Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

TGM1 transglutaminase 1 [Homo sapiens (human)]

Gene Symbol TGM1
Entrez Gene ID 7051
Full Name transglutaminase 1
Synonyms ARCI1, ICR2, KTG, LI, LI1, TGASE, TGK
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Ichthyosis, lamellar, autosomal recessive, 242300 (3); Ichthyosiform
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu23436 NM_000359 Homo sapiens transglutaminase 1 (TGM1), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu23436D
Sequence Information ORF Nucleotide Sequence (Length: 2454bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein-glutamine gamma-glutamyltransferase K
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA437895.1, BC034699.1 and AL096870.5. This sequence is a reference standard in the RefSeqGene project. On Jul 20, 2006 this sequence version replaced gi:4507474. Summary: The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC034699.1, AK291350.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)65..67(+)
Misc Feature(2)125..424(+)
Misc Feature(3)194..196(+)
Misc Feature(4)368..370(+)
Misc Feature(5)377..379(+)
Misc Feature(6)398..400(+)
Misc Feature(7)452..811(+)
Misc Feature(8)1235..1510(+)
Misc Feature(9)1859..2173(+)
Misc Feature(10)2195..2488(+)
Exon (1)1..122
Gene Synonym:
Exon (2)123..443
Gene Synonym:
Exon (3)444..632
Gene Synonym:
Exon (4)633..881
Gene Synonym:
Exon (5)882..1000
Gene Synonym:
Exon (6)1001..1108
Gene Synonym:
Exon (7)1109..1283
Gene Synonym:
Exon (8)1284..1422
Gene Synonym:
Exon (9)1423..1526
Gene Synonym:
Exon (10)1527..1615
Gene Synonym:
Exon (11)1616..1769
Gene Synonym:
Exon (12)1770..2051
Gene Synonym:
Exon (13)2052..2212
Gene Synonym:
Exon (14)2213..2349
Gene Synonym:
Exon (15)2350..2777
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:530609496
4 4 g, t dbSNP:41295328
30 30 c, t dbSNP:144764474
55 55 c, g dbSNP:528113103
83 83 c, t dbSNP:8003142
98 98 c, t dbSNP:2748512
101 101 c, t dbSNP:147260129
123 123 c, g dbSNP:768110639
125 125 a, g dbSNP:760172387
139 139 -, a dbSNP:766014574
140 140 c, t dbSNP:372412279
141 141 a, g dbSNP:368781510
145 145 c, t dbSNP:150913268
146 146 a, c, g dbSNP:376706308
148 148 c, t dbSNP:772683158
150 150 g, t dbSNP:267603965
155 155 c, t dbSNP:747931513
156 156 a, g dbSNP:764819314
157 157 c, t dbSNP:754885672
178 178 a, g dbSNP:41295336
184 184 c, t dbSNP:145812304
185 185 a, g dbSNP:140542428
187 187 c, t dbSNP:767948114
189 189 c, g, t dbSNP:201774398
190 190 a, g dbSNP:756448718
197 197 c, t dbSNP:753092145
202 202 a, g dbSNP:767947212
206 206 c, g dbSNP:760012789
210 210 c, t dbSNP:200873762
214 214 -, gccaga dbSNP:762513810
219 219 -, gccaga dbSNP:772760501
220 220 c, t dbSNP:151333205
221 221 a, g dbSNP:142455594
224 224 c, t dbSNP:149148326
226 226 c, g dbSNP:374708302
230 230 a, c, t dbSNP:145197904
231 231 a, g dbSNP:367872941
232 232 c, g dbSNP:761501783
245 245 c, t dbSNP:776286185
246 246 a, g dbSNP:768398275
249 249 a, c, g dbSNP:41295338
250 250 c, t dbSNP:772100268
260 260 c, t dbSNP:752411526
261 261 a, g dbSNP:777960926
267 267 a, g dbSNP:756287272
268 268 c, t dbSNP:752930335
274 274 c, g dbSNP:781571049
283 283 a, c dbSNP:201432046
284 284 c, t dbSNP:140000324
285 285 a, g, t dbSNP:536915231
291 291 a, c, t dbSNP:147479810
292 292 a, g dbSNP:79251149
296 296 g, t dbSNP:139569235
301 301 c, t dbSNP:8193031
302 302 a, g dbSNP:768306663
304 304 a, c dbSNP:760445319
312 312 a, c dbSNP:775398833
319 319 c, g dbSNP:771885092
326 326 -, c dbSNP:34491912
326 326 a, g, t dbSNP:778749307
329 329 a, g dbSNP:769930720
332 332 a, g dbSNP:150599652
333 333 a, g dbSNP:781552476
336 336 a, g dbSNP:374035643
340 340 a, g dbSNP:771277378
343 343 c, t dbSNP:780515334
344 344 a, c dbSNP:565811853
345 345 g, t dbSNP:750901013
346 346 c, t dbSNP:200023674
347 347 g, t dbSNP:761252462
348 348 c, g dbSNP:753400612
350 350 a, g dbSNP:372349270
356 356 c, t dbSNP:760429286
357 357 -, g dbSNP:765131653
357 357 a, g dbSNP:775030916
363 363 c, g dbSNP:767307328
369 369 c, t dbSNP:141792428
371 371 c, t dbSNP:774288859
372 372 a, g dbSNP:771051927
375 375 g, t dbSNP:748234923
376 376 c, t dbSNP:148048398
386 386 c, t dbSNP:768743174
389 389 c, t dbSNP:146189995
390 390 a, g dbSNP:141492969
391 391 a, g dbSNP:758721094
394 394 a, t dbSNP:201400055
395 395 c, g dbSNP:779376697
401 401 c, t dbSNP:757823355
402 402 a, g dbSNP:753328770
405 405 a, g dbSNP:121918729
409 409 c, t dbSNP:2228336
410 410 a, g dbSNP:547714904
417 417 a, g dbSNP:575342998
418 418 c, t dbSNP:767091325
421 421 a, g dbSNP:41295340
429 429 a, g, t dbSNP:398122901
439 439 c, g, t dbSNP:763033733
440 440 c, t dbSNP:773303931
441 441 a, g dbSNP:369941973
443 443 a, g dbSNP:376728988
447 447 a, g dbSNP:780616986
449 449 a, g dbSNP:781313993
452 452 c, g dbSNP:754537753
455 455 a, g dbSNP:751217406
459 459 c, t dbSNP:779855523
463 463 c, t dbSNP:144651432
464 464 a, g dbSNP:750299116
465 465 a, g dbSNP:765214286
470 470 a, g dbSNP:148993226
481 481 c, t dbSNP:752796535
483 483 c, t dbSNP:138885883
484 484 a, g dbSNP:41295444
485 485 c, t dbSNP:80145541
486 486 a, g, t dbSNP:763303938
489 489 c, t dbSNP:141486741
490 490 a, g dbSNP:17102410
493 493 c, t dbSNP:748555249
500 500 c, t dbSNP:397514524
501 501 a, g dbSNP:200491579
504 504 a, g dbSNP:371944908
507 507 a, g dbSNP:138592626
517 517 a, g dbSNP:746939150
518 518 a, g dbSNP:2229462
519 519 a, g dbSNP:780000520
520 520 -, cga dbSNP:768506846
520 520 c, t dbSNP:376590179
521 521 a, c, g dbSNP:141524659
525 525 a, g dbSNP:147916609
532 532 a, c, t dbSNP:142338588
533 533 a, g dbSNP:149089854
535 535 c, t dbSNP:145002586
536 536 a, g dbSNP:765478385
542 542 a, g dbSNP:149923908
544 544 a, g dbSNP:139208806
546 546 g, t dbSNP:769342810
548 548 c, t dbSNP:121918716
549 549 a, g dbSNP:121918718
551 551 c, t dbSNP:531650682
552 552 a, g dbSNP:121918719
553 553 c, t dbSNP:144989372
554 554 a, g dbSNP:778635368
556 556 a, g dbSNP:141559048
561 561 c, g dbSNP:749167940
578 578 c, g, t dbSNP:532525772
580 580 -, cct dbSNP:746008257
581 581 c, t dbSNP:751619088
587 587 c, t dbSNP:187901859
588 588 a, g dbSNP:374574340
594 594 a, g dbSNP:750543171
596 596 c, g dbSNP:765510569
600 600 c, t dbSNP:762069170
601 601 a, c, t dbSNP:764662851
603 603 c, g dbSNP:121918728
608 608 c, g, t dbSNP:199894209
609 609 a, g dbSNP:771665132
616 616 a, c dbSNP:541307680
628 628 c, t dbSNP:773864507
631 631 c, t dbSNP:770687478
640 640 c, t dbSNP:769512970
641 641 c, t dbSNP:553309439
643 643 c, t dbSNP:139811103
644 644 a, g dbSNP:768705863
649 649 a, g dbSNP:200092961
650 650 a, g dbSNP:374723129
660 660 c, t dbSNP:779095091
661 661 a, g dbSNP:757301708
664 664 c, t dbSNP:145981439
665 665 a, g dbSNP:778143033
674 674 c, t dbSNP:200517023
679 679 a, g dbSNP:753181868
686 686 a, c, g dbSNP:760139170
688 688 a, g dbSNP:752029585
698 698 a, g dbSNP:765874994
699 699 c, g dbSNP:762375778
703 703 a, c, g dbSNP:199678720
709 709 c, t dbSNP:761591850
711 711 a, g dbSNP:538074682
712 712 a, g dbSNP:768452927
728 728 a, g dbSNP:141685762
730 730 a, g dbSNP:775319268
731 731 c, t dbSNP:201167101
734 734 a, g dbSNP:770973858
736 736 a, t dbSNP:552396029
746 746 c, t dbSNP:778139253
747 747 a, g dbSNP:369636498
748 748 a, g dbSNP:748504712
751 751 c, t dbSNP:781571622
755 755 a, g dbSNP:566962779
756 756 c, t dbSNP:200894024
760 760 c, t dbSNP:377705451
761 761 c, t dbSNP:530095586
762 762 c, g dbSNP:757888791
764 764 a, g dbSNP:749999915
765 765 a, g dbSNP:147994543
766 766 c, t dbSNP:761501855
767 767 a, g dbSNP:772025093
775 775 c, t dbSNP:763906036
776 776 a, g dbSNP:121918732
777 777 a, g dbSNP:775437367
784 784 c, t dbSNP:201493499
793 793 a, c dbSNP:749350038
797 797 c, t dbSNP:773479626
798 798 a, g dbSNP:549195122
799 799 c, t dbSNP:748341131
805 805 a, g dbSNP:368775721
808 808 a, g dbSNP:369162984
811 811 c, t dbSNP:143352384
812 812 a, g, t dbSNP:531428094
819 819 a, g dbSNP:758944662
820 820 a, g dbSNP:149605227
830 830 c, t dbSNP:371837832
832 832 c, t dbSNP:756786967
839 839 c, t dbSNP:753460914
842 842 c, t dbSNP:763663668
843 843 a, g dbSNP:138574046
846 846 a, g dbSNP:775191936
848 848 a, g dbSNP:201572824
850 850 a, g dbSNP:35755034
856 856 c, t dbSNP:759501423
857 857 a, g dbSNP:199820979
859 859 a, c dbSNP:769928814
869 869 a, c dbSNP:762000108
872 872 g, t dbSNP:318240748
889 889 c, t dbSNP:372360509
895 895 c, t dbSNP:141590446
896 896 a, g dbSNP:771471341
897 897 g, t dbSNP:748811947
904 904 a, g dbSNP:550881040
907 907 a, g dbSNP:777103051
910 910 c, t dbSNP:755685678
912 912 a, g dbSNP:367699137
914 914 c, t dbSNP:201868387
915 915 a, g dbSNP:781006633
916 916 g, t dbSNP:532184407
919 919 c, g dbSNP:754808781
922 922 a, g dbSNP:751468985
923 923 c, t dbSNP:750815702
924 924 a, g, t dbSNP:762845943
925 925 c, t dbSNP:750395926
928 928 c, t dbSNP:200870283
937 937 -, gtctgggaga dbSNP:778038848
938 938 c, t dbSNP:764040146
950 950 a, t dbSNP:397514523
955 955 c, t dbSNP:559847457
956 956 a, g dbSNP:121918725
958 958 a, g dbSNP:767782456
961 961 c, t dbSNP:370435399
962 962 a, c, g dbSNP:150181059
977 977 a, g dbSNP:749721551
980 980 c, t dbSNP:773777400
981 981 a, g dbSNP:121918727
990 990 a, c, g dbSNP:121918730
994 994 c, t dbSNP:539904518
996 996 a, g dbSNP:780990272
1009 1009 c, t dbSNP:186352813
1010 1010 a, g, t dbSNP:779761866
1011 1011 a, g dbSNP:758067421
1015 1015 a, g dbSNP:768880844
1023 1023 c, t dbSNP:778708394
1032 1032 a, g dbSNP:757256224
1034 1034 a, t dbSNP:753798494
1042 1042 c, t dbSNP:767547778
1043 1043 c, g, t dbSNP:121918731
1044 1044 a, g dbSNP:146770534
1047 1047 a, g dbSNP:201328637
1067 1067 c, t dbSNP:397514525
1068 1068 a, g, t dbSNP:143473912
1074 1074 a, g dbSNP:762359834
1077 1077 -, c dbSNP:755366540
1082 1082 a, g dbSNP:777308173
1083 1083 a, g dbSNP:768214832
1087 1087 c, t dbSNP:760270638
1089 1089 c, g dbSNP:774987995
1091 1091 c, t dbSNP:771820315
1092 1092 a, g dbSNP:121918717
1096 1096 a, c, t dbSNP:373557209
1101 1101 -, ct dbSNP:786205485
1121 1121 a, g dbSNP:759190792
1157 1157 a, g dbSNP:565588144
1165 1165 c, g dbSNP:545348591
1167 1167 a, g dbSNP:201379408
1169 1169 a, g dbSNP:777683020
1177 1177 a, c dbSNP:769764727
1183 1183 a, t dbSNP:747038767
1186 1186 a, c, g dbSNP:758437844
1193 1193 a, g dbSNP:750591055
1198 1198 c, g dbSNP:779287673
1199 1199 a, g dbSNP:202037016
1205 1205 a, g dbSNP:757682828
1216 1216 c, g, t dbSNP:764663238
1218 1218 a, g dbSNP:756732717
1223 1223 c, t dbSNP:753178188
1224 1224 a, g dbSNP:139949065
1227 1227 c, t dbSNP:199786703
1232 1232 c, t dbSNP:774039917
1236 1236 c, t dbSNP:766091239
1237 1237 c, t dbSNP:61747601
1238 1238 a, g dbSNP:41293794
1240 1240 a, c dbSNP:2855005
1252 1252 a, g dbSNP:769601827
1259 1259 a, c, g dbSNP:121918720
1261 1261 c, g dbSNP:767043223
1262 1262 c, t dbSNP:529243676
1267 1267 g, t dbSNP:149449576
1270 1270 a, c, t dbSNP:1126432
1271 1271 a, g dbSNP:121918722
1279 1279 a, c dbSNP:571513690
1289 1289 c, t dbSNP:757905282
1290 1290 a, c, g dbSNP:121918723
1299 1299 a, g dbSNP:121918726
1303 1303 a, g dbSNP:761659999
1308 1308 c, t dbSNP:372498705
1310 1310 c, t dbSNP:543521135
1311 1311 a, g, t dbSNP:121918721
1323 1323 a, g dbSNP:771078653
1329 1329 a, g dbSNP:763185124
1337 1337 c, g dbSNP:773565490
1339 1339 c, t dbSNP:769950645
1340 1340 a, g dbSNP:200050519
1342 1342 c, g dbSNP:781366138
1347 1347 -, acaca dbSNP:398122905
1351 1351 a, t dbSNP:769098662
1353 1353 a, c dbSNP:747452503
1367 1367 a, g dbSNP:780550366
1370 1370 c, t dbSNP:757886765
1375 1375 c, g, t dbSNP:778596476
1376 1376 a, g dbSNP:756907283
1378 1378 c, t dbSNP:150739753
1379 1379 a, g dbSNP:374898509
1381 1381 a, g dbSNP:760562528
1385 1385 a, c dbSNP:752670603
1388 1388 a, t dbSNP:563305936
1391 1391 a, c, t dbSNP:763095024
1393 1393 c, t dbSNP:572832245
1396 1396 a, g dbSNP:552834286
1402 1402 a, c dbSNP:761903751
1427 1427 -, ttcca dbSNP:398122900
1427 1427 g, t dbSNP:754922174
1432 1432 c, t dbSNP:751551536
1441 1441 c, t dbSNP:141972252
1442 1442 a, g dbSNP:761968652
1455 1455 -, a dbSNP:398122903
1462 1462 a, g dbSNP:776701915
1468 1468 a, c, g dbSNP:2855105
1473 1473 c, t dbSNP:760993072
1474 1474 a, c, g dbSNP:571310594
1483 1483 c, t dbSNP:746332814
1498 1498 a, g dbSNP:199623333
1514 1514 a, g dbSNP:774925814
1518 1518 c, t dbSNP:770335603
1525 1525 -, t dbSNP:766035647
1527 1527 a, g dbSNP:147078520
1530 1530 c, t dbSNP:767801047
1540 1540 c, t dbSNP:759957199
1542 1542 -, g dbSNP:758030729
1542 1542 g, t dbSNP:535121937
1546 1546 c, t dbSNP:774717848
1549 1549 c, t dbSNP:369128286
1558 1558 a, g dbSNP:748725054
1561 1561 c, t dbSNP:772800253
1562 1562 a, t dbSNP:377119683
1568 1568 a, g dbSNP:747739923
1573 1573 c, g dbSNP:2748528
1576 1576 c, g, t dbSNP:2855109
1591 1591 c, t dbSNP:768561754
1593 1593 a, g dbSNP:121918724
1597 1597 a, g dbSNP:187372624
1642 1642 a, g dbSNP:143320733
1643 1643 c, t dbSNP:200829531
1645 1645 c, g dbSNP:2855110
1648 1648 a, c, g dbSNP:2748529
1652 1652 a, g dbSNP:7147300
1653 1653 a, g dbSNP:139320583
1672 1672 c, t dbSNP:201388438
1674 1674 a, c dbSNP:755178560
1676 1676 a, g dbSNP:35312232
1683 1683 a, g dbSNP:142404759
1687 1687 a, g dbSNP:763244527
1693 1693 c, t dbSNP:750955048
1694 1694 a, g dbSNP:765914927
1710 1710 c, t dbSNP:761372792
1714 1714 a, g dbSNP:776328019
1728 1728 a, g dbSNP:763531422
1734 1734 a, g dbSNP:761557071
1741 1741 c, t dbSNP:575958464
1745 1745 a, c dbSNP:587779765
1746 1746 c, g dbSNP:751876711
1760 1760 c, t dbSNP:771840484
1762 1762 a, c dbSNP:556165359
1772 1772 c, t dbSNP:747128345
1775 1775 a, c, g dbSNP:758739021
1776 1776 a, t dbSNP:746110699
1777 1777 c, g, t dbSNP:2855111
1778 1778 a, g dbSNP:757697165
1783 1783 a, g dbSNP:754311329
1784 1784 c, t dbSNP:764567765
1785 1785 a, g, t dbSNP:372839534
1789 1789 a, g dbSNP:767076645
1796 1796 a, g dbSNP:759151284
1807 1807 a, t dbSNP:760229890
1811 1811 c, t dbSNP:751219893
1813 1813 c, t dbSNP:538295056
1814 1814 a, g dbSNP:762797327
1818 1818 a, g dbSNP:773200488
1823 1823 a, c dbSNP:769663593
1827 1827 a, g dbSNP:150428149
1828 1828 c, g, t dbSNP:772307070
1838 1838 a, c dbSNP:746018070
1839 1839 a, c dbSNP:779289911
1841 1841 c, t dbSNP:771407569
1851 1851 c, t dbSNP:140363039
1852 1852 a, g dbSNP:369097812
1855 1855 c, g dbSNP:756529645
1859 1859 a, g dbSNP:528553550
1862 1862 g, t dbSNP:753278878
1864 1864 c, t dbSNP:780615877
1868 1868 c, t dbSNP:397514522
1873 1873 a, g dbSNP:754498700
1874 1874 a, g dbSNP:533959758
1885 1885 c, t dbSNP:751201972
1886 1886 a, g dbSNP:146728175
1887 1887 c, t dbSNP:143322085
1888 1888 a, g dbSNP:750237191
1890 1890 c, t dbSNP:765099729
1891 1891 g, t dbSNP:141134584
1918 1918 a, g dbSNP:151000505
1933 1933 c, t dbSNP:776633094
1938 1938 a, g dbSNP:772218942
1943 1943 c, t dbSNP:2229464
1944 1944 a, g dbSNP:774708318
1947 1947 a, g dbSNP:771317843
1951 1951 a, c, g dbSNP:564390872
1964 1964 c, t dbSNP:770201228
1967 1967 c, t dbSNP:376000065
1970 1970 c, t dbSNP:781709502
1996 1996 c, t dbSNP:754482480
2023 2023 g, t dbSNP:751113929
2025 2025 a, c dbSNP:369855757
2029 2029 a, c, g dbSNP:547689240
2030 2030 a, g, t dbSNP:148402498
2042 2042 c, t dbSNP:753812357
2047 2047 a, g dbSNP:764192689
2048 2048 c, g, t dbSNP:199735949
2052 2052 c, t dbSNP:756075851
2053 2053 a, g dbSNP:200959566
2055 2055 a, g dbSNP:144489206
2057 2057 c, t dbSNP:144517528
2058 2058 a, g dbSNP:139837741
2060 2060 g, t dbSNP:765539126
2064 2064 c, g dbSNP:778371971
2090 2090 a, c, t dbSNP:144318024
2091 2091 a, g dbSNP:369173679
2092 2092 c, g dbSNP:747446195
2104 2104 a, g dbSNP:775986936
2113 2113 c, g dbSNP:187050700
2117 2117 a, g dbSNP:745449766
2120 2120 c, g dbSNP:750925723
2123 2123 c, t dbSNP:778397528
2129 2129 c, t dbSNP:2855009
2140 2140 c, t dbSNP:756983498
2141 2141 a, g dbSNP:748970601
2146 2146 a, g dbSNP:140355027
2151 2151 a, g dbSNP:755985963
2152 2152 c, g, t dbSNP:781259607
2153 2153 a, g dbSNP:758380663
2156 2156 a, c dbSNP:750568408
2159 2159 a, g dbSNP:765258731
2183 2183 c, t dbSNP:147516124
2189 2189 c, t dbSNP:754059368
2190 2190 a, g dbSNP:764380548
2191 2191 c, t dbSNP:761082837
2192 2192 a, t dbSNP:775854698
2193 2193 c, t dbSNP:372829569
2201 2201 a, c dbSNP:541758953
2203 2203 c, t dbSNP:143175209
2207 2207 a, c dbSNP:773861159
2209 2209 c, g dbSNP:2855112
2211 2211 c, t dbSNP:574941195
2212 2212 a, g dbSNP:748892991
2214 2214 g, t dbSNP:747781875
2221 2221 a, g dbSNP:369548118
2223 2223 a, c dbSNP:768344716
2226 2226 c, t dbSNP:746902595
2227 2227 a, g dbSNP:779909836
2236 2236 c, t dbSNP:757321874
2245 2245 c, t dbSNP:749407588
2249 2249 a, g dbSNP:777947115
2256 2256 c, t dbSNP:756278598
2259 2259 c, t dbSNP:752892328
2265 2265 a, g dbSNP:201733667
2271 2271 c, t dbSNP:767855778
2273 2273 a, c, t dbSNP:752103718
2278 2278 c, t dbSNP:377403581
2279 2279 a, g dbSNP:373148041
2284 2284 c, t dbSNP:139387079
2285 2285 c, g dbSNP:764875382
2296 2296 c, t dbSNP:761465837
2297 2297 a, g dbSNP:150686813
2302 2302 c, g dbSNP:202107026
2303 2303 c, t dbSNP:369781501
2304 2304 a, g dbSNP:775373347
2308 2308 c, t dbSNP:772044077
2309 2309 a, g dbSNP:745826502
2312 2312 a, g dbSNP:777789166
2313 2313 a, g dbSNP:575122207
2339 2339 c, t dbSNP:377261472
2340 2340 c, t dbSNP:781337282
2342 2342 a, g dbSNP:755339945
2344 2344 c, t dbSNP:554951371
2345 2345 a, g dbSNP:141864003
2346 2346 c, t dbSNP:758936479
2347 2347 c, t dbSNP:750973499
2348 2348 a, g dbSNP:764787488
2355 2355 c, t dbSNP:767241210
2356 2356 c, t dbSNP:201121939
2375 2375 a, c dbSNP:759392769
2379 2379 g, t dbSNP:774241352
2381 2381 c, t dbSNP:770824119
2382 2382 a, g dbSNP:202020907
2383 2383 c, t dbSNP:372243750
2388 2388 c, g, t dbSNP:35926651
2389 2389 g, t dbSNP:747167684
2396 2396 c, t dbSNP:780477427
2402 2402 c, t dbSNP:398122904
2403 2403 a, g dbSNP:746278667
2407 2407 a, c dbSNP:779456770
2414 2414 c, t dbSNP:201853046
2415 2415 a, g dbSNP:768048648
2440 2440 c, t dbSNP:757658720
2443 2443 a, g dbSNP:754401329
2459 2459 c, t dbSNP:777082660
2461 2461 c, t dbSNP:755635993
2467 2467 c, t dbSNP:752333115
2471 2471 c, t dbSNP:767197839
2490 2490 c, t dbSNP:759302866
2495 2495 g, t dbSNP:751304165
2498 2498 a, g dbSNP:766226043
2501 2501 a, g dbSNP:188646084
2504 2504 a, g dbSNP:773210753
2518 2518 c, t dbSNP:201811993
2522 2522 a, g dbSNP:760908374
2526 2526 g, t dbSNP:775827063
2529 2529 a, t dbSNP:2228337
2534 2534 c, g dbSNP:557395470
2547 2547 c, t dbSNP:746118638
2552 2552 c, t dbSNP:774542068
2553 2553 c, t dbSNP:771333451
2560 2560 a, g dbSNP:749701019
2563 2563 c, t dbSNP:778402369
2564 2564 c, t dbSNP:755589419
2565 2565 a, g dbSNP:747705778
2569 2569 c, t dbSNP:199898319
2580 2580 c, t dbSNP:372231860
2582 2582 c, t dbSNP:2229463
2591 2591 a, t dbSNP:766026902
2628 2628 c, g dbSNP:758268158
2659 2659 c, t dbSNP:752832687
2674 2674 -, ggggagtccagggctcccggag dbSNP:531264904
2695 2695 -, ctcaggt dbSNP:144344499
2696 2696 -, ggggagtccagggctcccggag dbSNP:41294726
2696 2696 a, g dbSNP:2748536
2731 2731 a, t dbSNP:186680597
2740 2740 a, c dbSNP:8193035

Target ORF information:

RefSeq Version NM_000359
Organism Homo sapiens (human)
Definition Homo sapiens transglutaminase 1 (TGM1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.