
TGM1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol TGM1
Entrez Gene ID 7051
Full Name transglutaminase 1
Synonyms ARCI1, ICR2, KTG, LI, LI1, TGASE, TGK
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Ichthyosis, lamellar, autosomal recessive, 242300 (3); Ichthyosiform

mRNA and Protein(s)

mRNA Protein Name
NM_000359 NP_000350 protein-glutamine gamma-glutamyltransferase K

Homo sapiens (human) TGM1 NP_000350.1
Pan troglodytes (chimpanzee) TGM1 XP_001169496.3
Macaca mulatta (Rhesus monkey) TGM1 XP_001113577.1
Canis lupus familiaris (dog) TGM1 NP_001003079.1
Bos taurus (cattle) TGM1 NP_001010991.1
Mus musculus (house mouse) Tgm1 NP_001155187.1
Rattus norvegicus (Norway rat) Tgm1 NP_113847.1
Danio rerio (zebrafish) LOC100334173 XP_002665624.2
Danio rerio (zebrafish) tgm1l4 NP_001025267.1
Danio rerio (zebrafish) LOC793448 XP_001331914.1
Danio rerio (zebrafish) si:ch1073-138d10.2 XP_005169495.1
Danio rerio (zebrafish) tgm1l1 XP_694950.3
Danio rerio (zebrafish) LOC100535918 XP_003201279.2
Danio rerio (zebrafish) tgm1l2 XP_001332075.5
Drosophila melanogaster (fruit fly) Tg NP_609174.1
Xenopus (Silurana) tropicalis (western clawed frog) tgm1 XP_002939073.1


ID Name Evidence
GO:0001533 cornified envelope TAS
GO:0016020 membrane IEA
GO:0031224 intrinsic to membrane IDA


ID Name Evidence
GO:0003810 protein-glutamine gamma-glutamyltransferase activity IDA
GO:0005515 protein binding IPI
GO:0008415 acyltransferase activity IEA
GO:0016740 transferase activity IEA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0006464 protein modification process NAS
GO:0018149 peptide cross-linking IEA
GO:0030216 keratinocyte differentiation IDA
GO:0031424 keratinization IEA
GO:0043163 cell envelope organization TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following TGM1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the TGM1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

***CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_000359 Homo sapiens transglutaminase 1 (TGM1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $279.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

***One clone ID might be correlated to multiple accession numbers, which share the same CDS sequence.

CloneID OHu23436
Clone ID Related Accession (Same CDS sequence) NM_000359
Accession Version NM_000359.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2454bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein-glutamine gamma-glutamyltransferase K
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA437895.1, BC034699.1 and AL096870.5. This sequence is a reference standard in the RefSeqGene project. On Jul 20, 2006 this sequence version replaced gi:4507474. Summary: The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC034699.1, AK291350.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_000350.1
Misc Feature(1)65..67(+)
Misc Feature(2)125..424(+)
Misc Feature(3)194..196(+)
Misc Feature(4)368..370(+)
Misc Feature(5)377..379(+)
Misc Feature(6)398..400(+)
Misc Feature(7)452..811(+)
Misc Feature(8)1235..1510(+)
Misc Feature(9)1859..2173(+)
Misc Feature(10)2195..2488(+)
Exon (1)1..122
Gene Synonym:
Exon (2)123..443
Gene Synonym:
Exon (3)444..632
Gene Synonym:
Exon (4)633..881
Gene Synonym:
Exon (5)882..1000
Gene Synonym:
Exon (6)1001..1108
Gene Synonym:
Exon (7)1109..1283
Gene Synonym:
Exon (8)1284..1422
Gene Synonym:
Exon (9)1423..1526
Gene Synonym:
Exon (10)1527..1615
Gene Synonym:
Exon (11)1616..1769
Gene Synonym:
Exon (12)1770..2051
Gene Synonym:
Exon (13)2052..2212
Gene Synonym:
Exon (14)2213..2349
Gene Synonym:
Exon (15)2350..2777
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:530609496
4 4 g, t dbSNP:41295328
30 30 c, t dbSNP:144764474
55 55 c, g dbSNP:528113103
83 83 c, t dbSNP:8003142
98 98 c, t dbSNP:2748512
101 101 c, t dbSNP:147260129
123 123 c, g dbSNP:768110639
125 125 a, g dbSNP:760172387
139 139 -, a dbSNP:766014574
140 140 c, t dbSNP:372412279
141 141 a, g dbSNP:368781510
145 145 c, t dbSNP:150913268
146 146 a, c, g dbSNP:376706308
148 148 c, t dbSNP:772683158
150 150 g, t dbSNP:267603965
155 155 c, t dbSNP:747931513
156 156 a, g dbSNP:764819314
157 157 c, t dbSNP:754885672
178 178 a, g dbSNP:41295336
184 184 c, t dbSNP:145812304
185 185 a, g dbSNP:140542428
187 187 c, t dbSNP:767948114
189 189 c, g, t dbSNP:201774398
190 190 a, g dbSNP:756448718
197 197 c, t dbSNP:753092145
202 202 a, g dbSNP:767947212
206 206 c, g dbSNP:760012789
210 210 c, t dbSNP:200873762
214 214 -, gccaga dbSNP:762513810
219 219 -, gccaga dbSNP:772760501
220 220 c, t dbSNP:151333205
221 221 a, g dbSNP:142455594
224 224 c, t dbSNP:149148326
226 226 c, g dbSNP:374708302
230 230 a, c, t dbSNP:145197904
231 231 a, g dbSNP:367872941
232 232 c, g dbSNP:761501783
245 245 c, t dbSNP:776286185
246 246 a, g dbSNP:768398275
249 249 a, c, g dbSNP:41295338
250 250 c, t dbSNP:772100268
260 260 c, t dbSNP:752411526
261 261 a, g dbSNP:777960926
267 267 a, g dbSNP:756287272
268 268 c, t dbSNP:752930335
274 274 c, g dbSNP:781571049
283 283 a, c dbSNP:201432046
284 284 c, t dbSNP:140000324
285 285 a, g, t dbSNP:536915231
291 291 a, c, t dbSNP:147479810
292 292 a, g dbSNP:79251149
296 296 g, t dbSNP:139569235
301 301 c, t dbSNP:8193031
302 302 a, g dbSNP:768306663
304 304 a, c dbSNP:760445319
312 312 a, c dbSNP:775398833
319 319 c, g dbSNP:771885092
326 326 -, c dbSNP:34491912
326 326 a, g, t dbSNP:778749307
329 329 a, g dbSNP:769930720
332 332 a, g dbSNP:150599652
333 333 a, g dbSNP:781552476
336 336 a, g dbSNP:374035643
340 340 a, g dbSNP:771277378
343 343 c, t dbSNP:780515334
344 344 a, c dbSNP:565811853
345 345 g, t dbSNP:750901013
346 346 c, t dbSNP:200023674
347 347 g, t dbSNP:761252462
348 348 c, g dbSNP:753400612
350 350 a, g dbSNP:372349270
356 356 c, t dbSNP:760429286
357 357 -, g dbSNP:765131653
357 357 a, g dbSNP:775030916
363 363 c, g dbSNP:767307328
369 369 c, t dbSNP:141792428
371 371 c, t dbSNP:774288859
372 372 a, g dbSNP:771051927
375 375 g, t dbSNP:748234923
376 376 c, t dbSNP:148048398
386 386 c, t dbSNP:768743174
389 389 c, t dbSNP:146189995
390 390 a, g dbSNP:141492969
391 391 a, g dbSNP:758721094
394 394 a, t dbSNP:201400055
395 395 c, g dbSNP:779376697
401 401 c, t dbSNP:757823355
402 402 a, g dbSNP:753328770
405 405 a, g dbSNP:121918729
409 409 c, t dbSNP:2228336
410 410 a, g dbSNP:547714904
417 417 a, g dbSNP:575342998
418 418 c, t dbSNP:767091325
421 421 a, g dbSNP:41295340
429 429 a, g, t dbSNP:398122901
439 439 c, g, t dbSNP:763033733
440 440 c, t dbSNP:773303931
441 441 a, g dbSNP:369941973
443 443 a, g dbSNP:376728988
447 447 a, g dbSNP:780616986
449 449 a, g dbSNP:781313993
452 452 c, g dbSNP:754537753
455 455 a, g dbSNP:751217406
459 459 c, t dbSNP:779855523
463 463 c, t dbSNP:144651432
464 464 a, g dbSNP:750299116
465 465 a, g dbSNP:765214286
470 470 a, g dbSNP:148993226
481 481 c, t dbSNP:752796535
483 483 c, t dbSNP:138885883
484 484 a, g dbSNP:41295444
485 485 c, t dbSNP:80145541
486 486 a, g, t dbSNP:763303938
489 489 c, t dbSNP:141486741
490 490 a, g dbSNP:17102410
493 493 c, t dbSNP:748555249
500 500 c, t dbSNP:397514524
501 501 a, g dbSNP:200491579
504 504 a, g dbSNP:371944908
507 507 a, g dbSNP:138592626
517 517 a, g dbSNP:746939150
518 518 a, g dbSNP:2229462
519 519 a, g dbSNP:780000520
520 520 -, cga dbSNP:768506846
520 520 c, t dbSNP:376590179
521 521 a, c, g dbSNP:141524659
525 525 a, g dbSNP:147916609
532 532 a, c, t dbSNP:142338588
533 533 a, g dbSNP:149089854
535 535 c, t dbSNP:145002586
536 536 a, g dbSNP:765478385
542 542 a, g dbSNP:149923908
544 544 a, g dbSNP:139208806
546 546 g, t dbSNP:769342810
548 548 c, t dbSNP:121918716
549 549 a, g dbSNP:121918718
551 551 c, t dbSNP:531650682
552 552 a, g dbSNP:121918719
553 553 c, t dbSNP:144989372
554 554 a, g dbSNP:778635368
556 556 a, g dbSNP:141559048
561 561 c, g dbSNP:749167940
578 578 c, g, t dbSNP:532525772
580 580 -, cct dbSNP:746008257
581 581 c, t dbSNP:751619088
587 587 c, t dbSNP:187901859
588 588 a, g dbSNP:374574340
594 594 a, g dbSNP:750543171
596 596 c, g dbSNP:765510569
600 600 c, t dbSNP:762069170
601 601 a, c, t dbSNP:764662851
603 603 c, g dbSNP:121918728
608 608 c, g, t dbSNP:199894209
609 609 a, g dbSNP:771665132
616 616 a, c dbSNP:541307680
628 628 c, t dbSNP:773864507
631 631 c, t dbSNP:770687478
640 640 c, t dbSNP:769512970
641 641 c, t dbSNP:553309439
643 643 c, t dbSNP:139811103
644 644 a, g dbSNP:768705863
649 649 a, g dbSNP:200092961
650 650 a, g dbSNP:374723129
660 660 c, t dbSNP:779095091
661 661 a, g dbSNP:757301708
664 664 c, t dbSNP:145981439
665 665 a, g dbSNP:778143033
674 674 c, t dbSNP:200517023
679 679 a, g dbSNP:753181868
686 686 a, c, g dbSNP:760139170
688 688 a, g dbSNP:752029585
698 698 a, g dbSNP:765874994
699 699 c, g dbSNP:762375778
703 703 a, c, g dbSNP:199678720
709 709 c, t dbSNP:761591850
711 711 a, g dbSNP:538074682
712 712 a, g dbSNP:768452927
728 728 a, g dbSNP:141685762
730 730 a, g dbSNP:775319268
731 731 c, t dbSNP:201167101
734 734 a, g dbSNP:770973858
736 736 a, t dbSNP:552396029
746 746 c, t dbSNP:778139253
747 747 a, g dbSNP:369636498
748 748 a, g dbSNP:748504712
751 751 c, t dbSNP:781571622
755 755 a, g dbSNP:566962779
756 756 c, t dbSNP:200894024
760 760 c, t dbSNP:377705451
761 761 c, t dbSNP:530095586
762 762 c, g dbSNP:757888791
764 764 a, g dbSNP:749999915
765 765 a, g dbSNP:147994543
766 766 c, t dbSNP:761501855
767 767 a, g dbSNP:772025093
775 775 c, t dbSNP:763906036
776 776 a, g dbSNP:121918732
777 777 a, g dbSNP:775437367
784 784 c, t dbSNP:201493499
793 793 a, c dbSNP:749350038
797 797 c, t dbSNP:773479626
798 798 a, g dbSNP:549195122
799 799 c, t dbSNP:748341131
805 805 a, g dbSNP:368775721
808 808 a, g dbSNP:369162984
811 811 c, t dbSNP:143352384
812 812 a, g, t dbSNP:531428094
819 819 a, g dbSNP:758944662
820 820 a, g dbSNP:149605227
830 830 c, t dbSNP:371837832
832 832 c, t dbSNP:756786967
839 839 c, t dbSNP:753460914
842 842 c, t dbSNP:763663668
843 843 a, g dbSNP:138574046
846 846 a, g dbSNP:775191936
848 848 a, g dbSNP:201572824
850 850 a, g dbSNP:35755034
856 856 c, t dbSNP:759501423
857 857 a, g dbSNP:199820979
859 859 a, c dbSNP:769928814
869 869 a, c dbSNP:762000108
872 872 g, t dbSNP:318240748
889 889 c, t dbSNP:372360509
895 895 c, t dbSNP:141590446
896 896 a, g dbSNP:771471341
897 897 g, t dbSNP:748811947
904 904 a, g dbSNP:550881040
907 907 a, g dbSNP:777103051
910 910 c, t dbSNP:755685678
912 912 a, g dbSNP:367699137
914 914 c, t dbSNP:201868387
915 915 a, g dbSNP:781006633
916 916 g, t dbSNP:532184407
919 919 c, g dbSNP:754808781
922 922 a, g dbSNP:751468985
923 923 c, t dbSNP:750815702
924 924 a, g, t dbSNP:762845943
925 925 c, t dbSNP:750395926
928 928 c, t dbSNP:200870283
937 937 -, gtctgggaga dbSNP:778038848
938 938 c, t dbSNP:764040146
950 950 a, t dbSNP:397514523
955 955 c, t dbSNP:559847457
956 956 a, g dbSNP:121918725
958 958 a, g dbSNP:767782456
961 961 c, t dbSNP:370435399
962 962 a, c, g dbSNP:150181059
977 977 a, g dbSNP:749721551
980 980 c, t dbSNP:773777400
981 981 a, g dbSNP:121918727
990 990 a, c, g dbSNP:121918730
994 994 c, t dbSNP:539904518
996 996 a, g dbSNP:780990272
1009 1009 c, t dbSNP:186352813
1010 1010 a, g, t dbSNP:779761866
1011 1011 a, g dbSNP:758067421
1015 1015 a, g dbSNP:768880844
1023 1023 c, t dbSNP:778708394
1032 1032 a, g dbSNP:757256224
1034 1034 a, t dbSNP:753798494
1042 1042 c, t dbSNP:767547778
1043 1043 c, g, t dbSNP:121918731
1044 1044 a, g dbSNP:146770534
1047 1047 a, g dbSNP:201328637
1067 1067 c, t dbSNP:397514525
1068 1068 a, g, t dbSNP:143473912
1074 1074 a, g dbSNP:762359834
1077 1077 -, c dbSNP:755366540
1082 1082 a, g dbSNP:777308173
1083 1083 a, g dbSNP:768214832
1087 1087 c, t dbSNP:760270638
1089 1089 c, g dbSNP:774987995
1091 1091 c, t dbSNP:771820315
1092 1092 a, g dbSNP:121918717
1096 1096 a, c, t dbSNP:373557209
1101 1101 -, ct dbSNP:786205485
1121 1121 a, g dbSNP:759190792
1157 1157 a, g dbSNP:565588144
1165 1165 c, g dbSNP:545348591
1167 1167 a, g dbSNP:201379408
1169 1169 a, g dbSNP:777683020
1177 1177 a, c dbSNP:769764727
1183 1183 a, t dbSNP:747038767
1186 1186 a, c, g dbSNP:758437844
1193 1193 a, g dbSNP:750591055
1198 1198 c, g dbSNP:779287673
1199 1199 a, g dbSNP:202037016
1205 1205 a, g dbSNP:757682828
1216 1216 c, g, t dbSNP:764663238
1218 1218 a, g dbSNP:756732717
1223 1223 c, t dbSNP:753178188
1224 1224 a, g dbSNP:139949065
1227 1227 c, t dbSNP:199786703
1232 1232 c, t dbSNP:774039917
1236 1236 c, t dbSNP:766091239
1237 1237 c, t dbSNP:61747601
1238 1238 a, g dbSNP:41293794
1240 1240 a, c dbSNP:2855005
1252 1252 a, g dbSNP:769601827
1259 1259 a, c, g dbSNP:121918720
1261 1261 c, g dbSNP:767043223
1262 1262 c, t dbSNP:529243676
1267 1267 g, t dbSNP:149449576
1270 1270 a, c, t dbSNP:1126432
1271 1271 a, g dbSNP:121918722
1279 1279 a, c dbSNP:571513690
1289 1289 c, t dbSNP:757905282
1290 1290 a, c, g dbSNP:121918723
1299 1299 a, g dbSNP:121918726
1303 1303 a, g dbSNP:761659999
1308 1308 c, t dbSNP:372498705
1310 1310 c, t dbSNP:543521135
1311 1311 a, g, t dbSNP:121918721
1323 1323 a, g dbSNP:771078653
1329 1329 a, g dbSNP:763185124
1337 1337 c, g dbSNP:773565490
1339 1339 c, t dbSNP:769950645
1340 1340 a, g dbSNP:200050519
1342 1342 c, g dbSNP:781366138
1347 1347 -, acaca dbSNP:398122905
1351 1351 a, t dbSNP:769098662
1353 1353 a, c dbSNP:747452503
1367 1367 a, g dbSNP:780550366
1370 1370 c, t dbSNP:757886765
1375 1375 c, g, t dbSNP:778596476
1376 1376 a, g dbSNP:756907283
1378 1378 c, t dbSNP:150739753
1379 1379 a, g dbSNP:374898509
1381 1381 a, g dbSNP:760562528
1385 1385 a, c dbSNP:752670603
1388 1388 a, t dbSNP:563305936
1391 1391 a, c, t dbSNP:763095024
1393 1393 c, t dbSNP:572832245
1396 1396 a, g dbSNP:552834286
1402 1402 a, c dbSNP:761903751
1427 1427 -, ttcca dbSNP:398122900
1427 1427 g, t dbSNP:754922174
1432 1432 c, t dbSNP:751551536
1441 1441 c, t dbSNP:141972252
1442 1442 a, g dbSNP:761968652
1455 1455 -, a dbSNP:398122903
1462 1462 a, g dbSNP:776701915
1468 1468 a, c, g dbSNP:2855105
1473 1473 c, t dbSNP:760993072
1474 1474 a, c, g dbSNP:571310594
1483 1483 c, t dbSNP:746332814
1498 1498 a, g dbSNP:199623333
1514 1514 a, g dbSNP:774925814
1518 1518 c, t dbSNP:770335603
1525 1525 -, t dbSNP:766035647
1527 1527 a, g dbSNP:147078520
1530 1530 c, t dbSNP:767801047
1540 1540 c, t dbSNP:759957199
1542 1542 -, g dbSNP:758030729
1542 1542 g, t dbSNP:535121937
1546 1546 c, t dbSNP:774717848
1549 1549 c, t dbSNP:369128286
1558 1558 a, g dbSNP:748725054
1561 1561 c, t dbSNP:772800253
1562 1562 a, t dbSNP:377119683
1568 1568 a, g dbSNP:747739923
1573 1573 c, g dbSNP:2748528
1576 1576 c, g, t dbSNP:2855109
1591 1591 c, t dbSNP:768561754
1593 1593 a, g dbSNP:121918724
1597 1597 a, g dbSNP:187372624
1642 1642 a, g dbSNP:143320733
1643 1643 c, t dbSNP:200829531
1645 1645 c, g dbSNP:2855110
1648 1648 a, c, g dbSNP:2748529
1652 1652 a, g dbSNP:7147300
1653 1653 a, g dbSNP:139320583
1672 1672 c, t dbSNP:201388438
1674 1674 a, c dbSNP:755178560
1676 1676 a, g dbSNP:35312232
1683 1683 a, g dbSNP:142404759
1687 1687 a, g dbSNP:763244527
1693 1693 c, t dbSNP:750955048
1694 1694 a, g dbSNP:765914927
1710 1710 c, t dbSNP:761372792
1714 1714 a, g dbSNP:776328019
1728 1728 a, g dbSNP:763531422
1734 1734 a, g dbSNP:761557071
1741 1741 c, t dbSNP:575958464
1745 1745 a, c dbSNP:587779765
1746 1746 c, g dbSNP:751876711
1760 1760 c, t dbSNP:771840484
1762 1762 a, c dbSNP:556165359
1772 1772 c, t dbSNP:747128345
1775 1775 a, c, g dbSNP:758739021
1776 1776 a, t dbSNP:746110699
1777 1777 c, g, t dbSNP:2855111
1778 1778 a, g dbSNP:757697165
1783 1783 a, g dbSNP:754311329
1784 1784 c, t dbSNP:764567765
1785 1785 a, g, t dbSNP:372839534
1789 1789 a, g dbSNP:767076645
1796 1796 a, g dbSNP:759151284
1807 1807 a, t dbSNP:760229890
1811 1811 c, t dbSNP:751219893
1813 1813 c, t dbSNP:538295056
1814 1814 a, g dbSNP:762797327
1818 1818 a, g dbSNP:773200488
1823 1823 a, c dbSNP:769663593
1827 1827 a, g dbSNP:150428149
1828 1828 c, g, t dbSNP:772307070
1838 1838 a, c dbSNP:746018070
1839 1839 a, c dbSNP:779289911
1841 1841 c, t dbSNP:771407569
1851 1851 c, t dbSNP:140363039
1852 1852 a, g dbSNP:369097812
1855 1855 c, g dbSNP:756529645
1859 1859 a, g dbSNP:528553550
1862 1862 g, t dbSNP:753278878
1864 1864 c, t dbSNP:780615877
1868 1868 c, t dbSNP:397514522
1873 1873 a, g dbSNP:754498700
1874 1874 a, g dbSNP:533959758
1885 1885 c, t dbSNP:751201972
1886 1886 a, g dbSNP:146728175
1887 1887 c, t dbSNP:143322085
1888 1888 a, g dbSNP:750237191
1890 1890 c, t dbSNP:765099729
1891 1891 g, t dbSNP:141134584
1918 1918 a, g dbSNP:151000505
1933 1933 c, t dbSNP:776633094
1938 1938 a, g dbSNP:772218942
1943 1943 c, t dbSNP:2229464
1944 1944 a, g dbSNP:774708318
1947 1947 a, g dbSNP:771317843
1951 1951 a, c, g dbSNP:564390872
1964 1964 c, t dbSNP:770201228
1967 1967 c, t dbSNP:376000065
1970 1970 c, t dbSNP:781709502
1996 1996 c, t dbSNP:754482480
2023 2023 g, t dbSNP:751113929
2025 2025 a, c dbSNP:369855757
2029 2029 a, c, g dbSNP:547689240
2030 2030 a, g, t dbSNP:148402498
2042 2042 c, t dbSNP:753812357
2047 2047 a, g dbSNP:764192689
2048 2048 c, g, t dbSNP:199735949
2052 2052 c, t dbSNP:756075851
2053 2053 a, g dbSNP:200959566
2055 2055 a, g dbSNP:144489206
2057 2057 c, t dbSNP:144517528
2058 2058 a, g dbSNP:139837741
2060 2060 g, t dbSNP:765539126
2064 2064 c, g dbSNP:778371971
2090 2090 a, c, t dbSNP:144318024
2091 2091 a, g dbSNP:369173679
2092 2092 c, g dbSNP:747446195
2104 2104 a, g dbSNP:775986936
2113 2113 c, g dbSNP:187050700
2117 2117 a, g dbSNP:745449766
2120 2120 c, g dbSNP:750925723
2123 2123 c, t dbSNP:778397528
2129 2129 c, t dbSNP:2855009
2140 2140 c, t dbSNP:756983498
2141 2141 a, g dbSNP:748970601
2146 2146 a, g dbSNP:140355027
2151 2151 a, g dbSNP:755985963
2152 2152 c, g, t dbSNP:781259607
2153 2153 a, g dbSNP:758380663
2156 2156 a, c dbSNP:750568408
2159 2159 a, g dbSNP:765258731
2183 2183 c, t dbSNP:147516124
2189 2189 c, t dbSNP:754059368
2190 2190 a, g dbSNP:764380548
2191 2191 c, t dbSNP:761082837
2192 2192 a, t dbSNP:775854698
2193 2193 c, t dbSNP:372829569
2201 2201 a, c dbSNP:541758953
2203 2203 c, t dbSNP:143175209
2207 2207 a, c dbSNP:773861159
2209 2209 c, g dbSNP:2855112
2211 2211 c, t dbSNP:574941195
2212 2212 a, g dbSNP:748892991
2214 2214 g, t dbSNP:747781875
2221 2221 a, g dbSNP:369548118
2223 2223 a, c dbSNP:768344716
2226 2226 c, t dbSNP:746902595
2227 2227 a, g dbSNP:779909836
2236 2236 c, t dbSNP:757321874
2245 2245 c, t dbSNP:749407588
2249 2249 a, g dbSNP:777947115
2256 2256 c, t dbSNP:756278598
2259 2259 c, t dbSNP:752892328
2265 2265 a, g dbSNP:201733667
2271 2271 c, t dbSNP:767855778
2273 2273 a, c, t dbSNP:752103718
2278 2278 c, t dbSNP:377403581
2279 2279 a, g dbSNP:373148041
2284 2284 c, t dbSNP:139387079
2285 2285 c, g dbSNP:764875382
2296 2296 c, t dbSNP:761465837
2297 2297 a, g dbSNP:150686813
2302 2302 c, g dbSNP:202107026
2303 2303 c, t dbSNP:369781501
2304 2304 a, g dbSNP:775373347
2308 2308 c, t dbSNP:772044077
2309 2309 a, g dbSNP:745826502
2312 2312 a, g dbSNP:777789166
2313 2313 a, g dbSNP:575122207
2339 2339 c, t dbSNP:377261472
2340 2340 c, t dbSNP:781337282
2342 2342 a, g dbSNP:755339945
2344 2344 c, t dbSNP:554951371
2345 2345 a, g dbSNP:141864003
2346 2346 c, t dbSNP:758936479
2347 2347 c, t dbSNP:750973499
2348 2348 a, g dbSNP:764787488
2355 2355 c, t dbSNP:767241210
2356 2356 c, t dbSNP:201121939
2375 2375 a, c dbSNP:759392769
2379 2379 g, t dbSNP:774241352
2381 2381 c, t dbSNP:770824119
2382 2382 a, g dbSNP:202020907
2383 2383 c, t dbSNP:372243750
2388 2388 c, g, t dbSNP:35926651
2389 2389 g, t dbSNP:747167684
2396 2396 c, t dbSNP:780477427
2402 2402 c, t dbSNP:398122904
2403 2403 a, g dbSNP:746278667
2407 2407 a, c dbSNP:779456770
2414 2414 c, t dbSNP:201853046
2415 2415 a, g dbSNP:768048648
2440 2440 c, t dbSNP:757658720
2443 2443 a, g dbSNP:754401329
2459 2459 c, t dbSNP:777082660
2461 2461 c, t dbSNP:755635993
2467 2467 c, t dbSNP:752333115
2471 2471 c, t dbSNP:767197839
2490 2490 c, t dbSNP:759302866
2495 2495 g, t dbSNP:751304165
2498 2498 a, g dbSNP:766226043
2501 2501 a, g dbSNP:188646084
2504 2504 a, g dbSNP:773210753
2518 2518 c, t dbSNP:201811993
2522 2522 a, g dbSNP:760908374
2526 2526 g, t dbSNP:775827063
2529 2529 a, t dbSNP:2228337
2534 2534 c, g dbSNP:557395470
2547 2547 c, t dbSNP:746118638
2552 2552 c, t dbSNP:774542068
2553 2553 c, t dbSNP:771333451
2560 2560 a, g dbSNP:749701019
2563 2563 c, t dbSNP:778402369
2564 2564 c, t dbSNP:755589419
2565 2565 a, g dbSNP:747705778
2569 2569 c, t dbSNP:199898319
2580 2580 c, t dbSNP:372231860
2582 2582 c, t dbSNP:2229463
2591 2591 a, t dbSNP:766026902
2628 2628 c, g dbSNP:758268158
2659 2659 c, t dbSNP:752832687
2674 2674 -, ggggagtccagggctcccggag dbSNP:531264904
2695 2695 -, ctcaggt dbSNP:144344499
2696 2696 -, ggggagtccagggctcccggag dbSNP:41294726
2696 2696 a, g dbSNP:2748536
2731 2731 a, t dbSNP:186680597
2740 2740 a, c dbSNP:8193035

Target ORF information:

RefSeq Version NM_000359
Organism Homo sapiens (human)
Definition Homo sapiens transglutaminase 1 (TGM1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Different TGM1 mutation spectra in Italian and Portuguese patients with autosomal recessive congenital ichthyosis: evidence of founder effects in Portugal
Br. J. Dermatol. 168 (6), 1364-1367 (2013)
Esposito,G., De Falco,F., Neri,I., Graziano,C., Toschi,B., Auricchio,L., Gouveia,C., Sousa,A.B. and Salvatore,F.


Interactions between FATP4 and ichthyin in epidermal lipid processing may provide clues to the pathogenesis of autosomal recessive congenital ichthyosis
J. Dermatol. Sci. 69 (3), 195-201 (2013)
Li H, Vahlquist A and Torma H.


Congenital lamellar ichthyosis in Tunisia is caused by a founder nonsense mutation in the TGM1 gene
Mol. Biol. Rep. 40 (3), 2527-2532 (2013)
Louhichi N, Hadjsalem I, Marrakchi S, Trabelsi F, Masmoudi A, Turki H and Fakhfakh F.


Transglutaminase-1 mutations in Omani families with lamellar ichthyosis
Med Princ Pract 22 (5), 438-443 (2013)
Al-Naamani A, Al-Waily A, Al-Kindi M, Al-Awadi M and Al-Yahyaee SA.


Genetic variation in the epidermal transglutaminase genes is not associated with atopic dermatitis
PLoS ONE 7 (11), E49694 (2012)
Lieden A, Winge MC, Saaf A, Kockum I, Ekelund E, Rodriguez E, Folster-Holst R, Franke A, Illig T, Tengvall-Linder M, Baurecht H, Weidinger S, Wahlgren CF, Nordenskjold M and Bradley M.


Autosomal Recessive Congenital Ichthyosis
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Richard,G. and Bale,S.J.


Type I keratinocyte transglutaminase: expression in human skin and psoriasis
J. Invest. Dermatol. 99 (1), 27-34 (1992)
Schroeder WT, Thacher SM, Stewart-Galetka S, Annarella M, Chema D, Siciliano MJ, Davies PJ, Tang HY, Sowa BA and Duvic M.


Organization and evolution of the human epidermal keratinocyte transglutaminase I gene
Proc. Natl. Acad. Sci. U.S.A. 89 (10), 4476-4480 (1992)
Polakowska RR, Eickbush T, Falciano V, Razvi F and Goldsmith LA.


Structure and organization of the human transglutaminase 1 gene
J. Biol. Chem. 267 (11), 7710-7717 (1992)
Kim IG, McBride OW, Wang M, Kim SY, Idler WW and Steinert PM.


Genomic structure of keratinocyte transglutaminase. Recruitment of new exon for modified function
J. Biol. Chem. 267 (4), 2282-2286 (1992)
Phillips MA, Stewart BE and Rice RH.
