, c dbSNP:200236257
3165 3165 a, g dbSNP:368344738
3169 3169 a, g dbSNP:774335258
3178 3178 c, t dbSNP:202153551
3181 3181 g, t dbSNP:767312604
3191 3191 a, g, t dbSNP:376557374
3195 3195 a, g dbSNP:765535216
3199 3199 c, t dbSNP:750449476
3200 3200 c, g dbSNP:371847235
3201 3201 c, t dbSNP:780702363
3203 3203 a, c, g dbSNP:752120798
3214 3214 c, t dbSNP:781435432
3220 3220 a, g dbSNP:747799506
3223 3223 c, g dbSNP:769305518
3232 3232 c, t dbSNP:267608665
3233 3233 a, g dbSNP:570887192
3243 3243 c, t dbSNP:770428990
3251 3251 c, t dbSNP:587783161
3252 3252 a, g dbSNP:140944590
3257 3257 g, t dbSNP:143243059
3259 3259 c, g dbSNP:775114662
3265 3265 c, g dbSNP:374054249
3266 3266 a, g dbSNP:760568446
3282 3282 c, t dbSNP:765366935
3303 3303 c, t dbSNP:750725714
3306 3306 g, t dbSNP:775556155
3308 3308 g, t dbSNP:267608666
3318 3318 c, t dbSNP:150900695
3319 3319 a, g, t dbSNP:35693326
3321 3321 a, g dbSNP:763292733
3323 3323 a, g dbSNP:766531184
3325 3325 c, g dbSNP:376960593
3327 3327 c, g, t dbSNP:36022183
3332 3332 c, t dbSNP:587783162
3333 3333 a, g dbSNP:767903007
3336 3336 g, t dbSNP:267608667
3337 3337 a, g dbSNP:145462429
3341 3341 c, t dbSNP:573588032
3355 3355 a, g dbSNP:727503848
3356 3356 c, t dbSNP:764540699
3361 3361 a, g dbSNP:753447480
3366 3366 a, c dbSNP:587783163
3367 3367 c, g dbSNP:377160785
3374 3374 c, t dbSNP:745370971
3383 3383 a, c dbSNP:757994307
3387 3387 c, t dbSNP:779791138
3391 3391 c, g dbSNP:772980434
3392 3392 a, g dbSNP:34166184
3398 3398 c, t dbSNP:768289707
3402 3402 a, g dbSNP:776601149
3407 3407 c, t dbSNP:762576315
3408 3408 a, c, g dbSNP:139155110
3409 3409 a, g dbSNP:201765217
3421 3421 c, t dbSNP:187317325
3428 3428 c, t dbSNP:759463462
3432 3432 c, t dbSNP:267608394
3433 3433 a, c, g dbSNP:775808084
3446 3446 a, g dbSNP:764547426
3447 3447 c, t dbSNP:754179699
3461 3461 c, t dbSNP:762222076
3467 3467 a, g dbSNP:764866730
3493 3493 c, g dbSNP:759485059
3496 3496 c, t dbSNP:767340396

Target ORF information:

RefSeq Version XM_011545569
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60792
Accession Version XM_011545570.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3084bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cyclin-dependent kinase-like 5 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)342..1406(+)
Misc Feature(2)345..1097(+)
Misc Feature(3)423..665(+)
Position Chain Variation Link
32 32 c, g dbSNP:770287183
39 39 a, g dbSNP:373175008
62 62 c, t dbSNP:773641641
64 64 c, t dbSNP:786204994
125 125 c, t dbSNP:778858217
140 140 a, c dbSNP:771019923
168 168 c, g dbSNP:370866731
215 215 a, g dbSNP:750094933
224 224 a, g dbSNP:758128193
229 229 g, t dbSNP:372701493
234 234 a, c dbSNP:751146225
238 238 c, g dbSNP:754557968
246 246 g, t dbSNP:780970781
248 248 a, t dbSNP:79219416
259 259 a, t dbSNP:138539908
265 265 a, g dbSNP:767844474
269 269 c, t dbSNP:746036179
291 291 -, t dbSNP:267608415
303 303 a, g dbSNP:772299455
310 310 c, g dbSNP:267608418
311 311 a, g dbSNP:786204962
314 314 a, g dbSNP:587783406
317 317 -, g dbSNP:267608420
325 325 a, g dbSNP:587783130
343 343 a, g dbSNP:786204991
345 345 a, g dbSNP:140332992
369 369 -, gaaa dbSNP:267608433
373 373 c, t dbSNP:774865696
374 374 a, g dbSNP:759058148
381 381 c, t dbSNP:62653623
386 386 a, g dbSNP:148697943
389 389 -, t dbSNP:62643608
397 397 c, t dbSNP:267608435
398 398 g, t dbSNP:145496868
400 400 a, g dbSNP:267608436
405 405 c, t dbSNP:267608437
413 413 -, ggaaaac dbSNP:786204977
417 417 a, g dbSNP:587783072
420 420 -, att dbSNP:786204960
421 421 a, c, t dbSNP:62641235
422 422 a, t dbSNP:267608439
426 426 g, t dbSNP:587783073
435 435 -, gaag dbSNP:267608441
445 445 a, g, t dbSNP:776025230
454 454 -, g dbSNP:587783109
454 454 g, t dbSNP:587783402
455 455 a, g dbSNP:764954859
456 456 a, t dbSNP:587783074
481 481 -, aa dbSNP:786204982
497 497 c, t dbSNP:138125282
510 510 a, g dbSNP:12689931
526 526 a, t dbSNP:587783076
533 533 a, t dbSNP:762793871
539 539 a, g dbSNP:786204955
545 545 a, g dbSNP:766151719
557 557 a, t dbSNP:587783077
558 558 c, t dbSNP:267608453
562 562 g, t dbSNP:587783078
581 581 c, g dbSNP:372825651
586 586 a, g dbSNP:267608468
606 606 c, t dbSNP:267608472
611 611 c, t dbSNP:786204957
619 619 c, t dbSNP:587783081
627 627 c, t dbSNP:587783082
631 631 a, t dbSNP:267608477
633 633 a, g dbSNP:746608623
643 643 a, g dbSNP:768320636
644 644 c, t dbSNP:776078892
655 655 a, g dbSNP:587783083
659 659 c, g dbSNP:762265641
661 661 g, t dbSNP:122460157
664 664 a, g dbSNP:786204985
679 679 a, c, g dbSNP:757402424
683 683 c, t dbSNP:765303813
686 686 a, g dbSNP:750878642
692 692 a, c dbSNP:758844150
712 712 -, ca dbSNP:786204987
717 717 -, gt dbSNP:786204988
719 719 a, c dbSNP:267608490
731 731 a, t dbSNP:61749700
732 732 a, c, g, t dbSNP:587783084
734 734 g, t dbSNP:786204989
738 738 a, c, t dbSNP:267608493
739 739 a, c, g dbSNP:267606715
740 740 a, g dbSNP:369535258
745 745 c, t dbSNP:61749704
748 748 a, c dbSNP:587783085
755 755 -, actt dbSNP:587783111
755 755 -, a dbSNP:267608497
762 762 a, g dbSNP:765304446
779 779 c, g dbSNP:786204958
783 783 a, g dbSNP:587783086
784 784 a, g dbSNP:267608500
793 793 c, t dbSNP:267608501
794 794 a, g dbSNP:750492179
808 808 c, t dbSNP:587783087
809 809 c, t dbSNP:763478005
813 813 g, t dbSNP:267608505
828 828 c, t dbSNP:587783405
832 832 c, g dbSNP:587783088
842 842 c, t dbSNP:751883002
862 862 a, c dbSNP:786204963
865 865 c, t dbSNP:267608511
866 866 c, t dbSNP:370073267
870 870 -, tttta dbSNP:786204990
880 880 a, g dbSNP:752118445
886 886 g, t dbSNP:267608515
893 893 a, g dbSNP:755330309
906 906 c, t dbSNP:587783089
925 925 c, g dbSNP:766475539
947 947 c, t dbSNP:752286259
948 948 c, t dbSNP:374585296
1007 1007 -, ta dbSNP:267608528
1014 1014 -, c dbSNP:587783112
1044 1044 -, ttggacccag dbSNP:61750250
1052 1052 a, g dbSNP:773523708
1058 1058 a, c dbSNP:762927814
1061 1061 a, c dbSNP:267608532
1064 1064 c, t dbSNP:766511365
1069 1069 c, t dbSNP:267606713
1073 1073 -, a dbSNP:267608537
1078 1078 a, g dbSNP:267606714
1090 1090 -, c dbSNP:267608542
1092 1092 a, g dbSNP:751995225
1094 1094 a, g dbSNP:760048639
1109 1109 -, ga dbSNP:267608546
1110 1110 c, t dbSNP:267608547
1120 1120 a, g dbSNP:767817521
1145 1145 a, g dbSNP:370986597
1148 1148 -, a dbSNP:786204992
1156 1156 a, g dbSNP:756537286
1157 1157 c, t dbSNP:374371309
1170 1170 -, a dbSNP:267608552
1173 1173 c, t dbSNP:527360143
1175 1175 a, g dbSNP:587783407
1179 1179 a, g dbSNP:756721244
1193 1193 c, t dbSNP:142665931
1194 1194 c, g dbSNP:760930296
1201 1201 a, g dbSNP:764589907
1202 1202 c, t dbSNP:17853543
1203 1203 a, t dbSNP:753370169
1208 1208 c, t dbSNP:756986206
1214 1214 -, gtctcaccacagatctaacagc dbSNP:786204964
1214 1214 a, g dbSNP:764793934
1218 1218 c, g, t dbSNP:749986393
1225 1225 a, g dbSNP:780119476
1233 1233 a, g dbSNP:371313385
1243 1243 g, t dbSNP:199916668
1244 1244 c, t dbSNP:754663076
1245 1245 c, t dbSNP:267608561
1251 1251 c, g dbSNP:781052780
1257 1257 a, g dbSNP:587783150
1260 1260 c, g dbSNP:749420859
1270 1270 a, g dbSNP:189400843
1272 1272 c, g dbSNP:774594152
1277 1277 -, c dbSNP:786204965
1277 1277 c, t dbSNP:144204039
1278 1278 a, g dbSNP:772194937
1285 1285 c, t dbSNP:775860922
1285 1285 -, t dbSNP:267608565
1288 1288 -, c dbSNP:267608566
1292 1292 c, t dbSNP:761253221
1294 1294 a, g dbSNP:755167459
1296 1296 g, t dbSNP:786204966
1304 1304 c, t dbSNP:777079786
1307 1307 a, g dbSNP:781401272
1308 1308 a, g dbSNP:764955063
1317 1317 c, t dbSNP:750150096
1322 1322 a, g, t dbSNP:148302590
1328 1328 a, t dbSNP:141452495
1340 1340 a, g dbSNP:754963806
1342 1342 g, t dbSNP:780808984
1359 1359 a, c dbSNP:752455644
1365 1365 a, g dbSNP:755949561
1369 1369 a, g dbSNP:779090061
1373 1373 a, g dbSNP:746152862
1394 1394 a, t dbSNP:772076629
1402 1402 a, c dbSNP:267608611
1411 1411 a, t dbSNP:747428764
1415 1415 a, g dbSNP:769239677
1419 1419 -, ctt dbSNP:759725174
1431 1431 a, g dbSNP:777046046
1436 1436 a, c dbSNP:762247736
1440 1440 a, g dbSNP:770340766
1444 1444 c, g dbSNP:267608618
1449 1449 a, g dbSNP:772931688
1453 1453 -, ag dbSNP:786204967
1472 1472 a, c, t dbSNP:762708691
1484 1484 a, c dbSNP:267608620
1492 1492 c, t dbSNP:377263491
1503 1503 c, t dbSNP:751110235
1510 1510 a, c dbSNP:759005252
1517 1517 -, c dbSNP:267608623
1530 1530 c, t dbSNP:587783151
1534 1534 a, c dbSNP:767464855
1536 1536 c, t dbSNP:61753977
1538 1538 c, t dbSNP:150844616
1544 1544 a, t dbSNP:139329419
1545 1545 c, t dbSNP:750590534
1546 1546 g, t dbSNP:758671947
1547 1547 -, c dbSNP:786204968
1551 1551 -, gaaagctctcaaagcaaag dbSNP:587783113
1551 1551 -, ga dbSNP:587783398
1573 1573 c, g dbSNP:779960805
1581 1581 c, t dbSNP:786204969
1584 1584 a, g dbSNP:4825262
1587 1587 a, g dbSNP:747081232
1588 1588 a, g, t dbSNP:267608629
1592 1592 a, c dbSNP:748731763
1593 1593 a, g dbSNP:770224409
1595 1595 a, g dbSNP:773733498
1603 1603 a, g dbSNP:748907380
1606 1606 a, c, g dbSNP:267608631
1623 1623 -, a dbSNP:786204970
1626 1626 -, c dbSNP:769967695
1628 1628 c, t dbSNP:773921712
1637 1637 c, t dbSNP:143992148
1638 1638 -, t dbSNP:786204971
1648 1648 c, g dbSNP:778294301
1652 1652 c, t dbSNP:372655753
1653 1653 a, g dbSNP:775336608
1657 1657 -, ccaagg dbSNP:774479468
1658 1658 a, c dbSNP:760623086
1661 1661 -, ggccaa dbSNP:587783114
1684 1684 c, g dbSNP:754063912
1706 1706 a, c dbSNP:587783152
1729 1729 c, t dbSNP:201893287
1732 1732 c, t dbSNP:779325312
1733 1733 a, g dbSNP:369561849
1740 1740 a, t dbSNP:766602493
1754 1754 c, t dbSNP:751789670
1756 1756 -, t dbSNP:786204972
1760 1760 a, g dbSNP:755082123
1770 1770 g, t dbSNP:781427744
1786 1786 c, t dbSNP:748615147
1792 1792 c, g dbSNP:756720478
1797 1797 a, g dbSNP:778464010
1802 1802 a, c dbSNP:201786426
1806 1806 a, g dbSNP:749639424
1820 1820 a, g dbSNP:147300538
1838 1838 a, t dbSNP:774046085
1842 1842 a, g dbSNP:587783153
1854 1854 c, t dbSNP:267608643
1855 1855 a, g dbSNP:745508309
1868 1868 a, g dbSNP:771556342
1869 1869 c, t dbSNP:775006943
1876 1876 c, g dbSNP:587783145
1877 1877 -, a dbSNP:587783115
1878 1878 c, t dbSNP:373370734
1879 1879 a, g dbSNP:763991639
1881 1881 c, t dbSNP:267608395
1884 1884 a, g dbSNP:587783400
1890 1890 a, g dbSNP:376341076
1898 1898 c, t dbSNP:765011302
1907 1907 a, g dbSNP:751738489
1914 1914 g, t dbSNP:267608644
1917 1917 c, t dbSNP:755177112
1919 1919 a, g dbSNP:767662661
1927 1927 c, t dbSNP:199897804
1928 1928 a, g dbSNP:371603866
1931 1931 a, g dbSNP:778407047
1936 1936 c, t dbSNP:749822712
1937 1937 g, t dbSNP:757573258
1961 1961 a, c, g dbSNP:779156340
1968 1968 c, t dbSNP:201209961
1973 1973 c, t dbSNP:267608645
1974 1974 a, g dbSNP:372629988
1988 1988 c, t dbSNP:768214366
1990 1990 -, g dbSNP:786204974
1992 1992 c, t dbSNP:776627003
2001 2001 -, a dbSNP:587783116
2001 2001 a, c dbSNP:761662406
2003 2003 -, c dbSNP:587783401
2003 2003 c, g dbSNP:141478957
2006 2006 a, c, t dbSNP:772909747
2009 2009 c, t dbSNP:767825838
2023 2023 a, g dbSNP:375650421
2024 2024 a, g dbSNP:587783154
2033 2033 c, t dbSNP:764272402
2060 2060 -, c dbSNP:786204975
2064 2064 a, c, g dbSNP:77097064
2075 2075 c, g dbSNP:754311008
2092 2092 -, tt dbSNP:587783117
2098 2098 c, t dbSNP:144878564
2099 2099 -, ta dbSNP:267608646
2113 2113 a, c dbSNP:779298697
2115 2115 -, g dbSNP:587783118
2116 2116 c, g dbSNP:750727784
2155 2155 a, g dbSNP:773251215
2160 2160 c, t dbSNP:267608647
2162 2162 a, g dbSNP:762828342
2188 2188 g, t dbSNP:770913092
2190 2190 c, t dbSNP:775783994
2192 2192 c, t dbSNP:760988585
2222 2222 -, c dbSNP:267608649
2222 2222 -, c dbSNP:267608648
2228 2228 c, g dbSNP:763419895
2238 2238 c, t dbSNP:753899592
2246 2246 a, g, t dbSNP:761995288
2251 2251 ag, nnnnnnnnnnnnnnnnnn dbSNP:672601303
2265 2265 c, t dbSNP:764423452
2272 2272 -, c dbSNP:267608651
2273 2273 a, g dbSNP:774307489
2283 2283 a, g dbSNP:747196703
2292 2292 a, g dbSNP:374518046
2311 2311 -, ac dbSNP:786204978
2313 2313 c, g dbSNP:776965205
2315 2315 a, g, t dbSNP:761789190
2324 2324 c, t dbSNP:17853544
2345 2345 a, t dbSNP:773642754
2349 2349 c, t dbSNP:17855594
2354 2354 -, ca dbSNP:587783119
2358 2358 a, g dbSNP:267608653
2363 2363 a, g, t dbSNP:200333632
2370 2370 c, t dbSNP:367674558
2406 2406 a, g dbSNP:55803460
2411 2411 -, ag dbSNP:587783120
2421 2421 c, g, t dbSNP:747554139
2424 2424 a, c, g dbSNP:775950681
2426 2426 a, g dbSNP:142079769
2447 2447 c, t dbSNP:753606345
2449 2449 a, g dbSNP:748459878
2460 2460 -, a dbSNP:587783121
2462 2462 a, g dbSNP:770193102
2471 2471 a, t dbSNP:727503846
2475 2475 a, g dbSNP:758383464
2477 2477 c, t dbSNP:779674798
2514 2514 a, c dbSNP:786204954
2529 2529 -, gaga dbSNP:587783122
2531 2531 -, ga dbSNP:267608654
2549 2549 -, g dbSNP:62643614
2553 2553 a, t dbSNP:761091421
2566 2566 -, agaa dbSNP:587783123
2569 2569 -, agaaa dbSNP:267608655
2578 2578 a, c dbSNP:35478150
2584 2584 c, t dbSNP:746661602
2603 2603 a, g dbSNP:189269000
2620 2620 a, g dbSNP:181987256
2706 2706 a, g dbSNP:754699773
2707 2707 c, t dbSNP:62643617
2717 2717 c, t dbSNP:727503847
2718 2718 a, c, g dbSNP:140313320
2723 2723 c, t dbSNP:757497935
2724 2724 c, g dbSNP:779041423
2738 2738 a, c, g dbSNP:145401225
2742 2742 c, t dbSNP:267608659
2774 2774 c, t dbSNP:371902632
2793 2793 c, t dbSNP:780609419
2794 2794 a, g dbSNP:376429571
2795 2795 c, g dbSNP:146488512
2798 2798 -, c dbSNP:587783124
2798 2798 c, t dbSNP:369377144
2799 2799 a, g dbSNP:747764150
2811 2811 c, g dbSNP:372839442
2814 2814 c, g dbSNP:772791378
2815 2815 c, t dbSNP:762517975
2823 2823 c, t dbSNP:17857094
2827 2827 c, g dbSNP:747470282
2829 2829 c, t dbSNP:122460158
2833 2833 -, c dbSNP:267608660
2858 2858 -, a dbSNP:267608661
2860 2860 -, a dbSNP:786204980
2869 2869 c, t dbSNP:755573510
2870 2870 a, g dbSNP:781774964
2876 2876 a, c dbSNP:748502843
2878 2878 -, a dbSNP:587783125
2880 2880 a, c dbSNP:770346971
2881 2881 a, g dbSNP:772853668
2884 2884 c, g, t dbSNP:587783156
2885 2885 a, g dbSNP:748905018
2896 2896 a, t dbSNP:770426025
2901 2901 -, c dbSNP:267608662
2901 2901 c, t dbSNP:773760466
2902 2902 a, g dbSNP:759083770
2916 2916 a, g dbSNP:767416919
2922 2922 c, t dbSNP:267608663
2925 2925 c, t dbSNP:587783158
2937 2937 -, t dbSNP:587783126
2964 2964 -, ct dbSNP:61753251
2981 2981 c, t dbSNP:201473442
2982 2982 a, g dbSNP:398123694
2998 2998 a, g dbSNP:200809878
3000 3000 c, t dbSNP:587783159
3002 3002 a, g dbSNP:373448935
3006 3006 c, t dbSNP:750605227
3008 3008 c, t dbSNP:777919249
3009 3009 a, g dbSNP:763110247
3013 3013 c, t dbSNP:587783157
3033 3033 c, t dbSNP:786204981
3044 3044 c, t dbSNP:201714912
3045 3045 a, c, g dbSNP:369009993
3048 3048 a, g dbSNP:769931918
3067 3067 a, g dbSNP:773644857
3068 3068 c, g dbSNP:587783160
3073 3073 a, g dbSNP:149345562
3076 3076 a, g dbSNP:774743991
3085 3085 c, t dbSNP:568161022
3086 3086 c, t dbSNP:759862340
3089 3089 a, g dbSNP:767180920
3095 3095 a, t dbSNP:752464218
3096 3096 a, c, t dbSNP:267608664
3113 3113 a, g dbSNP:369383134
3122 3122 a, g dbSNP:757292432
3149 3149 a, c dbSNP:587783403
3159 3159 a, c dbSNP:200236257
3170 3170 a, g dbSNP:368344738
3174 3174 a, g dbSNP:774335258
3183 3183 c, t dbSNP:202153551
3186 3186 g, t dbSNP:767312604
3196 3196 a, g, t dbSNP:376557374
3200 3200 a, g dbSNP:765535216
3204 3204 c, t dbSNP:750449476
3205 3205 c, g dbSNP:371847235
3206 3206 c, t dbSNP:780702363
3208 3208 a, c, g dbSNP:752120798
3219 3219 c, t dbSNP:781435432
3225 3225 a, g dbSNP:747799506
3228 3228 c, g dbSNP:769305518
3237 3237 c, t dbSNP:267608665
3238 3238 a, g dbSNP:570887192
3248 3248 c, t dbSNP:770428990
3256 3256 c, t dbSNP:587783161
3257 3257 a, g dbSNP:140944590
3262 3262 g, t dbSNP:143243059
3264 3264 c, g dbSNP:775114662
3270 3270 c, g dbSNP:374054249
3271 3271 a, g dbSNP:760568446
3287 3287 c, t dbSNP:765366935
3308 3308 c, t dbSNP:750725714
3311 3311 g, t dbSNP:775556155
3313 3313 g, t dbSNP:267608666
3323 3323 c, t dbSNP:150900695
3324 3324 a, g, t dbSNP:35693326
3326 3326 a, g dbSNP:763292733
3328 3328 a, g dbSNP:766531184
3330 3330 c, g dbSNP:376960593
3332 3332 c, g, t dbSNP:36022183
3337 3337 c, t dbSNP:587783162
3338 3338 a, g dbSNP:767903007
3341 3341 g, t dbSNP:267608667
3342 3342 a, g dbSNP:145462429
3346 3346 c, t dbSNP:573588032
3360 3360 a, g dbSNP:727503848
3361 3361 c, t dbSNP:764540699
3366 3366 a, g dbSNP:753447480
3371 3371 a, c dbSNP:587783163
3372 3372 c, g dbSNP:377160785
3379 3379 c, t dbSNP:745370971
3388 3388 a, c dbSNP:757994307
3392 3392 c, t dbSNP:779791138
3396 3396 c, g dbSNP:772980434
3397 3397 a, g dbSNP:34166184
3403 3403 c, t dbSNP:768289707
3407 3407 a, g dbSNP:776601149
3412 3412 c, t dbSNP:762576315
3413 3413 a, c, g dbSNP:139155110
3414 3414 a, g dbSNP:201765217
3426 3426 c, t dbSNP:187317325
3433 3433 c, t dbSNP:759463462
3437 3437 c, t dbSNP:267608394
3438 3438 a, c, g dbSNP:775808084
3451 3451 a, g dbSNP:764547426
3452 3452 c, t dbSNP:754179699
3466 3466 c, t dbSNP:762222076
3472 3472 a, g dbSNP:764866730
3498 3498 c, g dbSNP:759485059
3501 3501 c, t dbSNP:767340396

Target ORF information:

RefSeq Version XM_011545570
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25494
Accession Version NM_003159.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3093bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cyclin-dependent kinase-like 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC010966.1, AY217744.1 and AI286150.1. This sequence is a reference standard in the RefSeqGene project. On Dec 8, 2005 this sequence version replaced gi:4507280. Summary: This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (I) represents the longer transcript. Variants I and II encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY217744.1, Y15057.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)128..130(+)
Misc Feature(2)284..1144(+)
Misc Feature(3)290..1144(+)
Misc Feature(4)308..892(+)
Misc Feature(5)308..712(+)
Misc Feature(6)428..892(+)
Misc Feature(7)707..781(+)
Misc Feature(8)1472..1474(+)
Misc Feature(9)2411..2413(+)
Misc Feature(10)2534..2536(+)
Exon (1)1..91
Gene Synonym:
Exon (2)92..317
Gene Synonym:
Exon (3)318..352
Gene Synonym:
Exon (4)353..398
Gene Synonym:
Exon (5)399..535
Gene Synonym:
Exon (6)536..656
Gene Synonym:
Exon (7)657..716
Gene Synonym:
Exon (8)717..807
Gene Synonym:
Exon (9)808..997
Gene Synonym:
Exon (10)998..1078
Gene Synonym:
Exon (11)1079..1230
Gene Synonym:
Exon (12)1231..2197
Gene Synonym:
Exon (13)2198..2299
Gene Synonym:
Exon (14)2300..2405
Gene Synonym:
Exon (15)2406..2529
Gene Synonym:
Exon (16)2530..2629
Gene Synonym:
Exon (17)2630..2749
Gene Synonym:
Exon (18)2750..2966
Gene Synonym:
Exon (19)2967..3050
Gene Synonym:
Exon (20)3051..3233
Gene Synonym:
Exon (21)3234..3431
Gene Synonym:
Position Chain Variation Link
33 33 c, g dbSNP:770287183
40 40 a, g dbSNP:373175008
63 63 c, t dbSNP:773641641
65 65 c, t dbSNP:786204994
126 126 c, t dbSNP:778858217
141 141 a, c dbSNP:771019923
169 169 c, g dbSNP:370866731
216 216 a, g dbSNP:750094933
225 225 a, g dbSNP:758128193
230 230 g, t dbSNP:372701493
235 235 a, c dbSNP:751146225
239 239 c, g dbSNP:754557968
247 247 g, t dbSNP:780970781
249 249 a, t dbSNP:79219416
260 260 a, t dbSNP:138539908
266 266 a, g dbSNP:767844474
270 270 c, t dbSNP:746036179
292 292 -, t dbSNP:267608415
304 304 a, g dbSNP:772299455
311 311 c, g dbSNP:267608418
312 312 a, g dbSNP:786204962
315 315 a, g dbSNP:587783406
318 318 -, g dbSNP:267608420
326 326 a, g dbSNP:587783130
344 344 a, g dbSNP:786204991
346 346 a, g dbSNP:140332992
358 358 a, g dbSNP:760485617
360 360 a, g dbSNP:763985235
372 372 c, t dbSNP:122460159
374 374 a, t dbSNP:587783071
378 378 a, g dbSNP:267608429
416 416 -, gaaa dbSNP:267608433
420 420 c, t dbSNP:774865696
421 421 a, g dbSNP:759058148
428 428 c, t dbSNP:62653623
433 433 a, g dbSNP:148697943
436 436 -, t dbSNP:62643608
444 444 c, t dbSNP:267608435
445 445 g, t dbSNP:145496868
447 447 a, g dbSNP:267608436
452 452 c, t dbSNP:267608437
460 460 -, ggaaaac dbSNP:786204977
464 464 a, g dbSNP:587783072
467 467 -, att dbSNP:786204960
468 468 a, c, t dbSNP:62641235
469 469 a, t dbSNP:267608439
473 473 g, t dbSNP:587783073
482 482 -, gaag dbSNP:267608441
492 492 a, g, t dbSNP:776025230
501 501 -, g dbSNP:587783109
501 501 g, t dbSNP:587783402
502 502 a, g dbSNP:764954859
503 503 a, t dbSNP:587783074
528 528 -, aa dbSNP:786204982
544 544 c, t dbSNP:138125282
557 557 a, g dbSNP:12689931
573 573 a, t dbSNP:587783076
580 580 a, t dbSNP:762793871
586 586 a, g dbSNP:786204955
592 592 a, g dbSNP:766151719
604 604 a, t dbSNP:587783077
605 605 c, t dbSNP:267608453
609 609 g, t dbSNP:587783078
628 628 c, g dbSNP:372825651
633 633 a, g dbSNP:267608468
653 653 c, t dbSNP:267608472
658 658 c, t dbSNP:786204957
666 666 c, t dbSNP:587783081
674 674 c, t dbSNP:587783082
678 678 a, t dbSNP:267608477
680 680 a, g dbSNP:746608623
690 690 a, g dbSNP:768320636
691 691 c, t dbSNP:776078892
702 702 a, g dbSNP:587783083
706 706 c, g dbSNP:762265641
708 708 g, t dbSNP:122460157
711 711 a, g dbSNP:786204985
726 726 a, c, g dbSNP:757402424
730 730 c, t dbSNP:765303813
733 733 a, g dbSNP:750878642
739 739 a, c dbSNP:758844150
759 759 -, ca dbSNP:786204987
764 764 -, gt dbSNP:786204988
766 766 a, c dbSNP:267608490
778 778 a, t dbSNP:61749700
779 779 a, c, g, t dbSNP:587783084
781 781 g, t dbSNP:786204989
785 785 a, c, t dbSNP:267608493
786 786 a, c, g dbSNP:267606715
787 787 a, g dbSNP:369535258
792 792 c, t dbSNP:61749704
795 795 a, c dbSNP:587783085
802 802 -, actt dbSNP:587783111
802 802 -, a dbSNP:267608497
809 809 a, g dbSNP:765304446
826 826 c, g dbSNP:786204958
830 830 a, g dbSNP:587783086
831 831 a, g dbSNP:267608500
840 840 c, t dbSNP:267608501
841 841 a, g dbSNP:750492179
855 855 c, t dbSNP:587783087
856 856 c, t dbSNP:763478005
860 860 g, t dbSNP:267608505
875 875 c, t dbSNP:587783405
879 879 c, g dbSNP:587783088
889 889 c, t dbSNP:751883002
909 909 a, c dbSNP:786204963
912 912 c, t dbSNP:267608511
913 913 c, t dbSNP:370073267
917 917 -, tttta dbSNP:786204990
927 927 a, g dbSNP:752118445
933 933 g, t dbSNP:267608515
940 940 a, g dbSNP:755330309
953 953 c, t dbSNP:587783089
972 972 c, g dbSNP:766475539
994 994 c, t dbSNP:752286259
995 995 c, t dbSNP:374585296
1054 1054 -, ta dbSNP:267608528
1061 1061 -, c dbSNP:587783112
1091 1091 -, ttggacccag dbSNP:61750250
1099 1099 a, g dbSNP:773523708
1105 1105 a, c dbSNP:762927814
1108 1108 a, c dbSNP:267608532
1111 1111 c, t dbSNP:766511365
1116 1116 c, t dbSNP:267606713
1120 1120 -, a dbSNP:267608537
1125 1125 a, g dbSNP:267606714
1137 1137 -, c dbSNP:267608542
1139 1139 a, g dbSNP:751995225
1141 1141 a, g dbSNP:760048639
1156 1156 -, ga dbSNP:267608546
1157 1157 c, t dbSNP:267608547
1167 1167 a, g dbSNP:767817521
1192 1192 a, g dbSNP:370986597
1195 1195 -, a dbSNP:786204992
1203 1203 a, g dbSNP:756537286
1204 1204 c, t dbSNP:374371309
1217 1217 -, a dbSNP:267608552
1220 1220 c, t dbSNP:527360143
1222 1222 a, g dbSNP:587783407
1226 1226 a, g dbSNP:756721244
1240 1240 c, t dbSNP:142665931
1241 1241 c, g dbSNP:760930296
1248 1248 a, g dbSNP:764589907
1249 1249 c, t dbSNP:17853543
1250 1250 a, t dbSNP:753370169
1255 1255 c, t dbSNP:756986206
1261 1261 -, gtctcaccacagatctaacagc dbSNP:786204964
1261 1261 a, g dbSNP:764793934
1265 1265 c, g, t dbSNP:749986393
1272 1272 a, g dbSNP:780119476
1280 1280 a, g dbSNP:371313385
1290 1290 g, t dbSNP:199916668
1291 1291 c, t dbSNP:754663076
1292 1292 c, t dbSNP:267608561
1298 1298 c, g dbSNP:781052780
1304 1304 a, g dbSNP:587783150
1307 1307 c, g dbSNP:749420859
1317 1317 a, g dbSNP:189400843
1319 1319 c, g dbSNP:774594152
1324 1324 -, c dbSNP:786204965
1324 1324 c, t dbSNP:144204039
1325 1325 a, g dbSNP:772194937
1332 1332 c, t dbSNP:775860922
1332 1332 -, t dbSNP:267608565
1335 1335 -, c dbSNP:267608566
1339 1339 c, t dbSNP:761253221
1341 1341 a, g dbSNP:755167459
1343 1343 g, t dbSNP:786204966
1351 1351 c, t dbSNP:777079786
1354 1354 a, g dbSNP:781401272
1355 1355 a, g dbSNP:764955063
1364 1364 c, t dbSNP:750150096
1369 1369 a, g, t dbSNP:148302590
1375 1375 a, t dbSNP:141452495
1387 1387 a, g dbSNP:754963806
1389 1389 g, t dbSNP:780808984
1406 1406 a, c dbSNP:752455644
1412 1412 a, g dbSNP:755949561
1416 1416 a, g dbSNP:779090061
1420 1420 a, g dbSNP:746152862
1441 1441 a, t dbSNP:772076629
1449 1449 a, c dbSNP:267608611
1458 1458 a, t dbSNP:747428764
1462 1462 a, g dbSNP:769239677
1466 1466 -, ctt dbSNP:759725174
1478 1478 a, g dbSNP:777046046
1483 1483 a, c dbSNP:762247736
1487 1487 a, g dbSNP:770340766
1491 1491 c, g dbSNP:267608618
1496 1496 a, g dbSNP:772931688
1500 1500 -, ag dbSNP:786204967
1519 1519 a, c, t dbSNP:762708691
1531 1531 a, c dbSNP:267608620
1539 1539 c, t dbSNP:377263491
1550 1550 c, t dbSNP:751110235
1557 1557 a, c dbSNP:759005252
1564 1564 -, c dbSNP:267608623
1577 1577 c, t dbSNP:587783151
1581 1581 a, c dbSNP:767464855
1583 1583 c, t dbSNP:61753977
1585 1585 c, t dbSNP:150844616
1591 1591 a, t dbSNP:139329419
1592 1592 c, t dbSNP:750590534
1593 1593 g, t dbSNP:758671947
1594 1594 -, c dbSNP:786204968
1598 1598 -, gaaagctctcaaagcaaag dbSNP:587783113
1598 1598 -, ga dbSNP:587783398
1620 1620 c, g dbSNP:779960805
1628 1628 c, t dbSNP:786204969
1631 1631 a, g dbSNP:4825262
1634 1634 a, g dbSNP:747081232
1635 1635 a, g, t dbSNP:267608629
1639 1639 a, c dbSNP:748731763
1640 1640 a, g dbSNP:770224409
1642 1642 a, g dbSNP:773733498
1650 1650 a, g dbSNP:748907380
1653 1653 a, c, g dbSNP:267608631
1670 1670 -, a dbSNP:786204970
1673 1673 -, c dbSNP:769967695
1675 1675 c, t dbSNP:773921712
1684 1684 c, t dbSNP:143992148
1685 1685 -, t dbSNP:786204971
1695 1695 c, g dbSNP:778294301
1699 1699 c, t dbSNP:372655753
1700 1700 a, g dbSNP:775336608
1704 1704 -, ccaagg dbSNP:774479468
1705 1705 a, c dbSNP:760623086
1708 1708 -, ggccaa dbSNP:587783114
1731 1731 c, g dbSNP:754063912
1753 1753 a, c dbSNP:587783152
1776 1776 c, t dbSNP:201893287
1779 1779 c, t dbSNP:779325312
1780 1780 a, g dbSNP:369561849
1787 1787 a, t dbSNP:766602493
1801 1801 c, t dbSNP:751789670
1803 1803 -, t dbSNP:786204972
1807 1807 a, g dbSNP:755082123
1817 1817 g, t dbSNP:781427744
1833 1833 c, t dbSNP:748615147
1839 1839 c, g dbSNP:756720478
1844 1844 a, g dbSNP:778464010
1849 1849 a, c dbSNP:201786426
1853 1853 a, g dbSNP:749639424
1867 1867 a, g dbSNP:147300538
1885 1885 a, t dbSNP:774046085
1889 1889 a, g dbSNP:587783153
1901 1901 c, t dbSNP:267608643
1902 1902 a, g dbSNP:745508309
1915 1915 a, g dbSNP:771556342
1916 1916 c, t dbSNP:775006943
1923 1923 c, g dbSNP:587783145
1924 1924 -, a dbSNP:587783115
1925 1925 c, t dbSNP:373370734
1926 1926 a, g dbSNP:763991639
1928 1928 c, t dbSNP:267608395
1931 1931 a, g dbSNP:587783400
1937 1937 a, g dbSNP:376341076
1945 1945 c, t dbSNP:765011302
1954 1954 a, g dbSNP:751738489
1961 1961 g, t dbSNP:267608644
1964 1964 c, t dbSNP:755177112
1966 1966 a, g dbSNP:767662661
1974 1974 c, t dbSNP:199897804
1975 1975 a, g dbSNP:371603866
1978 1978 a, g dbSNP:778407047
1983 1983 c, t dbSNP:749822712
1984 1984 g, t dbSNP:757573258
2008 2008 a, c, g dbSNP:779156340
2015 2015 c, t dbSNP:201209961
2020 2020 c, t dbSNP:267608645
2021 2021 a, g dbSNP:372629988
2035 2035 c, t dbSNP:768214366
2037 2037 -, g dbSNP:786204974
2039 2039 c, t dbSNP:776627003
2048 2048 -, a dbSNP:587783116
2048 2048 a, c dbSNP:761662406
2050 2050 -, c dbSNP:587783401
2050 2050 c, g dbSNP:141478957
2053 2053 a, c, t dbSNP:772909747
2056 2056 c, t dbSNP:767825838
2070 2070 a, g dbSNP:375650421
2071 2071 a, g dbSNP:587783154
2080 2080 c, t dbSNP:764272402
2107 2107 -, c dbSNP:786204975
2111 2111 a, c, g dbSNP:77097064
2122 2122 c, g dbSNP:754311008
2139 2139 -, tt dbSNP:587783117
2145 2145 c, t dbSNP:144878564
2146 2146 -, ta dbSNP:267608646
2160 2160 a, c dbSNP:779298697
2162 2162 -, g dbSNP:587783118
2163 2163 c, g dbSNP:750727784
2202 2202 a, g dbSNP:773251215
2207 2207 c, t dbSNP:267608647
2209 2209 a, g dbSNP:762828342
2235 2235 g, t dbSNP:770913092
2237 2237 c, t dbSNP:775783994
2239 2239 c, t dbSNP:760988585
2269 2269 -, c dbSNP:267608649
2269 2269 -, c dbSNP:267608648
2275 2275 c, g dbSNP:763419895
2285 2285 c, t dbSNP:753899592
2293 2293 a, g, t dbSNP:761995288
2298 2298 ag, nnnnnnnnnnnnnnnnnn dbSNP:672601303
2312 2312 c, t dbSNP:764423452
2319 2319 -, c dbSNP:267608651
2320 2320 a, g dbSNP:774307489
2330 2330 a, g dbSNP:747196703
2339 2339 a, g dbSNP:374518046
2358 2358 -, ac dbSNP:786204978
2360 2360 c, g dbSNP:776965205
2362 2362 a, g, t dbSNP:761789190
2371 2371 c, t dbSNP:17853544
2392 2392 a, t dbSNP:773642754
2396 2396 c, t dbSNP:17855594
2401 2401 -, ca dbSNP:587783119
2405 2405 a, g dbSNP:267608653
2410 2410 a, g, t dbSNP:200333632
2417 2417 c, t dbSNP:367674558
2453 2453 a, g dbSNP:55803460
2458 2458 -, ag dbSNP:587783120
2468 2468 c, g, t dbSNP:747554139
2471 2471 a, c, g dbSNP:775950681
2473 2473 a, g dbSNP:142079769
2494 2494 c, t dbSNP:753606345
2496 2496 a, g dbSNP:748459878
2507 2507 -, a dbSNP:587783121
2509 2509 a, g dbSNP:770193102
2518 2518 a, t dbSNP:727503846
2522 2522 a, g dbSNP:758383464
2524 2524 c, t dbSNP:779674798
2561 2561 a, c dbSNP:786204954
2576 2576 -, gaga dbSNP:587783122
2578 2578 -, ga dbSNP:267608654
2596 2596 -, g dbSNP:62643614
2600 2600 a, t dbSNP:761091421
2613 2613 -, agaa dbSNP:587783123
2616 2616 -, agaaa dbSNP:267608655
2625 2625 a, c dbSNP:35478150
2630 2630 a, g dbSNP:754699773
2631 2631 c, t dbSNP:62643617
2641 2641 c, t dbSNP:727503847
2642 2642 a, c, g dbSNP:140313320
2647 2647 c, t dbSNP:757497935
2648 2648 c, g dbSNP:779041423
2662 2662 a, c, g dbSNP:145401225
2666 2666 c, t dbSNP:267608659
2698 2698 c, t dbSNP:371902632
2717 2717 c, t dbSNP:780609419
2718 2718 a, g dbSNP:376429571
2719 2719 c, g dbSNP:146488512
2722 2722 -, c dbSNP:587783124
2722 2722 c, t dbSNP:369377144
2723 2723 a, g dbSNP:747764150
2735 2735 c, g dbSNP:372839442
2738 2738 c, g dbSNP:772791378
2739 2739 c, t dbSNP:762517975
2747 2747 c, t dbSNP:17857094
2751 2751 c, g dbSNP:747470282
2753 2753 c, t dbSNP:122460158
2757 2757 -, c dbSNP:267608660
2782 2782 -, a dbSNP:267608661
2784 2784 -, a dbSNP:786204980
2793 2793 c, t dbSNP:755573510
2794 2794 a, g dbSNP:781774964
2800 2800 a, c dbSNP:748502843
2802 2802 -, a dbSNP:587783125
2804 2804 a, c dbSNP:770346971
2805 2805 a, g dbSNP:772853668
2808 2808 c, g, t dbSNP:587783156
2809 2809 a, g dbSNP:748905018
2820 2820 a, t dbSNP:770426025
2825 2825 -, c dbSNP:267608662
2825 2825 c, t dbSNP:773760466
2826 2826 a, g dbSNP:759083770
2840 2840 a, g dbSNP:767416919
2846 2846 c, t dbSNP:267608663
2849 2849 c, t dbSNP:587783158
2861 2861 -, t dbSNP:587783126
2888 2888 -, ct dbSNP:61753251
2905 2905 c, t dbSNP:201473442
2906 2906 a, g dbSNP:398123694
2922 2922 a, g dbSNP:200809878
2924 2924 c, t dbSNP:587783159
2926 2926 a, g dbSNP:373448935
2930 2930 c, t dbSNP:750605227
2932 2932 c, t dbSNP:777919249
2933 2933 a, g dbSNP:763110247
2937 2937 c, t dbSNP:587783157
2957 2957 c, t dbSNP:786204981
2968 2968 c, t dbSNP:201714912
2969 2969 a, c, g dbSNP:369009993
2972 2972 a, g dbSNP:769931918
2991 2991 a, g dbSNP:773644857
2992 2992 c, g dbSNP:587783160
2997 2997 a, g dbSNP:149345562
3000 3000 a, g dbSNP:774743991
3009 3009 c, t dbSNP:568161022
3010 3010 c, t dbSNP:759862340
3013 3013 a, g dbSNP:767180920
3019 3019 a, t dbSNP:752464218
3020 3020 a, c, t dbSNP:267608664
3037 3037 a, g dbSNP:369383134
3046 3046 a, g dbSNP:757292432
3073 3073 a, c dbSNP:587783403
3083 3083 a, c dbSNP:200236257
3094 3094 a, g dbSNP:368344738
3098 3098 a, g dbSNP:774335258
3107 3107 c, t dbSNP:202153551
3110 3110 g, t dbSNP:767312604
3120 3120 a, g, t dbSNP:376557374
3124 3124 a, g dbSNP:765535216
3128 3128 c, t dbSNP:750449476
3129 3129 c, g dbSNP:371847235
3130 3130 c, t dbSNP:780702363
3132 3132 a, c, g dbSNP:752120798
3143 3143 c, t dbSNP:781435432
3149 3149 a, g dbSNP:747799506
3152 3152 c, g dbSNP:769305518
3161 3161 c, t dbSNP:267608665
3162 3162 a, g dbSNP:570887192
3172 3172 c, t dbSNP:770428990
3180 3180 c, t dbSNP:587783161
3181 3181 a, g dbSNP:140944590
3186 3186 g, t dbSNP:143243059
3188 3188 c, g dbSNP:775114662
3194 3194 c, g dbSNP:374054249
3195 3195 a, g dbSNP:760568446
3211 3211 c, t dbSNP:765366935
3232 3232 c, t dbSNP:750725714
3235 3235 g, t dbSNP:775556155
3237 3237 g, t dbSNP:267608666
3247 3247 c, t dbSNP:150900695
3248 3248 a, g, t dbSNP:35693326
3250 3250 a, g dbSNP:763292733
3252 3252 a, g dbSNP:766531184
3254 3254 c, g dbSNP:376960593
3256 3256 c, g, t dbSNP:36022183
3261 3261 c, t dbSNP:587783162
3262 3262 a, g dbSNP:767903007
3265 3265 g, t dbSNP:267608667
3266 3266 a, g dbSNP:145462429
3270 3270 c, t dbSNP:573588032
3284 3284 a, g dbSNP:727503848
3285 3285 c, t dbSNP:764540699
3290 3290 a, g dbSNP:753447480
3295 3295 a, c dbSNP:587783163
3296 3296 c, g dbSNP:377160785
3303 3303 c, t dbSNP:745370971
3312 3312 a, c dbSNP:757994307
3316 3316 c, t dbSNP:779791138
3320 3320 c, g dbSNP:772980434
3321 3321 a, g dbSNP:34166184
3327 3327 c, t dbSNP:768289707
3331 3331 a, g dbSNP:776601149
3336 3336 c, t dbSNP:762576315
3337 3337 a, c, g dbSNP:139155110
3338 3338 a, g dbSNP:201765217
3350 3350 c, t dbSNP:187317325
3357 3357 c, t dbSNP:759463462
3361 3361 c, t dbSNP:267608394
3362 3362 a, c, g dbSNP:775808084
3375 3375 a, g dbSNP:764547426
3376 3376 c, t dbSNP:754179699
3390 3390 c, t dbSNP:762222076
3396 3396 a, g dbSNP:764866730
3422 3422 c, g dbSNP:759485059
3425 3425 c, t dbSNP:767340396

Target ORF information:

RefSeq Version NM_003159
Organism Homo sapiens (human)
Definition Homo sapiens cyclin-dependent kinase-like 5 (CDKL5), transcript variant I, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25494
Accession Version NM_001037343.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3093bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cyclin-dependent kinase-like 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL704691.1, BC036091.1, AY217744.1 and AI286150.1. Summary: This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (II) differs in the 5' UTR compared to variant 1. Variants I and II encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC036091.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148874 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)124..126(+)
Misc Feature(2)280..1140(+)
Misc Feature(3)286..1140(+)
Misc Feature(4)304..888(+)
Misc Feature(5)304..708(+)
Misc Feature(6)424..888(+)
Misc Feature(7)703..777(+)
Misc Feature(8)1468..1470(+)
Misc Feature(9)2407..2409(+)
Misc Feature(10)2530..2532(+)
Exon (1)1..38
Gene Synonym:
Exon (2)39..87
Gene Synonym:
Exon (3)88..313
Gene Synonym:
Exon (4)314..348
Gene Synonym:
Exon (5)349..394
Gene Synonym:
Exon (6)395..531
Gene Synonym:
Exon (7)532..652
Gene Synonym:
Exon (8)653..712
Gene Synonym:
Exon (9)713..803
Gene Synonym:
Exon (10)804..993
Gene Synonym:
Exon (11)994..1074
Gene Synonym:
Exon (12)1075..1226
Gene Synonym:
Exon (13)1227..2193
Gene Synonym:
Exon (14)2194..2295
Gene Synonym:
Exon (15)2296..2401
Gene Synonym:
Exon (16)2402..2525
Gene Synonym:
Exon (17)2526..2625
Gene Synonym:
Exon (18)2626..2745
Gene Synonym:
Exon (19)2746..2962
Gene Synonym:
Exon (20)2963..3046
Gene Synonym:
Exon (21)3047..3229
Gene Synonym:
Exon (22)3230..3427
Gene Synonym:
Position Chain Variation Link
44 44 c, t dbSNP:184071635
56 56 c, t dbSNP:188581304
68 68 c, g dbSNP:756093465
85 85 c, t dbSNP:72616065
122 122 c, t dbSNP:778858217
137 137 a, c dbSNP:771019923
165 165 c, g dbSNP:370866731
212 212 a, g dbSNP:750094933
221 221 a, g dbSNP:758128193
226 226 g, t dbSNP:372701493
231 231 a, c dbSNP:751146225
235 235 c, g dbSNP:754557968
243 243 g, t dbSNP:780970781
245 245 a, t dbSNP:79219416
256 256 a, t dbSNP:138539908
262 262 a, g dbSNP:767844474
266 266 c, t dbSNP:746036179
288 288 -, t dbSNP:267608415
300 300 a, g dbSNP:772299455
307 307 c, g dbSNP:267608418
308 308 a, g dbSNP:786204962
311 311 a, g dbSNP:587783406
314 314 -, g dbSNP:267608420
322 322 a, g dbSNP:587783130
340 340 a, g dbSNP:786204991
342 342 a, g dbSNP:140332992
354 354 a, g dbSNP:760485617
356 356 a, g dbSNP:763985235
368 368 c, t dbSNP:122460159
370 370 a, t dbSNP:587783071
374 374 a, g dbSNP:267608429
412 412 -, gaaa dbSNP:267608433
416 416 c, t dbSNP:774865696
417 417 a, g dbSNP:759058148
424 424 c, t dbSNP:62653623
429 429 a, g dbSNP:148697943
432 432 -, t dbSNP:62643608
440 440 c, t dbSNP:267608435
441 441 g, t dbSNP:145496868
443 443 a, g dbSNP:267608436
448 448 c, t dbSNP:267608437
456 456 -, ggaaaac dbSNP:786204977
460 460 a, g dbSNP:587783072
463 463 -, att dbSNP:786204960
464 464 a, c, t dbSNP:62641235
465 465 a, t dbSNP:267608439
469 469 g, t dbSNP:587783073
478 478 -, gaag dbSNP:267608441
488 488 a, g, t dbSNP:776025230
497 497 -, g dbSNP:587783109
497 497 g, t dbSNP:587783402
498 498 a, g dbSNP:764954859
499 499 a, t dbSNP:587783074
524 524 -, aa dbSNP:786204982
540 540 c, t dbSNP:138125282
553 553 a, g dbSNP:12689931
569 569 a, t dbSNP:587783076
576 576 a, t dbSNP:762793871
582 582 a, g dbSNP:786204955
588 588 a, g dbSNP:766151719
600 600 a, t dbSNP:587783077
601 601 c, t dbSNP:267608453
605 605 g, t dbSNP:587783078
624 624 c, g dbSNP:372825651
629 629 a, g dbSNP:267608468
649 649 c, t dbSNP:267608472
654 654 c, t dbSNP:786204957
662 662 c, t dbSNP:587783081
670 670 c, t dbSNP:587783082
674 674 a, t dbSNP:267608477
676 676 a, g dbSNP:746608623
686 686 a, g dbSNP:768320636
687 687 c, t dbSNP:776078892
698 698 a, g dbSNP:587783083
702 702 c, g dbSNP:762265641
704 704 g, t dbSNP:122460157
707 707 a, g dbSNP:786204985
722 722 a, c, g dbSNP:757402424
726 726 c, t dbSNP:765303813
729 729 a, g dbSNP:750878642
735 735 a, c dbSNP:758844150
755 755 -, ca dbSNP:786204987
760 760 -, gt dbSNP:786204988
762 762 a, c dbSNP:267608490
774 774 a, t dbSNP:61749700
775 775 a, c, g, t dbSNP:587783084
777 777 g, t dbSNP:786204989
781 781 a, c, t dbSNP:267608493
782 782 a, c, g dbSNP:267606715
783 783 a, g dbSNP:369535258
788 788 c, t dbSNP:61749704
791 791 a, c dbSNP:587783085
798 798 -, actt dbSNP:587783111
798 798 -, a dbSNP:267608497
805 805 a, g dbSNP:765304446
822 822 c, g dbSNP:786204958
826 826 a, g dbSNP:587783086
827 827 a, g dbSNP:267608500
836 836 c, t dbSNP:267608501
837 837 a, g dbSNP:750492179
851 851 c, t dbSNP:587783087
852 852 c, t dbSNP:763478005
856 856 g, t dbSNP:267608505
871 871 c, t dbSNP:587783405
875 875 c, g dbSNP:587783088
885 885 c, t dbSNP:751883002
905 905 a, c dbSNP:786204963
908 908 c, t dbSNP:267608511
909 909 c, t dbSNP:370073267
913 913 -, tttta dbSNP:786204990
923 923 a, g dbSNP:752118445
929 929 g, t dbSNP:267608515
936 936 a, g dbSNP:755330309
949 949 c, t dbSNP:587783089
968 968 c, g dbSNP:766475539
990 990 c, t dbSNP:752286259
991 991 c, t dbSNP:374585296
1050 1050 -, ta dbSNP:267608528
1057 1057 -, c dbSNP:587783112
1087 1087 -, ttggacccag dbSNP:61750250
1095 1095 a, g dbSNP:773523708
1101 1101 a, c dbSNP:762927814
1104 1104 a, c dbSNP:267608532
1107 1107 c, t dbSNP:766511365
1112 1112 c, t dbSNP:267606713
1116 1116 -, a dbSNP:267608537
1121 1121 a, g dbSNP:267606714
1133 1133 -, c dbSNP:267608542
1135 1135 a, g dbSNP:751995225
1137 1137 a, g dbSNP:760048639
1152 1152 -, ga dbSNP:267608546
1153 1153 c, t dbSNP:267608547
1163 1163 a, g dbSNP:767817521
1188 1188 a, g dbSNP:370986597
1191 1191 -, a dbSNP:786204992
1199 1199 a, g dbSNP:756537286
1200 1200 c, t dbSNP:374371309
1213 1213 -, a dbSNP:267608552
1216 1216 c, t dbSNP:527360143
1218 1218 a, g dbSNP:587783407
1222 1222 a, g dbSNP:756721244
1236 1236 c, t dbSNP:142665931
1237 1237 c, g dbSNP:760930296
1244 1244 a, g dbSNP:764589907
1245 1245 c, t dbSNP:17853543
1246 1246 a, t dbSNP:753370169
1251 1251 c, t dbSNP:756986206
1257 1257 -, gtctcaccacagatctaacagc dbSNP:786204964
1257 1257 a, g dbSNP:764793934
1261 1261 c, g, t dbSNP:749986393
1268 1268 a, g dbSNP:780119476
1276 1276 a, g dbSNP:371313385
1286 1286 g, t dbSNP:199916668
1287 1287 c, t dbSNP:754663076
1288 1288 c, t dbSNP:267608561
1294 1294 c, g dbSNP:781052780
1300 1300 a, g dbSNP:587783150
1303 1303 c, g dbSNP:749420859
1313 1313 a, g dbSNP:189400843
1315 1315 c, g dbSNP:774594152
1320 1320 -, c dbSNP:786204965
1320 1320 c, t dbSNP:144204039
1321 1321 a, g dbSNP:772194937
1328 1328 c, t dbSNP:775860922
1328 1328 -, t dbSNP:267608565
1331 1331 -, c dbSNP:267608566
1335 1335 c, t dbSNP:761253221
1337 1337 a, g dbSNP:755167459
1339 1339 g, t dbSNP:786204966
1347 1347 c, t dbSNP:777079786
1350 1350 a, g dbSNP:781401272
1351 1351 a, g dbSNP:764955063
1360 1360 c, t dbSNP:750150096
1365 1365 a, g, t dbSNP:148302590
1371 1371 a, t dbSNP:141452495
1383 1383 a, g dbSNP:754963806
1385 1385 g, t dbSNP:780808984
1402 1402 a, c dbSNP:752455644
1408 1408 a, g dbSNP:755949561
1412 1412 a, g dbSNP:779090061
1416 1416 a, g dbSNP:746152862
1437 1437 a, t dbSNP:772076629
1445 1445 a, c dbSNP:267608611
1454 1454 a, t dbSNP:747428764
1458 1458 a, g dbSNP:769239677
1462 1462 -, ctt dbSNP:759725174
1474 1474 a, g dbSNP:777046046
1479 1479 a, c dbSNP:762247736
1483 1483 a, g dbSNP:770340766
1487 1487 c, g dbSNP:267608618
1492 1492 a, g dbSNP:772931688
1496 1496 -, ag dbSNP:786204967
1515 1515 a, c, t dbSNP:762708691
1527 1527 a, c dbSNP:267608620
1535 1535 c, t dbSNP:377263491
1546 1546 c, t dbSNP:751110235
1553 1553 a, c dbSNP:759005252
1560 1560 -, c dbSNP:267608623
1573 1573 c, t dbSNP:587783151
1577 1577 a, c dbSNP:767464855
1579 1579 c, t dbSNP:61753977
1581 1581 c, t dbSNP:150844616
1587 1587 a, t dbSNP:139329419
1588 1588 c, t dbSNP:750590534
1589 1589 g, t dbSNP:758671947
1590 1590 -, c dbSNP:786204968
1594 1594 -, gaaagctctcaaagcaaag dbSNP:587783113
1594 1594 -, ga dbSNP:587783398
1616 1616 c, g dbSNP:779960805
1624 1624 c, t dbSNP:786204969
1627 1627 a, g dbSNP:4825262
1630 1630 a, g dbSNP:747081232
1631 1631 a, g, t dbSNP:267608629
1635 1635 a, c dbSNP:748731763
1636 1636 a, g dbSNP:770224409
1638 1638 a, g dbSNP:773733498
1646 1646 a, g dbSNP:748907380
1649 1649 a, c, g dbSNP:267608631
1666 1666 -, a dbSNP:786204970
1669 1669 -, c dbSNP:769967695
1671 1671 c, t dbSNP:773921712
1680 1680 c, t dbSNP:143992148
1681 1681 -, t dbSNP:786204971
1691 1691 c, g dbSNP:778294301
1695 1695 c, t dbSNP:372655753
1696 1696 a, g dbSNP:775336608
1700 1700 -, ccaagg dbSNP:774479468
1701 1701 a, c dbSNP:760623086
1704 1704 -, ggccaa dbSNP:587783114
1727 1727 c, g dbSNP:754063912
1749 1749 a, c dbSNP:587783152
1772 1772 c, t dbSNP:201893287
1775 1775 c, t dbSNP:779325312
1776 1776 a, g dbSNP:369561849
1783 1783 a, t dbSNP:766602493
1797 1797 c, t dbSNP:751789670
1799 1799 -, t dbSNP:786204972
1803 1803 a, g dbSNP:755082123
1813 1813 g, t dbSNP:781427744
1829 1829 c, t dbSNP:748615147
1835 1835 c, g dbSNP:756720478
1840 1840 a, g dbSNP:778464010
1845 1845 a, c dbSNP:201786426
1849 1849 a, g dbSNP:749639424
1863 1863 a, g dbSNP:147300538
1881 1881 a, t dbSNP:774046085
1885 1885 a, g dbSNP:587783153
1897 1897 c, t dbSNP:267608643
1898 1898 a, g dbSNP:745508309
1911 1911 a, g dbSNP:771556342
1912 1912 c, t dbSNP:775006943
1919 1919 c, g dbSNP:587783145
1920 1920 -, a dbSNP:587783115
1921 1921 c, t dbSNP:373370734
1922 1922 a, g dbSNP:763991639
1924 1924 c, t dbSNP:267608395
1927 1927 a, g dbSNP:587783400
1933 1933 a, g dbSNP:376341076
1941 1941 c, t dbSNP:765011302
1950 1950 a, g dbSNP:751738489
1957 1957 g, t dbSNP:267608644
1960 1960 c, t dbSNP:755177112
1962 1962 a, g dbSNP:767662661
1970 1970 c, t dbSNP:199897804
1971 1971 a, g dbSNP:371603866
1974 1974 a, g dbSNP:778407047
1979 1979 c, t dbSNP:749822712
1980 1980 g, t dbSNP:757573258
2004 2004 a, c, g dbSNP:779156340
2011 2011 c, t dbSNP:201209961
2016 2016 c, t dbSNP:267608645
2017 2017 a, g dbSNP:372629988
2031 2031 c, t dbSNP:768214366
2033 2033 -, g dbSNP:786204974
2035 2035 c, t dbSNP:776627003
2044 2044 -, a dbSNP:587783116
2044 2044 a, c dbSNP:761662406
2046 2046 -, c dbSNP:587783401
2046 2046 c, g dbSNP:141478957
2049 2049 a, c, t dbSNP:772909747
2052 2052 c, t dbSNP:767825838
2066 2066 a, g dbSNP:375650421
2067 2067 a, g dbSNP:587783154
2076 2076 c, t dbSNP:764272402
2103 2103 -, c dbSNP:786204975
2107 2107 a, c, g dbSNP:77097064
2118 2118 c, g dbSNP:754311008
2135 2135 -, tt dbSNP:587783117
2141 2141 c, t dbSNP:144878564
2142 2142 -, ta dbSNP:267608646
2156 2156 a, c dbSNP:779298697
2158 2158 -, g dbSNP:587783118
2159 2159 c, g dbSNP:750727784
2198 2198 a, g dbSNP:773251215
2203 2203 c, t dbSNP:267608647
2205 2205 a, g dbSNP:762828342
2231 2231 g, t dbSNP:770913092
2233 2233 c, t dbSNP:775783994
2235 2235 c, t dbSNP:760988585
2265 2265 -, c dbSNP:267608649
2265 2265 -, c dbSNP:267608648
2271 2271 c, g dbSNP:763419895
2281 2281 c, t dbSNP:753899592
2289 2289 a, g, t dbSNP:761995288
2294 2294 ag, nnnnnnnnnnnnnnnnnn dbSNP:672601303
2308 2308 c, t dbSNP:764423452
2315 2315 -, c dbSNP:267608651
2316 2316 a, g dbSNP:774307489
2326 2326 a, g dbSNP:747196703
2335 2335 a, g dbSNP:374518046
2354 2354 -, ac dbSNP:786204978
2356 2356 c, g dbSNP:776965205
2358 2358 a, g, t dbSNP:761789190
2367 2367 c, t dbSNP:17853544
2388 2388 a, t dbSNP:773642754
2392 2392 c, t dbSNP:17855594
2397 2397 -, ca dbSNP:587783119
2401 2401 a, g dbSNP:267608653
2406 2406 a, g, t dbSNP:200333632
2413 2413 c, t dbSNP:367674558
2449 2449 a, g dbSNP:55803460
2454 2454 -, ag dbSNP:587783120
2464 2464 c, g, t dbSNP:747554139
2467 2467 a, c, g dbSNP:775950681
2469 2469 a, g dbSNP:142079769
2490 2490 c, t dbSNP:753606345
2492 2492 a, g dbSNP:748459878
2503 2503 -, a dbSNP:587783121
2505 2505 a, g dbSNP:770193102
2514 2514 a, t dbSNP:727503846
2518 2518 a, g dbSNP:758383464
2520 2520 c, t dbSNP:779674798
2557 2557 a, c dbSNP:786204954
2572 2572 -, gaga dbSNP:587783122
2574 2574 -, ga dbSNP:267608654
2592 2592 -, g dbSNP:62643614
2596 2596 a, t dbSNP:761091421
2609 2609 -, agaa dbSNP:587783123
2612 2612 -, agaaa dbSNP:267608655
2621 2621 a, c dbSNP:35478150
2626 2626 a, g dbSNP:754699773
2627 2627 c, t dbSNP:62643617
2637 2637 c, t dbSNP:727503847
2638 2638 a, c, g dbSNP:140313320
2643 2643 c, t dbSNP:757497935
2644 2644 c, g dbSNP:779041423
2658 2658 a, c, g dbSNP:145401225
2662 2662 c, t dbSNP:267608659
2694 2694 c, t dbSNP:371902632
2713 2713 c, t dbSNP:780609419
2714 2714 a, g dbSNP:376429571
2715 2715 c, g dbSNP:146488512
2718 2718 -, c dbSNP:587783124
2718 2718 c, t dbSNP:369377144
2719 2719 a, g dbSNP:747764150
2731 2731 c, g dbSNP:372839442
2734 2734 c, g dbSNP:772791378
2735 2735 c, t dbSNP:762517975
2743 2743 c, t dbSNP:17857094
2747 2747 c, g dbSNP:747470282
2749 2749 c, t dbSNP:122460158
2753 2753 -, c dbSNP:267608660
2778 2778 -, a dbSNP:267608661
2780 2780 -, a dbSNP:786204980
2789 2789 c, t dbSNP:755573510
2790 2790 a, g dbSNP:781774964
2796 2796 a, c dbSNP:748502843
2798 2798 -, a dbSNP:587783125
2800 2800 a, c dbSNP:770346971
2801 2801 a, g dbSNP:772853668
2804 2804 c, g, t dbSNP:587783156
2805 2805 a, g dbSNP:748905018
2816 2816 a, t dbSNP:770426025
2821 2821 -, c dbSNP:267608662
2821 2821 c, t dbSNP:773760466
2822 2822 a, g dbSNP:759083770
2836 2836 a, g dbSNP:767416919
2842 2842 c, t dbSNP:267608663
2845 2845 c, t dbSNP:587783158
2857 2857 -, t dbSNP:587783126
2884 2884 -, ct dbSNP:61753251
2901 2901 c, t dbSNP:201473442
2902 2902 a, g dbSNP:398123694
2918 2918 a, g dbSNP:200809878
2920 2920 c, t dbSNP:587783159
2922 2922 a, g dbSNP:373448935
2926 2926 c, t dbSNP:750605227
2928 2928 c, t dbSNP:777919249
2929 2929 a, g dbSNP:763110247
2933 2933 c, t dbSNP:587783157
2953 2953 c, t dbSNP:786204981
2964 2964 c, t dbSNP:201714912
2965 2965 a, c, g dbSNP:369009993
2968 2968 a, g dbSNP:769931918
2987 2987 a, g dbSNP:773644857
2988 2988 c, g dbSNP:587783160
2993 2993 a, g dbSNP:149345562
2996 2996 a, g dbSNP:774743991
3005 3005 c, t dbSNP:568161022
3006 3006 c, t dbSNP:759862340
3009 3009 a, g dbSNP:767180920
3015 3015 a, t dbSNP:752464218
3016 3016 a, c, t dbSNP:267608664
3033 3033 a, g dbSNP:369383134
3042 3042 a, g dbSNP:757292432
3069 3069 a, c dbSNP:587783403
3079 3079 a, c dbSNP:200236257
3090 3090 a, g dbSNP:368344738
3094 3094 a, g dbSNP:774335258
3103 3103 c, t dbSNP:202153551
3106 3106 g, t dbSNP:767312604
3116 3116 a, g, t dbSNP:376557374
3120 3120 a, g dbSNP:765535216
3124 3124 c, t dbSNP:750449476
3125 3125 c, g dbSNP:371847235
3126 3126 c, t dbSNP:780702363
3128 3128 a, c, g dbSNP:752120798
3139 3139 c, t dbSNP:781435432
3145 3145 a, g dbSNP:747799506
3148 3148 c, g dbSNP:769305518
3157 3157 c, t dbSNP:267608665
3158 3158 a, g dbSNP:570887192
3168 3168 c, t dbSNP:770428990
3176 3176 c, t dbSNP:587783161
3177 3177 a, g dbSNP:140944590
3182 3182 g, t dbSNP:143243059
3184 3184 c, g dbSNP:775114662
3190 3190 c, g dbSNP:374054249
3191 3191 a, g dbSNP:760568446
3207 3207 c, t dbSNP:765366935
3228 3228 c, t dbSNP:750725714
3231 3231 g, t dbSNP:775556155
3233 3233 g, t dbSNP:267608666
3243 3243 c, t dbSNP:150900695
3244 3244 a, g, t dbSNP:35693326
3246 3246 a, g dbSNP:763292733
3248 3248 a, g dbSNP:766531184
3250 3250 c, g dbSNP:376960593
3252 3252 c, g, t dbSNP:36022183
3257 3257 c, t dbSNP:587783162
3258 3258 a, g dbSNP:767903007
3261 3261 g, t dbSNP:267608667
3262 3262 a, g dbSNP:145462429
3266 3266 c, t dbSNP:573588032
3280 3280 a, g dbSNP:727503848
3281 3281 c, t dbSNP:764540699
3286 3286 a, g dbSNP:753447480
3291 3291