Email to GenScript

TERT telomerase reverse transcriptase [Homo sapiens (human)]

Gene Symbol TERT
Entrez Gene ID 7015
Full Name telomerase reverse transcriptase
Synonyms CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT
General protein information
Preferred Names
telomerase reverse transcriptase
telomerase reverse transcriptase
telomerase catalytic subunit
telomerase-associated protein 2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Aplastic anemia, susceptibility to}, 609135 (3); {Pulmonary

The following TERT gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the TERT gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu60951 XM_011514104 PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu60952 XM_011514105 PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $439
OHu60952 XM_011514106 PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $439
OHu23650 NM_001193376 Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu25394 NM_198253 Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu60951
Accession Version XM_011514104.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1869bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product telomerase reverse transcriptase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)489..689(+)
Misc Feature(2)759..>1094(+)
Misc Feature(3)1041..1058(+)
Misc Feature(4)1380..1715(+)
Misc Feature(5)1404..1703(+)
Misc Feature(6)1407..1409(+)
Position Chain Variation Link
11 11 c, t dbSNP:758141526
16 16 c, t dbSNP:528890763
45 45 c, t dbSNP:184369732
48 48 a, c dbSNP:537613273
102 102 a, c dbSNP:373971011
138 138 c, t dbSNP:778905834
171 171 a, g dbSNP:546913340
174 174 a, c dbSNP:192814382
228 228 a, c dbSNP:35116243
229 229 a, g dbSNP:545694091
244 244 g, t dbSNP:2736100
258 258 g, t dbSNP:187573977
280 280 c, t dbSNP:544552015
283 283 a, c dbSNP:34363858
284 284 a, g dbSNP:555372519
291 291 c, t dbSNP:111668843
303 303 c, g dbSNP:573218717
305 305 c, t dbSNP:558304626
309 309 a, g dbSNP:539648836
337 337 a, g dbSNP:536269590
346 346 c, t dbSNP:750888914
404 404 a, g dbSNP:550394168
405 405 c, t dbSNP:767913721
406 406 a, g dbSNP:762375094
408 408 c, t dbSNP:535591745
412 412 c, t dbSNP:375652460
419 419 c, t dbSNP:774686196
458 458 a, g dbSNP:546652324
466 466 c, t dbSNP:764492977
467 467 a, g dbSNP:35135137
496 496 c, t dbSNP:369539932
500 500 c, t dbSNP:146462061
501 501 a, g dbSNP:776459827
511 511 a, g dbSNP:768398955
516 516 c, t dbSNP:760352197
530 530 g, t dbSNP:774891917
531 531 g, t dbSNP:771542084
542 542 g, t dbSNP:780652471
555 555 a, c dbSNP:745806589
557 557 a, t dbSNP:778896667
563 563 c, t dbSNP:143789839
564 564 a, g dbSNP:749051614
566 566 c, t dbSNP:35809415
569 569 c, g dbSNP:200539091
584 584 g, t dbSNP:752927236
597 597 a, t dbSNP:140261940
599 599 a, g dbSNP:377217777
621 621 a, c dbSNP:781140261
638 638 c, g dbSNP:143585580
657 657 g, t dbSNP:151204682
658 658 g, t dbSNP:143457728
666 666 a, g dbSNP:752068571
667 667 c, t dbSNP:148882731
686 686 g, t dbSNP:199585924
692 692 a, g dbSNP:765708956
698 698 a, g dbSNP:377106279
701 701 g, t dbSNP:752358619
702 702 c, t dbSNP:767166646
703 703 a, g dbSNP:372511089
712 712 c, t dbSNP:759017540
713 713 a, g dbSNP:773873942
719 719 a, g dbSNP:33959226
728 728 a, g dbSNP:368309861
731 731 a, g, t dbSNP:769540249
735 735 c, t dbSNP:747940807
736 736 a, g dbSNP:776763536
743 743 c, g dbSNP:34170122
749 749 c, t dbSNP:747157175
750 750 a, g dbSNP:112614087
753 753 c, t dbSNP:780283430
756 756 c, t dbSNP:140951453
760 760 c, t dbSNP:746434205
761 761 a, g, t dbSNP:746040728
787 787 c, g dbSNP:146439826
791 791 c, t dbSNP:143992655
794 794 a, g dbSNP:764318596
794 794 -, g dbSNP:765087191
799 799 a, g dbSNP:199422294
803 803 a, g dbSNP:140056333
821 821 c, t dbSNP:541931572
822 822 a, g dbSNP:151121796
824 824 a, c, t dbSNP:142989562
825 825 a, g dbSNP:765195721
831 831 a, g dbSNP:761603068
833 833 c, g, t dbSNP:768266882
838 838 c, t dbSNP:201927653
839 839 a, c, g dbSNP:148582238
843 843 c, t dbSNP:147521473
844 844 g, t dbSNP:779338296
846 846 a, c dbSNP:144821759
854 854 c, g dbSNP:749719489
856 856 a, g dbSNP:190125817
860 860 c, t dbSNP:201088708
864 864 c, t dbSNP:372272356
875 875 a, g dbSNP:368784316
878 878 a, g dbSNP:749973864
881 881 a, g dbSNP:778496417
884 884 a, g dbSNP:756706816
890 890 a, g dbSNP:375454175
896 896 c, t dbSNP:763907027
908 908 c, t dbSNP:758494245
912 912 c, t dbSNP:372140951
916 916 c, t dbSNP:767382450
917 917 a, g dbSNP:759843505
919 919 a, g dbSNP:774381540
920 920 a, g dbSNP:34625402
921 921 c, t dbSNP:368430301
926 926 c, t dbSNP:762941707
927 927 a, g dbSNP:773813809
936 936 g, t dbSNP:199422296
938 938 c, t dbSNP:33956095
947 947 c, g dbSNP:748610058
952 952 a, g dbSNP:199422295
958 958 a, g dbSNP:776981958
959 959 c, t dbSNP:768948796
965 965 c, t dbSNP:745590324
968 968 c, t dbSNP:370486790
979 979 a, g dbSNP:202123213
983 983 a, c dbSNP:748724920
986 986 c, t dbSNP:371759577
987 987 a, g dbSNP:121918662
994 994 a, g dbSNP:756152343
998 998 a, g dbSNP:377436842
1004 1004 c, t dbSNP:33963617
1012 1012 c, t dbSNP:754809046
1013 1013 a, g dbSNP:151055240
1015 1015 c, t dbSNP:564647937
1016 1016 a, g dbSNP:763147123
1017 1017 c, t dbSNP:199422297
1025 1025 a, g dbSNP:377030225
1034 1034 c, g dbSNP:765264494
1046 1046 a, g dbSNP:775722062
1048 1048 c, t dbSNP:772441504
1049 1049 a, g dbSNP:762534978
1052 1052 a, c, t dbSNP:769467251
1053 1053 a, g dbSNP:387907249
1054 1054 c, t dbSNP:199422298
1055 1055 a, g dbSNP:747654267
1058 1058 c, t dbSNP:147261325
1061 1061 c, t dbSNP:377437136
1065 1065 a, g dbSNP:373072850
1069 1069 c, g dbSNP:199422299
1076 1076 c, t dbSNP:368762140
1078 1078 c, g dbSNP:758192867
1084 1084 c, t dbSNP:149566858
1085 1085 a, g dbSNP:199422288
1091 1091 a, c dbSNP:757387292
1092 1092 a, g dbSNP:753929279
1094 1094 c, t dbSNP:200819224
1095 1095 a, g dbSNP:761116773
1097 1097 c, t dbSNP:138128892
1107 1107 a, g dbSNP:767819088
1112 1112 a, c dbSNP:772650889
1121 1121 a, g dbSNP:200858212
1127 1127 c, t dbSNP:769553764
1128 1128 a, g, t dbSNP:150819225
1132 1132 a, g dbSNP:727503468
1135 1135 a, g dbSNP:768168259
1142 1142 c, t dbSNP:777869512
1145 1145 a, g dbSNP:781604343
1147 1147 -, t dbSNP:199422300
1158 1158 a, g dbSNP:772070672
1162 1162 a, g dbSNP:375699185
1163 1163 c, t dbSNP:745650751
1169 1169 c, t dbSNP:778622091
1170 1170 a, g dbSNP:576633619
1173 1173 c, t dbSNP:754018580
1174 1174 a, g dbSNP:374206276
1179 1179 g, t dbSNP:756195573
1190 1190 c, t dbSNP:370808390
1193 1193 c, t dbSNP:768062052
1195 1195 g, t dbSNP:759490897
1206 1206 a, g dbSNP:774249292
1208 1208 a, g dbSNP:374592280
1214 1214 c, t dbSNP:117662357
1220 1220 a, g dbSNP:199770141
1222 1222 a, g dbSNP:121918663
1227 1227 a, c, t dbSNP:770066110
1235 1235 c, t dbSNP:748248614
1239 1239 g, t dbSNP:781360741
1242 1242 c, t dbSNP:755090021
1244 1244 c, t dbSNP:747564177
1245 1245 c, t dbSNP:560146437
1250 1250 a, g dbSNP:758894591
1253 1253 g, t dbSNP:750815238
1260 1260 c, g, t dbSNP:755822641
1261 1261 a, c, g dbSNP:483352771
1262 1262 a, g dbSNP:545260840
1274 1274 c, t dbSNP:759014638
1275 1275 a, g dbSNP:371413388
1277 1277 a, c, t dbSNP:376251639
1278 1278 a, g dbSNP:141425941
1283 1283 c, t dbSNP:769431975
1294 1294 c, t dbSNP:369810792
1298 1298 c, g dbSNP:377216965
1315 1315 a, g dbSNP:760914366
1325 1325 c, t dbSNP:372497245
1328 1328 c, t dbSNP:771997164
1329 1329 a, g dbSNP:200119385
1338 1338 c, t dbSNP:199422301
1339 1339 a, g dbSNP:552708120
1351 1351 a, g dbSNP:771392980
1355 1355 c, t dbSNP:368279364
1356 1356 a, g dbSNP:778051907
1358 1358 c, t dbSNP:752794198
1362 1362 a, c dbSNP:746621306
1365 1365 a, c dbSNP:779558116
1372 1372 a, g dbSNP:757820442
1376 1376 -, ggcaag dbSNP:751708357
1379 1379 c, g dbSNP:759744531
1382 1382 c, t dbSNP:141382603
1391 1391 c, t dbSNP:771514853
1403 1403 a, g, t dbSNP:763470933
1413 1413 a, g dbSNP:773683541
1418 1418 c, t dbSNP:374940572
1423 1423 c, t dbSNP:748503447
1424 1424 a, c, g dbSNP:140124989
1427 1427 a, g dbSNP:144310369
1444 1444 a, g dbSNP:199422302
1445 1445 c, t dbSNP:778309923
1448 1448 c, t dbSNP:770543108
1462 1462 a, g dbSNP:749279645
1464 1464 c, t dbSNP:375042320
1471 1471 c, t dbSNP:775014633
1472 1472 a, g dbSNP:769077049
1480 1480 a, g, t dbSNP:144779807
1483 1483 a, g dbSNP:755183437
1487 1487 c, t dbSNP:751752830
1497 1497 c, t dbSNP:777358007
1500 1500 c, t dbSNP:372868296
1501 1501 a, g dbSNP:121918666
1506 1506 a, g, t dbSNP:201159197
1520 1520 c, g dbSNP:780868215
1535 1535 c, g dbSNP:199422303
1537 1537 -, tcacc dbSNP:763191618
1547 1547 a, g dbSNP:754776542
1549 1549 a, t dbSNP:751767277
1550 1550 a, g dbSNP:375558251
1553 1553 a, c dbSNP:758561541
1559 1559 c, t dbSNP:374309472
1562 1562 c, g dbSNP:754372863
1565 1565 a, c dbSNP:371744235
1568 1568 g, t dbSNP:756519152
1573 1573 a, g dbSNP:532158398
1595 1595 c, t dbSNP:373952421
1596 1596 a, g, t dbSNP:559028617
1608 1608 c, t dbSNP:199422304
1609 1609 a, g dbSNP:772974254
1610 1610 a, g dbSNP:764875699
1612 1612 a, g dbSNP:387907250
1613 1613 c, g dbSNP:121918665
1615 1615 c, t dbSNP:727505125
1632 1632 a, g dbSNP:537649320
1635 1635 c, g dbSNP:776487058
1640 1640 c, t dbSNP:768646695
1641 1641 a, g dbSNP:746883330
1643 1643 a, g dbSNP:775289969
1646 1646 c, t dbSNP:771835512
1651 1651 a, g dbSNP:202033269
1657 1657 c, t dbSNP:779102560
1658 1658 a, g dbSNP:375200599
1671 1671 a, t dbSNP:554229004
1675 1675 c, t dbSNP:387907251
1676 1676 a, g dbSNP:200174990
1679 1679 c, t dbSNP:367672336
1682 1682 a, c, t dbSNP:34528119
1683 1683 a, g dbSNP:547377569
1688 1688 a, g dbSNP:370292237
1700 1700 c, t dbSNP:764925909
1701 1701 a, g dbSNP:761308654
1703 1703 a, c dbSNP:375675196
1706 1706 g, t dbSNP:763468049
1709 1709 g, t dbSNP:201322872
1720 1720 a, g dbSNP:199741493
1727 1727 g, t dbSNP:771921274
1738 1738 a, g dbSNP:759314942
1751 1751 a, c, g dbSNP:34062885
1757 1757 c, g dbSNP:758664162
1758 1758 a, c, t dbSNP:370445231
1759 1759 a, g dbSNP:755707625
1775 1775 c, t dbSNP:752210365
1791 1791 c, t dbSNP:144697790
1792 1792 a, g dbSNP:759490631
1793 1793 c, t dbSNP:542440625
1794 1794 a, g dbSNP:201272197
1804 1804 c, g dbSNP:766236334
1815 1815 a, c dbSNP:762647113
1816 1816 c, t dbSNP:149439946
1821 1821 c, t dbSNP:773537902
1842 1842 c, t dbSNP:199422305
1843 1843 a, g dbSNP:765566930
1846 1846 c, t dbSNP:762057495
1853 1853 c, t dbSNP:201689770
1866 1866 -, c dbSNP:770230888
1873 1873 -, t dbSNP:760179727
1889 1889 c, t dbSNP:762178169
1895 1895 a, g dbSNP:776966669
1898 1898 a, g dbSNP:376266401
1913 1913 c, t dbSNP:760659103
1934 1934 a, g dbSNP:775582757
1946 1946 c, t dbSNP:33954691
1950 1950 c, t dbSNP:199422307
1960 1960 a, c dbSNP:745871038
1996 1996 c, g dbSNP:377419542
2003 2003 c, t dbSNP:757204201
2004 2004 c, t dbSNP:753691323
2007 2007 c, t dbSNP:777672180
2008 2008 a, g dbSNP:62331332
2009 2009 c, t dbSNP:752939718
2010 2010 a, g, t dbSNP:374968697
2012 2012 c, t dbSNP:181612536
2021 2021 c, t dbSNP:766881195
2023 2023 c, t dbSNP:763381198
2024 2024 a, g dbSNP:773595628
2025 2025 g, t dbSNP:770144114
2030 2030 c, t dbSNP:760287437
2033 2033 c, t dbSNP:377570406
2039 2039 c, t dbSNP:771543669
2051 2051 a, g dbSNP:745389061
2057 2057 c, g dbSNP:373400596
2060 2060 c, t dbSNP:771025266
2066 2066 a, g dbSNP:200002330
2071 2071 c, t dbSNP:201330213
2072 2072 a, g, t dbSNP:554739019
2087 2087 c, t dbSNP:202166769
2090 2090 c, t dbSNP:769532174
2091 2091 a, g dbSNP:35719940
2093 2093 c, t dbSNP:201067706
2108 2108 c, t dbSNP:755223754
2114 2114 c, t dbSNP:376835357
2127 2127 g, t dbSNP:201235479
2131 2131 a, g dbSNP:780154973
2147 2147 c, t dbSNP:758469915
2157 2157 c, t dbSNP:750951309
2158 2158 a, g dbSNP:765787352
2159 2159 a, g dbSNP:757638312
2164 2164 a, g dbSNP:200288187
2166 2166 a, g dbSNP:571590747
2174 2174 c, t dbSNP:759883263
2175 2175 a, g dbSNP:121918664
2177 2177 c, g dbSNP:766050973
2183 2183 c, t dbSNP:368551449
2209 2209 c, t dbSNP:764602705
2210 2210 a, g dbSNP:551516320
2221 2221 a, g dbSNP:532930887
2229 2229 c, t dbSNP:763647787
2230 2230 c, t dbSNP:376255453
2231 2231 a, g dbSNP:35033501
2233 2233 a, g dbSNP:185829989
2236 2236 c, t dbSNP:199422306
2237 2237 a, g dbSNP:772311888
2239 2239 c, t dbSNP:370686937
2240 2240 a, c, g dbSNP:200102606
2255 2255 a, g dbSNP:770887619
2256 2256 g, t dbSNP:749874887
2257 2257 a, c dbSNP:372822033
2258 2258 c, t dbSNP:192377676
2259 2259 a, g dbSNP:756628621
2262 2262 a, g dbSNP:753112435
2265 2265 a, c dbSNP:781651959
2267 2267 c, t dbSNP:758092349
2270 2270 a, g dbSNP:750020682
2271 2271 a, g dbSNP:764841621
2276 2276 a, g dbSNP:529179931
2293 2293 a, c dbSNP:775095158
2311 2311 -, cacccgcccacagccaggccgagagcagacaccagcagccctgtcacg ccgggctctacgtcccagggagggaggggcggcccacacccaggcccgcaccgctggg agtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaaggctgagt gtccggctgaggc dbSNP:199422308
2313 2313 c, t dbSNP:753289422
2315 2315 c, g, t dbSNP:374834138
2316 2316 a, g, t dbSNP:771745814
2320 2320 a, c dbSNP:759844975
2328 2328 a, g dbSNP:774434714
2330 2330 c, g, t dbSNP:749338229
2335 2335 a, g dbSNP:773355204
2338 2338 c, g dbSNP:770451101
2350 2350 c, t dbSNP:757941512
2357 2357 c, t dbSNP:748616970
2360 2360 c, t dbSNP:561884153
2369 2369 c, t dbSNP:5031049
2388 2388 c, t dbSNP:750640403
2389 2389 a, g dbSNP:533940688
2405 2405 c, t dbSNP:2853690
2411 2411 a, g dbSNP:554285274
2444 2444 c, t dbSNP:376258654
2445 2445 a, g dbSNP:553818689
2449 2449 c, t dbSNP:147703938
2455 2455 c, t dbSNP:539080954
2459 2459 c, t dbSNP:114012142
2460 2460 a, g dbSNP:142869901
2461 2461 c, g dbSNP:537898055
2493 2493 a, c, t dbSNP:556129131
2511 2511 c, t dbSNP:766752651
2532 2532 c, t dbSNP:534356342
2536 2536 c, t dbSNP:751808151
2543 2543 c, t dbSNP:567092780
2557 2557 a, g dbSNP:34527601
2560 2560 c, t dbSNP:750662141
2561 2561 a, g dbSNP:373241100
2575 2575 a, g dbSNP:369456871
2600 2600 a, g dbSNP:571607606
2640 2640 c, g, t dbSNP:531597316
2641 2641 a, g dbSNP:375391845
2719 2719 a, g dbSNP:538533887
2720 2720 a, g dbSNP:528913036
2796 2796 a, g dbSNP:561635924
2806 2806 c, t dbSNP:564365986
2809 2809 c, g dbSNP:546508805
2853 2853 c, t dbSNP:528223152
2866 2866 a, g dbSNP:549635168

Target ORF information:

RefSeq Version XM_011514104
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60952
Accession Version XM_011514105.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1755bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product telomerase reverse transcriptase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)593..730(+)
Misc Feature(2)800..>1135(+)
Misc Feature(3)1082..1099(+)
Misc Feature(4)1421..1756(+)
Misc Feature(5)1445..1744(+)
Misc Feature(6)1448..1450(+)
Position Chain Variation Link
11 11 c, t dbSNP:758141526
16 16 c, t dbSNP:528890763
45 45 c, t dbSNP:184369732
48 48 a, c dbSNP:537613273
102 102 a, c dbSNP:373971011
138 138 c, t dbSNP:778905834
171 171 a, g dbSNP:546913340
174 174 a, c dbSNP:192814382
228 228 a, c dbSNP:35116243
229 229 a, g dbSNP:545694091
244 244 g, t dbSNP:2736100
258 258 g, t dbSNP:187573977
280 280 c, t dbSNP:544552015
283 283 a, c dbSNP:34363858
284 284 a, g dbSNP:555372519
291 291 c, t dbSNP:111668843
303 303 c, g dbSNP:573218717
305 305 c, t dbSNP:558304626
309 309 a, g dbSNP:539648836
337 337 a, g dbSNP:536269590
346 346 c, t dbSNP:750888914
404 404 a, g dbSNP:550394168
405 405 c, t dbSNP:767913721
406 406 a, g dbSNP:762375094
408 408 c, t dbSNP:535591745
412 412 c, t dbSNP:375652460
419 419 c, t dbSNP:774686196
458 458 a, g dbSNP:546652324
466 466 c, t dbSNP:764492977
467 467 a, g dbSNP:35135137
500 500 c, t dbSNP:755728926
509 509 c, t dbSNP:528359987
537 537 c, t dbSNP:369539932
541 541 c, t dbSNP:146462061
542 542 a, g dbSNP:776459827
552 552 a, g dbSNP:768398955
557 557 c, t dbSNP:760352197
571 571 g, t dbSNP:774891917
572 572 g, t dbSNP:771542084
583 583 g, t dbSNP:780652471
596 596 a, c dbSNP:745806589
598 598 a, t dbSNP:778896667
604 604 c, t dbSNP:143789839
605 605 a, g dbSNP:749051614
607 607 c, t dbSNP:35809415
610 610 c, g dbSNP:200539091
625 625 g, t dbSNP:752927236
638 638 a, t dbSNP:140261940
640 640 a, g dbSNP:377217777
662 662 a, c dbSNP:781140261
679 679 c, g dbSNP:143585580
698 698 g, t dbSNP:151204682
699 699 g, t dbSNP:143457728
707 707 a, g dbSNP:752068571
708 708 c, t dbSNP:148882731
727 727 g, t dbSNP:199585924
733 733 a, g dbSNP:765708956
739 739 a, g dbSNP:377106279
742 742 g, t dbSNP:752358619
743 743 c, t dbSNP:767166646
744 744 a, g dbSNP:372511089
753 753 c, t dbSNP:759017540
754 754 a, g dbSNP:773873942
760 760 a, g dbSNP:33959226
769 769 a, g dbSNP:368309861
772 772 a, g, t dbSNP:769540249
776 776 c, t dbSNP:747940807
777 777 a, g dbSNP:776763536
784 784 c, g dbSNP:34170122
790 790 c, t dbSNP:747157175
791 791 a, g dbSNP:112614087
794 794 c, t dbSNP:780283430
797 797 c, t dbSNP:140951453
801 801 c, t dbSNP:746434205
802 802 a, g, t dbSNP:746040728
828 828 c, g dbSNP:146439826
832 832 c, t dbSNP:143992655
835 835 a, g dbSNP:764318596
835 835 -, g dbSNP:765087191
840 840 a, g dbSNP:199422294
844 844 a, g dbSNP:140056333
862 862 c, t dbSNP:541931572
863 863 a, g dbSNP:151121796
865 865 a, c, t dbSNP:142989562
866 866 a, g dbSNP:765195721
872 872 a, g dbSNP:761603068
874 874 c, g, t dbSNP:768266882
879 879 c, t dbSNP:201927653
880 880 a, c, g dbSNP:148582238
884 884 c, t dbSNP:147521473
885 885 g, t dbSNP:779338296
887 887 a, c dbSNP:144821759
895 895 c, g dbSNP:749719489
897 897 a, g dbSNP:190125817
901 901 c, t dbSNP:201088708
905 905 c, t dbSNP:372272356
916 916 a, g dbSNP:368784316
919 919 a, g dbSNP:749973864
922 922 a, g dbSNP:778496417
925 925 a, g dbSNP:756706816
931 931 a, g dbSNP:375454175
937 937 c, t dbSNP:763907027
949 949 c, t dbSNP:758494245
953 953 c, t dbSNP:372140951
957 957 c, t dbSNP:767382450
958 958 a, g dbSNP:759843505
960 960 a, g dbSNP:774381540
961 961 a, g dbSNP:34625402
962 962 c, t dbSNP:368430301
967 967 c, t dbSNP:762941707
968 968 a, g dbSNP:773813809
977 977 g, t dbSNP:199422296
979 979 c, t dbSNP:33956095
988 988 c, g dbSNP:748610058
993 993 a, g dbSNP:199422295
999 999 a, g dbSNP:776981958
1000 1000 c, t dbSNP:768948796
1006 1006 c, t dbSNP:745590324
1009 1009 c, t dbSNP:370486790
1020 1020 a, g dbSNP:202123213
1024 1024 a, c dbSNP:748724920
1027 1027 c, t dbSNP:371759577
1028 1028 a, g dbSNP:121918662
1035 1035 a, g dbSNP:756152343
1039 1039 a, g dbSNP:377436842
1045 1045 c, t dbSNP:33963617
1053 1053 c, t dbSNP:754809046
1054 1054 a, g dbSNP:151055240
1056 1056 c, t dbSNP:564647937
1057 1057 a, g dbSNP:763147123
1058 1058 c, t dbSNP:199422297
1066 1066 a, g dbSNP:377030225
1075 1075 c, g dbSNP:765264494
1087 1087 a, g dbSNP:775722062
1089 1089 c, t dbSNP:772441504
1090 1090 a, g dbSNP:762534978
1093 1093 a, c, t dbSNP:769467251
1094 1094 a, g dbSNP:387907249
1095 1095 c, t dbSNP:199422298
1096 1096 a, g dbSNP:747654267
1099 1099 c, t dbSNP:147261325
1102 1102 c, t dbSNP:377437136
1106 1106 a, g dbSNP:373072850
1110 1110 c, g dbSNP:199422299
1117 1117 c, t dbSNP:368762140
1119 1119 c, g dbSNP:758192867
1125 1125 c, t dbSNP:149566858
1126 1126 a, g dbSNP:199422288
1132 1132 a, c dbSNP:757387292
1133 1133 a, g dbSNP:753929279
1135 1135 c, t dbSNP:200819224
1136 1136 a, g dbSNP:761116773
1138 1138 c, t dbSNP:138128892
1148 1148 a, g dbSNP:767819088
1153 1153 a, c dbSNP:772650889
1162 1162 a, g dbSNP:200858212
1168 1168 c, t dbSNP:769553764
1169 1169 a, g, t dbSNP:150819225
1173 1173 a, g dbSNP:727503468
1176 1176 a, g dbSNP:768168259
1183 1183 c, t dbSNP:777869512
1186 1186 a, g dbSNP:781604343
1188 1188 -, t dbSNP:199422300
1199 1199 a, g dbSNP:772070672
1203 1203 a, g dbSNP:375699185
1204 1204 c, t dbSNP:745650751
1210 1210 c, t dbSNP:778622091
1211 1211 a, g dbSNP:576633619
1214 1214 c, t dbSNP:754018580
1215 1215 a, g dbSNP:374206276
1220 1220 g, t dbSNP:756195573
1231 1231 c, t dbSNP:370808390
1234 1234 c, t dbSNP:768062052
1236 1236 g, t dbSNP:759490897
1247 1247 a, g dbSNP:774249292
1249 1249 a, g dbSNP:374592280
1255 1255 c, t dbSNP:117662357
1261 1261 a, g dbSNP:199770141
1263 1263 a, g dbSNP:121918663
1268 1268 a, c, t dbSNP:770066110
1276 1276 c, t dbSNP:748248614
1280 1280 g, t dbSNP:781360741
1283 1283 c, t dbSNP:755090021
1285 1285 c, t dbSNP:747564177
1286 1286 c, t dbSNP:560146437
1291 1291 a, g dbSNP:758894591
1294 1294 g, t dbSNP:750815238
1301 1301 c, g, t dbSNP:755822641
1302 1302 a, c, g dbSNP:483352771
1303 1303 a, g dbSNP:545260840
1315 1315 c, t dbSNP:759014638
1316 1316 a, g dbSNP:371413388
1318 1318 a, c, t dbSNP:376251639
1319 1319 a, g dbSNP:141425941
1324 1324 c, t dbSNP:769431975
1335 1335 c, t dbSNP:369810792
1339 1339 c, g dbSNP:377216965
1356 1356 a, g dbSNP:760914366
1366 1366 c, t dbSNP:372497245
1369 1369 c, t dbSNP:771997164
1370 1370 a, g dbSNP:200119385
1379 1379 c, t dbSNP:199422301
1380 1380 a, g dbSNP:552708120
1392 1392 a, g dbSNP:771392980
1396 1396 c, t dbSNP:368279364
1397 1397 a, g dbSNP:778051907
1399 1399 c, t dbSNP:752794198
1403 1403 a, c dbSNP:746621306
1406 1406 a, c dbSNP:779558116
1413 1413 a, g dbSNP:757820442
1417 1417 -, ggcaag dbSNP:751708357
1420 1420 c, g dbSNP:759744531
1423 1423 c, t dbSNP:141382603
1432 1432 c, t dbSNP:771514853
1444 1444 a, g, t dbSNP:763470933
1454 1454 a, g dbSNP:773683541
1459 1459 c, t dbSNP:374940572
1464 1464 c, t dbSNP:748503447
1465 1465 a, c, g dbSNP:140124989
1468 1468 a, g dbSNP:144310369
1485 1485 a, g dbSNP:199422302
1486 1486 c, t dbSNP:778309923
1489 1489 c, t dbSNP:770543108
1503 1503 a, g dbSNP:749279645
1505 1505 c, t dbSNP:375042320
1512 1512 c, t dbSNP:775014633
1513 1513 a, g dbSNP:769077049
1521 1521 a, g, t dbSNP:144779807
1524 1524 a, g dbSNP:755183437
1528 1528 c, t dbSNP:751752830
1538 1538 c, t dbSNP:777358007
1541 1541 c, t dbSNP:372868296
1542 1542 a, g dbSNP:121918666
1547 1547 a, g, t dbSNP:201159197
1561 1561 c, g dbSNP:780868215
1576 1576 c, g dbSNP:199422303
1578 1578 -, tcacc dbSNP:763191618
1588 1588 a, g dbSNP:754776542
1590 1590 a, t dbSNP:751767277
1591 1591 a, g dbSNP:375558251
1594 1594 a, c dbSNP:758561541
1600 1600 c, t dbSNP:374309472
1603 1603 c, g dbSNP:754372863
1606 1606 a, c dbSNP:371744235
1609 1609 g, t dbSNP:756519152
1614 1614 a, g dbSNP:532158398
1636 1636 c, t dbSNP:373952421
1637 1637 a, g, t dbSNP:559028617
1649 1649 c, t dbSNP:199422304
1650 1650 a, g dbSNP:772974254
1651 1651 a, g dbSNP:764875699
1653 1653 a, g dbSNP:387907250
1654 1654 c, g dbSNP:121918665
1656 1656 c, t dbSNP:727505125
1673 1673 a, g dbSNP:537649320
1676 1676 c, g dbSNP:776487058
1681 1681 c, t dbSNP:768646695
1682 1682 a, g dbSNP:746883330
1684 1684 a, g dbSNP:775289969
1687 1687 c, t dbSNP:771835512
1692 1692 a, g dbSNP:202033269
1698 1698 c, t dbSNP:779102560
1699 1699 a, g dbSNP:375200599
1712 1712 a, t dbSNP:554229004
1716 1716 c, t dbSNP:387907251
1717 1717 a, g dbSNP:200174990
1720 1720 c, t dbSNP:367672336
1723 1723 a, c, t dbSNP:34528119
1724 1724 a, g dbSNP:547377569
1729 1729 a, g dbSNP:370292237
1741 1741 c, t dbSNP:764925909
1742 1742 a, g dbSNP:761308654
1744 1744 a, c dbSNP:375675196
1747 1747 g, t dbSNP:763468049
1750 1750 g, t dbSNP:201322872
1761 1761 a, g dbSNP:199741493
1768 1768 g, t dbSNP:771921274
1779 1779 a, g dbSNP:759314942
1792 1792 a, c, g dbSNP:34062885
1798 1798 c, g dbSNP:758664162
1799 1799 a, c, t dbSNP:370445231
1800 1800 a, g dbSNP:755707625
1816 1816 c, t dbSNP:752210365
1832 1832 c, t dbSNP:144697790
1833 1833 a, g dbSNP:759490631
1834 1834 c, t dbSNP:542440625
1835 1835 a, g dbSNP:201272197
1845 1845 c, g dbSNP:766236334
1856 1856 a, c dbSNP:762647113
1857 1857 c, t dbSNP:149439946
1862 1862 c, t dbSNP:773537902
1883 1883 c, t dbSNP:199422305
1884 1884 a, g dbSNP:765566930
1887 1887 c, t dbSNP:762057495
1894 1894 c, t dbSNP:201689770
1907 1907 -, c dbSNP:770230888
1914 1914 -, t dbSNP:760179727
1930 1930 c, t dbSNP:762178169
1936 1936 a, g dbSNP:776966669
1939 1939 a, g dbSNP:376266401
1954 1954 c, t dbSNP:760659103
1975 1975 a, g dbSNP:775582757
1987 1987 c, t dbSNP:33954691
1991 1991 c, t dbSNP:199422307
2001 2001 a, c dbSNP:745871038
2037 2037 c, g dbSNP:377419542
2044 2044 c, t dbSNP:757204201
2045 2045 c, t dbSNP:753691323
2048 2048 c, t dbSNP:777672180
2049 2049 a, g dbSNP:62331332
2050 2050 c, t dbSNP:752939718
2051 2051 a, g, t dbSNP:374968697
2053 2053 c, t dbSNP:181612536
2062 2062 c, t dbSNP:766881195
2064 2064 c, t dbSNP:763381198
2065 2065 a, g dbSNP:773595628
2066 2066 g, t dbSNP:770144114
2071 2071 c, t dbSNP:760287437
2074 2074 c, t dbSNP:377570406
2080 2080 c, t dbSNP:771543669
2092 2092 a, g dbSNP:745389061
2098 2098 c, g dbSNP:373400596
2101 2101 c, t dbSNP:771025266
2107 2107 a, g dbSNP:200002330
2112 2112 c, t dbSNP:201330213
2113 2113 a, g, t dbSNP:554739019
2128 2128 c, t dbSNP:202166769
2131 2131 c, t dbSNP:769532174
2132 2132 a, g dbSNP:35719940
2134 2134 c, t dbSNP:201067706
2149 2149 c, t dbSNP:755223754
2155 2155 c, t dbSNP:376835357
2168 2168 g, t dbSNP:201235479
2172 2172 a, g dbSNP:780154973
2188 2188 c, t dbSNP:758469915
2198 2198 c, t dbSNP:750951309
2199 2199 a, g dbSNP:765787352
2200 2200 a, g dbSNP:757638312
2205 2205 a, g dbSNP:200288187
2207 2207 a, g dbSNP:571590747
2215 2215 c, t dbSNP:759883263
2216 2216 a, g dbSNP:121918664
2218 2218 c, g dbSNP:766050973
2224 2224 c, t dbSNP:368551449
2250 2250 c, t dbSNP:764602705
2251 2251 a, g dbSNP:551516320
2262 2262 a, g dbSNP:532930887
2270 2270 c, t dbSNP:763647787
2271 2271 c, t dbSNP:376255453
2272 2272 a, g dbSNP:35033501
2274 2274 a, g dbSNP:185829989
2277 2277 c, t dbSNP:199422306
2278 2278 a, g dbSNP:772311888
2280 2280 c, t dbSNP:370686937
2281 2281 a, c, g dbSNP:200102606
2296 2296 a, g dbSNP:770887619
2297 2297 g, t dbSNP:749874887
2298 2298 a, c dbSNP:372822033
2299 2299 c, t dbSNP:192377676
2300 2300 a, g dbSNP:756628621
2303 2303 a, g dbSNP:753112435
2306 2306 a, c dbSNP:781651959
2308 2308 c, t dbSNP:758092349
2311 2311 a, g dbSNP:750020682
2312 2312 a, g dbSNP:764841621
2317 2317 a, g dbSNP:529179931
2334 2334 a, c dbSNP:775095158
2352 2352 -, cacccgcccacagccaggccgagagcagacaccagcagccctgtcacg ccgggctctacgtcccagggagggaggggcggcccacacccaggcccgcaccgctggg agtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaaggctgagt gtccggctgaggc dbSNP:199422308
2354 2354 c, t dbSNP:753289422
2356 2356 c, g, t dbSNP:374834138
2357 2357 a, g, t dbSNP:771745814
2361 2361 a, c dbSNP:759844975
2369 2369 a, g dbSNP:774434714
2371 2371 c, g, t dbSNP:749338229
2376 2376 a, g dbSNP:773355204
2379 2379 c, g dbSNP:770451101
2391 2391 c, t dbSNP:757941512
2398 2398 c, t dbSNP:748616970
2401 2401 c, t dbSNP:561884153
2410 2410 c, t dbSNP:5031049
2429 2429 c, t dbSNP:750640403
2430 2430 a, g dbSNP:533940688
2446 2446 c, t dbSNP:2853690
2452 2452 a, g dbSNP:554285274
2485 2485 c, t dbSNP:376258654
2486 2486 a, g dbSNP:553818689
2490 2490 c, t dbSNP:147703938
2496 2496 c, t dbSNP:539080954
2500 2500 c, t dbSNP:114012142
2501 2501 a, g dbSNP:142869901
2502 2502 c, g dbSNP:537898055
2534 2534 a, c, t dbSNP:556129131
2552 2552 c, t dbSNP:766752651
2573 2573 c, t dbSNP:534356342
2577 2577 c, t dbSNP:751808151
2584 2584 c, t dbSNP:567092780
2598 2598 a, g dbSNP:34527601
2601 2601 c, t dbSNP:750662141
2602 2602 a, g dbSNP:373241100
2616 2616 a, g dbSNP:369456871
2641 2641 a, g dbSNP:571607606
2681 2681 c, g, t dbSNP:531597316
2682 2682 a, g dbSNP:375391845
2760 2760 a, g dbSNP:538533887
2761 2761 a, g dbSNP:528913036
2837 2837 a, g dbSNP:561635924
2847 2847 c, t dbSNP:564365986
2850 2850 c, g dbSNP:546508805
2894 2894 c, t dbSNP:528223152
2907 2907 a, g dbSNP:549635168

Target ORF information:

RefSeq Version XM_011514105
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu60952
Accession Version XM_011514106.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1755bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product telomerase reverse transcriptase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)280..417(+)
Misc Feature(2)487..>822(+)
Misc Feature(3)769..786(+)
Misc Feature(4)1108..1443(+)
Misc Feature(5)1132..1431(+)
Misc Feature(6)1135..1137(+)
Position Chain Variation Link
2 2 c, t dbSNP:757423615
14 14 g, t dbSNP:565534349
39 39 a, g dbSNP:547712340
57 57 c, t dbSNP:191093565
97 97 c, t dbSNP:532316931
123 123 a, g dbSNP:187595603
139 139 c, t dbSNP:182916577
184 184 c, t dbSNP:530625272
185 185 a, g dbSNP:62332583
188 188 g, t dbSNP:544361488
190 190 c, t dbSNP:112290073
224 224 c, t dbSNP:369539932
228 228 c, t dbSNP:146462061
229 229 a, g dbSNP:776459827
239 239 a, g dbSNP:768398955
244 244 c, t dbSNP:760352197
258 258 g, t dbSNP:774891917
259 259 g, t dbSNP:771542084
270 270 g, t dbSNP:780652471
283 283 a, c dbSNP:745806589
285 285 a, t dbSNP:778896667
291 291 c, t dbSNP:143789839
292 292 a, g dbSNP:749051614
294 294 c, t dbSNP:35809415
297 297 c, g dbSNP:200539091
312 312 g, t dbSNP:752927236
325 325 a, t dbSNP:140261940
327 327 a, g dbSNP:377217777
349 349 a, c dbSNP:781140261
366 366 c, g dbSNP:143585580
385 385 g, t dbSNP:151204682
386 386 g, t dbSNP:143457728
394 394 a, g dbSNP:752068571
395 395 c, t dbSNP:148882731
414 414 g, t dbSNP:199585924
420 420 a, g dbSNP:765708956
426 426 a, g dbSNP:377106279
429 429 g, t dbSNP:752358619
430 430 c, t dbSNP:767166646
431 431 a, g dbSNP:372511089
440 440 c, t dbSNP:759017540
441 441 a, g dbSNP:773873942
447 447 a, g dbSNP:33959226
456 456 a, g dbSNP:368309861
459 459 a, g, t dbSNP:769540249
463 463 c, t dbSNP:747940807
464 464 a, g dbSNP:776763536
471 471 c, g dbSNP:34170122
477 477 c, t dbSNP:747157175
478 478 a, g dbSNP:112614087
481 481 c, t dbSNP:780283430
484 484 c, t dbSNP:140951453
488 488 c, t dbSNP:746434205
489 489 a, g, t dbSNP:746040728
515 515 c, g dbSNP:146439826
519 519 c, t dbSNP:143992655
522 522 a, g dbSNP:764318596
522 522 -, g dbSNP:765087191
527 527 a, g dbSNP:199422294
531 531 a, g dbSNP:140056333
549 549 c, t dbSNP:541931572
550 550 a, g dbSNP:151121796
552 552 a, c, t dbSNP:142989562
553 553 a, g dbSNP:765195721
559 559 a, g dbSNP:761603068
561 561 c, g, t dbSNP:768266882
566 566 c, t dbSNP:201927653
567 567 a, c, g dbSNP:148582238
571 571 c, t dbSNP:147521473
572 572 g, t dbSNP:779338296
574 574 a, c dbSNP:144821759
582 582 c, g dbSNP:749719489
584 584 a, g dbSNP:190125817
588 588 c, t dbSNP:201088708
592 592 c, t dbSNP:372272356
603 603 a, g dbSNP:368784316
606 606 a, g dbSNP:749973864
609 609 a, g dbSNP:778496417
612 612 a, g dbSNP:756706816
618 618 a, g dbSNP:375454175
624 624 c, t dbSNP:763907027
636 636 c, t dbSNP:758494245
640 640 c, t dbSNP:372140951
644 644 c, t dbSNP:767382450
645 645 a, g dbSNP:759843505
647 647 a, g dbSNP:774381540
648 648 a, g dbSNP:34625402
649 649 c, t dbSNP:368430301
654 654 c, t dbSNP:762941707
655 655 a, g dbSNP:773813809
664 664 g, t dbSNP:199422296
666 666 c, t dbSNP:33956095
675 675 c, g dbSNP:748610058
680 680 a, g dbSNP:199422295
686 686 a, g dbSNP:776981958
687 687 c, t dbSNP:768948796
693 693 c, t dbSNP:745590324
696 696 c, t dbSNP:370486790
707 707 a, g dbSNP:202123213
711 711 a, c dbSNP:748724920
714 714 c, t dbSNP:371759577
715 715 a, g dbSNP:121918662
722 722 a, g dbSNP:756152343
726 726 a, g dbSNP:377436842
732 732 c, t dbSNP:33963617
740 740 c, t dbSNP:754809046
741 741 a, g dbSNP:151055240
743 743 c, t dbSNP:564647937
744 744 a, g dbSNP:763147123
745 745 c, t dbSNP:199422297
753 753 a, g dbSNP:377030225
762 762 c, g dbSNP:765264494
774 774 a, g dbSNP:775722062
776 776 c, t dbSNP:772441504
777 777 a, g dbSNP:762534978
780 780 a, c, t dbSNP:769467251
781 781 a, g dbSNP:387907249
782 782 c, t dbSNP:199422298
783 783 a, g dbSNP:747654267
786 786 c, t dbSNP:147261325
789 789 c, t dbSNP:377437136
793 793 a, g dbSNP:373072850
797 797 c, g dbSNP:199422299
804 804 c, t dbSNP:368762140
806 806 c, g dbSNP:758192867
812 812 c, t dbSNP:149566858
813 813 a, g dbSNP:199422288
819 819 a, c dbSNP:757387292
820 820 a, g dbSNP:753929279
822 822 c, t dbSNP:200819224
823 823 a, g dbSNP:761116773
825 825 c, t dbSNP:138128892
835 835 a, g dbSNP:767819088
840 840 a, c dbSNP:772650889
849 849 a, g dbSNP:200858212
855 855 c, t dbSNP:769553764
856 856 a, g, t dbSNP:150819225
860 860 a, g dbSNP:727503468
863 863 a, g dbSNP:768168259
870 870 c, t dbSNP:777869512
873 873 a, g dbSNP:781604343
875 875 -, t dbSNP:199422300
886 886 a, g dbSNP:772070672
890 890 a, g dbSNP:375699185
891 891 c, t dbSNP:745650751
897 897 c, t dbSNP:778622091
898 898 a, g dbSNP:576633619
901 901 c, t dbSNP:754018580
902 902 a, g dbSNP:374206276
907 907 g, t dbSNP:756195573
918 918 c, t dbSNP:370808390
921 921 c, t dbSNP:768062052
923 923 g, t dbSNP:759490897
934 934 a, g dbSNP:774249292
936 936 a, g dbSNP:374592280
942 942 c, t dbSNP:117662357
948 948 a, g dbSNP:199770141
950 950 a, g dbSNP:121918663
955 955 a, c, t dbSNP:770066110
963 963 c, t dbSNP:748248614
967 967 g, t dbSNP:781360741
970 970 c, t dbSNP:755090021
972 972 c, t dbSNP:747564177
973 973 c, t dbSNP:560146437
978 978 a, g dbSNP:758894591
981 981 g, t dbSNP:750815238
988 988 c, g, t dbSNP:755822641
989 989 a, c, g dbSNP:483352771
990 990 a, g dbSNP:545260840
1002 1002 c, t dbSNP:759014638
1003 1003 a, g dbSNP:371413388
1005 1005 a, c, t dbSNP:376251639
1006 1006 a, g dbSNP:141425941
1011 1011 c, t dbSNP:769431975
1022 1022 c, t dbSNP:369810792
1026 1026 c, g dbSNP:377216965
1043 1043 a, g dbSNP:760914366
1053 1053 c, t dbSNP:372497245
1056 1056 c, t dbSNP:771997164
1057 1057 a, g dbSNP:200119385
1066 1066 c, t dbSNP:199422301
1067 1067 a, g dbSNP:552708120
1079 1079 a, g dbSNP:771392980
1083 1083 c, t dbSNP:368279364
1084 1084 a, g dbSNP:778051907
1086 1086 c, t dbSNP:752794198
1090 1090 a, c dbSNP:746621306
1093 1093 a, c dbSNP:779558116
1100 1100 a, g dbSNP:757820442
1104 1104 -, ggcaag dbSNP:751708357
1107 1107 c, g dbSNP:759744531
1110 1110 c, t dbSNP:141382603
1119 1119 c, t dbSNP:771514853
1131 1131 a, g, t dbSNP:763470933
1141 1141 a, g dbSNP:773683541
1146 1146 c, t dbSNP:374940572
1151 1151 c, t dbSNP:748503447
1152 1152 a, c, g dbSNP:140124989
1155 1155 a, g dbSNP:144310369
1172 1172 a, g dbSNP:199422302
1173 1173 c, t dbSNP:778309923
1176 1176 c, t dbSNP:770543108
1190 1190 a, g dbSNP:749279645
1192 1192 c, t dbSNP:375042320
1199 1199 c, t dbSNP:775014633
1200 1200 a, g dbSNP:769077049
1208 1208 a, g, t dbSNP:144779807
1211 1211 a, g dbSNP:755183437
1215 1215 c, t dbSNP:751752830
1225 1225 c, t dbSNP:777358007
1228 1228 c, t dbSNP:372868296
1229 1229 a, g dbSNP:121918666
1234 1234 a, g, t dbSNP:201159197
1248 1248 c, g dbSNP:780868215
1263 1263 c, g dbSNP:199422303
1265 1265 -, tcacc dbSNP:763191618
1275 1275 a, g dbSNP:754776542
1277 1277 a, t dbSNP:751767277
1278 1278 a, g dbSNP:375558251
1281 1281 a, c dbSNP:758561541
1287 1287 c, t dbSNP:374309472
1290 1290 c, g dbSNP:754372863
1293 1293 a, c dbSNP:371744235
1296 1296 g, t dbSNP:756519152
1301 1301 a, g dbSNP:532158398
1323 1323 c, t dbSNP:373952421
1324 1324 a, g, t dbSNP:559028617
1336 1336 c, t dbSNP:199422304
1337 1337 a, g dbSNP:772974254
1338 1338 a, g dbSNP:764875699
1340 1340 a, g dbSNP:387907250
1341 1341 c, g dbSNP:121918665
1343 1343 c, t dbSNP:727505125
1360 1360 a, g dbSNP:537649320
1363 1363 c, g dbSNP:776487058
1368 1368 c, t dbSNP:768646695
1369 1369 a, g dbSNP:746883330
1371 1371 a, g dbSNP:775289969
1374 1374 c, t dbSNP:771835512
1379 1379 a, g dbSNP:202033269
1385 1385 c, t dbSNP:779102560
1386 1386 a, g dbSNP:375200599
1399 1399 a, t dbSNP:554229004
1403 1403 c, t dbSNP:387907251
1404 1404 a, g dbSNP:200174990
1407 1407 c, t dbSNP:367672336
1410 1410 a, c, t dbSNP:34528119
1411 1411 a, g dbSNP:547377569
1416 1416 a, g dbSNP:370292237
1428 1428 c, t dbSNP:764925909
1429 1429 a, g dbSNP:761308654
1431 1431 a, c dbSNP:375675196
1434 1434 g, t dbSNP:763468049
1437 1437 g, t dbSNP:201322872
1448 1448 a, g dbSNP:199741493
1455 1455 g, t dbSNP:771921274
1466 1466 a, g dbSNP:759314942
1479 1479 a, c, g dbSNP:34062885
1485 1485 c, g dbSNP:758664162
1486 1486 a, c, t dbSNP:370445231
1487 1487 a, g dbSNP:755707625
1503 1503 c, t dbSNP:752210365
1519 1519 c, t dbSNP:144697790
1520 1520 a, g dbSNP:759490631
1521 1521 c, t dbSNP:542440625
1522 1522 a, g dbSNP:201272197
1532 1532 c, g dbSNP:766236334
1543 1543 a, c dbSNP:762647113
1544 1544 c, t dbSNP:149439946
1549 1549 c, t dbSNP:773537902
1570 1570 c, t dbSNP:199422305
1571 1571 a, g dbSNP:765566930
1574 1574 c, t dbSNP:762057495
1581 1581 c, t dbSNP:201689770
1594 1594 -, c dbSNP:770230888
1601 1601 -, t dbSNP:760179727
1617 1617 c, t dbSNP:762178169
1623 1623 a, g dbSNP:776966669
1626 1626 a, g dbSNP:376266401
1641 1641 c, t dbSNP:760659103
1662 1662 a, g dbSNP:775582757
1674 1674 c, t dbSNP:33954691
1678 1678 c, t dbSNP:199422307
1688 1688 a, c dbSNP:745871038
1724 1724 c, g dbSNP:377419542
1731 1731 c, t dbSNP:757204201
1732 1732 c, t dbSNP:753691323
1735 1735 c, t dbSNP:777672180
1736 1736 a, g dbSNP:62331332
1737 1737 c, t dbSNP:752939718
1738 1738 a, g, t dbSNP:374968697
1740 1740 c, t dbSNP:181612536
1749 1749 c, t dbSNP:766881195
1751 1751 c, t dbSNP:763381198
1752 1752 a, g dbSNP:773595628
1753 1753 g, t dbSNP:770144114
1758 1758 c, t dbSNP:760287437
1761 1761 c, t dbSNP:377570406
1767 1767 c, t dbSNP:771543669
1779 1779 a, g dbSNP:745389061
1785 1785 c, g dbSNP:373400596
1788 1788 c, t dbSNP:771025266
1794 1794 a, g dbSNP:200002330
1799 1799 c, t dbSNP:201330213
1800 1800 a, g, t dbSNP:554739019
1815 1815 c, t dbSNP:202166769
1818 1818 c, t dbSNP:769532174
1819 1819 a, g dbSNP:35719940
1821 1821 c, t dbSNP:201067706
1836 1836 c, t dbSNP:755223754
1842 1842 c, t dbSNP:376835357
1855 1855 g, t dbSNP:201235479
1859 1859 a, g dbSNP:780154973
1875 1875 c, t dbSNP:758469915
1885 1885 c, t dbSNP:750951309
1886 1886 a, g dbSNP:765787352
1887 1887 a, g dbSNP:757638312
1892 1892 a, g dbSNP:200288187
1894 1894 a, g dbSNP:571590747
1902 1902 c, t dbSNP:759883263
1903 1903 a, g dbSNP:121918664
1905 1905 c, g dbSNP:766050973
1911 1911 c, t dbSNP:368551449
1937 1937 c, t dbSNP:764602705
1938 1938 a, g dbSNP:551516320
1949 1949 a, g dbSNP:532930887
1957 1957 c, t dbSNP:763647787
1958 1958 c, t dbSNP:376255453
1959 1959 a, g dbSNP:35033501
1961 1961 a, g dbSNP:185829989
1964 1964 c, t dbSNP:199422306
1965 1965 a, g dbSNP:772311888
1967 1967 c, t dbSNP:370686937
1968 1968 a, c, g dbSNP:200102606
1983 1983 a, g dbSNP:770887619
1984 1984 g, t dbSNP:749874887
1985 1985 a, c dbSNP:372822033
1986 1986 c, t dbSNP:192377676
1987 1987 a, g dbSNP:756628621
1990 1990 a, g dbSNP:753112435
1993 1993 a, c dbSNP:781651959
1995 1995 c, t dbSNP:758092349
1998 1998 a, g dbSNP:750020682
1999 1999 a, g dbSNP:764841621
2004 2004 a, g dbSNP:529179931
2021 2021 a, c dbSNP:775095158
2039 2039 -, cacccgcccacagccaggccgagagcagacaccagcagccctgtcacg ccgggctctacgtcccagggagggaggggcggcccacacccaggcccgcaccgctggg agtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaaggctgagt gtccggctgaggc dbSNP:199422308
2041 2041 c, t dbSNP:753289422
2043 2043 c, g, t dbSNP:374834138
2044 2044 a, g, t dbSNP:771745814
2048 2048 a, c dbSNP:759844975
2056 2056 a, g dbSNP:774434714
2058 2058 c, g, t dbSNP:749338229
2063 2063 a, g dbSNP:773355204
2066 2066 c, g dbSNP:770451101
2078 2078 c, t dbSNP:757941512
2085 2085 c, t dbSNP:748616970
2088 2088 c, t dbSNP:561884153
2097 2097 c, t dbSNP:5031049
2116 2116 c, t dbSNP:750640403
2117 2117 a, g dbSNP:533940688
2133 2133 c, t dbSNP:2853690
2139 2139 a, g dbSNP:554285274
2172 2172 c, t dbSNP:376258654
2173 2173 a, g dbSNP:553818689
2177 2177 c, t dbSNP:147703938
2183 2183 c, t dbSNP:539080954
2187 2187 c, t dbSNP:114012142
2188 2188 a, g dbSNP:142869901
2189 2189 c, g dbSNP:537898055
2221 2221 a, c, t dbSNP:556129131
2239 2239 c, t dbSNP:766752651
2260 2260 c, t dbSNP:534356342
2264 2264 c, t dbSNP:751808151
2271 2271 c, t dbSNP:567092780
2285 2285 a, g dbSNP:34527601
2288 2288 c, t dbSNP:750662141
2289 2289 a, g dbSNP:373241100
2303 2303 a, g dbSNP:369456871
2328 2328 a, g dbSNP:571607606
2368 2368 c, g, t dbSNP:531597316
2369 2369 a, g dbSNP:375391845
2447 2447 a, g dbSNP:538533887
2448 2448 a, g dbSNP:528913036
2524 2524 a, g dbSNP:561635924
2534 2534 c, t dbSNP:564365986
2537 2537 c, g dbSNP:546508805
2581 2581 c, t dbSNP:528223152
2594 2594 a, g dbSNP:549635168

Target ORF information:

RefSeq Version XM_011514106
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens telomerase reverse transcriptase (TERT), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23650
Accession Version NM_001193376.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3210bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product telomerase reverse transcriptase isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC114291.2, AB085628.1 and AF015950.1. Summary: Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks an alternate in-frame exon in the middle portion of the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB085628.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1968968 [ECO:0000350] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1436..1840(+)
Misc Feature(2)1910..>2245(+)
Misc Feature(3)2192..2209(+)
Misc Feature(4)2531..>2710(+)
Misc Feature(5)2558..2560(+)
Exon (1)1..277
Gene Synonym:
Exon (2)278..1631
Gene Synonym:
Exon (3)1632..1827
Gene Synonym:
Exon (4)1828..2008
Gene Synonym:
Exon (5)2009..2188
Gene Synonym:
Exon (6)2189..2344
Gene Synonym:
Exon (7)2345..2440
Gene Synonym:
Exon (8)2441..2526
Gene Synonym:
Exon (9)2527..2640
Gene Synonym:
Exon (10)2641..2712
Gene Synonym:
Exon (11)2713..2839
Gene Synonym:
Exon (12)2840..2901
Gene Synonym:
Exon (13)2902..3026
Gene Synonym:
Exon (14)3027..3164
Gene Synonym:
Exon (15)3165..3829
Gene Synonym:
Position Chain Variation Link
103 103 c, t dbSNP:750133706
135 135 c, t dbSNP:760727529
145 145 a, g dbSNP:765999996
148 148 c, g dbSNP:776045913
155 155 c, t dbSNP:199422289
170 170 -, c dbSNP:199422290
187 187 c, t dbSNP:772537721
202 202 c, t dbSNP:746281705
222 222 a, t dbSNP:387907247
251 251 c, g dbSNP:544215765
278 278 a, g dbSNP:771343717
280 280 a, g dbSNP:373356928
318 318 a, g dbSNP:776383511
322 322 c, g dbSNP:768398792
355 355 c, t dbSNP:746607875
367 367 a, g dbSNP:779738846
370 370 a, g dbSNP:757915567
376 376 g, t dbSNP:745831414
388 388 c, t dbSNP:778702039
397 397 a, g dbSNP:757141480
436 436 g, t dbSNP:753548160
440 440 a, g dbSNP:764350001
445 445 c, t dbSNP:756352137
451 451 a, g dbSNP:752876848
457 457 c, g dbSNP:767592753
459 459 a, g dbSNP:141125591
461 461 a, g dbSNP:200843534
466 466 a, c, g dbSNP:766794006
472 472 a, c, g dbSNP:767353485
473 473 c, t dbSNP:770240505
478 478 g, t dbSNP:746660804
479 479 c, t dbSNP:775225240
488 488 a, g dbSNP:199422291
499 499 c, t dbSNP:771765361
500 500 a, g dbSNP:745363596
505 505 g, t dbSNP:778951942
514 514 c, g dbSNP:757121533
517 517 a, g dbSNP:749200840
520 520 a, t dbSNP:558025297
526 526 c, t dbSNP:755843023
532 532 a, c dbSNP:752933900
539 539 c, t dbSNP:368291455
541 541 a, g dbSNP:755155708
550 550 c, t dbSNP:751568040
561 561 a, t dbSNP:139824461
566 566 a, g dbSNP:387907248
577 577 a, g dbSNP:763396974
578 578 c, g dbSNP:145958962
580 580 g, t dbSNP:773784305
583 583 g, t dbSNP:765709243
589 589 a, g dbSNP:142489903
592 592 c, g, t dbSNP:370420108
594 594 g, t dbSNP:771590775
599 599 g, t dbSNP:759137449
608 608 a, g dbSNP:773758089
611 611 c, t dbSNP:770436206
612 612 a, g dbSNP:749187042
613 613 c, g dbSNP:777633830
624 624 a, g dbSNP:769638625
625 625 a, c dbSNP:747935528
626 626 a, g dbSNP:377016753
627 627 c, t dbSNP:781435225
630 630 c, g dbSNP:11952056
634 634 a, g dbSNP:138395366
636 636 c, t dbSNP:751762765
645 645 a, g dbSNP:779999492
646 646 -, c dbSNP:147627306
650 650 a, g dbSNP:758442518
655 655 c, t dbSNP:751029411
659 659 c, t dbSNP:765833936
661 661 a, g dbSNP:538256221
662 662 a, g dbSNP:121918661
669 669 a, t dbSNP:764473257
676 676 c, t dbSNP:759142412
682 682 a, g dbSNP:773987859
690 690 g, t dbSNP:770364387
694 694 c, t dbSNP:762440833
696 696 c, t dbSNP:773202955
697 697 c, t dbSNP:769691692
700 700 a, g dbSNP:549656839
702 702 a, g dbSNP:780878492
703 703 c, t dbSNP:768426236
706 706 a, g dbSNP:747206136
716 716 -, gg dbSNP:771404882
721 721 a, g, t dbSNP:35837567
728 728 c, t dbSNP:750497661
736 736 c, t dbSNP:779611656
757 757 a, g dbSNP:757862712
760 760 c, g dbSNP:754359147
770 770 a, c, t dbSNP:149427814
774 774 c, g dbSNP:761042742
777 777 a, g dbSNP:751231538
782 782 c, g dbSNP:766054124
787 787 c, t dbSNP:762491880
795 795 c, t dbSNP:377315722
796 796 a, g, t dbSNP:111527543
805 805 c, g dbSNP:138920650
808 808 c, t dbSNP:761741087
809 809 a, g dbSNP:776569822
820 820 a, g dbSNP:768389892
828 828 c, g dbSNP:746814762
834 834 c, t dbSNP:775613951
835 835 a, g, t dbSNP:746036694
837 837 a, g dbSNP:148798048
843 843 a, c dbSNP:150277224
845 845 c, t dbSNP:757340699
860 860 c, t dbSNP:749827230
861 861 a, g dbSNP:374426285
868 868 c, t dbSNP:369812320
873 873 g, t dbSNP:753076785
874 874 a, g dbSNP:765999804
881 881 c, t dbSNP:758074759
889 889 a, c dbSNP:750008200
892 892 a, c dbSNP:375423906
893 893 a, g dbSNP:61748181
896 896 a, g dbSNP:199701877
900 900 a, g dbSNP:764994019
904 904 c, t dbSNP:764061395
907 907 c, t dbSNP:760434389
909 909 -, t dbSNP:145184650
911 911 g, t dbSNP:138332462
913 913 a, g dbSNP:372185671
917 917 a, c, g dbSNP:746095609
921 921 c, t dbSNP:774657340
925 925 c, t dbSNP:771194908
927 927 c, t dbSNP:147056740
943 943 c, t dbSNP:367957748
945 945 a, c dbSNP:778187343
953 953 a, g dbSNP:756624928
964 964 a, g dbSNP:748557434
965 965 a, c dbSNP:376074999
971 971 g, t dbSNP:755275006
972 972 c, t dbSNP:750129321
973 973 a, g dbSNP:2736098
974 974 a, g dbSNP:543818650
980 980 a, c dbSNP:753366759
981 981 c, t dbSNP:763462006
992 992 c, t dbSNP:760697425
993 993 a, g dbSNP:752511903
1020 1020 g, t dbSNP:150981755
1021 1021 g, t dbSNP:142595542
1026 1026 c, g dbSNP:139342764
1027 1027 a, g dbSNP:148549782
1033 1033 c, t dbSNP:774784101
1037 1037 c, g dbSNP:371457181
1042 1042 a, c dbSNP:762993766
1075 1075 a, g dbSNP:768003291
1083 1083 a, g dbSNP:773366454
1090 1090 c, g dbSNP:367668700
1131 1131 a, g dbSNP:200191524
1138 1138 c, g dbSNP:374549447
1148 1148 a, g dbSNP:748699440
1150 1150 c, g dbSNP:781652548
1166 1166 c, t dbSNP:143148040
1177 1177 a, g dbSNP:747342234
1179 1179 a, g dbSNP:778585289
1188 1188 a, g dbSNP:756954938
1196 1196 c, t dbSNP:144756946
1199 1199 c, t dbSNP:573210043
1200 1200 c, g dbSNP:777343359
1222 1222 a, g dbSNP:377477531
1231 1231 c, t dbSNP:201505416
1258 1258 c, t dbSNP:755523267
1259 1259 g, t dbSNP:370887827
1260 1260 c, t dbSNP:539667998
1266 1266 g, t dbSNP:767558514
1271 1271 c, t dbSNP:759448205
1278 1278 g, t dbSNP:148877257
1292 1292 c, t dbSNP:34094720
1294 1294 c, g dbSNP:766229902
1300 1300 a, g dbSNP:775795705
1318 1318 a, c dbSNP:763270537
1319 1319 c, t dbSNP:773246847
1327 1327 a, c, t dbSNP:190411812
1328 1328 a, g dbSNP:374180689
1356 1356 a, g dbSNP:537806041
1357 1357 c, t dbSNP:545887137
1358 1358 c, t dbSNP:769128451
1373 1373 c, g dbSNP:747463378
1381 1381 -, gga dbSNP:377639087
1382 1382 a, g dbSNP:780427764
1386 1386 c, g dbSNP:772257175
1390 1390 c, t dbSNP:748983668
1394 1394 a, c dbSNP:567650961
1395 1395 a, g, t dbSNP:111952055
1396 1396 c, t dbSNP:112441737
1403 1403 a, g dbSNP:755718415
1409 1409 c, t dbSNP:752227262
1422 1422 a, t dbSNP:781329984
1436 1436 -, cag dbSNP:199422292
1438 1438 a, g dbSNP:754992012
1440 1440 g, t dbSNP:751505899
1450 1450 c, t dbSNP:186596886
1451 1451 c, g dbSNP:758110675
1469 1469 c, t dbSNP:750721558
1476 1476 g, t dbSNP:765342787
1480 1480 c, t dbSNP:139133620
1489 1489 c, g dbSNP:35459373
1497 1497 c, g dbSNP:776712013
1498 1498 c, t dbSNP:764118817
1507 1507 c, t dbSNP:761174773
1511 1511 c, t dbSNP:775919290
1514 1514 c, t dbSNP:199422293
1519 1519 c, t dbSNP:772545351
1520 1520 c, t dbSNP:746216837
1523 1523 a, c dbSNP:201990815
1527 1527 a, g dbSNP:566842222
1545 1545 c, t dbSNP:143499386
1547 1547 c, g dbSNP:747756167
1552 1552 a, g dbSNP:200369031
1555 1555 a, g dbSNP:754473890
1566 1566 c, t dbSNP:746996450
1570 1570 g, t dbSNP:779846566
1574 1574 c, t dbSNP:758250185
1585 1585 g, t dbSNP:750159404
1605 1605 a, g, t dbSNP:113065975
1610 1610 g, t dbSNP:551522837
1618 1618 a, g dbSNP:753991999
1621 1621 c, t dbSNP:764171875
1622 1622 a, c dbSNP:200864183
1624 1624 a, g dbSNP:770410182
1647 1647 c, t dbSNP:369539932
1651 1651 c, t dbSNP:146462061
1652 1652 a, g dbSNP:776459827
1662 1662 a, g dbSNP:768398955
1667 1667 c, t dbSNP:760352197
1681 1681 g, t dbSNP:774891917
1682 1682 g, t dbSNP:771542084
1693 1693 g, t dbSNP:780652471
1706 1706 a, c dbSNP:745806589
1708 1708 a, t dbSNP:778896667
1714 1714 c, t dbSNP:143789839
1715 1715 a, g dbSNP:749051614
1717 1717 c, t dbSNP:35809415
1720 1720 c, g dbSNP:200539091
1735 1735 g, t dbSNP:752927236
1748 1748 a, t dbSNP:140261940
1750 1750 a, g dbSNP:377217777
1772 1772 a, c dbSNP:781140261
1789 1789 c, g dbSNP:143585580
1808 1808 g, t dbSNP:151204682
1809 1809 g, t dbSNP:143457728
1817 1817 a, g dbSNP:752068571
1818 1818 c, t dbSNP:148882731
1837 1837 g, t dbSNP:199585924
1843 1843 a, g dbSNP:765708956
1849 1849 a, g dbSNP:377106279
1852 1852 g, t dbSNP:752358619
1853 1853 c, t dbSNP:767166646
1854 1854 a, g dbSNP:372511089
1863 1863 c, t dbSNP:759017540
1864 1864 a, g dbSNP:773873942
1870 1870 a, g dbSNP:33959226
1879 1879 a, g dbSNP:368309861
1882 1882 a, g, t dbSNP:769540249
1886 1886 c, t dbSNP:747940807
1887 1887 a, g dbSNP:776763536
1894 1894 c, g dbSNP:34170122
1900 1900 c, t dbSNP:747157175
1901 1901 a, g dbSNP:112614087
1904 1904 c, t dbSNP:780283430
1907 1907 c, t dbSNP:140951453
1911 1911 c, t dbSNP:746434205
1912 1912 a, g, t dbSNP:746040728
1938 1938 c, g dbSNP:146439826
1942 1942 c, t dbSNP:143992655
1945 1945 a, g dbSNP:764318596
1945 1945 -, g dbSNP:765087191
1950 1950 a, g dbSNP:199422294
1954 1954 a, g dbSNP:140056333
1972 1972 c, t dbSNP:541931572
1973 1973 a, g dbSNP:151121796
1975 1975 a, c, t dbSNP:142989562
1976 1976 a, g dbSNP:765195721
1982 1982 a, g dbSNP:761603068
1984 1984 c, g, t dbSNP:768266882
1989 1989 c, t dbSNP:201927653
1990 1990 a, c, g dbSNP:148582238
1994 1994 c, t dbSNP:147521473
1995 1995 g, t dbSNP:779338296
1997 1997 a, c dbSNP:144821759
2005 2005 c, g dbSNP:749719489
2007 2007 a, g dbSNP:190125817
2011 2011 c, t dbSNP:201088708
2015 2015 c, t dbSNP:372272356
2026 2026 a, g dbSNP:368784316
2029 2029 a, g dbSNP:749973864
2032 2032 a, g dbSNP:778496417
2035 2035 a, g dbSNP:756706816
2041 2041 a, g dbSNP:375454175
2047 2047 c, t dbSNP:763907027
2059 2059 c, t dbSNP:758494245
2063 2063 c, t dbSNP:372140951
2067 2067 c, t dbSNP:767382450
2068 2068 a, g dbSNP:759843505
2070 2070 a, g dbSNP:774381540
2071 2071 a, g dbSNP:34625402
2072 2072 c, t dbSNP:368430301
2077 2077 c, t dbSNP:762941707
2078 2078 a, g dbSNP:773813809
2087 2087 g, t dbSNP:199422296
2089 2089 c, t dbSNP:33956095
2098 2098 c, g dbSNP:748610058
2103 2103 a, g dbSNP:199422295
2109 2109 a, g dbSNP:776981958
2110 2110 c, t dbSNP:768948796
2116 2116 c, t dbSNP:745590324
2119 2119 c, t dbSNP:370486790
2130 2130 a, g dbSNP:202123213
2134 2134 a, c dbSNP:748724920
2137 2137 c, t dbSNP:371759577
2138 2138 a, g dbSNP:121918662
2145 2145 a, g dbSNP:756152343
2149 2149 a, g dbSNP:377436842
2155 2155 c, t dbSNP:33963617
2163 2163 c, t dbSNP:754809046
2164 2164 a, g dbSNP:151055240
2166 2166 c, t dbSNP:564647937
2167 2167 a, g dbSNP:763147123
2168 2168 c, t dbSNP:199422297
2176 2176 a, g dbSNP:377030225
2185 2185 c, g dbSNP:765264494
2197 2197 a, g dbSNP:775722062
2199 2199 c, t dbSNP:772441504
2200 2200 a, g dbSNP:762534978
2203 2203 a, c, t dbSNP:769467251
2204 2204 a, g dbSNP:387907249
2205 2205 c, t dbSNP:199422298
2206 2206 a, g dbSNP:747654267
2209 2209 c, t dbSNP:147261325
2212 2212 c, t dbSNP:377437136
2216 2216 a, g dbSNP:373072850
2220 2220 c, g dbSNP:199422299
2227 2227 c, t dbSNP:368762140
2229 2229 c, g dbSNP:758192867
2235 2235 c, t dbSNP:149566858
2236 2236 a, g dbSNP:199422288
2242 2242 a, c dbSNP:757387292
2243 2243 a, g dbSNP:753929279
2245 2245 c, t dbSNP:200819224
2246 2246 a, g dbSNP:761116773
2248 2248 c, t dbSNP:138128892
2258 2258 a, g dbSNP:767819088
2263 2263 a, c dbSNP:772650889
2272 2272 a, g dbSNP:200858212
2278 2278 c, t dbSNP:769553764
2279 2279 a, g, t dbSNP:150819225
2283 2283 a, g dbSNP:727503468
2286 2286 a, g dbSNP:768168259
2293 2293 c, t dbSNP:777869512
2296 2296 a, g dbSNP:781604343
2298 2298 -, t dbSNP:199422300
2309 2309 a, g dbSNP:772070672
2313 2313 a, g dbSNP:375699185
2314 2314 c, t dbSNP:745650751
2320 2320 c, t dbSNP:778622091
2321 2321 a, g dbSNP:576633619
2324 2324 c, t dbSNP:754018580
2325 2325 a, g dbSNP:374206276
2330 2330 g, t dbSNP:756195573
2341 2341 c, t dbSNP:370808390
2344 2344 c, t dbSNP:768062052
2346 2346 g, t dbSNP:759490897
2357 2357 a, g dbSNP:774249292
2359 2359 a, g dbSNP:374592280
2365 2365 c, t dbSNP:117662357
2371 2371 a, g dbSNP:199770141
2373 2373 a, g dbSNP:121918663
2378 2378 a, c, t dbSNP:770066110
2386 2386 c, t dbSNP:748248614
2390 2390 g, t dbSNP:781360741
2393 2393 c, t dbSNP:755090021
2395 2395 c, t dbSNP:747564177
2396 2396 c, t dbSNP:560146437
2401 2401 a, g dbSNP:758894591
2404 2404 g, t dbSNP:750815238
2411 2411 c, g, t dbSNP:755822641
2412 2412 a, c, g dbSNP:483352771
2413 2413 a, g dbSNP:545260840
2425 2425 c, t dbSNP:759014638
2426 2426 a, g dbSNP:371413388
2428 2428 a, c, t dbSNP:376251639
2429 2429 a, g dbSNP:141425941
2434 2434 c, t dbSNP:769431975
2445 2445 c, t dbSNP:369810792
2449 2449 c, g dbSNP:377216965
2466 2466 a, g dbSNP:760914366
2476 2476 c, t dbSNP:372497245
2479 2479 c, t dbSNP:771997164
2480 2480 a, g dbSNP:200119385
2489 2489 c, t dbSNP:199422301
2490 2490 a, g dbSNP:552708120
2502 2502 a, g dbSNP:771392980
2506 2506 c, t dbSNP:368279364
2507 2507 a, g dbSNP:778051907
2509 2509 c, t dbSNP:752794198
2513 2513 a, c dbSNP:746621306
2516 2516 a, c dbSNP:779558116
2523 2523 a, g dbSNP:757820442
2527 2527 -, ggcaag dbSNP:751708357
2530 2530 c, g dbSNP:759744531
2533 2533 c, t dbSNP:141382603
2542 2542 c, t dbSNP:771514853
2554 2554 a, g, t dbSNP:763470933
2564 2564 a, g dbSNP:773683541
2569 2569 c, t dbSNP:374940572
2574 2574 c, t dbSNP:748503447
2575 2575 a, c, g dbSNP:140124989
2578 2578 a, g dbSNP:144310369
2595 2595 a, g dbSNP:199422302
2596 2596 c, t dbSNP:778309923
2599 2599 c, t dbSNP:770543108
2613 2613 a, g dbSNP:749279645
2615 2615 c, t dbSNP:375042320
2622 2622 c, t dbSNP:775014633
2623 2623 a, g dbSNP:769077049
2631 2631 a, g, t dbSNP:144779807
2634 2634 a, g dbSNP:755183437
2638 2638 c, t dbSNP:751752830
2648 2648 c, t dbSNP:777358007
2651 2651 c, t dbSNP:372868296
2652 2652 a, g dbSNP:121918666
2657 2657 a, g, t dbSNP:201159197
2671 2671 c, g dbSNP:780868215
2686 2686 c, g dbSNP:199422303
2688 2688 -, tcacc dbSNP:763191618
2698 2698 a, g dbSNP:754776542
2700 2700 a, t dbSNP:751767277
2701 2701 a, g dbSNP:375558251
2704 2704 a, c dbSNP:758561541
2710 2710 c, t dbSNP:374309472
2713 2713 a, c, g dbSNP:34062885
2719 2719 c, g dbSNP:758664162
2720 2720 a, c, t dbSNP:370445231
2721 2721 a, g dbSNP:755707625
2737 2737 c, t dbSNP:752210365
2753 2753 c, t dbSNP:144697790
2754 2754 a, g dbSNP:759490631
2755 2755 c, t dbSNP:542440625
2756 2756 a, g dbSNP:201272197
2766 2766 c, g dbSNP:766236334
2777 2777 a, c dbSNP:762647113
2778 2778 c, t dbSNP:149439946
2783 2783 c, t dbSNP:773537902
2804 2804 c, t dbSNP:199422305
2805 2805 a, g dbSNP:765566930
2808 2808 c, t dbSNP:762057495
2815 2815 c, t dbSNP:201689770
2828 2828 -, c dbSNP:770230888
2835 2835 -, t dbSNP:760179727
2851 2851 c, t dbSNP:762178169
2857 2857 a, g dbSNP:776966669
2860 2860 a, g dbSNP:376266401
2875 2875 c, t dbSNP:760659103
2896 2896 a, g dbSNP:775582757
2908 2908 c, t dbSNP:33954691
2912 2912 c, t dbSNP:199422307
2922 2922 a, c dbSNP:745871038
2958 2958 c, g dbSNP:377419542
2965 2965 c, t dbSNP:757204201
2966 2966 c, t dbSNP:753691323
2969 2969 c, t dbSNP:777672180
2970 2970 a, g dbSNP:62331332
2971 2971 c, t dbSNP:752939718
2972 2972 a, g, t dbSNP:374968697
2974 2974 c, t dbSNP:181612536
2983 2983 c, t dbSNP:766881195
2985 2985 c, t dbSNP:763381198
2986 2986 a, g dbSNP:773595628
2987 2987 g, t dbSNP:770144114
2992 2992 c, t dbSNP:760287437
2995 2995 c, t dbSNP:377570406
3001 3001 c, t dbSNP:771543669
3013 3013 a, g dbSNP:745389061
3019 3019 c, g dbSNP:373400596
3022 3022 c, t dbSNP:771025266
3028 3028 a, g dbSNP:200002330
3033 3033 c, t dbSNP:201330213
3034 3034 a, g, t dbSNP:554739019
3049 3049 c, t dbSNP:202166769
3052 3052 c, t dbSNP:769532174
3053 3053 a, g dbSNP:35719940
3055 3055 c, t dbSNP:201067706
3070 3070 c, t dbSNP:755223754
3076 3076 c, t dbSNP:376835357
3089 3089 g, t dbSNP:201235479
3093 3093 a, g dbSNP:780154973
3109 3109 c, t dbSNP:758469915
3119 3119 c, t dbSNP:750951309
3120 3120 a, g dbSNP:765787352
3121 3121 a, g dbSNP:757638312
3126 3126 a, g dbSNP:200288187
3128 3128 a, g dbSNP:571590747
3136 3136 c, t dbSNP:759883263
3137 3137 a, g dbSNP:121918664
3139 3139 c, g dbSNP:766050973
3145 3145 c, t dbSNP:368551449
3171 3171 c, t dbSNP:764602705
3172 3172 a, g dbSNP:551516320
3183 3183 a, g dbSNP:532930887
3191 3191 c, t dbSNP:763647787
3192 3192 c, t dbSNP:376255453
3193 3193 a, g dbSNP:35033501
3195 3195 a, g dbSNP:185829989
3198 3198 c, t dbSNP:199422306
3199 3199 a, g dbSNP:772311888
3201 3201 c, t dbSNP:370686937
3202 3202 a, c, g dbSNP:200102606
3217 3217 a, g dbSNP:770887619
3218 3218 g, t dbSNP:749874887
3219 3219 a, c dbSNP:372822033
3220 3220 c, t dbSNP:192377676
3221 3221 a, g dbSNP:756628621
3224 3224 a, g dbSNP:753112435
3227 3227 a, c dbSNP:781651959
3229 3229 c, t dbSNP:758092349
3232 3232 a, g dbSNP:750020682
3233 3233 a, g dbSNP:764841621
3238 3238 a, g dbSNP:529179931
3255 3255 a, c dbSNP:775095158
3273 3273 -, cacccgcccacagccaggccgagagcagacaccagcagccctgtcacg ccgggctctacgtcccagggagggaggggcggcccacacccaggcccgcaccgctggg agtctgaggcctgagtgagtgtttggccgaggcctgcatgtccggctgaaggctgagt gtccggctgaggc dbSNP:199422308
3275 3275 c, t dbSNP:753289422
3277 3277 c, g, t dbSNP:374834138
3278 3278 a, g, t dbSNP:771745814
3282 3282 a, c dbSNP:759844975
3290 3290 a, g dbSNP:774434714
3292 3292 c, g, t dbSNP:749338229
3297 3297 a, g dbSNP:773355204
3300 3300 c, g dbSNP:770451101
3312 3312 c, t dbSNP:757941512
3319 3319 c, t dbSNP:748616970
3322 3322 c, t dbSNP:561884153
3331 3331 c, t dbSNP:5031049
3350 3350 c, t dbSNP:750640403
3351 3351 a, g dbSNP:533940688
3367 3367 c, t dbSNP:2853690
3373 3373 a, g dbSNP:554285274
3406 3406 c, t dbSNP:376258654
3407 3407 a, g dbSNP:553818689
3411 3411 c, t dbSNP:147703938
3417 3417 c, t dbSNP:539080954
3421 3421 c, t dbSNP:114012142
3422 3422 a, g dbSNP:142869901
3423 3423 c, g dbSNP:537898055
3455 3455 a, c, t dbSNP:556129131
3473 3473 c, t dbSNP:766752651
3494 3494 c, t dbSNP:534356342
3498 3498 c, t dbSNP:751808151
3505 3505 c, t dbSNP:567092780
3519 3519 a, g dbSNP:34527601
3522 3522 c, t dbSNP:750662141
3523 3523 a, g dbSNP:373241100
3537 3537 a, g dbSNP:369456871
3562 3562 a, g dbSNP:571607606
3602 3602 c, g, t dbSNP:531597316
3603 3603 a, g dbSNP:375391845
3681 3681 a, g dbSNP:538533887
3682 3682 a, g dbSNP:528913036
3758 3758 a, g dbSNP:561635924
3768 3768 c, t dbSNP:564365986
3771 3771 c, g dbSNP:546508805
3815 3815 c, t dbSNP:528223152
3828 3828 a, g dbSNP:549635168

Target ORF information:

RefSeq Version NM_001193376
Organism Homo sapiens (human)
Definition Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25394
Accession Version NM_198253.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3399bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product telomerase reverse transcriptase isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF018167.1 and AF015950.1. This sequence is a reference standard in the RefSeqGene project. On or before Jun 23, 2006 this sequence version replaced gi:4507438, gi:38201697. Summary: Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF018167.1, AF015950.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)59..748(+)
Misc Feature(2)230..649(+)
Misc Feature(3)467..481(+)
Misc Feature(4)563..565(+)
Misc Feature(5)722..778(+)
Misc Feature(6)737..739(+)
Misc Feature(7)737..739(+)
Misc Feature(8)749..1030(+)
Misc Feature(9)959..1672(+)
Misc Feature(10)1031..1708(+)
Misc Feature(11)1184..1621(+)
Misc Feature(12)1247..1309(+)
Misc Feature(13)1427..1429(+)
Misc Feature(14)1436..1840(+)
Misc Feature(15)1910..>2245(+)
Misc Feature(16)2177..2179(+)
Misc Feature(17)2177..2179(+)
Misc Feature(18)2192..2209(+)
Misc Feature(19)2531..2866(+)
Misc Feature(20)2555..2854(+)
Misc Feature(21)2558..2560(+)
Misc Feature(22)2657..2659(+)
Misc Feature(23)2798..2842(+)
Misc Feature(24)2846..2860(+)
Misc Feature(25)2864..3454(+)
Exon (1)1..277
Gene Synonym:
Exon (2)278..1631
Gene Synonym:
Exon (3)1632..1827
Gene Synonym:
Exon (4)1828..2008
Gene Synonym:
Exon (5)2009..2188
Gene Synonym:
Exon (6)2189..2344
Gene Synonym:
Exon (7)2345..2440
Gene Synonym:
Exon (8)2441..2526
Gene Synonym:
Exon (9)2527..2640
Gene Synonym:
Exon (10)2641..2712
Gene Synonym:
Exon (11)2713..2901
Gene Synonym:
Exon (12)2902..3028
Gene Synonym:
Exon (13)3029..3090
Gene Synonym:
Exon (14)3091..3215
Gene Synonym:
Exon (15)3216..3353
Gene Synonym:
Exon (16)3354..4018
Gene Synonym:
Position Chain Variation Link
103 103 c, t dbSNP:750133706
135 135 c, t dbSNP:760727529
145 145 a, g dbSNP:765999996
148 148 c, g dbSNP:776045913
155 155 c, t dbSNP:199422289
170 170 -, c dbSNP:199422290
187 187 c, t dbSNP:772537721
202 202 c, t dbSNP:746281705
222 222 a, t dbSNP:387907247
251 251 c, g dbSNP:544215765
278 278 a, g dbSNP:771343717
280 280 a, g dbSNP:373356928
318 318 a, g dbSNP:776383511
322 322 c, g dbSNP:768398792
355 355 c, t dbSNP:746607875
367 367 a, g dbSNP:779738846
370 370 a, g dbSNP:757915567
376 376 g, t dbSNP:745831414
388 388 c, t dbSNP:778702039
397 397 a, g dbSNP:757141480
436 436 g, t dbSNP:753548160
440 440 a, g dbSNP:764350001
445 445 c, t dbSNP:756352137
451 451 a, g dbSNP:752876848
457 457 c, g dbSNP:767592753
459 459 a, g dbSNP:141125591
461 461 a, g dbSNP:200843534
466 466 a, c, g dbSNP:766794006
472 472 a, c, g dbSNP:767353485
473 473 c, t dbSNP:770240505
478 478 g, t dbSNP:746660804
479 479 c, t dbSNP:775225240
488 488 a, g dbSNP:199422291
499 499 c, t dbSNP:771765361
500 500 a, g dbSNP:745363596
505 505 g, t dbSNP:778951942
514 514 c, g dbSNP:757121533
517 517 a, g dbSNP:749200840
520 520 a, t dbSNP:558025297
526 526 c, t dbSNP:755843023
532 532 a, c dbSNP:752933900
539 539 c, t dbSNP:368291455
541 541 a, g dbSNP:755155708
550 550 c, t dbSNP:751568040
561 561 a, t dbSNP:139824461
566 566 a, g dbSNP:387907248
577 577 a, g dbSNP:763396974
578 578 c, g dbSNP:145958962
580 580 g, t dbSNP:773784305
583 583 g, t dbSNP:765709243
589 589 a, g dbSNP:142489903
592 592 c, g, t dbSNP:370420108
594 594 g, t dbSNP:771590775
599 599 g, t dbSNP:759137449
608 608 a, g dbSNP:773758089
611 611 c, t dbSNP:770436206
612 612 a, g dbSNP:749187042
613 613 c, g dbSNP:777633830
624 624 a, g dbSNP:769638625
625 625 a, c dbSNP:747935528
626 626 a, g dbSNP:377016753
627 627 c, t dbSNP:781435225
630 630 c, g dbSNP:11952056
634 634 a, g dbSNP:138395366
636 636 c, t dbSNP:751762765
645 645 a, g dbSNP:779999492
646 646 -, c dbSNP:147627306
650 650 a, g dbSNP:758442518
655 655 c, t dbSNP:751029411
659 659 c, t dbSNP:765833936
661 661 a, g dbSNP:538256221
662 662 a, g dbSNP:121918661
669 669 a, t dbSNP:764473257
676 676 c, t dbSNP:759142412
682 682 a, g dbSNP:773987859
690 690 g, t dbSNP:770364387
694 694 c, t dbSNP:762440833
696 696 c, t dbSNP:773202955
697 697 c, t dbSNP:769691692
700 700 a, g dbSNP:549656839
702 702 a, g dbSNP:780878492
703 703 c, t dbSNP:768426236
706 706 a, g dbSNP:747206136
716 716 -, gg dbSNP:771404882
721 721 a, g, t dbSNP:35837567
728 728 c, t dbSNP:750497661
736 736 c, t dbSNP:779611656
757 757 a, g dbSNP:757862712
760 760 c, g dbSNP:754359147
770 770 a, c, t dbSNP:149427814
774 774 c, g dbSNP:761042742
777 777 a, g dbSNP:751231538
782 782 c, g dbSNP:766054124
787 787 c, t dbSNP:762491880
795 795 c, t dbSNP:377315722
796 796 a, g, t dbSNP:111527543
805 805 c, g dbSNP:138920650
808 808 c, t