Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

TGFBR3 transforming growth factor, beta receptor III [Homo sapiens (human)]

Gene Symbol TGFBR3
Entrez Gene ID 7049
Full Name transforming growth factor, beta receptor III
Synonyms BGCAN, betaglycan
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu15987 XM_006710867 PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu15987 XM_006710868 PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu60981 XM_011542058 PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu15987 NM_003243 Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu16032 NM_001195683 Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu16032 NM_001195684 Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu15987D
Sequence Information ORF Nucleotide Sequence (Length: 2556bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product transforming growth factor beta receptor type 3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1597..2409(+)
Position Chain Variation Link
1 1 a, t dbSNP:537116060
34 34 c, g dbSNP:569770254
35 35 c, t dbSNP:548456247
68 68 g, t dbSNP:766359193
81 81 -, cccg dbSNP:765394951
98 98 g, t dbSNP:530361674
116 116 a, c dbSNP:559793963
117 117 a, c dbSNP:767147180
119 119 a, g dbSNP:548099980
122 122 a, g dbSNP:778067216
142 142 a, g dbSNP:181487368
144 144 a, g dbSNP:752849826
160 160 -, tct dbSNP:755456776
171 171 a, g dbSNP:766192311
173 173 g, t dbSNP:541690091
174 174 a, c dbSNP:368069428
175 175 c, t dbSNP:767236938
176 176 c, t dbSNP:761612569
177 177 c, g dbSNP:773829664
179 179 -, ctgt dbSNP:780693606
185 185 c, t dbSNP:763840812
190 190 g, t dbSNP:762340856
192 192 a, g dbSNP:775116038
194 194 c, g dbSNP:770412112
196 196 c, t dbSNP:760186833
197 197 a, g dbSNP:1805109
200 200 a, g dbSNP:771362748
206 206 a, g dbSNP:747398767
207 207 g, t dbSNP:777816113
209 209 c, t dbSNP:376626057
211 211 -, a dbSNP:766648708
215 215 a, g dbSNP:567071982
216 216 c, t dbSNP:779103371
220 220 c, g dbSNP:755058299
227 227 a, g dbSNP:747691680
245 245 a, g dbSNP:189150159
249 249 c, t dbSNP:201318720
254 254 c, t dbSNP:757007799
259 259 a, g dbSNP:751412677
264 264 g, t dbSNP:763632739
265 265 a, g dbSNP:781041296
271 271 a, g dbSNP:762724326
275 275 a, g dbSNP:17884205
278 278 c, t dbSNP:1805110
289 289 a, c, g dbSNP:147586574
291 291 g, t dbSNP:755099836
297 297 c, g, t dbSNP:758161891
299 299 c, t dbSNP:543589826
300 300 a, g dbSNP:778674614
303 303 c, g dbSNP:754724902
310 310 a, g, t dbSNP:766050765
315 315 g, t dbSNP:755596815
319 319 c, g dbSNP:150762460
328 328 c, t dbSNP:767943888
330 330 c, t dbSNP:373417209
341 341 c, t dbSNP:762209366
360 360 g, t dbSNP:774747669
369 369 c, t dbSNP:764288602
384 384 a, g dbSNP:763228514
387 387 c, t dbSNP:199845905
393 393 c, t dbSNP:769853640
410 410 a, g dbSNP:745956756
411 411 a, c, g dbSNP:771942211
418 418 c, t dbSNP:747925928
426 426 a, g dbSNP:778907509
428 428 a, g dbSNP:754669633
430 430 a, g dbSNP:181868200
435 435 a, g, t dbSNP:779598675
439 439 c, g dbSNP:755614260
442 442 c, t dbSNP:749945007
443 443 a, g dbSNP:373327242
447 447 c, t dbSNP:757764905
449 449 c, t dbSNP:751917590
450 450 a, g dbSNP:1805111
450 450 a, c, g dbSNP:2810904
459 459 a, g dbSNP:763320119
461 461 c, t dbSNP:752866715
470 470 a, t dbSNP:765407857
471 471 a, g dbSNP:759628579
490 490 a, c dbSNP:762822366
502 502 a, g dbSNP:775208341
506 506 a, c dbSNP:769484825
555 555 a, c dbSNP:202175419
558 558 c, t dbSNP:780911799
559 559 c, t dbSNP:770378014
561 561 c, g, t dbSNP:778219483
564 564 a, g dbSNP:758951153
580 580 a, g dbSNP:750438019
589 589 c, t dbSNP:146325720
595 595 a, t dbSNP:550319582
596 596 c, g dbSNP:779209674
597 597 c, t dbSNP:755370456
603 603 c, t dbSNP:17881905
610 610 c, t dbSNP:753945219
618 618 g, t dbSNP:529153697
622 622 g, t dbSNP:759218481
629 629 g, t dbSNP:776459001
641 641 a, g dbSNP:375529061
647 647 c, t dbSNP:760383880
654 654 a, g, t dbSNP:150238777
656 656 a, t dbSNP:372344244
658 658 c, g, t dbSNP:61748116
660 660 c, t dbSNP:201647804
663 663 c, t dbSNP:749607019
673 673 a, g dbSNP:780636660
676 676 a, g dbSNP:770287785
681 681 a, g dbSNP:368616204
683 683 a, g dbSNP:781589341
687 687 a, g dbSNP:17883665
691 691 c, t dbSNP:376114836
698 698 a, g dbSNP:41286789
700 700 a, g dbSNP:755000509
706 706 c, g dbSNP:753625720
711 711 c, t dbSNP:766091481
712 712 -, ct dbSNP:771711000
717 717 a, c, g dbSNP:750026425
722 722 g, t dbSNP:17885124
728 728 a, g dbSNP:148843052
732 732 a, g dbSNP:773971555
739 739 a, g dbSNP:190581409
746 746 c, t dbSNP:186259544
753 753 a, g dbSNP:2306888
759 759 c, t dbSNP:376528004
762 762 a, t dbSNP:746268292
772 772 a, g dbSNP:781532156
780 780 c, t dbSNP:771231530
787 787 a, g dbSNP:536473318
798 798 a, g dbSNP:775446469
807 807 a, g dbSNP:745661002
808 808 a, g dbSNP:780978982
809 809 c, t dbSNP:370498680
818 818 c, g dbSNP:757019550
822 822 a, g dbSNP:11466585
831 831 a, g dbSNP:763685958
832 832 a, g dbSNP:559817863
847 847 -, tc dbSNP:745682445
852 852 c, t dbSNP:141981218
853 853 a, g dbSNP:765823600
854 854 a, g dbSNP:760186755
865 865 a, g dbSNP:756599009
867 867 a, g dbSNP:541129908
878 878 a, c dbSNP:766704525
884 884 c, g dbSNP:377574327
888 888 a, c dbSNP:760965001
905 905 c, t dbSNP:150076618
907 907 a, c dbSNP:368820380
915 915 a, c, t dbSNP:17879403
937 937 a, g dbSNP:373402175
939 939 c, t dbSNP:191275535
940 940 a, g dbSNP:373881895
952 952 c, t dbSNP:188060482
960 960 g, t dbSNP:781013705
983 983 c, t dbSNP:761959767
988 988 a, g dbSNP:774573661
992 992 a, c dbSNP:768677082
999 999 a, t dbSNP:369086061
1000 1000 a, g dbSNP:760195053
1008 1008 g, t dbSNP:375200304
1015 1015 c, g dbSNP:746804625
1018 1018 a, g dbSNP:777776328
1022 1022 c, t dbSNP:561024989
1030 1030 a, g dbSNP:747745660
1039 1039 c, t dbSNP:147108633
1042 1042 a, c dbSNP:754494166
1043 1043 c, t dbSNP:753325521
1044 1044 c, t dbSNP:780586588
1050 1050 c, t dbSNP:183798036
1062 1062 a, g dbSNP:756649418
1064 1064 a, c dbSNP:750948208
1065 1065 a, g dbSNP:767815459
1073 1073 a, c, g dbSNP:751741728
1078 1078 g, t dbSNP:764341440
1080 1080 a, g dbSNP:763068114
1083 1083 c, g dbSNP:775493031
1095 1095 c, t dbSNP:770894357
1097 1097 a, t dbSNP:760461110
1118 1118 c, t dbSNP:146918650
1120 1120 a, g, t dbSNP:140100898
1123 1123 c, t dbSNP:773240069
1130 1130 a, g dbSNP:767599240
1169 1169 c, t dbSNP:149079126
1170 1170 a, g dbSNP:774342612
1173 1173 a, c dbSNP:768505076
1180 1180 a, g dbSNP:144104234
1184 1184 a, g dbSNP:534911985
1189 1189 a, g dbSNP:775234466
1190 1190 a, g dbSNP:769150204
1191 1191 c, g, t dbSNP:369559704
1196 1196 c, t dbSNP:757821042
1201 1201 a, t dbSNP:747370952
1203 1203 c, t dbSNP:576982336
1206 1206 a, t dbSNP:758802793
1210 1210 a, t dbSNP:752812457
1213 1213 c, t dbSNP:765527206
1221 1221 a, g dbSNP:755073660
1233 1233 a, c dbSNP:754016022
1241 1241 a, g dbSNP:200531720
1244 1244 a, g dbSNP:558826985
1257 1257 a, c dbSNP:371359360
1277 1277 c, t dbSNP:774446526
1278 1278 g, t dbSNP:200330964
1285 1285 a, t dbSNP:11466592
1294 1294 c, t dbSNP:41305630
1295 1295 a, g dbSNP:202193233
1296 1296 g, t dbSNP:745369413
1299 1299 g, t dbSNP:776192202
1306 1306 a, g dbSNP:566197748
1307 1307 a, g dbSNP:747455652
1312 1312 a, g dbSNP:751095060
1315 1315 c, g dbSNP:752598480
1316 1316 a, c dbSNP:764796295
1317 1317 c, g dbSNP:549548203
1330 1330 a, g dbSNP:759124773
1334 1334 c, t dbSNP:776276219
1345 1345 c, t dbSNP:770375974
1348 1348 c, t dbSNP:760206017
1349 1349 c, t dbSNP:773557800
1357 1357 c, t dbSNP:772684078
1358 1358 a, g dbSNP:748447003
1362 1362 c, t dbSNP:11466595
1363 1363 c, t dbSNP:769144659
1369 1369 g, t dbSNP:749474592
1373 1373 c, t dbSNP:752436447
1394 1394 a, g dbSNP:780456773
1397 1397 a, t dbSNP:371268765
1398 1398 c, t dbSNP:543461938
1400 1400 c, t dbSNP:755269794
1401 1401 a, g dbSNP:368105520
1406 1406 g, t dbSNP:752583624
1408 1408 a, c, g, t dbSNP:753445562
1409 1409 a, g, t dbSNP:373979895
1410 1410 g, t dbSNP:772835583
1412 1412 a, g dbSNP:772452575
1413 1413 a, g dbSNP:762313181
1419 1419 a, c dbSNP:774744521
1420 1420 a, g dbSNP:769103679
1424 1424 a, g dbSNP:749710802
1440 1440 a, g dbSNP:1805112
1449 1449 c, g dbSNP:200104902
1450 1450 c, g, t dbSNP:781269907
1464 1464 g, t dbSNP:757299733
1465 1465 a, g dbSNP:752629058
1466 1466 a, g dbSNP:145694501
1470 1470 c, g dbSNP:754734057
1475 1475 a, g dbSNP:572813555
1476 1476 c, t dbSNP:368258508
1491 1491 c, t dbSNP:753678001
1501 1501 c, t dbSNP:766001542
1502 1502 a, g dbSNP:201034517
1508 1508 a, c dbSNP:750047242
1509 1509 a, g dbSNP:375543343
1514 1514 c, t dbSNP:761261903
1536 1536 g, t dbSNP:774969767
1538 1538 c, t dbSNP:118059179
1549 1549 a, g dbSNP:763397177
1561 1561 c, g dbSNP:149771979
1564 1564 a, g dbSNP:770291536
1566 1566 g, t dbSNP:746047801
1575 1575 c, g, t dbSNP:2229500
1576 1576 a, g dbSNP:139306280
1587 1587 c, t dbSNP:778795967
1590 1590 a, g dbSNP:754966297
1598 1598 a, g, t dbSNP:146915187
1605 1605 a, c dbSNP:779756769
1610 1610 a, g dbSNP:188034157
1620 1620 c, t dbSNP:750054560
1659 1659 a, c, t dbSNP:756927421
1661 1661 c, t dbSNP:542785122
1662 1662 a, g dbSNP:777364038
1666 1666 a, g, t dbSNP:753218529
1670 1670 a, g dbSNP:756480739
1671 1671 c, t dbSNP:369943428
1672 1672 a, g dbSNP:375360299
1674 1674 c, t dbSNP:766616318
1691 1691 a, c dbSNP:760819218
1695 1695 c, t dbSNP:773434398
1702 1702 a, c dbSNP:772088791
1703 1703 a, g dbSNP:138396794
1705 1705 a, g dbSNP:775478266
1713 1713 c, t dbSNP:769678052
1717 1717 c, t dbSNP:745672291
1722 1722 a, t dbSNP:780786832
1726 1726 c, t dbSNP:770867935
1732 1732 a, t dbSNP:768020296
1740 1740 a, g dbSNP:777602667
1742 1742 a, g dbSNP:201897960
1743 1743 c, t dbSNP:536057012
1749 1749 c, t dbSNP:773132708
1750 1750 a, c, g dbSNP:754374295
1756 1756 c, t dbSNP:766593780
1757 1757 g, t dbSNP:761048180
1759 1759 c, t dbSNP:761669111
1762 1762 c, t dbSNP:750602752
1763 1763 a, g dbSNP:373312953
1767 1767 a, c, g dbSNP:774361383
1790 1790 a, g dbSNP:769783512
1800 1800 c, t dbSNP:183096494
1803 1803 c, t dbSNP:766465020
1817 1817 a, c dbSNP:760530231
1824 1824 c, t dbSNP:773203555
1831 1831 a, g dbSNP:771994220
1833 1833 g, t dbSNP:199525985
1844 1844 c, t dbSNP:140758164
1847 1847 a, g dbSNP:570468337
1850 1850 g, t dbSNP:748868835
1854 1854 c, t dbSNP:61748119
1872 1872 g, t dbSNP:756683171
1885 1885 a, c, g dbSNP:150461884
1886 1886 c, t dbSNP:757667211
1887 1887 a, g dbSNP:368651115
1894 1894 a, g dbSNP:764420048
1914 1914 c, t dbSNP:758389011
1916 1916 c, t dbSNP:752876418
1921 1921 a, c dbSNP:766413439
1924 1924 a, c, t dbSNP:773291941
1927 1927 c, t dbSNP:767370504
1935 1935 c, t dbSNP:761698806
1936 1936 a, g dbSNP:201405416
1942 1942 g, t dbSNP:751439439
1971 1971 a, c dbSNP:111842248
1977 1977 c, t dbSNP:369529047
1981 1981 c, t dbSNP:762609649
1993 1993 c, t dbSNP:775146340
1996 1996 c, t dbSNP:769257484
1998 1998 c, t dbSNP:376531068
1999 1999 a, g dbSNP:777102917
2004 2004 c, t dbSNP:17884575
2013 2013 c, t dbSNP:747327054
2017 2017 a, g dbSNP:778130466
2026 2026 g, t dbSNP:772332689
2027 2027 a, g dbSNP:748328802
2031 2031 a, c dbSNP:575273869
2039 2039 a, t dbSNP:556991834
2042 2042 g, t dbSNP:773262690
2061 2061 c, t dbSNP:114901303
2062 2062 a, g dbSNP:757151934
2064 2064 c, t dbSNP:751468237
2068 2068 c, t dbSNP:763902185
2083 2083 g, t dbSNP:762770869
2100 2100 a, g dbSNP:752318641
2103 2103 a, g dbSNP:2228362
2107 2107 a, g dbSNP:780124678
2112 2112 c, t dbSNP:779983549
2119 2119 a, g dbSNP:756171899
2128 2128 a, c dbSNP:746926980
2130 2130 a, g dbSNP:777614030
2137 2137 a, g dbSNP:17882578
2139 2139 c, t dbSNP:758170516
2146 2146 a, g dbSNP:752549942
2147 2147 c, t dbSNP:148711567
2148 2148 a, g dbSNP:572029245
2157 2157 c, t dbSNP:753441965
2163 2163 a, c, g dbSNP:760131822
2168 2168 c, t dbSNP:773736382
2169 2169 a, c, g dbSNP:762255439
2171 2171 a, g dbSNP:774922685
2173 2173 a, c, g dbSNP:749474625
2180 2180 a, g dbSNP:775607589
2197 2197 a, g dbSNP:553748759
2242 2242 a, c dbSNP:769890281
2243 2243 g, t dbSNP:745986180
2246 2246 a, c dbSNP:777757403
2247 2247 c, t dbSNP:376827122
2248 2248 a, g dbSNP:748078614
2252 2252 c, g dbSNP:778617818
2254 2254 a, g dbSNP:139927115
2259 2259 a, c dbSNP:754787479
2261 2261 c, t dbSNP:147485470
2262 2262 c, t dbSNP:1805113
2270 2270 c, t dbSNP:755626465
2271 2271 a, g, t dbSNP:148167041
2276 2276 c, t dbSNP:762353605
2279 2279 a, g dbSNP:752135289
2283 2283 a, g dbSNP:556122074
2289 2289 a, g dbSNP:142025249
2292 2292 a, g dbSNP:775762460
2293 2293 c, t dbSNP:769971153
2319 2319 c, g dbSNP:759661348
2334 2334 a, g dbSNP:776511661
2335 2335 c, g dbSNP:537982098
2340 2340 -, t dbSNP:772081624
2356 2356 a, g dbSNP:748025391
2357 2357 c, t dbSNP:778850853
2358 2358 a, g dbSNP:199724223
2361 2361 a, g dbSNP:749083874
2366 2366 c, g, t dbSNP:760566089
2367 2367 a, g dbSNP:755788608
2371 2371 a, g, t dbSNP:780800633
2372 2372 c, t dbSNP:756861353
2373 2373 a, g dbSNP:752082377
2381 2381 a, g dbSNP:764750656
2383 2383 a, c dbSNP:763365526
2384 2384 a, c dbSNP:753074067
2392 2392 c, t dbSNP:541821566
2394 2394 c, g dbSNP:137915935
2415 2415 a, c, t dbSNP:376382556
2425 2425 a, c, g dbSNP:755397132
2429 2429 c, t dbSNP:754026466
2430 2430 a, g, t dbSNP:535647246
2436 2436 c, t dbSNP:143550507
2437 2437 a, g dbSNP:150162893
2441 2441 c, t dbSNP:767638550
2442 2442 a, g dbSNP:762741046
2448 2448 c, g dbSNP:775529350
2449 2449 a, t dbSNP:377239958
2450 2450 g, t dbSNP:769446254
2451 2451 a, g dbSNP:745709350
2455 2455 a, g dbSNP:367749656
2474 2474 c, t dbSNP:373781090
2475 2475 a, g dbSNP:151016095
2478 2478 c, t dbSNP:777093311
2481 2481 c, t dbSNP:284878
2483 2483 a, c, g dbSNP:779512084
2504 2504 a, g dbSNP:755273380
2527 2527 c, g dbSNP:17882828
2536 2536 a, g dbSNP:746615814
2561 2561 a, c dbSNP:772944696
2563 2563 c, t dbSNP:2228363
2568 2568 a, t dbSNP:749746695
2570 2570 g, t dbSNP:780579095
2573 2573 a, g, t dbSNP:539857176
2580 2580 a, g dbSNP:142345668
2583 2583 c, t dbSNP:781267646
2592 2592 c, t dbSNP:373480626
2593 2593 a, g dbSNP:141883791
2596 2596 a, t dbSNP:777954361
2597 2597 c, t dbSNP:758585914
2600 2600 g, t dbSNP:753791977
2602 2602 a, t dbSNP:137909765
2607 2607 a, g dbSNP:760530133
2622 2622 a, g dbSNP:750297587
2625 2625 a, c, t dbSNP:761469766
2639 2639 c, t dbSNP:751027246
2640 2640 a, g dbSNP:768114361
2644 2644 g, t dbSNP:762499783
2649 2649 g, t dbSNP:775964197
2652 2652 c, g dbSNP:770353695
2660 2660 a, g dbSNP:746368140
2665 2665 c, t dbSNP:781565336
2674 2674 g, t dbSNP:751202263
2676 2676 a, g dbSNP:368530249
2680 2680 g, t dbSNP:763795251
2681 2681 c, t dbSNP:762446878
2691 2691 a, g dbSNP:774915438
2695 2695 a, c, g dbSNP:760042952
2701 2701 a, c dbSNP:777039782
2702 2702 c, t dbSNP:771300709
2704 2704 c, t dbSNP:747378008
2708 2708 c, t dbSNP:138603096
2709 2709 a, g dbSNP:143117141
2718 2718 a, g dbSNP:34064838
2724 2724 c, t dbSNP:779079477
2742 2742 c, t dbSNP:755036359
2743 2743 a, t dbSNP:566457282
2748 2748 c, t dbSNP:781031870
2753 2753 c, t dbSNP:193920827
2754 2754 a, g, t dbSNP:17878885
2756 2756 a, g dbSNP:757986605
2762 2762 c, t dbSNP:188809339
2774 2774 a, g dbSNP:764760703
2783 2783 c, t dbSNP:147885293
2799 2799 a, g dbSNP:202191737
2805 2805 -, acccggcccaacccagccca dbSNP:780383881
2805 2805 a, g dbSNP:375168931
2807 2807 c, g dbSNP:371085991
2808 2808 a, c, t dbSNP:542197544
2809 2809 -, ggcccaaccc dbSNP:769235100
2809 2809 a, g dbSNP:1131243
2810 2810 a, g dbSNP:562004206
2811 2811 c, t dbSNP:774746910
2815 2815 -, acccagccca dbSNP:767580175
2815 2815 a, c dbSNP:768750878
2817 2817 a, c dbSNP:749386034
2824 2824 -, acccggcccaacccagccca dbSNP:758963836
2826 2826 -, ccc dbSNP:750939024
2829 2829 a, g dbSNP:781184201
2830 2830 c, g dbSNP:540918983
2833 2833 a, c dbSNP:746960035
2834 2834 a, g dbSNP:777492809
2840 2840 a, g dbSNP:758217785
2842 2842 -, cagct dbSNP:754058860
2846 2846 a, g dbSNP:752312414
2861 2861 a, t dbSNP:754474478
2862 2862 a, g dbSNP:751156484
2865 2865 g, t dbSNP:576526609
2867 2867 c, t dbSNP:573184725
2871 2871 c, t dbSNP:780119636
2875 2875 a, c, g dbSNP:765920731
2916 2916 a, g dbSNP:564491881
2926 2926 a, t dbSNP:199503452
2937 2937 a, c dbSNP:761208990
2947 2947 a, g dbSNP:1805115
2961 2961 a, g dbSNP:767955261
2973 2973 a, g dbSNP:574788524
2974 2974 a, g dbSNP:575782942
2990 2990 a, g dbSNP:1805116
2998 2998 g, t dbSNP:765016060
3003 3003 a, c dbSNP:534907849
3042 3042 c, t dbSNP:774611037
3045 3045 c, t dbSNP:375927498
3050 3050 a, g dbSNP:182999308
3060 3060 c, g dbSNP:763239975
3075 3075 a, t dbSNP:1050619
3086 3086 -, c dbSNP:565585559
3088 3088 c, t dbSNP:573873791
3092 3092 a, g dbSNP:556859031
3096 3096 a, t dbSNP:769937561
3141 3141 c, g dbSNP:555742735
3191 3191 c, g, t dbSNP:764740196
3200 3200 c, t dbSNP:749899080
3214 3214 a, g dbSNP:761525685
3216 3216 c, t dbSNP:192924147
3222 3222 a, g dbSNP:764253029
3229 3229 a, g dbSNP:778627082
3244 3244 a, t dbSNP:566376747
3247 3247 a, g dbSNP:1805117
3256 3256 a, t dbSNP:539179739
3260 3260 a, c, t dbSNP:138858788
3277 3277 c, t dbSNP:41313401
3278 3278 a, g dbSNP:768188215
3284 3284 c, t dbSNP:762263808
3290 3290 c, t dbSNP:550771540
3293 3293 a, t dbSNP:529485848
3304 3304 c, g dbSNP:751804044
3316 3316 a, t dbSNP:1050620
3332 3332 c, t dbSNP:561926024
3350 3350 a, g dbSNP:772550023
3357 3357 c, t dbSNP:764530840
3360 3360 a, t dbSNP:1050621
3361 3361 a, t dbSNP:1050623
3363 3363 a, g dbSNP:763034502
3367 3367 a, g dbSNP:547012723
3377 3377 c, t dbSNP:775809577
3378 3378 -, a dbSNP:764419888
3386 3386 c, t dbSNP:145038062
3388 3388 c, t dbSNP:564347164
3417 3417 g, t dbSNP:1050624
3440 3440 a, g dbSNP:570933377
3500 3500 a, g dbSNP:773116819
3517 3517 g, t dbSNP:772068416
3519 3519 a, g dbSNP:186509687
3523 3523 c, t dbSNP:182258756
3570 3570 a, g dbSNP:563815973
3580 3580 a, g dbSNP:374704929
3599 3599 g, t dbSNP:773962728
3609 3609 a, g dbSNP:542342250
3636 3636 a, g dbSNP:760097803
3647 3647 c, t dbSNP:573907130
3648 3648 a, g dbSNP:555519876
3666 3666 a, g dbSNP:190787610
3672 3672 a, g dbSNP:374069443
3697 3697 a, c dbSNP:771282350
3715 3715 g, t dbSNP:755664359
3751 3751 a, c, g dbSNP:186173500
3764 3764 c, t dbSNP:780853579
3789 3789 g, t dbSNP:557470398
3798 3798 a, g dbSNP:149171541
3809 3809 c, t dbSNP:568502404
3833 3833 -, a dbSNP:760799851
3835 3835 a, g dbSNP:145149335
3842 3842 g, t dbSNP:780868960
3850 3850 a, c, g dbSNP:990
3857 3857 c, t dbSNP:768112880
3859 3859 c, g dbSNP:902
3863 3863 c, g dbSNP:746505769
3879 3879 c, g dbSNP:568332656
3892 3892 a, g dbSNP:752837120
3913 3913 a, c dbSNP:149986478
3934 3934 a, g dbSNP:140877088
3936 3936 a, g dbSNP:765497918
3963 3963 c, g dbSNP:759611426
3972 3972 c, t dbSNP:528786379
3999 3999 g, t dbSNP:776629862
4016 4016 g, t dbSNP:779777966
4028 4028 c, t dbSNP:564763331
4036 4036 a, c dbSNP:147653232
4050 4050 a, g dbSNP:766463714
4073 4073 a, g dbSNP:1804506
4086 4086 c, t dbSNP:774378714
4091 4091 a, t dbSNP:563648018
4096 4096 -, c dbSNP:34978889
4101 4101 g, t dbSNP:768305985
4103 4103 a, t dbSNP:749158044
4104 4104 a, t dbSNP:368181429
4120 4120 -, c dbSNP:762750274
4120 4120 a, c dbSNP:769504166
4121 4121 a, g dbSNP:76721579
4123 4123 -, aa dbSNP:746377582
4124 4124 -, a, aa, aaa, aaaa dbSNP:768087199
4124 4124 -, a dbSNP:780727991
4125 4125 a, g dbSNP:200216410
4125 4125 -, g dbSNP:779579345
4127 4127 -, aa dbSNP:757633551
4132 4132 -, a dbSNP:17883810
4161 4161 a, c dbSNP:745527810
4165 4165 a, c dbSNP:72714407
4170 4170 a, g dbSNP:28394336
4177 4177 g, t dbSNP:530180883
4188 4188 c, t dbSNP:778737112
4218 4218 c, t dbSNP:184187810
4222 4222 a, g dbSNP:28698523
4226 4226 a, t dbSNP:111695686
4255 4255 c, t dbSNP:778390099
4284 4284 c, t dbSNP:540375214
4292 4292 a, g dbSNP:758672781
4304 4304 c, t dbSNP:753168518
4312 4312 c, t dbSNP:573063340
4334 4334 a, g dbSNP:765594185
4341 4341 c, g dbSNP:755139754
4346 4346 g, t dbSNP:558071969
4348 4348 a, g dbSNP:766408784
4364 4364 a, g dbSNP:760851199
4376 4376 a, g dbSNP:75861863
4387 4387 a, g dbSNP:191543210
4403 4403 a, c dbSNP:556505387
4420 4420 c, t dbSNP:762651450
4428 4428 a, t dbSNP:775366817
4453 4453 c, t dbSNP:375232472
4458 4458 a, g, t dbSNP:370676839
4483 4483 -, t dbSNP:778095946
4483 4483 -, t dbSNP:756338808
4486 4486 a, g dbSNP:759221609
4491 4491 a, g dbSNP:756382683
4492 4492 a, g dbSNP:368850678
4524 4524 a, c dbSNP:139697752
4543 4543 a, g dbSNP:770321440
4553 4553 g, t dbSNP:746584073
4591 4591 c, t dbSNP:74923072
4603 4603 c, g dbSNP:778134022
4616 4616 g, t dbSNP:752764596
4618 4618 a, t dbSNP:75692888
4620 4620 a, t dbSNP:74896573
4628 4628 -, t dbSNP:201044103
4628 4628 -, t dbSNP:752904515
4669 4669 c, t dbSNP:553301669
4703 4703 c, t dbSNP:376306385
4754 4754 g, t dbSNP:772559613
4768 4768 c, g dbSNP:111911073
4779 4779 a, c dbSNP:186980840
4780 4780 a, g dbSNP:554390769
4784 4784 a, g dbSNP:552935952
4797 4797 g, t dbSNP:767531327
4854 4854 -, t dbSNP:767630579
4898 4898 c, g dbSNP:779202869
4902 4902 a, g dbSNP:755370800
4934 4934 c, t dbSNP:371215513
4935 4935 a, g dbSNP:538787765
4965 4965 c, t dbSNP:534412268
5016 5016 a, g dbSNP:780305406
5041 5041 a, t dbSNP:756134998
5042 5042 c, t dbSNP:750584816
5051 5051 g, t dbSNP:377444926
5111 5111 a, t dbSNP:373115808
5130 5130 -, agag dbSNP:755707185
5132 5132 -, ag dbSNP:751440711
5135 5135 a, g dbSNP:376113740
5138 5138 a, g dbSNP:181125491
5146 5146 a, c, t dbSNP:759637948
5163 5163 c, t dbSNP:762898642
5169 5169 g, t dbSNP:6669888
5173 5173 -, ga dbSNP:766308427
5196 5196 c, t dbSNP:17571088
5203 5203 c, t dbSNP:763355562
5206 5206 g, t dbSNP:773508844
5226 5226 c, g dbSNP:759450328
5236 5236 a, g dbSNP:545353127
5238 5238 c, t dbSNP:746593487
5239 5239 a, g dbSNP:776406969
5243 5243 a, c dbSNP:147408871
5268 5268 a, t dbSNP:775295275
5273 5273 a, c dbSNP:748205328
5282 5282 a, c dbSNP:745400222
5356 5356 c, t dbSNP:531865952
5362 5362 c, g dbSNP:373652155
5367 5367 c, t dbSNP:188735272
5375 5375 a, c dbSNP:541156474
5376 5376 c, g, t dbSNP:528335137
5385 5385 a, c dbSNP:771508847
5405 5405 a, g dbSNP:778876583
5415 5415 a, g dbSNP:55667079
5429 5429 a, g dbSNP:545708974
5433 5433 c, g dbSNP:779439568
5454 5454 a, g dbSNP:757188919
5456 5456 g, t dbSNP:56404248
5461 5461 a, g dbSNP:185197797
5468 5468 a, g dbSNP:749712255
5474 5474 a, g dbSNP:541386059
5497 5497 c, g dbSNP:34364530
5500 5500 g, t dbSNP:756293851
5505 5505 a, g dbSNP:750631155
5541 5541 -, agatt dbSNP:762695050
5546 5546 a, g dbSNP:781291511
5554 5554 c, t dbSNP:757318985
5559 5559 c, t dbSNP:752658461
5570 5570 c, t dbSNP:79001261
5593 5593 c, t dbSNP:759398951
5629 5629 a, g dbSNP:534401333
5644 5644 a, c dbSNP:755904238
5663 5663 -, a dbSNP:765062293
5663 5663 -, a dbSNP:376911402
5668 5668 c, t dbSNP:752872500
5692 5692 g, t dbSNP:767762057
5720 5720 c, t dbSNP:766096612
5725 5725 a, g dbSNP:746829560
5729 5729 c, t dbSNP:77378509
5751 5751 c, g dbSNP:113200221
5758 5758 c, t dbSNP:116500181
5759 5759 a, g dbSNP:761363032
5761 5761 a, g dbSNP:376434814
5807 5807 c, t dbSNP:113820201
5852 5852 c, g dbSNP:763437847
5863 5863 c, t dbSNP:774838846
5886 5886 a, g dbSNP:570314767
5897 5897 a, g dbSNP:749801851
5902 5902 -, tgac dbSNP:761492490
5907 5907 g, t dbSNP:56247486
5925 5925 a, g dbSNP:770086149
5926 5926 c, t dbSNP:773775119
5975 5975 a, g dbSNP:746070050
6021 6021 c, t dbSNP:373535351
6022 6022 a, g dbSNP:781316968
6023 6023 a, g dbSNP:180780531
6028 6028 a, c dbSNP:757995859
6029 6029 c, t dbSNP:548611386
6044 6044 a, g dbSNP:188411829
6058 6058 a, c dbSNP:565936194
6060 6060 c, t dbSNP:765639657
6087 6087 a, t dbSNP:754901024
6100 6100 a, g dbSNP:762290500
6149 6149 -, tatct dbSNP:776209113
6151 6151 c, t dbSNP:547898508
6169 6169 a, t dbSNP:766162194
6172 6172 c, t dbSNP:532466392
6177 6177 c, t dbSNP:564328488
6178 6178 a, c dbSNP:551908322
6179 6179 a, g dbSNP:74103025

Target ORF information:

RefSeq Version XM_006710867
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu15987D
Sequence Information ORF Nucleotide Sequence (Length: 2556bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product transforming growth factor beta receptor type 3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1563..2375(+)
Position Chain Variation Link
9 9 c, t dbSNP:140336318
13 13 c, t dbSNP:56194616
88 88 a, g dbSNP:778067216
108 108 a, g dbSNP:181487368
110 110 a, g dbSNP:752849826
126 126 -, tct dbSNP:755456776
137 137 a, g dbSNP:766192311
139 139 g, t dbSNP:541690091
140 140 a, c dbSNP:368069428
141 141 c, t dbSNP:767236938
142 142 c, t dbSNP:761612569
143 143 c, g dbSNP:773829664
145 145 -, ctgt dbSNP:780693606
151 151 c, t dbSNP:763840812
156 156 g, t dbSNP:762340856
158 158 a, g dbSNP:775116038
160 160 c, g dbSNP:770412112
162 162 c, t dbSNP:760186833
163 163 a, g dbSNP:1805109
166 166 a, g dbSNP:771362748
172 172 a, g dbSNP:747398767
173 173 g, t dbSNP:777816113
175 175 c, t dbSNP:376626057
177 177 -, a dbSNP:766648708
181 181 a, g dbSNP:567071982
182 182 c, t dbSNP:779103371
186 186 c, g dbSNP:755058299
193 193 a, g dbSNP:747691680
211 211 a, g dbSNP:189150159
215 215 c, t dbSNP:201318720
220 220 c, t dbSNP:757007799
225 225 a, g dbSNP:751412677
230 230 g, t dbSNP:763632739
231 231 a, g dbSNP:781041296
237 237 a, g dbSNP:762724326
241 241 a, g dbSNP:17884205
244 244 c, t dbSNP:1805110
255 255 a, c, g dbSNP:147586574
257 257 g, t dbSNP:755099836
263 263 c, g, t dbSNP:758161891
265 265 c, t dbSNP:543589826
266 266 a, g dbSNP:778674614
269 269 c, g dbSNP:754724902
276 276 a, g, t dbSNP:766050765
281 281 g, t dbSNP:755596815
285 285 c, g dbSNP:150762460
294 294 c, t dbSNP:767943888
296 296 c, t dbSNP:373417209
307 307 c, t dbSNP:762209366
326 326 g, t dbSNP:774747669
335 335 c, t dbSNP:764288602
350 350 a, g dbSNP:763228514
353 353 c, t dbSNP:199845905
359 359 c, t dbSNP:769853640
376 376 a, g dbSNP:745956756
377 377 a, c, g dbSNP:771942211
384 384 c, t dbSNP:747925928
392 392 a, g dbSNP:778907509
394 394 a, g dbSNP:754669633
396 396 a, g dbSNP:181868200
401 401 a, g, t dbSNP:779598675
405 405 c, g dbSNP:755614260
408 408 c, t dbSNP:749945007
409 409 a, g dbSNP:373327242
413 413 c, t dbSNP:757764905
415 415 c, t dbSNP:751917590
416 416 a, g dbSNP:1805111
416 416 a, c, g dbSNP:2810904
425 425 a, g dbSNP:763320119
427 427 c, t dbSNP:752866715
436 436 a, t dbSNP:765407857
437 437 a, g dbSNP:759628579
456 456 a, c dbSNP:762822366
468 468 a, g dbSNP:775208341
472 472 a, c dbSNP:769484825
521 521 a, c dbSNP:202175419
524 524 c, t dbSNP:780911799
525 525 c, t dbSNP:770378014
527 527 c, g, t dbSNP:778219483
530 530 a, g dbSNP:758951153
546 546 a, g dbSNP:750438019
555 555 c, t dbSNP:146325720
561 561 a, t dbSNP:550319582
562 562 c, g dbSNP:779209674
563 563 c, t dbSNP:755370456
569 569 c, t dbSNP:17881905
576 576 c, t dbSNP:753945219
584 584 g, t dbSNP:529153697
588 588 g, t dbSNP:759218481
595 595 g, t dbSNP:776459001
607 607 a, g dbSNP:375529061
613 613 c, t dbSNP:760383880
620 620 a, g, t dbSNP:150238777
622 622 a, t dbSNP:372344244
624 624 c, g, t dbSNP:61748116
626 626 c, t dbSNP:201647804
629 629 c, t dbSNP:749607019
639 639 a, g dbSNP:780636660
642 642 a, g dbSNP:770287785
647 647 a, g dbSNP:368616204
649 649 a, g dbSNP:781589341
653 653 a, g dbSNP:17883665
657 657 c, t dbSNP:376114836
664 664 a, g dbSNP:41286789
666 666 a, g dbSNP:755000509
672 672 c, g dbSNP:753625720
677 677 c, t dbSNP:766091481
678 678 -, ct dbSNP:771711000
683 683 a, c, g dbSNP:750026425
688 688 g, t dbSNP:17885124
694 694 a, g dbSNP:148843052
698 698 a, g dbSNP:773971555
705 705 a, g dbSNP:190581409
712 712 c, t dbSNP:186259544
719 719 a, g dbSNP:2306888
725 725 c, t dbSNP:376528004
728 728 a, t dbSNP:746268292
738 738 a, g dbSNP:781532156
746 746 c, t dbSNP:771231530
753 753 a, g dbSNP:536473318
764 764 a, g dbSNP:775446469
773 773 a, g dbSNP:745661002
774 774 a, g dbSNP:780978982
775 775 c, t dbSNP:370498680
784 784 c, g dbSNP:757019550
788 788 a, g dbSNP:11466585
797 797 a, g dbSNP:763685958
798 798 a, g dbSNP:559817863
813 813 -, tc dbSNP:745682445
818 818 c, t dbSNP:141981218
819 819 a, g dbSNP:765823600
820 820 a, g dbSNP:760186755
831 831 a, g dbSNP:756599009
833 833 a, g dbSNP:541129908
844 844 a, c dbSNP:766704525
850 850 c, g dbSNP:377574327
854 854 a, c dbSNP:760965001
871 871 c, t dbSNP:150076618
873 873 a, c dbSNP:368820380
881 881 a, c, t dbSNP:17879403
903 903 a, g dbSNP:373402175
905 905 c, t dbSNP:191275535
906 906 a, g dbSNP:373881895
918 918 c, t dbSNP:188060482
926 926 g, t dbSNP:781013705
949 949 c, t dbSNP:761959767
954 954 a, g dbSNP:774573661
958 958 a, c dbSNP:768677082
965 965 a, t dbSNP:369086061
966 966 a, g dbSNP:760195053
974 974 g, t dbSNP:375200304
981 981 c, g dbSNP:746804625
984 984 a, g dbSNP:777776328
988 988 c, t dbSNP:561024989
996 996 a, g dbSNP:747745660
1005 1005 c, t dbSNP:147108633
1008 1008 a, c dbSNP:754494166
1009 1009 c, t dbSNP:753325521
1010 1010 c, t dbSNP:780586588
1016 1016 c, t dbSNP:183798036
1028 1028 a, g dbSNP:756649418
1030 1030 a, c dbSNP:750948208
1031 1031 a, g dbSNP:767815459
1039 1039 a, c, g dbSNP:751741728
1044 1044 g, t dbSNP:764341440
1046 1046 a, g dbSNP:763068114
1049 1049 c, g dbSNP:775493031
1061 1061 c, t dbSNP:770894357
1063 1063 a, t dbSNP:760461110
1084 1084 c, t dbSNP:146918650
1086 1086 a, g, t dbSNP:140100898
1089 1089 c, t dbSNP:773240069
1096 1096 a, g dbSNP:767599240
1135 1135 c, t dbSNP:149079126
1136 1136 a, g dbSNP:774342612
1139 1139 a, c dbSNP:768505076
1146 1146 a, g dbSNP:144104234
1150 1150 a, g dbSNP:534911985
1155 1155 a, g dbSNP:775234466
1156 1156 a, g dbSNP:769150204
1157 1157 c, g, t dbSNP:369559704
1162 1162 c, t dbSNP:757821042
1167 1167 a, t dbSNP:747370952
1169 1169 c, t dbSNP:576982336
1172 1172 a, t dbSNP:758802793
1176 1176 a, t dbSNP:752812457
1179 1179 c, t dbSNP:765527206
1187 1187 a, g dbSNP:755073660
1199 1199 a, c dbSNP:754016022
1207 1207 a, g dbSNP:200531720
1210 1210 a, g dbSNP:558826985
1223 1223 a, c dbSNP:371359360
1243 1243 c, t dbSNP:774446526
1244 1244 g, t dbSNP:200330964
1251 1251 a, t dbSNP:11466592
1260 1260 c, t dbSNP:41305630
1261 1261 a, g dbSNP:202193233
1262 1262 g, t dbSNP:745369413
1265 1265 g, t dbSNP:776192202
1272 1272 a, g dbSNP:566197748
1273 1273 a, g dbSNP:747455652
1278 1278 a, g dbSNP:751095060
1281 1281 c, g dbSNP:752598480
1282 1282 a, c dbSNP:764796295
1283 1283 c, g dbSNP:549548203
1296 1296 a, g dbSNP:759124773
1300 1300 c, t dbSNP:776276219
1311 1311 c, t dbSNP:770375974
1314 1314 c, t dbSNP:760206017
1315 1315 c, t dbSNP:773557800
1323 1323 c, t dbSNP:772684078
1324 1324 a, g dbSNP:748447003
1328 1328 c, t dbSNP:11466595
1329 1329 c, t dbSNP:769144659
1335 1335 g, t dbSNP:749474592
1339 1339 c, t dbSNP:752436447
1360 1360 a, g dbSNP:780456773
1363 1363 a, t dbSNP:371268765
1364 1364 c, t dbSNP:543461938
1366 1366 c, t dbSNP:755269794
1367 1367 a, g dbSNP:368105520
1372 1372 g, t dbSNP:752583624
1374 1374 a, c, g, t dbSNP:753445562
1375 1375 a, g, t dbSNP:373979895
1376 1376 g, t dbSNP:772835583
1378 1378 a, g dbSNP:772452575
1379 1379 a, g dbSNP:762313181
1385 1385 a, c dbSNP:774744521
1386 1386 a, g dbSNP:769103679
1390 1390 a, g dbSNP:749710802
1406 1406 a, g dbSNP:1805112
1415 1415 c, g dbSNP:200104902
1416 1416 c, g, t dbSNP:781269907
1430 1430 g, t dbSNP:757299733
1431 1431 a, g dbSNP:752629058
1432 1432 a, g dbSNP:145694501
1436 1436 c, g dbSNP:754734057
1441 1441 a, g dbSNP:572813555
1442 1442 c, t dbSNP:368258508
1457 1457 c, t dbSNP:753678001
1467 1467 c, t dbSNP:766001542
1468 1468 a, g dbSNP:201034517
1474 1474 a, c dbSNP:750047242
1475 1475 a, g dbSNP:375543343
1480 1480 c, t dbSNP:761261903
1502 1502 g, t dbSNP:774969767
1504 1504 c, t dbSNP:118059179
1515 1515 a, g dbSNP:763397177
1527 1527 c, g dbSNP:149771979
1530 1530 a, g dbSNP:770291536
1532 1532 g, t dbSNP:746047801
1541 1541 c, g, t dbSNP:2229500
1542 1542 a, g dbSNP:139306280
1553 1553 c, t dbSNP:778795967
1556 1556 a, g dbSNP:754966297
1564 1564 a, g, t dbSNP:146915187
1571 1571 a, c dbSNP:779756769
1576 1576 a, g dbSNP:188034157
1586 1586 c, t dbSNP:750054560
1625 1625 a, c, t dbSNP:756927421
1627 1627 c, t dbSNP:542785122
1628 1628 a, g dbSNP:777364038
1632 1632 a, g, t dbSNP:753218529
1636 1636 a, g dbSNP:756480739
1637 1637 c, t dbSNP:369943428
1638 1638 a, g dbSNP:375360299
1640 1640 c, t dbSNP:766616318
1657 1657 a, c dbSNP:760819218
1661 1661 c, t dbSNP:773434398
1668 1668 a, c dbSNP:772088791
1669 1669 a, g dbSNP:138396794
1671 1671 a, g dbSNP:775478266
1679 1679 c, t dbSNP:769678052
1683 1683 c, t dbSNP:745672291
1688 1688 a, t dbSNP:780786832
1692 1692 c, t dbSNP:770867935
1698 1698 a, t dbSNP:768020296
1706 1706 a, g dbSNP:777602667
1708 1708 a, g dbSNP:201897960
1709 1709 c, t dbSNP:536057012
1715 1715 c, t dbSNP:773132708
1716 1716 a, c, g dbSNP:754374295
1722 1722 c, t dbSNP:766593780
1723 1723 g, t dbSNP:761048180
1725 1725 c, t dbSNP:761669111
1728 1728 c, t dbSNP:750602752
1729 1729 a, g dbSNP:373312953
1733 1733 a, c, g dbSNP:774361383
1756 1756 a, g dbSNP:769783512
1766 1766 c, t dbSNP:183096494
1769 1769 c, t dbSNP:766465020
1783 1783 a, c dbSNP:760530231
1790 1790 c, t dbSNP:773203555
1797 1797 a, g dbSNP:771994220
1799 1799 g, t dbSNP:199525985
1810 1810 c, t dbSNP:140758164
1813 1813 a, g dbSNP:570468337
1816 1816 g, t dbSNP:748868835
1820 1820 c, t dbSNP:61748119
1838 1838 g, t dbSNP:756683171
1851 1851 a, c, g dbSNP:150461884
1852 1852 c, t dbSNP:757667211
1853 1853 a, g dbSNP:368651115
1860 1860 a, g dbSNP:764420048
1880 1880 c, t dbSNP:758389011
1882 1882 c, t dbSNP:752876418
1887 1887 a, c dbSNP:766413439
1890 1890 a, c, t dbSNP:773291941
1893 1893 c, t dbSNP:767370504
1901 1901 c, t dbSNP:761698806
1902 1902 a, g dbSNP:201405416
1908 1908 g, t dbSNP:751439439
1937 1937 a, c dbSNP:111842248
1943 1943 c, t dbSNP:369529047
1947 1947 c, t dbSNP:762609649
1959 1959 c, t dbSNP:775146340
1962 1962 c, t dbSNP:769257484
1964 1964 c, t dbSNP:376531068
1965 1965 a, g dbSNP:777102917
1970 1970 c, t dbSNP:17884575
1979 1979 c, t dbSNP:747327054
1983 1983 a, g dbSNP:778130466
1992 1992 g, t dbSNP:772332689
1993 1993 a, g dbSNP:748328802
1997 1997 a, c dbSNP:575273869
2005 2005 a, t dbSNP:556991834
2008 2008 g, t dbSNP:773262690
2027 2027 c, t dbSNP:114901303
2028 2028 a, g dbSNP:757151934
2030 2030 c, t dbSNP:751468237
2034 2034 c, t dbSNP:763902185
2049 2049 g, t dbSNP:762770869
2066 2066 a, g dbSNP:752318641
2069 2069 a, g dbSNP:2228362
2073 2073 a, g dbSNP:780124678
2078 2078 c, t dbSNP:779983549
2085 2085 a, g dbSNP:756171899
2094 2094 a, c dbSNP:746926980
2096 2096 a, g dbSNP:777614030
2103 2103 a, g dbSNP:17882578
2105 2105 c, t dbSNP:758170516
2112 2112 a, g dbSNP:752549942
2113 2113 c, t dbSNP:148711567
2114 2114 a, g dbSNP:572029245
2123 2123 c, t dbSNP:753441965
2129 2129 a, c, g dbSNP:760131822
2134 2134 c, t dbSNP:773736382
2135 2135 a, c, g dbSNP:762255439
2137 2137 a, g dbSNP:774922685
2139 2139 a, c, g dbSNP:749474625
2146 2146 a, g dbSNP:775607589
2163 2163 a, g dbSNP:553748759
2208 2208 a, c dbSNP:769890281
2209 2209 g, t dbSNP:745986180
2212 2212 a, c dbSNP:777757403
2213 2213 c, t dbSNP:376827122
2214 2214 a, g dbSNP:748078614
2218 2218 c, g dbSNP:778617818
2220 2220 a, g dbSNP:139927115
2225 2225 a, c dbSNP:754787479
2227 2227 c, t dbSNP:147485470
2228 2228 c, t dbSNP:1805113
2236 2236 c, t dbSNP:755626465
2237 2237 a, g, t dbSNP:148167041
2242 2242 c, t dbSNP:762353605
2245 2245 a, g dbSNP:752135289
2249 2249 a, g dbSNP:556122074
2255 2255 a, g dbSNP:142025249
2258 2258 a, g dbSNP:775762460
2259 2259 c, t dbSNP:769971153
2285 2285 c, g dbSNP:759661348
2300 2300 a, g dbSNP:776511661
2301 2301 c, g dbSNP:537982098
2306 2306 -, t dbSNP:772081624
2322 2322 a, g dbSNP:748025391
2323 2323 c, t dbSNP:778850853
2324 2324 a, g dbSNP:199724223
2327 2327 a, g dbSNP:749083874
2332 2332 c, g, t dbSNP:760566089
2333 2333 a, g dbSNP:755788608
2337 2337 a, g, t dbSNP:780800633
2338 2338 c, t dbSNP:756861353
2339 2339 a, g dbSNP:752082377
2347 2347 a, g dbSNP:764750656
2349 2349 a, c dbSNP:763365526
2350 2350 a, c dbSNP:753074067
2358 2358 c, t dbSNP:541821566
2360 2360 c, g dbSNP:137915935
2381 2381 a, c, t dbSNP:376382556
2391 2391 a, c, g dbSNP:755397132
2395 2395 c, t dbSNP:754026466
2396 2396 a, g, t dbSNP:535647246
2402 2402 c, t dbSNP:143550507
2403 2403 a, g dbSNP:150162893
2407 2407 c, t dbSNP:767638550
2408 2408 a, g dbSNP:762741046
2414 2414 c, g dbSNP:775529350
2415 2415 a, t dbSNP:377239958
2416 2416 g, t dbSNP:769446254
2417 2417 a, g dbSNP:745709350
2421 2421 a, g dbSNP:367749656
2440 2440 c, t dbSNP:373781090
2441 2441 a, g dbSNP:151016095
2444 2444 c, t dbSNP:777093311
2447 2447 c, t dbSNP:284878
2449 2449 a, c, g dbSNP:779512084
2470 2470 a, g dbSNP:755273380
2493 2493 c, g dbSNP:17882828
2502 2502 a, g dbSNP:746615814
2527 2527 a, c dbSNP:772944696
2529 2529 c, t dbSNP:2228363
2534 2534 a, t dbSNP:749746695
2536 2536 g, t dbSNP:780579095
2539 2539 a, g, t dbSNP:539857176
2546 2546 a, g dbSNP:142345668
2549 2549 c, t dbSNP:781267646
2558 2558 c, t dbSNP:373480626
2559 2559 a, g dbSNP:141883791
2562 2562 a, t dbSNP:777954361
2563 2563 c, t dbSNP:758585914
2566 2566 g, t dbSNP:753791977
2568 2568 a, t dbSNP:137909765
2573 2573 a, g dbSNP:760530133
2588 2588 a, g dbSNP:750297587
2591 2591 a, c, t dbSNP:761469766
2605 2605 c, t dbSNP:751027246
2606 2606 a, g dbSNP:768114361
2610 2610 g, t dbSNP:762499783
2615 2615 g, t dbSNP:775964197
2618 2618 c, g dbSNP:770353695
2626 2626 a, g dbSNP:746368140
2631 2631 c, t dbSNP:781565336
2640 2640 g, t dbSNP:751202263
2642 2642 a, g dbSNP:368530249
2646 2646 g, t dbSNP:763795251
2647 2647 c, t dbSNP:762446878
2657 2657 a, g dbSNP:774915438
2661 2661 a, c, g dbSNP:760042952
2667 2667 a, c dbSNP:777039782
2668 2668 c, t dbSNP:771300709
2670 2670 c, t dbSNP:747378008
2674 2674 c, t dbSNP:138603096
2675 2675 a, g dbSNP:143117141
2684 2684 a, g dbSNP:34064838
2690 2690 c, t dbSNP:779079477
2708 2708 c, t dbSNP:755036359
2709 2709 a, t dbSNP:566457282
2714 2714 c, t dbSNP:781031870
2719 2719 c, t dbSNP:193920827
2720 2720 a, g, t dbSNP:17878885
2722 2722 a, g dbSNP:757986605
2728 2728 c, t dbSNP:188809339
2740 2740 a, g dbSNP:764760703
2749 2749 c, t dbSNP:147885293
2765 2765 a, g dbSNP:202191737
2771 2771 -, acccggcccaacccagccca dbSNP:780383881
2771 2771 a, g dbSNP:375168931
2773 2773 c, g dbSNP:371085991
2774 2774 a, c, t dbSNP:542197544
2775 2775 -, ggcccaaccc dbSNP:769235100
2775 2775 a, g dbSNP:1131243
2776 2776 a, g dbSNP:562004206
2777 2777 c, t dbSNP:774746910
2781 2781 -, acccagccca dbSNP:767580175
2781 2781 a, c dbSNP:768750878
2783 2783 a, c dbSNP:749386034
2790 2790 -, acccggcccaacccagccca dbSNP:758963836
2792 2792 -, ccc dbSNP:750939024
2795 2795 a, g dbSNP:781184201
2796 2796 c, g dbSNP:540918983
2799 2799 a, c dbSNP:746960035
2800 2800 a, g dbSNP:777492809
2806 2806 a, g dbSNP:758217785
2808 2808 -, cagct dbSNP:754058860
2812 2812 a, g dbSNP:752312414
2827 2827 a, t dbSNP:754474478
2828 2828 a, g dbSNP:751156484
2831 2831 g, t dbSNP:576526609
2833 2833 c, t dbSNP:573184725
2837 2837 c, t dbSNP:780119636
2841 2841 a, c, g dbSNP:765920731
2882 2882 a, g dbSNP:564491881
2892 2892 a, t dbSNP:199503452
2903 2903 a, c dbSNP:761208990
2913 2913 a, g dbSNP:1805115
2927 2927 a, g dbSNP:767955261
2939 2939 a, g dbSNP:574788524
2940 2940 a, g dbSNP:575782942
2956 2956 a, g dbSNP:1805116
2964 2964 g, t dbSNP:765016060
2969 2969 a, c dbSNP:534907849
3008 3008 c, t dbSNP:774611037
3011 3011 c, t dbSNP:375927498
3016 3016 a, g dbSNP:182999308
3026 3026 c, g dbSNP:763239975
3041 3041 a, t dbSNP:1050619
3052 3052 -, c dbSNP:565585559
3054 3054 c, t dbSNP:573873791
3058 3058 a, g dbSNP:556859031
3062 3062 a, t dbSNP:769937561
3107 3107 c, g dbSNP:555742735
3157 3157 c, g, t dbSNP:764740196
3166 3166 c, t dbSNP:749899080
3180 3180 a, g dbSNP:761525685
3182 3182 c, t dbSNP:192924147
3188 3188 a, g dbSNP:764253029
3195 3195 a, g dbSNP:778627082
3210 3210 a, t dbSNP:566376747
3213 3213 a, g dbSNP:1805117
3222 3222 a, t dbSNP:539179739
3226 3226 a, c, t dbSNP:138858788
3243 3243 c, t dbSNP:41313401
3244 3244 a, g dbSNP:768188215
3250 3250 c, t dbSNP:762263808
3256 3256 c, t dbSNP:550771540
3259 3259 a, t dbSNP:529485848
3270 3270 c, g dbSNP:751804044
3282 3282 a, t dbSNP:1050620
3298 3298 c, t dbSNP:561926024
3316 3316 a, g dbSNP:772550023
3323 3323 c, t dbSNP:764530840
3326 3326 a, t dbSNP:1050621
3327 3327 a, t dbSNP:1050623
3329 3329 a, g dbSNP:763034502
3333 3333 a, g dbSNP:547012723
3343 3343 c, t dbSNP:775809577
3344 3344 -, a dbSNP:764419888
3352 3352 c, t dbSNP:145038062
3354 3354 c, t dbSNP:564347164
3383 3383 g, t dbSNP:1050624
3406 3406 a, g dbSNP:570933377
3466 3466 a, g dbSNP:773116819
3483 3483 g, t dbSNP:772068416
3485 3485 a, g dbSNP:186509687
3489 3489 c, t dbSNP:182258756
3536 3536 a, g dbSNP:563815973
3546 3546 a, g dbSNP:374704929
3565 3565 g, t dbSNP:773962728
3575 3575 a, g dbSNP:542342250
3602 3602 a, g dbSNP:760097803
3613 3613 c, t dbSNP:573907130
3614 3614 a, g dbSNP:555519876
3632 3632 a, g dbSNP:190787610
3638 3638 a, g dbSNP:374069443
3663 3663 a, c dbSNP:771282350
3681 3681 g, t dbSNP:755664359
3717 3717 a, c, g dbSNP:186173500
3730 3730 c, t dbSNP:780853579
3755 3755 g, t dbSNP:557470398
3764 3764 a, g dbSNP:149171541
3775 3775 c, t dbSNP:568502404
3799 3799 -, a dbSNP:760799851
3801 3801 a, g dbSNP:145149335
3808 3808 g, t dbSNP:780868960
3816 3816 a, c, g dbSNP:990
3823 3823 c, t dbSNP:768112880
3825 3825 c, g dbSNP:902
3829 3829 c, g dbSNP:746505769
3845 3845 c, g dbSNP:568332656
3858 3858 a, g dbSNP:752837120
3879 3879 a, c dbSNP:149986478
3900 3900 a, g dbSNP:140877088
3902 3902 a, g dbSNP:765497918
3929 3929 c, g dbSNP:759611426
3938 3938 c, t dbSNP:528786379
3965 3965 g, t dbSNP:776629862
3982 3982 g, t dbSNP:779777966
3994 3994 c, t dbSNP:564763331
4002 4002 a, c dbSNP:147653232
4016 4016 a, g dbSNP:766463714
4039 4039 a, g dbSNP:1804506
4052 4052 c, t dbSNP:774378714
4057 4057 a, t dbSNP:563648018
4062 4062 -, c dbSNP:34978889
4067 4067 g, t dbSNP:768305985
4069 4069 a, t dbSNP:749158044
4070 4070 a, t dbSNP:368181429
4086 4086 -, c dbSNP:762750274
4086 4086 a, c dbSNP:769504166
4087 4087 a, g dbSNP:76721579
4089 4089 -, aa dbSNP:746377582
4090 4090 -, a, aa, aaa, aaaa dbSNP:768087199
4090 4090 -, a dbSNP:780727991
4091 4091 a, g dbSNP:200216410
4091 4091 -, g dbSNP:779579345
4093 4093 -, aa dbSNP:757633551
4098 4098 -, a dbSNP:17883810
4127 4127 a, c dbSNP:745527810
4131 4131 a, c dbSNP:72714407
4136 4136 a, g dbSNP:28394336
4143 4143 g, t dbSNP:530180883
4154 4154 c, t dbSNP:778737112
4184 4184 c, t dbSNP:184187810
4188 4188 a, g dbSNP:28698523
4192 4192 a, t dbSNP:111695686
4221 4221 c, t dbSNP:778390099
4250 4250 c, t dbSNP:540375214
4258 4258 a, g dbSNP:758672781
4270 4270 c, t dbSNP:753168518
4278 4278 c, t dbSNP:573063340
4300 4300 a, g dbSNP:765594185
4307 4307 c, g dbSNP:755139754
4312 4312 g, t dbSNP:558071969
4314 4314 a, g dbSNP:766408784
4330 4330 a, g dbSNP:760851199
4342 4342 a, g dbSNP:75861863
4353 4353 a, g dbSNP:191543210
4369 4369 a, c dbSNP:556505387
4386 4386 c, t dbSNP:762651450
4394 4394 a, t dbSNP:775366817
4419 4419 c, t dbSNP:375232472
4424 4424 a, g, t dbSNP:370676839
4449 4449 -, t dbSNP:778095946
4449 4449 -, t dbSNP:756338808
4452 4452 a, g dbSNP:759221609
4457 4457 a, g dbSNP:756382683
4458 4458 a, g dbSNP:368850678
4490 4490 a, c dbSNP:139697752
4509 4509 a, g dbSNP:770321440
4519 4519 g, t dbSNP:746584073
4557 4557 c, t dbSNP:74923072
4569 4569 c, g dbSNP:778134022
4582 4582 g, t dbSNP:752764596
4584 4584 a, t dbSNP:75692888
4586 4586 a, t dbSNP:74896573
4594 4594 -, t dbSNP:201044103
4594 4594 -, t dbSNP:752904515
4635 4635 c, t dbSNP:553301669
4669 4669 c, t dbSNP:376306385
4720 4720 g, t dbSNP:772559613
4734 4734 c, g dbSNP:111911073
4745 4745 a, c dbSNP:186980840
4746 4746 a, g dbSNP:554390769
4750 4750 a, g dbSNP:552935952
4763 4763 g, t dbSNP:767531327
4820 4820 -, t dbSNP:767630579
4864 4864 c, g dbSNP:779202869
4868 4868 a, g dbSNP:755370800
4900 4900 c, t dbSNP:371215513
4901 4901 a, g dbSNP:538787765
4931 4931 c, t dbSNP:534412268
4982 4982 a, g dbSNP:780305406
5007 5007 a, t dbSNP:756134998
5008 5008 c, t dbSNP:750584816
5017 5017 g, t dbSNP:377444926
5077 5077 a, t dbSNP:373115808
5096 5096 -, agag dbSNP:755707185
5098 5098 -, ag dbSNP:751440711
5101 5101 a, g dbSNP:376113740
5104 5104 a, g dbSNP:181125491
5112 5112 a, c, t dbSNP:759637948
5129 5129 c, t dbSNP:762898642
5135 5135 g, t dbSNP:6669888
5139 5139 -, ga dbSNP:766308427
5162 5162 c, t dbSNP:17571088
5169 5169 c, t dbSNP:763355562
5172 5172 g, t dbSNP:773508844
5192 5192 c, g dbSNP:759450328
5202 5202 a, g dbSNP:545353127
5204 5204 c, t dbSNP:746593487
5205 5205 a, g dbSNP:776406969
5209 5209 a, c dbSNP:147408871
5234 5234 a, t dbSNP:775295275
5239 5239 a, c dbSNP:748205328
5248 5248 a, c dbSNP:745400222
5322 5322 c, t dbSNP:531865952
5328 5328 c, g dbSNP:373652155
5333 5333 c, t dbSNP:188735272
5341 5341 a, c dbSNP:541156474
5342 5342 c, g, t dbSNP:528335137
5351 5351 a, c dbSNP:771508847
5371 5371 a, g dbSNP:778876583
5381 5381 a, g dbSNP:55667079
5395 5395 a, g dbSNP:545708974
5399 5399 c, g dbSNP:779439568
5420 5420 a, g dbSNP:757188919
5422 5422 g, t dbSNP:56404248
5427 5427 a, g dbSNP:185197797
5434 5434 a, g dbSNP:749712255
5440 5440 a, g dbSNP:541386059
5463 5463 c, g dbSNP:34364530
5466 5466 g, t dbSNP:756293851
5471 5471 a, g dbSNP:750631155
5507 5507 -, agatt dbSNP:762695050
5512 5512 a, g dbSNP:781291511
5520 5520 c, t dbSNP:757318985
5525 5525 c, t dbSNP:752658461
5536 5536 c, t dbSNP:79001261
5559 5559 c, t dbSNP:759398951
5595 5595 a, g dbSNP:534401333
5610 5610 a, c dbSNP:755904238
5629 5629 -, a dbSNP:765062293
5629 5629 -, a dbSNP:376911402
5634 5634 c, t dbSNP:752872500
5658 5658 g, t dbSNP:767762057
5686 5686 c, t dbSNP:766096612
5691 5691 a, g dbSNP:746829560
5695 5695 c, t dbSNP:77378509
5717 5717 c, g dbSNP:113200221
5724 5724 c, t dbSNP:116500181
5725 5725 a, g dbSNP:761363032
5727 5727 a, g dbSNP:376434814
5773 5773 c, t dbSNP:113820201
5818 5818 c, g dbSNP:763437847
5829 5829 c, t dbSNP:774838846
5852 5852 a, g dbSNP:570314767
5863 5863 a, g dbSNP:749801851
5868 5868 -, tgac dbSNP:761492490
5873 5873 g, t dbSNP:56247486
5891 5891 a, g dbSNP:770086149
5892 5892 c, t dbSNP:773775119
5941 5941 a, g dbSNP:746070050
5987 5987 c, t dbSNP:373535351
5988 5988 a, g dbSNP:781316968
5989 5989 a, g dbSNP:180780531
5994 5994 a, c dbSNP:757995859
5995 5995 c, t dbSNP:548611386
6010 6010 a, g dbSNP:188411829
6024 6024 a, c dbSNP:565936194
6026 6026 c, t dbSNP:765639657
6053 6053 a, t dbSNP:754901024
6066 6066 a, g dbSNP:762290500
6115 6115 -, tatct dbSNP:776209113
6117 6117 c, t dbSNP:547898508
6135 6135 a, t dbSNP:766162194
6138 6138 c, t dbSNP:532466392
6143 6143 c, t dbSNP:564328488
6144 6144 a, c dbSNP:551908322
6145 6145 a, g dbSNP:74103025

Target ORF information:

RefSeq Version XM_006710868
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu60981D
Sequence Information ORF Nucleotide Sequence (Length: 1890bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product transforming growth factor beta receptor type 3 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1149..1961(+)
Position Chain Variation Link
1 1 c, t dbSNP:529014907
22 22 g, t dbSNP:561563189
27 27 a, g dbSNP:540111387
30 30 c, t dbSNP:548633857
42 42 a, c dbSNP:762822366
54 54 a, g dbSNP:775208341
58 58 a, c dbSNP:769484825
107 107 a, c dbSNP:202175419
110 110 c, t dbSNP:780911799
111 111 c, t dbSNP:770378014
113 113 c, g, t dbSNP:778219483
116 116 a, g dbSNP:758951153
132 132 a, g dbSNP:750438019
141 141 c, t dbSNP:146325720
147 147 a, t dbSNP:550319582
148 148 c, g dbSNP:779209674
149 149 c, t dbSNP:755370456
155 155 c, t dbSNP:17881905
162 162 c, t dbSNP:753945219
170 170 g, t dbSNP:529153697
174 174 g, t dbSNP:759218481
181 181 g, t dbSNP:776459001
193 193 a, g dbSNP:375529061
199 199 c, t dbSNP:760383880
206 206 a, g, t dbSNP:150238777
208 208 a, t dbSNP:372344244
210 210 c, g, t dbSNP:61748116
212 212 c, t dbSNP:201647804
215 215 c, t dbSNP:749607019
225 225 a, g dbSNP:780636660
228 228 a, g dbSNP:770287785
233 233 a, g dbSNP:368616204
235 235 a, g dbSNP:781589341
239 239 a, g dbSNP:17883665
243 243 c, t dbSNP:376114836
250 250 a, g dbSNP:41286789
252 252 a, g dbSNP:755000509
258 258 c, g dbSNP:753625720
263 263 c, t dbSNP:766091481
264 264 -, ct dbSNP:771711000
269 269 a, c, g dbSNP:750026425
274 274 g, t dbSNP:17885124
280 280 a, g dbSNP:148843052
284 284 a, g dbSNP:773971555
291 291 a, g dbSNP:190581409
298 298 c, t dbSNP:186259544
305 305 a, g dbSNP:2306888
311 311 c, t dbSNP:376528004
314 314 a, t dbSNP:746268292
324 324 a, g dbSNP:781532156
332 332 c, t dbSNP:771231530
339 339 a, g dbSNP:536473318
350 350 a, g dbSNP:775446469
359 359 a, g dbSNP:745661002
360 360 a, g dbSNP:780978982
361 361 c, t dbSNP:370498680
370 370 c, g dbSNP:757019550
374 374 a, g dbSNP:11466585
383 383 a, g dbSNP:763685958
384 384 a, g dbSNP:559817863
399 399 -, tc dbSNP:745682445
404 404 c, t dbSNP:141981218
405 405 a, g dbSNP:765823600
406 406 a, g dbSNP:760186755
417 417 a, g dbSNP:756599009
419 419 a, g dbSNP:541129908
430 430 a, c dbSNP:766704525
436 436 c, g dbSNP:377574327
440 440 a, c dbSNP:760965001
457 457 c, t dbSNP:150076618
459 459 a, c dbSNP:368820380
467 467 a, c, t dbSNP:17879403
489 489 a, g dbSNP:373402175
491 491 c, t dbSNP:191275535
492 492 a, g dbSNP:373881895
504 504 c, t dbSNP:188060482
512 512 g, t dbSNP:781013705
535 535 c, t dbSNP:761959767
540 540 a, g dbSNP:774573661
544 544 a, c dbSNP:768677082
551 551 a, t dbSNP:369086061
552 552 a, g dbSNP:760195053
560 560 g, t dbSNP:375200304
567 567 c, g dbSNP:746804625
570 570 a, g dbSNP:777776328
574 574 c, t dbSNP:561024989
582 582 a, g dbSNP:747745660
591 591 c, t dbSNP:147108633
594 594 a, c dbSNP:754494166
595 595 c, t dbSNP:753325521
596 596 c, t dbSNP:780586588
602 602 c, t dbSNP:183798036
614 614 a, g dbSNP:756649418
616 616 a, c dbSNP:750948208
617 617 a, g dbSNP:767815459
625 625 a, c, g dbSNP:751741728
630 630 g, t dbSNP:764341440
632 632 a, g dbSNP:763068114
635 635 c, g dbSNP:775493031
647 647 c, t dbSNP:770894357
649 649 a, t dbSNP:760461110
670 670 c, t dbSNP:146918650
672 672 a, g, t dbSNP:140100898
675 675 c, t dbSNP:773240069
682 682 a, g dbSNP:767599240
721 721 c, t dbSNP:149079126
722 722 a, g dbSNP:774342612
725 725 a, c dbSNP:768505076
732 732 a, g dbSNP:144104234
736 736 a, g dbSNP:534911985
741 741 a, g dbSNP:775234466
742 742 a, g dbSNP:769150204
743 743 c, g, t dbSNP:369559704
748 748 c, t dbSNP:757821042
753 753 a, t dbSNP:747370952
755 755 c, t dbSNP:576982336
758 758 a, t dbSNP:758802793
762 762 a, t dbSNP:752812457
765 765 c, t dbSNP:765527206
773 773 a, g dbSNP:755073660
785 785 a, c dbSNP:754016022
793 793 a, g dbSNP:200531720
796 796 a, g dbSNP:558826985
809 809 a, c dbSNP:371359360
829 829 c, t dbSNP:774446526
830 830 g, t dbSNP:200330964
837 837 a, t dbSNP:11466592
846 846 c, t dbSNP:41305630
847 847 a, g dbSNP:202193233
848 848 g, t dbSNP:745369413
851 851 g, t dbSNP:776192202
858 858 a, g dbSNP:566197748
859 859 a, g dbSNP:747455652
864 864 a, g dbSNP:751095060
867 867 c, g dbSNP:752598480
868 868 a, c dbSNP:764796295
869 869 c, g dbSNP:549548203
882 882 a, g dbSNP:759124773
886 886 c, t dbSNP:776276219
897 897 c, t dbSNP:770375974
900 900 c, t dbSNP:760206017
901 901 c, t dbSNP:773557800
909 909 c, t dbSNP:772684078
910 910 a, g dbSNP:748447003
914 914 c, t dbSNP:11466595
915 915 c, t dbSNP:769144659
921 921 g, t dbSNP:749474592
925 925 c, t dbSNP:752436447
946 946 a, g dbSNP:780456773
949 949 a, t dbSNP:371268765
950 950 c, t dbSNP:543461938
952 952 c, t dbSNP:755269794
953 953 a, g dbSNP:368105520
958 958 g, t dbSNP:752583624
960 960 a, c, g, t dbSNP:753445562
961 961 a, g, t dbSNP:373979895
962 962 g, t dbSNP:772835583
964 964 a, g dbSNP:772452575
965 965 a, g dbSNP:762313181
971 971 a, c dbSNP:774744521
972 972 a, g dbSNP:769103679
976 976 a, g dbSNP:749710802
992 992 a, g dbSNP:1805112
1001 1001 c, g dbSNP:200104902
1002 1002 c, g, t dbSNP:781269907
1016 1016 g, t dbSNP:757299733
1017 1017 a, g dbSNP:752629058
1018 1018 a, g dbSNP:145694501
1022 1022 c, g dbSNP:754734057
1027 1027 a, g dbSNP:572813555
1028 1028 c, t dbSNP:368258508
1043 1043 c, t dbSNP:753678001
1053 1053 c, t dbSNP:766001542
1054 1054 a, g dbSNP:201034517
1060 1060 a, c dbSNP:750047242
1061 1061 a, g dbSNP:375543343
1066 1066 c, t dbSNP:761261903
1088 1088 g, t dbSNP:774969767
1090 1090 c, t dbSNP:118059179
1101 1101 a, g dbSNP:763397177
1113 1113 c, g dbSNP:149771979
1116 1116 a, g dbSNP:770291536
1118 1118 g, t dbSNP:746047801
1127 1127 c, g, t dbSNP:2229500
1128 1128 a, g dbSNP:139306280
1139 1139 c, t dbSNP:778795967
1142 1142 a, g dbSNP:754966297
1150 1150 a, g, t dbSNP:146915187
1157 1157 a, c dbSNP:779756769
1162 1162 a, g dbSNP:188034157
1172 1172 c, t dbSNP:750054560
1211 1211 a, c, t dbSNP:756927421
1213 1213 c, t dbSNP:542785122
1214 1214 a, g dbSNP:777364038
1218 1218 a, g, t dbSNP:753218529
1222 1222 a, g dbSNP:756480739
1223 1223 c, t dbSNP:369943428
1224 1224 a, g dbSNP:375360299
1226 1226 c, t dbSNP:766616318
1243 1243 a, c dbSNP:760819218
1247 1247 c, t dbSNP:773434398
1254 1254 a, c dbSNP:772088791
1255 1255 a, g dbSNP:138396794
1257 1257 a, g dbSNP:775478266
1265 1265 c, t dbSNP:769678052
1269 1269 c, t dbSNP:745672291
1274 1274 a, t dbSNP:780786832
1278 1278 c, t dbSNP:770867935
1284 1284 a, t dbSNP:768020296
1292 1292 a, g dbSNP:777602667
1294 1294 a, g dbSNP:201897960
1295 1295 c, t dbSNP:536057012
1301 1301 c, t dbSNP:773132708
1302 1302 a, c, g dbSNP:754374295
1308 1308 c, t dbSNP:766593780
1309 1309 g, t dbSNP:761048180
1311 1311 c, t dbSNP:761669111
1314 1314 c, t dbSNP:750602752
1315 1315 a, g dbSNP:373312953
1319 1319 a, c, g dbSNP:774361383
1342 1342 a, g dbSNP:769783512
1352 1352 c, t dbSNP:183096494
1355 1355 c, t dbSNP:766465020
1369 1369 a, c dbSNP:760530231
1376 1376 c, t dbSNP:773203555
1383 1383 a, g dbSNP:771994220
1385 1385 g, t dbSNP:199525985
1396 1396 c, t dbSNP:140758164
1399 1399 a, g dbSNP:570468337
1402 1402 g, t dbSNP:748868835
1406 1406 c, t dbSNP:61748119
1424 1424 g, t dbSNP:756683171
1437 1437 a, c, g dbSNP:150461884
1438 1438 c, t dbSNP:757667211
1439 1439 a, g dbSNP:368651115
1446 1446 a, g dbSNP:764420048
1466 1466 c, t dbSNP:758389011
1468 1468 c, t dbSNP:752876418
1473 1473 a, c dbSNP:766413439
1476 1476 a, c, t dbSNP:773291941
1479 1479 c, t dbSNP:767370504
1487 1487 c, t dbSNP:761698806
1488 1488 a, g dbSNP:201405416
1494 1494 g, t dbSNP:751439439
1523 1523 a, c dbSNP:111842248
1529 1529 c, t dbSNP:369529047
1533 1533 c, t dbSNP:762609649
1545 1545 c, t dbSNP:775146340
1548 1548 c, t dbSNP:769257484
1550 1550 c, t dbSNP:376531068
1551 1551 a, g dbSNP:777102917
1556 1556 c, t dbSNP:17884575
1565 1565 c, t dbSNP:747327054
1569 1569 a, g dbSNP:778130466
1578 1578 g, t dbSNP:772332689
1579 1579 a, g dbSNP:748328802
1583 1583 a, c dbSNP:575273869
1591 1591 a, t dbSNP:556991834
1594 1594 g, t dbSNP:773262690
1613 1613 c, t dbSNP:114901303
1614 1614 a, g dbSNP:757151934
1616 1616 c, t dbSNP:751468237
1620 1620 c, t dbSNP:763902185
1635 1635 g, t dbSNP:762770869
1652 1652 a, g dbSNP:752318641
1655 1655 a, g dbSNP:2228362
1659 1659 a, g dbSNP:780124678
1664 1664 c, t dbSNP:779983549
1671 1671 a, g dbSNP:756171899
1680 1680 a, c dbSNP:746926980
1682 1682 a, g dbSNP:777614030
1689 1689 a, g dbSNP:17882578
1691 1691 c, t dbSNP:758170516
1698 1698 a, g dbSNP:752549942
1699 1699 c, t dbSNP:148711567
1700 1700 a, g dbSNP:572029245
1709 1709 c, t dbSNP:753441965
1715 1715 a, c, g dbSNP:760131822
1720 1720 c, t dbSNP:773736382
1721 1721 a, c, g dbSNP:762255439
1723 1723 a, g dbSNP:774922685
1725 1725 a, c, g dbSNP:749474625
1732 1732 a, g dbSNP:775607589
1749 1749 a, g dbSNP:553748759
1794 1794 a, c dbSNP:769890281
1795 1795 g, t dbSNP:745986180
1798 1798 a, c dbSNP:777757403
1799 1799 c, t dbSNP:376827122
1800 1800 a, g dbSNP:748078614
1804 1804 c, g dbSNP:778617818
1806 1806 a, g dbSNP:139927115
1811 1811 a, c dbSNP:754787479
1813 1813 c, t dbSNP:147485470
1814 1814 c, t dbSNP:1805113
1822 1822 c, t dbSNP:755626465
1823 1823 a, g, t dbSNP:148167041
1828 1828 c, t dbSNP:762353605
1831 1831 a, g dbSNP:752135289
1835 1835 a, g dbSNP:556122074
1841 1841 a, g dbSNP:142025249
1844 1844 a, g dbSNP:775762460
1845 1845 c, t dbSNP:769971153
1871 1871 c, g dbSNP:759661348
1886 1886 a, g dbSNP:776511661
1887 1887 c, g dbSNP:537982098
1892 1892 -, t dbSNP:772081624
1908 1908 a, g dbSNP:748025391
1909 1909 c, t dbSNP:778850853
1910 1910 a, g dbSNP:199724223
1913 1913 a, g dbSNP:749083874
1918 1918 c, g, t dbSNP:760566089
1919 1919 a, g dbSNP:755788608
1923 1923 a, g, t dbSNP:780800633
1924 1924 c, t dbSNP:756861353
1925 1925 a, g dbSNP:752082377
1933 1933 a, g dbSNP:764750656
1935 1935 a, c dbSNP:763365526
1936 1936 a, c dbSNP:753074067
1944 1944 c, t dbSNP:541821566
1946 1946 c, g dbSNP:137915935
1967 1967 a, c, t dbSNP:376382556
1977 1977 a, c, g dbSNP:755397132
1981 1981 c, t dbSNP:754026466
1982 1982 a, g, t dbSNP:535647246
1988 1988 c, t dbSNP:143550507
1989 1989 a, g dbSNP:150162893
1993 1993 c, t dbSNP:767638550
1994 1994 a, g dbSNP:762741046
2000 2000 c, g dbSNP:775529350
2001 2001 a, t dbSNP:377239958
2002 2002 g, t dbSNP:769446254
2003 2003 a, g dbSNP:745709350
2007 2007 a, g dbSNP:367749656
2026 2026 c, t dbSNP:373781090
2027 2027 a, g dbSNP:151016095
2030 2030 c, t dbSNP:777093311
2033 2033 c, t dbSNP:284878
2035 2035 a, c, g dbSNP:779512084
2056 2056 a, g dbSNP:755273380
2079 2079 c, g dbSNP:17882828
2088 2088 a, g dbSNP:746615814
2113 2113 a, c dbSNP:772944696
2115 2115 c, t dbSNP:2228363
2120 2120 a, t dbSNP:749746695
2122 2122 g, t dbSNP:780579095
2125 2125 a, g, t dbSNP:539857176
2132 2132 a, g dbSNP:142345668
2135 2135 c, t dbSNP:781267646
2144 2144 c, t dbSNP:373480626
2145 2145 a, g dbSNP:141883791
2148 2148 a, t dbSNP:777954361
2149 2149 c, t dbSNP:758585914
2152 2152 g, t dbSNP:753791977
2154 2154 a, t dbSNP:137909765
2159 2159 a, g dbSNP:760530133
2174 2174 a, g dbSNP:750297587
2177 2177 a, c, t dbSNP:761469766
2191 2191 c, t dbSNP:751027246
2192 2192 a, g dbSNP:768114361
2196 2196 g, t dbSNP:762499783
2201 2201 g, t dbSNP:775964197
2204 2204 c, g dbSNP:770353695
2212 2212 a, g dbSNP:746368140
2217 2217 c, t dbSNP:781565336
2226 2226 g, t dbSNP:751202263
2228 2228 a, g dbSNP:368530249
2232 2232 g, t dbSNP:763795251
2233 2233 c, t dbSNP:762446878
2243 2243 a, g dbSNP:774915438
2247 2247 a, c, g dbSNP:760042952
2253 2253 a, c dbSNP:777039782
2254 2254 c, t dbSNP:771300709
2256 2256 c, t dbSNP:747378008
2260 2260 c, t dbSNP:138603096
2261 2261 a, g dbSNP:143117141
2270 2270 a, g dbSNP:34064838
2276 2276 c, t dbSNP:779079477
2294 2294 c, t dbSNP:755036359
2295 2295 a, t dbSNP:566457282
2300 2300 c, t dbSNP:781031870
2305 2305 c, t dbSNP:193920827
2306 2306 a, g, t dbSNP:17878885
2308 2308 a, g dbSNP:757986605
2314 2314 c, t dbSNP:188809339
2326 2326 a, g dbSNP:764760703
2335 2335 c, t dbSNP:147885293
2351 2351 a, g dbSNP:202191737
2357 2357 -, acccggcccaacccagccca dbSNP:780383881
2357 2357 a, g dbSNP:375168931
2359 2359 c, g dbSNP:371085991
2360 2360 a, c, t dbSNP:542197544
2361 2361 -, ggcccaaccc dbSNP:769235100
2361 2361 a, g dbSNP:1131243
2362 2362 a, g dbSNP:562004206
2363 2363 c, t dbSNP:774746910
2367 2367 -, acccagccca dbSNP:767580175
2367 2367 a, c dbSNP:768750878
2369 2369 a, c dbSNP:749386034
2376 2376 -, acccggcccaacccagccca dbSNP:758963836
2378 2378 -, ccc dbSNP:750939024
2381 2381 a, g dbSNP:781184201
2382 2382 c, g dbSNP:540918983
2385 2385 a, c dbSNP:746960035
2386 2386 a, g dbSNP:777492809
2392 2392 a, g dbSNP:758217785
2394 2394 -, cagct dbSNP:754058860
2398 2398 a, g dbSNP:752312414
2413 2413 a, t dbSNP:754474478
2414 2414 a, g dbSNP:751156484
2417 2417 g, t dbSNP:576526609
2419 2419 c, t dbSNP:573184725
2423 2423 c, t dbSNP:780119636
2427 2427 a, c, g dbSNP:765920731
2468 2468 a, g dbSNP:564491881
2478 2478 a, t dbSNP:199503452
2489 2489 a, c dbSNP:761208990
2499 2499 a, g dbSNP:1805115
2513 2513 a, g dbSNP:767955261
2525 2525 a, g dbSNP:574788524
2526 2526 a, g dbSNP:575782942
2542 2542 a, g dbSNP:1805116
2550 2550 g, t dbSNP:765016060
2555 2555 a, c dbSNP:534907849
2594 2594 c, t dbSNP:774611037
2597 2597 c, t dbSNP:375927498
2602 2602 a, g dbSNP:182999308
2612 2612 c, g dbSNP:763239975
2627 2627 a, t dbSNP:1050619
2638 2638 -, c dbSNP:565585559
2640 2640 c, t dbSNP:573873791
2644 2644 a, g dbSNP:556859031
2648 2648 a, t dbSNP:769937561
2693 2693 c, g dbSNP:555742735
2743 2743 c, g, t dbSNP:764740196
2752 2752 c, t dbSNP:749899080
2766 2766 a, g dbSNP:761525685
2768 2768 c, t dbSNP:192924147
2774 2774 a, g dbSNP:764253029
2781 2781 a, g dbSNP:778627082
2796 2796 a, t dbSNP:566376747
2799 2799 a, g dbSNP:1805117
2808 2808 a, t dbSNP:539179739
2812 2812 a, c, t dbSNP:138858788
2829 2829 c, t dbSNP:41313401
2830 2830 a, g dbSNP:768188215
2836 2836 c, t dbSNP:762263808
2842 2842 c, t dbSNP:550771540
2845 2845 a, t dbSNP:529485848
2856 2856 c, g dbSNP:751804044
2868 2868 a, t dbSNP:1050620
2884 2884 c, t dbSNP:561926024
2902 2902 a, g dbSNP:772550023
2909 2909 c, t dbSNP:764530840
2912 2912 a, t dbSNP:1050621
2913 2913 a, t dbSNP:1050623
2915 2915 a, g dbSNP:763034502
2919 2919 a, g dbSNP:547012723
2929 2929 c, t dbSNP:775809577
2930 2930 -, a dbSNP:764419888
2938 2938 c, t dbSNP:145038062
2940 2940 c, t dbSNP:564347164
2969 2969 g, t dbSNP:1050624
2992 2992 a, g dbSNP:570933377
3052 3052 a, g dbSNP:773116819
3069 3069 g, t dbSNP:772068416
3071 3071 a, g dbSNP:186509687
3075 3075 c, t dbSNP:182258756
3122 3122 a, g dbSNP:563815973
3132 3132 a, g dbSNP:374704929
3151 3151 g, t dbSNP:773962728
3161 3161 a, g dbSNP:542342250
3188 3188 a, g dbSNP:760097803
3199 3199 c, t dbSNP:573907130
3200 3200 a, g dbSNP:555519876
3218 3218 a, g dbSNP:190787610
3224 3224 a, g dbSNP:374069443
3249 3249 a, c dbSNP:771282350
3267 3267 g, t dbSNP:755664359
3303 3303 a, c, g dbSNP:186173500
3316 3316 c, t dbSNP:780853579
3341 3341 g, t dbSNP:557470398
3350 3350 a, g dbSNP:149171541
3361 3361 c, t dbSNP:568502404
3385 3385 -, a dbSNP:760799851
3387 3387 a, g dbSNP:145149335
3394 3394 g, t dbSNP:780868960
3402 3402 a, c, g dbSNP:990
3409 3409 c, t dbSNP:768112880
3411 3411 c, g dbSNP:902
3415 3415 c, g dbSNP:746505769
3431 3431 c, g dbSNP:568332656
3444 3444 a, g dbSNP:752837120
3465 3465 a, c dbSNP:149986478
3486 3486 a, g dbSNP:140877088
3488 3488 a, g dbSNP:765497918
3515 3515 c, g dbSNP:759611426
3524 3524 c, t dbSNP:528786379
3551 3551 g, t dbSNP:776629862
3568 3568 g, t dbSNP:779777966
3580 3580 c, t dbSNP:564763331
3588 3588 a, c dbSNP:147653232
3602 3602 a, g dbSNP:766463714
3625 3625 a, g dbSNP:1804506
3638 3638 c, t dbSNP:774378714
3643 3643 a, t dbSNP:563648018
3648 3648 -, c dbSNP:34978889
3653 3653 g, t dbSNP:768305985
3655 3655 a, t dbSNP:749158044
3656 3656 a, t dbSNP:368181429
3672 3672 -, c dbSNP:762750274
3672 3672 a, c dbSNP:769504166
3673 3673 a, g dbSNP:76721579
3675 3675 -, aa dbSNP:746377582
3676 3676 -, a, aa, aaa, aaaa dbSNP:768087199
3676 3676 -, a dbSNP:780727991
3677 3677 a, g dbSNP:200216410
3677 3677 -, g dbSNP:779579345
3679 3679 -, aa dbSNP:757633551
3684 3684 -, a dbSNP:17883810
3713 3713 a, c dbSNP:745527810
3717 3717 a, c dbSNP:72714407
3722 3722 a, g dbSNP:28394336
3729 3729 g, t dbSNP:530180883
3740 3740 c, t dbSNP:778737112
3770 3770 c, t dbSNP:184187810
3774 3774 a, g dbSNP:28698523
3778 3778 a, t dbSNP:111695686
3807 3807 c, t dbSNP:778390099
3836 3836 c, t dbSNP:540375214
3844 3844 a, g dbSNP:758672781
3856 3856 c, t dbSNP:753168518
3864 3864 c, t dbSNP:573063340
3886 3886 a, g dbSNP:765594185
3893 3893 c, g dbSNP:755139754
3898 3898 g, t dbSNP:558071969
3900 3900 a, g dbSNP:766408784
3916 3916 a, g dbSNP:760851199
3928 3928 a, g dbSNP:75861863
3939 3939 a, g dbSNP:191543210
3955 3955 a, c dbSNP:556505387
3972 3972 c, t dbSNP:762651450
3980 3980 a, t dbSNP:775366817
4005 4005 c, t dbSNP:375232472
4010 4010 a, g, t dbSNP:370676839
4035 4035 -, t dbSNP:778095946
4035 4035 -, t dbSNP:756338808
4038 4038 a, g dbSNP:759221609
4043 4043 a, g dbSNP:756382683
4044 4044 a, g dbSNP:368850678
4076 4076 a, c dbSNP:139697752
4095 4095 a, g dbSNP:770321440
4105 4105 g, t dbSNP:746584073
4143 4143 c, t dbSNP:74923072
4155 4155 c, g dbSNP:778134022
4168 4168 g, t dbSNP:752764596
4170 4170 a, t dbSNP:75692888
4172 4172 a, t dbSNP:74896573
4180 4180 -, t dbSNP:201044103
4180 4180 -, t dbSNP:752904515
4221 4221 c, t dbSNP:553301669
4255 4255 c, t dbSNP:376306385
4306 4306 g, t dbSNP:772559613
4320 4320 c, g dbSNP:111911073
4331 4331 a, c dbSNP:186980840
4332 4332 a, g dbSNP:554390769
4336 4336 a, g dbSNP:552935952
4349 4349 g, t dbSNP:767531327
4406 4406 -, t dbSNP:767630579
4450 4450 c, g dbSNP:779202869
4454 4454 a, g dbSNP:755370800
4486 4486 c, t dbSNP:371215513
4487 4487 a, g dbSNP:538787765
4517 4517 c, t dbSNP:534412268
4568 4568 a, g dbSNP:780305406
4593 4593 a, t dbSNP:756134998
4594 4594 c, t dbSNP:750584816
4603 4603 g, t dbSNP:377444926
4663 4663 a, t dbSNP:373115808
4682 4682 -, agag dbSNP:755707185
4684 4684 -, ag dbSNP:751440711
4687 4687 a, g dbSNP:376113740
4690 4690 a, g dbSNP:181125491
4698 4698 a, c, t dbSNP:759637948
4715 4715 c, t dbSNP:762898642
4721 4721 g, t dbSNP:6669888
4725 4725 -, ga dbSNP:766308427
4748 4748 c, t dbSNP:17571088
4755 4755 c, t dbSNP:763355562
4758 4758 g, t dbSNP:773508844
4778 4778 c, g dbSNP:759450328
4788 4788 a, g dbSNP:545353127
4790 4790 c, t dbSNP:746593487
4791 4791 a, g dbSNP:776406969
4795 4795 a, c dbSNP:147408871
4820 4820 a, t dbSNP:775295275
4825 4825 a, c dbSNP:748205328
4834 4834 a, c dbSNP:745400222
4908 4908 c, t dbSNP:531865952
4914 4914 c, g dbSNP:373652155
4919 4919 c, t dbSNP:188735272
4927 4927 a, c dbSNP:541156474
4928 4928 c, g, t dbSNP:528335137
4937 4937 a, c dbSNP:771508847
4957 4957 a, g dbSNP:778876583
4967 4967 a, g dbSNP:55667079
4981 4981 a, g dbSNP:545708974
4985 4985 c, g dbSNP:779439568
5006 5006 a, g dbSNP:757188919
5008 5008 g, t dbSNP:56404248
5013 5013 a, g dbSNP:185197797
5020 5020 a, g dbSNP:749712255
5026 5026 a, g dbSNP:541386059
5049 5049 c, g dbSNP:34364530
5052 5052 g, t dbSNP:756293851
5057 5057 a, g dbSNP:750631155
5093 5093 -, agatt dbSNP:762695050
5098 5098 a, g dbSNP:781291511
5106 5106 c, t dbSNP:757318985
5111 5111 c, t dbSNP:752658461
5122 5122 c, t dbSNP:79001261
5145 5145 c, t dbSNP:759398951
5181 5181 a, g dbSNP:534401333
5196 5196 a, c dbSNP:755904238
5215 5215 -, a dbSNP:765062293
5215 5215 -, a dbSNP:376911402
5220 5220 c, t dbSNP:752872500
5244 5244 g, t dbSNP:767762057
5272 5272 c, t dbSNP:766096612
5277 5277 a, g dbSNP:746829560
5281 5281 c, t dbSNP:77378509
5303 5303 c, g dbSNP:113200221
5310 5310 c, t dbSNP:116500181
5311 5311 a, g dbSNP:761363032
5313 5313 a, g dbSNP:376434814
5359 5359 c, t dbSNP:113820201
5404 5404 c, g dbSNP:763437847
5415 5415 c, t dbSNP:774838846
5438 5438 a, g dbSNP:570314767
5449 5449 a, g dbSNP:749801851
5454 5454 -, tgac dbSNP:761492490
5459 5459 g, t dbSNP:56247486
5477 5477 a, g dbSNP:770086149
5478 5478 c, t dbSNP:773775119
5527 5527 a, g dbSNP:746070050
5573 5573 c, t dbSNP:373535351
5574 5574 a, g dbSNP:781316968
5575 5575 a, g dbSNP:180780531
5580 5580 a, c dbSNP:757995859
5581 5581 c, t dbSNP:548611386
5596 5596 a, g dbSNP:188411829
5610 5610 a, c dbSNP:565936194
5612 5612 c, t dbSNP:765639657
5639 5639 a, t dbSNP:754901024
5652 5652 a, g dbSNP:762290500
5701 5701 -, tatct dbSNP:776209113
5703 5703 c, t dbSNP:547898508
5721 5721 a, t dbSNP:766162194
5724 5724 c, t dbSNP:532466392
5729 5729 c, t dbSNP:564328488
5730 5730 a, c dbSNP:551908322
5731 5731 a, g dbSNP:74103025

Target ORF information:

RefSeq Version XM_011542058
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens transforming growth factor, beta receptor III (TGFBR3), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.