
TP53 cDNA ORF clone, Homo sapiens (human)

Gene Symbol TP53
Entrez Gene ID 7157
Full Name tumor protein p53
Synonyms BCC7, LFS1, P53, TRP53
General protein information
Preferred Names
cellular tumor antigen p53
cellular tumor antigen p53
antigen NY-CO-13
phosphoprotein p53
p53 tumor suppressor
transformation-related protein 53
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, 114500 (3); Li-Fraumeni syndrome, 151623 (3);

The following TP53 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the TP53 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_001276697 Homo sapiens tumor protein p53 (TP53), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276698 Homo sapiens tumor protein p53 (TP53), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276699 Homo sapiens tumor protein p53 (TP53), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126115 Homo sapiens tumor protein p53 (TP53), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126116 Homo sapiens tumor protein p53 (TP53), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126117 Homo sapiens tumor protein p53 (TP53), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_000546 Homo sapiens tumor protein p53 (TP53), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126112 Homo sapiens tumor protein p53 (TP53), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126113 Homo sapiens tumor protein p53 (TP53), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126114 Homo sapiens tumor protein p53 (TP53), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001126118 Homo sapiens tumor protein p53 (TP53), transcript variant 8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276695 Homo sapiens tumor protein p53 (TP53), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276696 Homo sapiens tumor protein p53 (TP53), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276760 Homo sapiens tumor protein p53 (TP53), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001276761 Homo sapiens tumor protein p53 (TP53), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu20389
Accession Version NM_001276697.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 705bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cellular tumor antigen p53 isoform j
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC087388.9, DQ186650.1 and AK223026.1. Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. Transcript Variant: This variant (5) uses an alternate promoter and lacks multiple 5' exons, compared to variant 1. This variant can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (j, also known as delta160p53alpha) results from translation initiation at the downstream start codon. It has a shorter N-terminus, compared to isoform a. This variant is supported by data in PMID:16131611. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## CDS uses downstream in-frame AUG :: experimental evidence (PMID:20937277) ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: DQ186650.1, BM467806.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)135..137(+)
Misc Feature(2)279..281(+)
Misc Feature(3)360..746(+)
Misc Feature(4)408..608(+)
Misc Feature(5)411..425(+)
Misc Feature(6)597..722(+)
Misc Feature(7)852..959(+)
Exon (1)1..441
Gene Synonym:
Exon (2)442..554
Gene Synonym:
Exon (3)555..664
Gene Synonym:
Exon (4)665..801
Gene Synonym:
Exon (5)802..875
Gene Synonym:
Exon (6)876..982
Gene Synonym:
Exon (7)983..2271
Gene Synonym:
Position Chain Variation Link
19 19 a, g dbSNP:530780060
40 40 a, c dbSNP:563612371
67 67 -, ag dbSNP:17880765
83 83 -, aaa dbSNP:5819162
87 87 a, c dbSNP:75785681
97 97 -, aaaa dbSNP:754750418
97 97 -, aaa dbSNP:752947053
97 97 a, g dbSNP:75821853
98 98 -, aaa dbSNP:141204613
101 101 -, gaa dbSNP:376546152
104 104 a, g dbSNP:77624624
133 133 c, t dbSNP:9895829
141 141 a, g dbSNP:35850753
157 157 a, t dbSNP:145153611
167 167 a, g dbSNP:2909430
172 172 c, t dbSNP:113530090
189 189 a, g dbSNP:537058017
191 191 c, g dbSNP:2856920
211 211 g, t dbSNP:774330271
218 218 c, t dbSNP:770686190
223 223 c, t dbSNP:576912263
235 235 c, t dbSNP:773029752
240 240 -, t dbSNP:756417643
241 241 c, t dbSNP:376713749
247 247 g, t dbSNP:747705704
256 256 -, a dbSNP:751253294
256 256 a, g dbSNP:786202799
262 262 c, t dbSNP:730881999
268 268 c, t dbSNP:137852792
272 272 c, t dbSNP:781537596
273 273 a, t dbSNP:587782160
275 275 a, c dbSNP:769270327
276 276 -, aagatgttttgccaac dbSNP:786203589
276 276 a, g dbSNP:747342068
280 280 c, t dbSNP:28934873
282 282 c, t dbSNP:267605077
283 283 g, t dbSNP:780442292
286 286 a, g dbSNP:587781991
290 290 a, c, g dbSNP:758781593
294 294 c, g dbSNP:28934875
295 295 -, c dbSNP:137852794
295 295 c, t dbSNP:750600586
301 301 a, c dbSNP:786202561
304 304 a, g dbSNP:587781288
307 307 c, t dbSNP:779196500
309 309 a, g, t dbSNP:587782620
312 312 c, t dbSNP:757274881
313 313 a, c dbSNP:786203071
314 314 a, g dbSNP:786201419
315 315 c, t dbSNP:786203928
316 316 c, t dbSNP:587782197
318 318 g, t dbSNP:786203064
329 329 -, cacacccccgccc dbSNP:587782393
330 330 -, acacccccgccc dbSNP:137852790
332 332 -, acccccgccc dbSNP:137852791
332 332 a, g dbSNP:754020850
333 333 a, c, t dbSNP:28934874
336 336 c, t dbSNP:767328513
337 337 -, c dbSNP:730882019
337 337 c, t dbSNP:587782705
341 341 c, t dbSNP:72661116
342 342 a, g dbSNP:137852789
343 343 a, g dbSNP:762846821
344 344 c, t dbSNP:137852793
345 345 a, g dbSNP:772683278
346 346 c, g dbSNP:786202752
347 347 a, c dbSNP:786202992
348 348 c, t dbSNP:563378859
349 349 a, g dbSNP:371524413
350 350 c, t dbSNP:761222871
351 351 a, g, t dbSNP:121912654
354 354 c, t dbSNP:587780068
355 355 a, g dbSNP:587782144
356 356 c, t dbSNP:139200646
357 357 gc, tt dbSNP:730882022
357 357 c, g dbSNP:730882000
360 360 a, t dbSNP:377274728
362 362 a, g dbSNP:772354334
363 363 a, g dbSNP:193920817
367 367 g, t dbSNP:587780069
369 369 g, t dbSNP:786203436
370 370 a, g dbSNP:148924904
375 375 c, t dbSNP:730882001
386 386 c, t dbSNP:746293837
390 390 a, g dbSNP:587780729
391 391 c, t dbSNP:779000871
392 392 a, g dbSNP:757544615
393 393 a, g dbSNP:587781845
397 397 -, gaggt dbSNP:786202514
398 398 g, t dbSNP:749309577
405 405 c, g, t dbSNP:138729528
406 406 a, g, t dbSNP:28934578
409 409 a, g dbSNP:786202962
411 411 c, t dbSNP:147002414
412 412 c, g dbSNP:751477326
414 414 -, ccc dbSNP:786202525
417 417 c, t dbSNP:587780070
423 423 c, t dbSNP:587782596
424 424 a, g, t dbSNP:397514495
432 432 a, g dbSNP:72661117
436 436 a, g dbSNP:150607408
437 437 c, t dbSNP:367560109
440 440 a, c, t dbSNP:375275361
441 441 a, g dbSNP:776167460
448 448 c, t dbSNP:121912665
449 449 a, c dbSNP:55764374
454 454 c, g dbSNP:587778718
457 457 a, g dbSNP:730882002
460 460 a, g, t dbSNP:786201838
462 462 c, t dbSNP:587780071
464 464 c, t dbSNP:370216745
466 466 c, t dbSNP:760043106
468 468 c, t dbSNP:397516435
469 469 g, t dbSNP:483352697
471 471 a, g dbSNP:786204041
485 485 g, t dbSNP:730882024
486 486 c, t dbSNP:587780072
487 487 a, g, t dbSNP:587778719
489 489 a, g dbSNP:730882003
494 494 a, g dbSNP:749629973
497 497 a, t dbSNP:786202222
500 500 a, g dbSNP:142813240
509 509 -, aa dbSNP:587776768
519 519 c, t dbSNP:397516436
520 520 a, g dbSNP:587778720
521 521 a, g, t dbSNP:1800372
524 524 c, g, t dbSNP:587781386
526 526 c, g dbSNP:587782177
528 528 a, g dbSNP:730882025
530 530 c, g dbSNP:199693249
531 531 a, g dbSNP:35163653
533 533 -, ggtgccctatgagccg dbSNP:786202315
536 536 a, g dbSNP:753630563
539 539 a, c dbSNP:786201859
540 540 c, t dbSNP:530941076
541 541 a, c, g dbSNP:121912666
543 543 a, g dbSNP:786201592
547 547 c, t dbSNP:146340390
548 548 a, g, t dbSNP:72661118
550 550 a, c dbSNP:138983188
554 554 a, g dbSNP:267605076
555 555 c, g dbSNP:746504075
567 567 -, tgtaccac dbSNP:730882016
577 577 c, t dbSNP:587781589
578 578 c, t dbSNP:786202888
583 583 a, g dbSNP:587780073
585 585 a, t dbSNP:786204145
586 586 a, g dbSNP:144340710
587 587 c, t dbSNP:750893877
588 588 g, t dbSNP:587782289
589 589 a, c dbSNP:730882026
591 591 a, g dbSNP:730882004
592 592 a, t dbSNP:765848205
593 593 a, g dbSNP:587782664
595 595 a, g dbSNP:730882005
596 596 g, t dbSNP:193920789
600 600 -, agttcctgcatgggcggcatgaac dbSNP:397516437
602 602 c, t dbSNP:764342812
604 604 c, g, t dbSNP:28934573
607 607 a, c, g dbSNP:121912655
608 608 c, t dbSNP:375874539
609 609 a, c dbSNP:786203117
610 610 c, t dbSNP:730882006
614 614 c, t dbSNP:759625762
615 615 a, g, t dbSNP:28934575
616 616 a, g, t dbSNP:121912656
618 618 a, c, g dbSNP:483352695
619 619 g, t dbSNP:587780074
622 622 a, t dbSNP:786201762
623 623 c, t dbSNP:786202448
624 624 c, t dbSNP:121912651
625 625 a, g dbSNP:11540652
627 627 a, t dbSNP:587782082
628 628 a, g dbSNP:587782329
629 629 g, t dbSNP:28934571
633 633 a, c dbSNP:730882007
634 634 g, t dbSNP:730882027
637 637 c, t dbSNP:121912653
642 642 a, g dbSNP:746601313
648 648 a, g dbSNP:587781433
650 650 a, g dbSNP:786203563
651 651 c, t dbSNP:779761818
652 652 a, g, t dbSNP:28934577
654 654 a, g dbSNP:121912652
658 658 a, g dbSNP:745425759
664 664 c, g dbSNP:786203396
666 666 a, g, t dbSNP:200579969
669 669 a, g dbSNP:72661119
671 671 c, t dbSNP:770598448
679 679 a, g dbSNP:193920774
681 681 c, t dbSNP:55832599
682 682 a, g dbSNP:587780075
690 690 -, tttgaggtgc dbSNP:587781987
696 696 a, g, t dbSNP:121912657
698 698 a, g dbSNP:756421198
699 699 a, c, t dbSNP:121913343
700 700 a, g, t dbSNP:28934576
709 709 c, g dbSNP:786202082
712 712 a, g, t dbSNP:763098116
714 714 c, g dbSNP:17849781
719 719 a, g dbSNP:786201322
720 720 agagaccggcg, ca dbSNP:587781564
720 720 a, c dbSNP:753660142
721 721 c, g, t dbSNP:121912660
723 723 a, g dbSNP:764146326
724 724 a, g, t dbSNP:587781525
726 726 c, g, t dbSNP:28934574
727 727 g, t dbSNP:730882008
729 729 a, c, t dbSNP:149633775
730 730 -, tcctgggagagaccggcg dbSNP:786204061
730 730 a, g dbSNP:371409680
734 734 a, c dbSNP:786203004
735 735 a, g dbSNP:112431538
736 736 a, t dbSNP:121912667
738 738 a, g dbSNP:786201059
741 741 a, g dbSNP:587782006
743 743 c, g dbSNP:748891343
749 749 c, t dbSNP:778138282
750 750 c, t dbSNP:770374782
751 751 a, g dbSNP:55819519
754 754 a, g dbSNP:781490101
755 755 c, g dbSNP:372613518
757 757 a, t dbSNP:121912663
759 759 a, g, t dbSNP:587780076
766 766 c, t dbSNP:751713111
767 767 c, t dbSNP:200073907
768 768 c, t dbSNP:672601296
769 769 a, g dbSNP:483352696
770 770 c, t dbSNP:758395031
773 773 c, t dbSNP:750578863
774 774 a, g, t dbSNP:201744589
776 776 -, ag dbSNP:761885916
776 776 a, g dbSNP:756123992
777 777 c, t dbSNP:752701561
782 782 c, t dbSNP:767356182
785 785 a, g dbSNP:72661120
788 788 -, g dbSNP:786202055
789 789 a, g dbSNP:587782391
792 792 a, g dbSNP:587782654
798 798 c, t dbSNP:121913344
806 806 a, g dbSNP:786202546
814 814 a, g dbSNP:56184981
815 815 c, t dbSNP:201601993
817 817 c, g dbSNP:145151284
823 823 c, t dbSNP:751440465
824 824 a, c dbSNP:765930028
825 825 a, t dbSNP:762620193
828 828 a, c dbSNP:772773208
831 831 a, c dbSNP:764735889
836 836 a, c dbSNP:761322293
851 851 a, g dbSNP:672601297
856 856 g, t dbSNP:121912659
875 875 a, g dbSNP:11575996
879 879 c, g, t dbSNP:769934890
880 880 a, g dbSNP:573154688
882 882 a, c, g dbSNP:730882028
884 884 a, g dbSNP:786203531
885 885 c, t dbSNP:375444154
886 886 a, g dbSNP:771939956
891 891 c, t dbSNP:587782529
892 892 a, c, g, t dbSNP:121912664
896 896 c, g, t dbSNP:150293825
897 897 a, c, g dbSNP:17882252
906 906 c, t dbSNP:730882029
907 907 a, g dbSNP:375338359
909 909 c, g dbSNP:375573770
913 913 c, t dbSNP:121912662
914 914 c, g dbSNP:752189180
922 922 a, c dbSNP:397516434
930 930 c, g dbSNP:768046010
933 933 a, g dbSNP:141402957
942 942 a, c dbSNP:755394212
943 943 a, g dbSNP:752142489
948 948 c, g dbSNP:766786605
952 952 a, g dbSNP:763426446
954 954 a, g dbSNP:587782237
955 955 a, t dbSNP:773553186
959 959 a, g dbSNP:539224556
960 960 a, g dbSNP:786203298
961 961 c, g, t dbSNP:35993958
964 964 a, g dbSNP:587781663
967 967 g, t dbSNP:768803947
969 969 a, g dbSNP:745751553
975 975 c, t dbSNP:267605075
978 978 g, t dbSNP:17881470
982 982 a, g dbSNP:749150541
984 984 c, t dbSNP:786204227
995 995 a, c dbSNP:765530090
1002 1002 a, c, g, t dbSNP:587781858
1007 1007 a, g dbSNP:764011631
1007 1007 -, g dbSNP:730882017
1010 1010 c, t dbSNP:760820708
1011 1011 -, a dbSNP:770970987
1011 1011 a, c dbSNP:774269719
1014 1014 c, t dbSNP:80184930
1017 1017 a, c, t dbSNP:749061599
1019 1019 c, t dbSNP:786202368
1029 1029 c, t dbSNP:150842067
1031 1031 c, t dbSNP:373710656
1032 1032 a, g dbSNP:730882009
1045 1045 a, c dbSNP:587781736
1047 1047 g, t dbSNP:587783064
1049 1049 -, g dbSNP:749817236
1057 1057 a, c dbSNP:769664911
1070 1070 a, c, t dbSNP:369567704
1073 1073 a, c dbSNP:8065799
1079 1079 c, t dbSNP:374294340
1094 1094 g, t dbSNP:746581308
1098 1098 c, t dbSNP:545818827
1101 1101 a, g, t dbSNP:1042526
1102 1102 c, t dbSNP:759018180
1115 1115 c, t dbSNP:760698953
1169 1169 c, t dbSNP:35919705
1170 1170 a, g dbSNP:375913211
1206 1206 a, g dbSNP:771458013
1208 1208 a, g dbSNP:371002418
1258 1258 -, a dbSNP:140346117
1258 1258 a, g dbSNP:560862596
1269 1269 a, g dbSNP:16956880
1339 1339 -, a dbSNP:771579509
1373 1373 g, t dbSNP:79516338
1378 1378 a, g dbSNP:34486624
1392 1392 a, g dbSNP:17881366
1421 1421 c, t dbSNP:534624315
1451 1451 a, c dbSNP:558662880
1473 1473 a, c dbSNP:191918079
1491 1491 g, t dbSNP:774263885
1531 1531 a, c dbSNP:377621596
1545 1545 a, t dbSNP:546208790
1549 1549 a, g dbSNP:4968187
1555 1555 a, g dbSNP:916131
1566 1566 c, t dbSNP:569519287
1578 1578 c, t dbSNP:916132
1593 1593 c, g dbSNP:551213894
1598 1598 ct, tc dbSNP:35944977
1633 1633 -, gt dbSNP:200962122
1633 1633 -, gt dbSNP:386545301
1659 1659 -, c dbSNP:34607064
1671 1671 c, g dbSNP:554283011
1677 1677 a, c dbSNP:17879353
1698 1698 c, g dbSNP:1042535
1698 1698 cg, ga dbSNP:371242826
1729 1729 c, t dbSNP:773742778
1738 1738 -, c dbSNP:34182553
1760 1760 c, t dbSNP:568571322
1762 1762 c, t dbSNP:563401383
1818 1818 -, c dbSNP:778421206
1818 1818 -, c dbSNP:368059785
1818 1818 c, t dbSNP:199729221
1827 1827 c, t dbSNP:547075078
1836 1836 c, t dbSNP:376415575
1836 1836 -, t dbSNP:200757381
1837 1837 c, t dbSNP:200378797
1846 1846 c, t dbSNP:564370767
1861 1861 -, t dbSNP:35940853
1889 1889 c, t dbSNP:552520476
1890 1890 a, g dbSNP:17884306
1919 1919 c, t dbSNP:17884586
1927 1927 c, t dbSNP:541641686
1950 1950 a, g dbSNP:35659787
2000 2000 a, g dbSNP:55817367
2037 2037 a, g dbSNP:746517601
2055 2055 g, t dbSNP:540817365
2060 2060 a, t dbSNP:373069673
2120 2120 cc, gg dbSNP:34734132
2127 2127 a, g dbSNP:576851964
2134 2134 c, t dbSNP:114831472
2137 2137 c, t dbSNP:779644413
2161 2161 a, t dbSNP:139396032
2239 2239 a, c dbSNP:78378222

Target ORF information:

RefSeq Version NM_001276697
Organism Homo sapiens (human)
Definition Homo sapiens tumor protein p53 (TP53), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20873
Accession Version NM_001276698.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 549bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cellular tumor antigen p53 isoform k
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC087388.9, DQ186651.1 and AK223026.1. Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. Transcript Variant: This variant (6) uses an alternate promoter and lacks multiple 5' exons, compared to variant 1. This variant can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (k, also known as delta160p53beta) results from translation initiation at the downstream start codon. It has a shorter N-terminus and a distinct C-terminus, compared to isoform a. This variant is supported by data in PMID:16131611. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## CDS uses downstream in-frame AUG :: experimental evidence (PMID:20937277) NMD candidate :: translation inferred ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: DQ186651.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)135..137(+)
Misc Feature(2)279..281(+)
Misc Feature(3)360..746(+)
Misc Feature(4)408..608(+)
Misc Feature(5)411..425(+)
Misc Feature(6)597..722(+)
Exon (1)1..441
Gene Synonym:
Exon (2)442..554
Gene Synonym:
Exon (3)555..664
Gene Synonym:
Exon (4)665..801
Gene Synonym:
Exon (5)802..875
Gene Synonym:
Exon (6)876..1008
Gene Synonym:
Exon (7)1009..1115
Gene Synonym:
Exon (8)1116..2404
Gene Synonym:
Position Chain Variation Link
19 19 a, g dbSNP:530780060
40 40 a, c dbSNP:563612371
67 67 -, ag dbSNP:17880765
83 83 -, aaa dbSNP:5819162
87 87 a, c dbSNP:75785681
97 97 -, aaaa dbSNP:754750418
97 97 -, aaa dbSNP:752947053
97 97 a, g dbSNP:75821853
98 98 -, aaa dbSNP:141204613
101 101 -, gaa dbSNP:376546152
104 104 a, g dbSNP:77624624
133 133 c, t dbSNP:9895829
141 141 a, g dbSNP:35850753
157 157 a, t dbSNP:145153611
167 167 a, g dbSNP:2909430
172 172 c, t dbSNP:113530090
189 189 a, g dbSNP:537058017
191 191 c, g dbSNP:2856920
211 211 g, t dbSNP:774330271
218 218 c, t dbSNP:770686190
223 223 c, t dbSNP:576912263
235 235 c, t dbSNP:773029752
240 240 -, t dbSNP:756417643
241 241 c, t dbSNP:376713749
247 247 g, t dbSNP:747705704
256 256 -, a dbSNP:751253294
256 256 a, g dbSNP:786202799
262 262 c, t dbSNP:730881999
268 268 c, t dbSNP:137852792
272 272 c, t dbSNP:781537596
273 273 a, t dbSNP:587782160
275 275 a, c dbSNP:769270327
276 276 -, aagatgttttgccaac dbSNP:786203589
276 276 a, g dbSNP:747342068
280 280 c, t dbSNP:28934873
282 282 c, t dbSNP:267605077
283 283 g, t dbSNP:780442292
286 286 a, g dbSNP:587781991
290 290 a, c, g dbSNP:758781593
294 294 c, g dbSNP:28934875
295 295 -, c dbSNP:137852794
295 295 c, t dbSNP:750600586
301 301 a, c dbSNP:786202561
304 304 a, g dbSNP:587781288
307 307 c, t dbSNP:779196500
309 309 a, g, t dbSNP:587782620
312 312 c, t dbSNP:757274881
313 313 a, c dbSNP:786203071
314 314 a, g dbSNP:786201419
315 315 c, t dbSNP:786203928
316 316 c, t dbSNP:587782197
318 318 g, t dbSNP:786203064
329 329 -, cacacccccgccc dbSNP:587782393
330 330 -, acacccccgccc dbSNP:137852790
332 332 -, acccccgccc dbSNP:137852791
332 332 a, g dbSNP:754020850
333 333 a, c, t dbSNP:28934874
336 336 c, t dbSNP:767328513
337 337 -, c dbSNP:730882019
337 337 c, t dbSNP:587782705
341 341 c, t dbSNP:72661116
342 342 a, g dbSNP:137852789
343 343 a, g dbSNP:762846821
344 344 c, t dbSNP:137852793
345 345 a, g dbSNP:772683278
346 346 c, g dbSNP:786202752
347 347 a, c dbSNP:786202992
348 348 c, t dbSNP:563378859
349 349 a, g dbSNP:371524413
350 350 c, t dbSNP:761222871
351 351 a, g, t dbSNP:121912654
354 354 c, t dbSNP:587780068
355 355 a, g dbSNP:587782144
356 356 c, t dbSNP:139200646
357 357 gc, tt dbSNP:730882022
357 357 c, g dbSNP:730882000
360 360 a, t dbSNP:377274728
362 362 a, g dbSNP:772354334
363 363 a, g dbSNP:193920817
367 367 g, t dbSNP:587780069
369 369 g, t dbSNP:786203436
370 370 a, g dbSNP:148924904
375 375 c, t dbSNP:730882001
386 386 c, t dbSNP:746293837
390 390 a, g dbSNP:587780729
391 391 c, t dbSNP:779000871
392 392 a, g dbSNP:757544615
393 393 a, g dbSNP:587781845
397 397 -, gaggt dbSNP:786202514
398 398 g, t dbSNP:749309577
405 405 c, g, t dbSNP:138729528
406 406 a, g, t dbSNP:28934578
409 409 a, g dbSNP:786202962
411 411 c, t dbSNP:147002414
412 412 c, g dbSNP:751477326
414 414 -, ccc dbSNP:786202525
417 417 c, t dbSNP:587780070
423 423 c, t dbSNP:587782596
424 424 a, g, t dbSNP:397514495
432 432 a, g dbSNP:72661117
436 436 a, g dbSNP:150607408
437 437 c, t dbSNP:367560109
440 440 a, c, t dbSNP:375275361
441 441 a, g dbSNP:776167460
448 448 c, t dbSNP:121912665
449 449 a, c dbSNP:55764374
454 454 c, g dbSNP:587778718
457 457 a, g dbSNP:730882002
460 460 a, g, t dbSNP:786201838
462 462 c, t dbSNP:587780071
464 464 c, t dbSNP:370216745
466 466 c, t dbSNP:760043106
468 468 c, t dbSNP:397516435
469 469 g, t dbSNP:483352697
471 471 a, g dbSNP:786204041
485 485 g, t dbSNP:730882024
486 486 c, t dbSNP:587780072
487 487 a, g, t dbSNP:587778719
489 489 a, g dbSNP:730882003
494 494 a, g dbSNP:749629973
497 497 a, t dbSNP:786202222
500 500 a, g dbSNP:142813240
509 509 -, aa dbSNP:587776768
519 519 c, t dbSNP:397516436
520 520 a, g dbSNP:587778720
521 521 a, g, t dbSNP:1800372
524 524 c, g, t dbSNP:587781386
526 526 c, g dbSNP:587782177
528 528 a, g dbSNP:730882025
530 530 c, g dbSNP:199693249
531 531 a, g dbSNP:35163653
533 533 -, ggtgccctatgagccg dbSNP:786202315
536 536 a, g dbSNP:753630563
539 539 a, c dbSNP:786201859
540 540 c, t dbSNP:530941076
541 541 a, c, g dbSNP:121912666
543 543 a, g dbSNP:786201592
547 547 c, t dbSNP:146340390
548 548 a, g, t dbSNP:72661118
550 550 a, c dbSNP:138983188
554 554 a, g dbSNP:267605076
555 555 c, g dbSNP:746504075
567 567 -, tgtaccac dbSNP:730882016
577 577 c, t dbSNP:587781589
578 578 c, t dbSNP:786202888
583 583 a, g dbSNP:587780073
585 585 a, t dbSNP:786204145
586 586 a, g dbSNP:144340710
587 587 c, t dbSNP:750893877
588 588 g, t dbSNP:587782289
589 589 a, c dbSNP:730882026
591 591 a, g dbSNP:730882004
592 592 a, t dbSNP:765848205
593 593 a, g dbSNP:587782664
595 595 a, g dbSNP:730882005
596 596 g, t dbSNP:193920789
600 600 -, agttcctgcatgggcggcatgaac dbSNP:397516437
602 602 c, t dbSNP:764342812
604 604 c, g, t dbSNP:28934573
607 607 a, c, g dbSNP:121912655
608 608 c, t dbSNP:375874539
609 609 a, c dbSNP:786203117
610 610 c, t dbSNP:730882006
614 614 c, t dbSNP:759625762
615 615 a, g, t dbSNP:28934575
616 616 a, g, t dbSNP:121912656
618 618 a, c, g dbSNP:483352695
619 619 g, t dbSNP:587780074
622 622 a, t dbSNP:786201762
623 623 c, t dbSNP:786202448
624 624 c, t dbSNP:121912651
625 625 a, g dbSNP:11540652
627 627 a, t dbSNP:587782082
628 628 a, g dbSNP:587782329
629 629 g, t dbSNP:28934571
633 633 a, c dbSNP:730882007
634 634 g, t dbSNP:730882027
637 637 c, t dbSNP:121912653
642 642 a, g dbSNP:746601313
648 648 a, g dbSNP:587781433
650 650 a, g dbSNP:786203563
651 651 c, t dbSNP:779761818
652 652 a, g, t dbSNP:28934577
654 654 a, g dbSNP:121912652
658 658 a, g dbSNP:745425759
664 664 c, g dbSNP:786203396
666 666 a, g, t dbSNP:200579969
669 669 a, g dbSNP:72661119
671 671 c, t dbSNP:770598448
679 679 a, g dbSNP:193920774
681 681 c, t dbSNP:55832599
682 682 a, g dbSNP:587780075
690 690 -, tttgaggtgc dbSNP:587781987
696 696 a, g, t dbSNP:121912657
698 698 a, g dbSNP:756421198
699 699 a, c, t dbSNP:121913343
700 700 a, g, t dbSNP:28934576
709 709 c, g dbSNP:786202082
712 712 a, g, t dbSNP:763098116
714 714 c, g dbSNP:17849781
719 719 a, g dbSNP:786201322
720 720 agagaccggcg, ca dbSNP:587781564
720 720 a, c dbSNP:753660142
721 721 c, g, t dbSNP:121912660
723 723 a, g dbSNP:764146326
724 724 a, g, t dbSNP:587781525
726 726 c, g, t dbSNP:28934574
727 727 g, t dbSNP:730882008
729 729 a, c, t dbSNP:149633775
730 730 -, tcctgggagagaccggcg dbSNP:786204061
730 730 a, g dbSNP:371409680
734 734 a, c dbSNP:786203004
735 735 a, g dbSNP:112431538
736 736 a, t dbSNP:121912667
738 738 a, g dbSNP:786201059
741 741 a, g dbSNP:587782006
743 743 c, g dbSNP:748891343
749 749 c, t dbSNP:778138282
750 750 c, t dbSNP:770374782
751 751 a, g dbSNP:55819519
754 754 a, g dbSNP:781490101
755 755 c, g dbSNP:372613518
757 757 a, t dbSNP:121912663
759 759 a, g, t dbSNP:587780076
766 766 c, t dbSNP:751713111
767 767 c, t dbSNP:200073907
768 768 c, t dbSNP:672601296
769 769 a, g dbSNP:483352696
770 770 c, t dbSNP:758395031
773 773 c, t dbSNP:750578863
774 774 a, g, t dbSNP:201744589
776 776 -, ag dbSNP:761885916
776 776 a, g dbSNP:756123992
777 777 c, t dbSNP:752701561
782 782 c, t dbSNP:767356182
785 785 a, g dbSNP:72661120
788 788 -, g dbSNP:786202055
789 789 a, g dbSNP:587782391
792 792 a, g dbSNP:587782654
798 798 c, t dbSNP:121913344
806 806 a, g dbSNP:786202546
814 814 a, g dbSNP:56184981
815 815 c, t dbSNP:201601993
817 817 c, g dbSNP:145151284
823 823 c, t dbSNP:751440465
824 824 a, c dbSNP:765930028
825 825 a, t dbSNP:762620193
828 828 a, c dbSNP:772773208
831 831 a, c dbSNP:764735889
836 836 a, c dbSNP:761322293
851 851 a, g dbSNP:672601297
856 856 g, t dbSNP:121912659
875 875 a, g dbSNP:11575996
878 878 c, t dbSNP:750031971
879 879 c, g dbSNP:764851816
896 896 a, c dbSNP:761303879
903 903 a, g, t dbSNP:3021068
907 907 a, c dbSNP:764562217
908 908 a, g dbSNP:761121529
914 914 a, g dbSNP:17883348
915 915 c, t dbSNP:772425309
922 922 a, g dbSNP:768929781
924 924 g, t dbSNP:576532147
964 964 c, t dbSNP:554738122
965 965 a, g dbSNP:771319678
967 967 c, t dbSNP:749361930
970 970 a, c, t dbSNP:1642789
979 979 c, t dbSNP:770028766
987 987 c, g, t dbSNP:200274944
989 989 c, t dbSNP:758194998
990 990 a, g, t dbSNP:201293647
992 992 c, t dbSNP:756952434
993 993 a, g dbSNP:372821099
1012 1012 c, g, t dbSNP:769934890
1013 1013 a, g dbSNP:573154688
1015 1015 a, c, g dbSNP:730882028
1017 1017 a, g dbSNP:786203531
1018 1018 c, t dbSNP:375444154
1019 1019 a, g dbSNP:771939956
1024 1024 c, t dbSNP:587782529
1025 1025 a, c, g, t dbSNP:121912664
1029 1029 c, g, t dbSNP:150293825
1030 1030 a, c, g dbSNP:17882252
1039 1039 c, t dbSNP:730882029
1040 1040 a, g dbSNP:375338359
1042 1042 c, g dbSNP:375573770
1046 1046 c, t dbSNP:121912662
1047 1047 c, g dbSNP:752189180
1055 1055 a, c dbSNP:397516434
1063 1063 c, g dbSNP:768046010
1066 1066 a, g dbSNP:141402957
1075 1075 a, c dbSNP:755394212
1076 1076 a, g dbSNP:752142489
1081 1081 c, g dbSNP:766786605
1085 1085 a, g dbSNP:763426446
1087 1087 a, g dbSNP:587782237
1088 1088 a, t dbSNP:773553186
1092 1092 a, g dbSNP:539224556
1093 1093 a, g dbSNP:786203298
1094 1094 c, g, t dbSNP:35993958
1097 1097 a, g dbSNP:587781663
1100 1100 g, t dbSNP:768803947
1102 1102 a, g dbSNP:745751553
1108 1108 c, t dbSNP:267605075
1111 1111 g, t dbSNP:17881470
1115 1115 a, g dbSNP:749150541
1117 1117 c, t dbSNP:786204227
1128 1128 a, c dbSNP:765530090
1135 1135 a, c, g, t dbSNP:587781858
1140 1140 a, g dbSNP:764011631
1140 1140 -, g dbSNP:730882017
1143 1143 c, t dbSNP:760820708
1144 1144 -, a dbSNP:770970987
1144 1144 a, c dbSNP:774269719
1147 1147 c, t dbSNP:80184930
1150 1150 a, c, t dbSNP:749061599
1152 1152 c, t dbSNP:786202368
1162 1162 c, t dbSNP:150842067
1164 1164 c, t dbSNP:373710656
1165 1165 a, g dbSNP:730882009
1178 1178 a, c dbSNP:587781736
1180 1180 g, t dbSNP:587783064
1182 1182 -, g dbSNP:749817236
1190 1190 a, c dbSNP:769664911
1203 1203 a, c, t dbSNP:369567704
1206 1206 a, c dbSNP:8065799
1212 1212 c, t dbSNP:374294340
1227 1227 g, t dbSNP:746581308
1231 1231 c, t dbSNP:545818827
1234 1234 a, g, t dbSNP:1042526
1235 1235 c, t dbSNP:759018180
1248 1248 c, t dbSNP:760698953
1302 1302 c, t dbSNP:35919705
1303 1303 a, g dbSNP:375913211
1339 1339 a, g dbSNP:771458013
1341 1341 a, g dbSNP:371002418
1391 1391 -, a dbSNP:140346117
1391 1391 a, g dbSNP:560862596
1402 1402 a, g dbSNP:16956880
1472 1472 -, a dbSNP:771579509
1506 1506 g, t dbSNP:79516338
1511 1511 a, g dbSNP:34486624
1525 1525 a, g dbSNP:17881366
1554 1554 c, t dbSNP:534624315
1584 1584 a, c dbSNP:558662880
1606 1606 a, c dbSNP:191918079
1624 1624 g, t dbSNP:774263885
1664 1664 a, c dbSNP:377621596
1678 1678 a, t dbSNP:546208790
1682 1682 a, g dbSNP:4968187
1688 1688 a, g dbSNP:916131
1699 1699 c, t dbSNP:569519287
1711 1711 c, t dbSNP:916132
1726 1726 c, g dbSNP:551213894
1731 1731 ct, tc dbSNP:35944977
1766 1766 -, gt dbSNP:200962122
1766 1766 -, gt dbSNP:386545301
1792 1792 -, c dbSNP:34607064
1804 1804 c, g dbSNP:554283011
1810 1810 a, c dbSNP:17879353
1831 1831 c, g dbSNP:1042535
1831 1831 cg, ga dbSNP:371242826
1862 1862 c, t dbSNP:773742778
1871 1871 -, c dbSNP:34182553
1893 1893 c, t dbSNP:568571322
1895 1895 c, t dbSNP:563401383
1951 1951 -, c dbSNP:778421206
1951 1951 -, c dbSNP:368059785
1951 1951 c, t dbSNP:199729221
1960 1960 c, t dbSNP:547075078
1969 1969 c, t dbSNP:376415575
1969 1969 -, t dbSNP:200757381
1970 1970 c, t dbSNP:200378797
1979 1979 c, t dbSNP:564370767
1994 1994 -, t dbSNP:35940853
2022 2022 c, t dbSNP:552520476
2023 2023 a, g dbSNP:17884306
2052 2052 c, t dbSNP:17884586
2060 2060 c, t dbSNP:541641686
2083 2083 a, g dbSNP:35659787
2133 2133 a, g dbSNP:55817367
2170 2170 a, g dbSNP:746517601
2188 2188 g, t dbSNP:540817365
2193 2193 a, t dbSNP:373069673
2253 2253 cc, gg dbSNP:34734132
2260 2260 a, g dbSNP:576851964
2267 2267 c, t dbSNP:114831472
2270 2270 c, t dbSNP:779644413
2294 2294 a, t dbSNP:139396032
2372 2372 a, c dbSNP:78378222

Target ORF information:

RefSeq Version NM_001276698
Organism Homo sapiens (human)
Definition Homo sapiens tumor protein p53 (TP53), transcript variant 6, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21229
Accession Version NM_001276699.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 564bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cellular tumor antigen p53 isoform l
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC087388.9, DQ186652.1 and AK223026.1. Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. Transcript Variant: This variant (7) uses an alternate promoter and lacks multiple 5' exons, compared to variant 1. This variant can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (l, also known as delta160p53gamma) results from translation initiation at the downstream start codon. It has a shorter N-terminus and a distinct C-terminus, compared to isoform a. This variant is supported by data in PMID:16131611. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## CDS uses downstream in-frame AUG :: experimental evidence (PMID:20937277) NMD candidate :: translation inferred ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: DQ186652.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA2155371 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)135..137(+)
Misc Feature(2)279..281(+)
Misc Feature(3)360..746(+)
Misc Feature(4)408..608(+)
Misc Feature(5)411..425(+)
Misc Feature(6)597..722(+)
Exon (1)1..441
Gene Synonym:
Exon (2)442..554
Gene Synonym:
Exon (3)555..664
Gene Synonym:
Exon (4)665..801
Gene Synonym:
Exon (5)802..875
Gene Synonym:
Exon (6)876..935
Gene Synonym:
Exon (7)936..1042
Gene Synonym:
Exon (8)1043..2331
Gene Synonym:
Position Chain Variation Link
19 19 a, g dbSNP:530780060
40 40 a, c dbSNP:563612371
67 67 -, ag dbSNP:17880765
83 83 -, aaa dbSNP:5819162
87 87 a, c dbSNP:75785681
97 97 -, aaaa dbSNP:754750418
97 97 -, aaa dbSNP:752947053
97 97 a, g dbSNP:75821853
98 98 -, aaa dbSNP:141204613
101 101 -, gaa dbSNP:376546152
104 104 a, g dbSNP:77624624
133 133 c, t dbSNP:9895829
141 141 a, g dbSNP:35850753
157 157 a, t dbSNP:145153611
167 167 a, g dbSNP:2909430
172 172 c, t dbSNP:113530090
189 189 a, g dbSNP:537058017
191 191 c, g dbSNP:2856920
211 211 g, t dbSNP:774330271
218 218 c, t dbSNP:770686190
223 223 c, t dbSNP:576912263
235 235 c, t dbSNP:773029752
240 240 -, t dbSNP:756417643
241 241 c, t dbSNP:376713749
247 247 g, t dbSNP:747705704
256 256 -, a dbSNP:751253294
256 256 a, g dbSNP:786202799
262 262 c, t dbSNP:730881999
268 268 c, t dbSNP:137852792
272 272 c, t dbSNP:781537596
273 273 a, t dbSNP:587782160
275 275 a, c dbSNP:769270327
276 276 -, aagatgttttgccaac dbSNP:786203589
276 276 a, g dbSNP:747342068
280 280 c, t dbSNP:28934873
282 282 c, t dbSNP:267605077
283 283 g, t dbSNP:780442292
286 286 a, g dbSNP:587781991
290 290 a, c, g dbSNP:758781593
294 294 c, g dbSNP:28934875
295 295 -, c dbSNP:137852794
295 295 c, t dbSNP:750600586
301 301 a, c dbSNP:786202561
304 304 a, g dbSNP:587781288
307 307 c, t dbSNP:779196500
309 309 a, g, t dbSNP:587782620
312 312 c, t dbSNP:757274881
313 313 a, c dbSNP:786203071
314 314 a, g dbSNP:786201419
315 315 c, t dbSNP:786203928
316 316 c, t dbSNP:587782197
318 318 g, t dbSNP:786203064
329 329 -, cacacccccgccc dbSNP:587782393
330 330 -, acacccccgccc dbSNP:137852790
332 332 -, acccccgccc dbSNP:137852791
332 332 a, g dbSNP:754020850
333 333 a, c, t dbSNP:28934874
336 336 c, t dbSNP:767328513
337 337 -, c dbSNP:730882019
337 337 c, t dbSNP:587782705
341 341 c, t dbSNP:72661116
342 342 a, g dbSNP:137852789
343 343 a, g dbSNP:762846821
344 344 c, t dbSNP:137852793
345 345 a, g dbSNP:772683278
346 346 c, g dbSNP:786202752
347 347 a, c dbSNP:786202992
348 348 c, t dbSNP:563378859
349 349 a, g dbSNP:371524413
350 350 c, t dbSNP:761222871
351 351 a, g, t dbSNP:121912654
354 354 c, t dbSNP:587780068
355 355 a, g dbSNP:587782144
356 356 c, t dbSNP:139200646
357 357 gc, tt dbSNP:730882022
357 357 c, g dbSNP:730882000
360 360 a, t dbSNP:377274728
362 362 a, g dbSNP:772354334
363 363 a, g dbSNP:193920817
367 367 g, t dbSNP:587780069
369 369 g, t dbSNP:786203436
370 370 a, g dbSNP:148924904
375 375 c, t dbSNP:730882001
386 386 c, t dbSNP:746293837
390 390 a, g dbSNP:587780729
391 391 c, t dbSNP:779000871
392 392 a, g dbSNP:757544615
393 393 a, g dbSNP:587781845
397 397 -, gaggt dbSNP:786202514
398 398 g, t dbSNP:749309577
405 405 c, g, t dbSNP:138729528
406 406 a, g, t dbSNP:28934578
409 409 a, g dbSNP:786202962
411 411 c, t dbSNP:147002414
412 412 c, g dbSNP:751477326
414 414 -, ccc dbSNP:786202525
417 417 c, t dbSNP:587780070
423 423 c, t dbSNP:587782596
424 424 a, g, t dbSNP:397514495
432 432 a, g dbSNP:72661117
436 436 a, g dbSNP:150607408
437 437 c, t dbSNP:367560109
440 440 a, c, t dbSNP:375275361
441 441 a, g dbSNP:776167460
448 448 c, t dbSNP:121912665
449 449 a, c dbSNP:55764374
454 454 c, g dbSNP:587778718
457 457 a, g dbSNP:730882002
460 460 a, g, t dbSNP:786201838
462 462 c, t dbSNP:587780071
464 464 c, t dbSNP:370216745
466 466 c, t dbSNP:760043106
468 468 c, t dbSNP:397516435
469 469 g, t dbSNP:483352697
471 471 a, g dbSNP:786204041
485 485 g, t dbSNP:730882024
486 486 c, t dbSNP:587780072
487 487 a, g, t dbSNP:587778719
489 489 a, g dbSNP:730882003
494 494 a, g dbSNP:749629973
497 497 a, t dbSNP:786202222
500 500 a, g dbSNP:142813240
509 509 -, aa dbSNP:587776768
519 519 c, t dbSNP:397516436
520 520 a, g dbSNP:587778720
521 521 a, g, t dbSNP:1800372
524 524 c, g, t dbSNP:587781386
526 526 c, g dbSNP:587782177
528 528 a, g dbSNP:730882025
530 530 c, g dbSNP:199693249
531 531 a, g dbSNP:35163653
533 533 -, ggtgccctatgagccg dbSNP:786202315
536 536 a, g dbSNP:753630563
539 539 a, c dbSNP:786201859
540 540 c, t dbSNP:530941076
541 541 a, c, g dbSNP:121912666
543 543 a, g dbSNP:786201592
547 547 c, t dbSNP:146340390
548 548 a, g, t dbSNP:72661118
550 550 a, c dbSNP:138983188
554 554 a, g dbSNP:267605076
555 555 c, g dbSNP:746504075
567 567 -, tgtaccac dbSNP:730882016
577 577 c, t dbSNP:587781589
578 578 c, t dbSNP:786202888
583 583 a, g dbSNP:587780073
585 585 a, t dbSNP:786204145
586 586 a, g dbSNP:144340710
587 587 c, t dbSNP:750893877
588 588 g, t dbSNP:587782289
589 589 a, c dbSNP:730882026
591 591 a, g dbSNP:730882004
592 592 a, t dbSNP:765848205
593 593 a, g dbSNP:587782664
595 595 a, g dbSNP:730882005
596 596 g, t dbSNP:193920789
600 600 -, agttcctgcatgggcggcatgaac dbSNP:397516437
602 602 c, t dbSNP:764342812
604 604 c, g, t dbSNP:28934573
607 607 a, c, g dbSNP:121912655
608 608 c, t dbSNP:375874539
609 609 a, c dbSNP:786203117
610 610 c, t dbSNP:730882006
614 614 c, t dbSNP:759625762
615 615 a, g, t dbSNP:28934575
616 616 a, g, t dbSNP:121912656
618 618 a, c, g dbSNP:483352695
619 619 g, t dbSNP:587780074
622 622 a, t dbSNP:786201762
623 623 c, t dbSNP:786202448
624 624 c, t dbSNP:121912651
625 625 a, g dbSNP:11540652
627 627 a, t dbSNP:587782082
628 628 a, g dbSNP:587782329
629 629 g, t dbSNP:28934571
633 633 a, c dbSNP:730882007
634 634 g, t dbSNP:730882027
637 637 c, t dbSNP:121912653
642 642 a, g dbSNP:746601313
648 648 a, g dbSNP:587781433
650 650 a, g dbSNP:786203563
651 651 c, t dbSNP:779761818
652 652 a, g, t dbSNP:28934577
654 654 a, g dbSNP:121912652
658 658 a, g dbSNP:745425759
664 664 c, g dbSNP:786203396
666 666 a, g, t dbSNP:200579969
669 669 a, g dbSNP:72661119
671 671 c, t dbSNP:770598448
679 679 a, g dbSNP:193920774
681 681 c, t dbSNP:55832599
682 682 a, g dbSNP:587780075
690 690 -, tttgaggtgc dbSNP:587781987
696 696 a, g, t dbSNP:121912657
698 698 a, g dbSNP:756421198
699 699 a, c, t dbSNP:121913343
700 700 a, g, t dbSNP:28934576
709 709 c, g dbSNP:786202082
712 712 a, g, t dbSNP:763098116
714 714 c, g dbSNP:17849781
719 719 a, g dbSNP:786201322
720 720 agagaccggcg, ca dbSNP:587781564
720 720 a, c dbSNP:753660142
721 721 c, g, t dbSNP:121912660
723 723 a, g dbSNP:764146326
724 724 a, g, t dbSNP:587781525
726 726 c, g, t dbSNP:28934574
727 727 g, t dbSNP:730882008
729 729 a, c, t dbSNP:149633775
730 730 -, tcctgggagagaccggcg dbSNP:786204061
730 730 a, g dbSNP:371409680
734 734 a, c dbSNP:786203004
735 735 a, g dbSNP:112431538
736 736 a, t dbSNP:121912667
738 738 a, g dbSNP:786201059
741 741 a, g dbSNP:587782006
743 743 c, g dbSNP:748891343
749 749 c, t dbSNP:778138282
750 750 c, t dbSNP:770374782
751 751 a, g dbSNP:55819519
754 754 a, g dbSNP:781490101
755 755 c, g dbSNP:372613518
757 757 a, t dbSNP:121912663
759 759 a, g, t dbSNP:587780076
766 766 c, t dbSNP:751713111
767 767 c, t dbSNP:200073907
768 768 c, t dbSNP:672601296
769 769 a, g dbSNP:483352696
770 770 c, t dbSNP:758395031
773 773 c, t dbSNP:750578863
774 774 a, g, t dbSNP:201744589
776 776 -, ag dbSNP:761885916
776 776 a, g dbSNP:756123992
777 777 c, t dbSNP:752701561
782 782 c, t dbSNP:767356182
785 785 a, g dbSNP:72661120
788 788 -, g dbSNP:786202055
789 789 a, g dbSNP:587782391
792 792 a, g dbSNP:587782654
798 798 c, t dbSNP:121913344
806 806 a, g dbSNP:786202546
814 814 a, g dbSNP:56184981
815 815 c, t dbSNP:201601993
817 817 c, g dbSNP:145151284
823 823 c, t dbSNP:751440465
824 824 a, c dbSNP:765930028
825 825 a, t dbSNP:762620193
828 828 a, c dbSNP:772773208
831 831 a, c dbSNP:764735889
836 836 a, c dbSNP:761322293
851 851 a, g dbSNP:672601297
856 856 g, t dbSNP:121912659
875 875 a, g dbSNP:11575996
891 891 c, t dbSNP:554738122
892 892 a, g dbSNP:771319678
894 894 c, t dbSNP:749361930
897 897 a, c, t dbSNP:1642789
906 906 c, t dbSNP:770028766
914 914 c, g, t dbSNP:200274944
916 916 c, t dbSNP:758194998
917 917 a, g, t dbSNP:201293647
919 919 c, t dbSNP:756952434
920 920 a, g dbSNP:372821099
939 939 c, g, t dbSNP:769934890
940 940 a, g dbSNP:573154688
942 942 a, c, g dbSNP:730882028
944 944 a, g dbSNP:786203531
945 945 c, t dbSNP:375444154
946 946 a, g dbSNP:771939956
951 951 c, t dbSNP:587782529
952 952 a, c, g, t dbSNP:121912664
956 956 c, g, t dbSNP:150293825
957 957 a, c, g dbSNP:17882252
966 966 c, t dbSNP:730882029
967 967 a, g dbSNP:375338359
969 969 c, g dbSNP:375573770
973 973 c, t dbSNP:121912662
974 974 c, g dbSNP:752189180
982 982 a, c dbSNP:397516434
990 990 c, g dbSNP:768046010
993 993 a, g dbSNP:141402957
1002 1002 a, c dbSNP:755394212
1003 1003 a, g dbSNP:752142489
1008 1008 c, g dbSNP:766786605
1012 1012 a, g dbSNP:763426446
1014 1014 a, g dbSNP:587782237
1015 1015 a, t dbSNP:773553186
1019 1019 a, g dbSNP:539224556
1020 1020 a, g dbSNP:786203298
1021 1021 c, g, t dbSNP:35993958
1024 1024 a, g dbSNP:587781663
1027 1027 g, t dbSNP:768803947
1029 1029 a, g dbSNP:745751553
1035 1035 c, t dbSNP:267605075
1038 1038 g, t dbSNP:17881470
1042 1042 a, g dbSNP:749150541
1044 1044 c, t dbSNP:786204227
1055 1055 a, c dbSNP:765530090
1062 1062 a, c, g, t dbSNP:587781858
1067 1067 a, g dbSNP:764011631
1067 1067 -, g dbSNP:730882017
1070 1070 c, t dbSNP:760820708
1071 1071 -, a dbSNP:770970987
1071 1071 a, c dbSNP:774269719
1074 1074 c, t dbSNP:80184930
1077 1077 a, c, t dbSNP:749061599
1079 1079 c, t dbSNP:786202368
1089 1089 c, t dbSNP:150842067
1091 1091 c, t dbSNP:373710656
1092 1092 a, g dbSNP:730882009
1105 1105 a, c dbSNP:587781736
1107 1107 g, t dbSNP:587783064
1109 1109 -, g dbSNP:749817236
1117 1117 a, c dbSNP:769664911
1130 1130 a, c, t dbSNP:369567704
1133 1133 a, c dbSNP:8065799
1139 1139 c, t dbSNP:374294340
1154 1154 g, t dbSNP:746581308
1158 1158 c, t dbSNP:545818827
1161 1161 a, g, t dbSNP:1042526
1162 1162 c, t dbSNP:759018180
1175 1175 c, t dbSNP:760698953
1229 1229 c, t dbSNP:35919705
1230 1230 a, g dbSNP:375913211
1266 1266 a, g dbSNP:771458013
1268 1268 a, g dbSNP:371002418
1318 1318 -, a dbSNP:140346117
1318 1318 a, g dbSNP:560862596
1329 1329 a, g dbSNP:16956880
1399 1399 -, a dbSNP:771579509
1433 1433 g, t dbSNP:79516338
1438 1438 a, g dbSNP:34486624
1452 1452 a, g dbSNP:17881366
1481 1481 c, t dbSNP:534624315
1511 1511 a, c dbSNP:558662880
1533 1533 a, c dbSNP:191918079
1551 1551 g, t dbSNP:774263885
1591 1591 a, c dbSNP:377621596
1605 1605 a, t dbSNP:546208790
1609 1609 a, g dbSNP:4968187
1615 1615 a, g dbSNP:916131
1626 1626 c, t dbSNP:569519287
1638 1638 c, t dbSNP:916132
1653 1653 c, g dbSNP:551213894
1658 1658 ct, tc dbSNP:35944977
1693 1693 -, gt dbSNP:200962122
1693 1693 -, gt dbSNP:386545301
1719 1719 -, c dbSNP:34607064
1731 1731 c, g dbSNP:554283011
1737 1737 a, c dbSNP:17879353
1758 1758 c, g dbSNP:1042535
1758 1758 cg, ga dbSNP:371242826
1789 1789 c, t dbSNP:773742778
1798 1798 -, c dbSNP:34182553
1820 1820 c, t dbSNP:568571322
1822 1822 c, t dbSNP:563401383
1878 1878 -, c dbSNP:778421206
1878 1878 -, c dbSNP:368059785
1878 1878 c, t dbSNP:199729221
1887 1887 c, t dbSNP:547075078
1896 1896 c, t dbSNP:376415575
1896 1896 -, t dbSNP:200757381
1897 1897 c, t dbSNP:200378797
1906 1906 c, t dbSNP:564370767
1921 1921 -, t dbSNP:35940853
1949 1949 c, t dbSNP:552520476
1950 1950 a, g dbSNP:17884306
1979 1979 c, t dbSNP:17884586
1987 1987 c, t dbSNP:541641686
2010 2010 a, g dbSNP:35659787
2060 2060 a, g dbSNP:55817367
2097 2097 a, g dbSNP:746517601
2115 2115 g, t dbSNP:540817365
2120 2120 a, t dbSNP:373069673
2180 2180 cc, gg dbSNP:34734132
2187 2187 a, g dbSNP:576851964
2194 2194 c, t dbSNP:114831472
2197 2197 c, t dbSNP:779644413
2221 2221 a, t dbSNP:139396032
2299 2299 a, c dbSNP:78378222

Target ORF information:

RefSeq Version NM_001276699
Organism Homo sapiens (human)
Definition Homo sapiens tumor protein p53 (TP53), transcript variant 7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19337
Accession Version NM_001126115.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 786bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cellular tumor antigen p53 isoform d
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC087388.9, DQ186650.1 and AK223026.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. Transcript Variant: This variant (5) uses an alternate promoter and lacks multiple 5' exons, compared to variant 1. This variant can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (d, also known as delta133p53alpha) results from translation initiation at the upstream start codon. It has a shorter N-terminus, compared to isoform a. This variant is supported by data in PMID:16131611. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ186650.1, BM467806.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)135..137(+)
Misc Feature(2)279..746(+)
Misc Feature(3)360..362(+)
Misc Feature(4)408..608(+)
Misc Feature(5)411..425(+)
Misc Feature(6)597..722(+)
Misc Feature(7)852..959(+)
Exon (1)1..441
Gene Synonym:
Exon (2)442..554
Gene Synonym:
Exon (3)555..664
Gene Synonym:
Exon (4)665..801
Gene Synonym:
Exon (5)802..875
Gene Synonym:
Exon (6)876..982
Gene Synonym:
Exon (7)983..2271
Gene Synonym:
Position Chain Variation Link
19 19 a, g dbSNP:530780060
40 40 a, c dbSNP:563612371
67 67 -, ag dbSNP:17880765
83 83 -, aaa dbSNP:5819162
87 87 a, c dbSNP:75785681
97 97 -, aaaa dbSNP:754750418
97 97 -, aaa dbSNP:752947053
97 97 a, g dbSNP:75821853
98 98 -, aaa dbSNP:141204613
101 101 -, gaa dbSNP:376546152
104 104 a, g dbSNP:77624624
133 133 c, t dbSNP:9895829
141 141 a, g dbSNP:35850753
157 157 a, t dbSNP:145153611
167 167 a, g dbSNP:2909430
172 172 c, t dbSNP:113530090
189 189 a, g dbSNP:537058017
191 191 c, g dbSNP:2856920
211 211 g, t dbSNP:774330271
218 218 c, t dbSNP:770686190
223 223 c, t dbSNP:576912263
235 235 c, t dbSNP:773029752
240 240 -, t dbSNP:756417643
241 241 c, t dbSNP:376713749
247 247 g, t dbSNP:747705704
256 256 -, a dbSNP:751253294
256 256 a, g dbSNP:786202799
262 262 c, t dbSNP:730881999
268 268 c, t dbSNP:137852792
272 272 c, t dbSNP:781537596
273 273 a, t dbSNP:587782160
275 275 a, c dbSNP:769270327
276 276 -, aagatgttttgccaac dbSNP:786203589
276 276 a, g dbSNP:747342068
280 280 c, t dbSNP:28934873
282 282 c, t dbSNP:267605077
283 283 g, t dbSNP:780442292
286 286 a, g dbSNP:587781991
290 290 a, c, g dbSNP:758781593
294 294 c, g dbSNP:28934875
295 295 -, c dbSNP:137852794
295 295 c, t dbSNP:750600586
301 301 a, c dbSNP:786202561
304 304 a, g dbSNP:587781288
307 307 c, t dbSNP:779196500
309 309 a, g, t dbSNP:587782620
312 312 c, t dbSNP:757274881
313 313 a, c dbSNP:786203071
314 314 a, g dbSNP:786201419
315 315 c, t dbSNP:786203928
316 316 c, t dbSNP:587782197
318 318 g, t dbSNP:786203064
329 329 -, cacacccccgccc dbSNP:587782393
330 330 -, acacccccgccc dbSNP:137852790
332 332 -, acccccgccc dbSNP:137852791
332 332 a, g dbSNP:754020850
333 333 a, c, t dbSNP:28934874
336 336 c, t dbSNP:767328513
337 337 -, c dbSNP:730882019
337 337 c, t dbSNP:587782705
341 341 c, t dbSNP:72661116
342 342 a, g dbSNP:137852789
343 343 a, g dbSNP:762846821
344 344 c, t dbSNP:137852793
345 345 a, g dbSNP:772683278
346 346 c, g dbSNP:786202752
347 347 a, c dbSNP:786202992
348 348 c, t dbSNP:563378859
349 349 a, g dbSNP:371524413
350 350 c, t dbSNP:761222871
351 351 a, g, t dbSNP:121912654
354 354 c, t dbSNP:587780068
355 355 a, g dbSNP:587782144
356 356 c, t dbSNP:139200646
357 357 gc, tt dbSNP:730882022
357 357 c, g dbSNP:730882000
360 360 a, t dbSNP:377274728
362 362 a, g dbSNP:772354334
363 363 a, g dbSNP:193920817
367 367 g, t dbSNP:587780069
369 369 g, t dbSNP:786203436
370 370 a, g dbSNP:148924904
375 375 c, t dbSNP:730882001
386 386 c, t dbSNP:746293837
390 390 a, g dbSNP:587780729
391 391 c, t dbSNP:779000871
392 392 a, g dbSNP:757544615
393 393 a, g dbSNP:587781845
397 397 -, gaggt dbSNP:786202514
398 398 g, t dbSNP:749309577
405 405 c, g, t dbSNP:138729528
406 406 a, g, t dbSNP:28934578
409 409 a, g dbSNP:786202962
411 411 c, t dbSNP:147002414
412 412 c, g dbSNP:751477326
414 414 -, ccc dbSNP:786202525
417 417 c, t dbSNP:587780070
423 423 c, t dbSNP:587782596
424 424 a, g, t dbSNP:397514495
432 432 a, g dbSNP:72661117
436 436 a, g dbSNP:150607408
437 437 c, t dbSNP:367560109
440 440 a, c, t dbSNP:375275361
441 441 a, g dbSNP:776167460
448 448 c, t dbSNP:121912665
449 449 a, c dbSNP:55764374
454 454 c, g dbSNP:587778718
457 457 a, g dbSNP:730882002
460 460 a, g, t dbSNP:786201838
462 462 c, t dbSNP:587780071
464 464 c, t dbSNP:370216745
466 466 c, t dbSNP:760043106
468 468 c, t dbSNP:397516435
469 469 g, t dbSNP:483352697
471 471 a, g dbSNP:786204041
485 485 g, t dbSNP:730882024
486 486 c, t dbSNP:587780072
487 487 a, g, t dbSNP:587778719
489 489 a, g dbSNP:730882003
494 494 a, g dbSNP:749629973
497 497 a, t dbSNP:786202222
500 500 a, g dbSNP:142813240
509 509 -, aa dbSNP:587776768
519 519 c, t dbSNP:397516436
520 520 a, g dbSNP:587778720
521 521 a, g, t dbSNP:1800372
524 524 c, g, t dbSNP:587781386
526 526 c, g dbSNP:587782177
528 528 a, g dbSNP:730882025
530 530 c, g dbSNP:199693249
531 531 a, g dbSNP:35163653
533 533 -, ggtgccctatgagccg dbSNP:786202315
536 536 a, g dbSNP:753630563
539 539 a, c dbSNP:786201859
540 540 c, t dbSNP:530941076
541 541 a, c, g dbSNP:121912666
543 543 a, g dbSNP:786201592
547 547 c, t dbSNP:146340390
548 548 a, g, t dbSNP:72661118
550 550 a, c dbSNP:138983188
554 554 a, g dbSNP:267605076
555 555 c, g dbSNP:746504075
567 567 -, tgtaccac dbSNP:730882016
577 577 c, t dbSNP:587781589
578 578 c, t dbSNP:786202888
583 583 a, g dbSNP:587780073
585 585 a, t dbSNP:786204145
586 586 a, g dbSNP:144340710
587 587 c, t dbSNP:750893877
588 588 g, t dbSNP:587782289
589 589 a, c dbSNP:730882026
591 591 a, g dbSNP:730882004
592 592 a, t dbSNP:765848205
593 593 a, g dbSNP:587782664
595 595 a, g dbSNP:730882005
596 596 g, t dbSNP:193920789
600 600 -, agttcctgcatgggcggcatgaac dbSNP:397516437
602 602 c, t dbSNP:764342812
604 604 c, g, t dbSNP:28934573
607 607 a, c, g dbSNP:121912655
608 608 c, t dbSNP:375874539
609 609 a, c dbSNP:786203117
610 610 c, t dbSNP:730882006
614 614 c, t dbSNP:759625762
615 615 a, g, t dbSNP:28934575
616 616 a, g, t dbSNP:121912656
618 618 a, c, g dbSNP:483352695
619 619 g, t dbSNP:587780074
622 622 a, t dbSNP:786201762
623 623 c, t dbSNP:786202448
624 624 c, t dbSNP:121912651
625 625 a, g dbSNP:11540652
627 627 a, t dbSNP:587782082
628 628 a, g dbSNP:587782329
629 629 g, t dbSNP:28934571
633 633 a, c dbSNP:730882007
634 634 g, t dbSNP:730882027
637 637 c, t dbSNP:121912653
642 642 a, g dbSNP:746601313
648 648 a, g dbSNP:587781433
650 650 a, g dbSNP:786203563
651 651 c, t dbSNP:779761818
652 652 a, g, t dbSNP:28934577
654 654 a, g dbSNP:121912652
658 658 a, g dbSNP:745425759
664 664 c, g dbSNP:786203396
666 666 a, g, t dbSNP:200579969
669 669 a, g dbSNP:72661119
671 671 c, t dbSNP:770598448
679 679 a, g dbSNP:193920774
681 681 c, t dbSNP:55832599
682 682 a, g dbSNP:587780075
690 690 -, tttgaggtgc dbSNP:587781987
696 696 a, g, t dbSNP:121912657
698 698 a, g dbSNP:756421198
699 699 a, c, t dbSNP:121913343
700 700 a, g, t dbSNP:28934576
709 709 c, g dbSNP:786202082
712 712 a, g, t dbSNP:763098116
714 714 c, g dbSNP:17849781
719 719 a, g dbSNP:786201322
720 720 agagaccggcg, ca dbSNP:587781564
720 720 a, c dbSNP:753660142
721 721 c, g, t dbSNP:121912660
723 723 a, g dbSNP:764146326
724 724 a, g, t dbSNP:587781525
726 726 c, g, t dbSNP:28934574
727 727 g, t dbSNP:730882008
729 729 a, c, t dbSNP:149633775
730 730 -, tcctgggagagaccggcg dbSNP:786204061
730 730 a, g dbSNP:371409680
734 734 a, c dbSNP:786203004
735 735 a, g dbSNP:112431538
736 736 a, t dbSNP:121912667
738 738 a, g dbSNP:786201059
741 741 a, g dbSNP:587782006
743 743 c, g dbSNP:748891343
749 749 c, t dbSNP:778138282
750 750 c, t dbSNP:770374782
751 751 a, g dbSNP:55819519
754 754 a, g dbSNP:781490101
755 755 c, g dbSNP:372613518
757 757 a, t dbSNP:121912663
759 759 a, g, t dbSNP:587780076
766 766 c, t dbSNP:751713111
767 767 c, t dbSNP:200073907
768 768 c, t dbSNP:672601296
769 769 a, g dbSNP:483352696
770 770 c, t dbSNP:758395031
773 773 c, t dbSNP:750578863
774 774 a, g, t dbSNP:201744589
776 776 -, ag dbSNP:761885916
776 776 a, g dbSNP:756123992
777 777 c, t dbSNP:752701561
782 782 c, t dbSNP:767356182
785 785 a, g dbSNP:72661120
788 788 -, g dbSNP:786202055
789 789 a, g dbSNP:587782391
792 792 a, g dbSNP:587782654
798 798 c, t dbSNP:121913344
806 806 a, g dbSNP:786202546
814 814 a, g dbSNP:56184981
815 815 c, t dbSNP:201601993
817 817 c, g dbSNP:145151284
823 823 c, t dbSNP:751440465
824 824 a, c dbSNP:765930028
825 825 a, t dbSNP:762620193
828 828 a, c dbSNP:772773208
831 831 a, c dbSNP:764735889
836 836 a, c dbSNP:761322293
851 851 a, g dbSNP:672601297
856 856 g, t dbSNP:121912659
875 875 a, g dbSNP:11575996
879 879 c, g, t dbSNP:769934890
880 880 a, g dbSNP:573154688
882 882 a, c, g dbSNP:730882028
884 884 a, g dbSNP:786203531
885 885 c, t dbSNP:375444154
886 886 a, g dbSNP:771939956
891 891 c, t dbSNP:587782529
892 892 a, c, g, t dbSNP:121912664
896 896 c, g, t dbSNP:150293825
897 897 a, c, g dbSNP:17882252
906 906 c, t dbSNP:730882029
907 907 a, g dbSNP:375338359
909 909 c, g dbSNP:375573770
913 913 c, t dbSNP:121912662
914 914 c, g dbSNP:752189180
922 922 a, c dbSNP:397516434
930 930 c, g dbSNP:768046010
933 933 a, g dbSNP:141402957
942 942 a, c dbSNP:755394212
943 943 a, g dbSNP:752142489
948 948 c, g dbSNP:766786605
952 952 a, g dbSNP:763426446
954 954 a, g dbSNP:587782237
955 955 a, t dbSNP:773553186
959 959 a, g dbSNP:539224556
960 960 a, g dbSNP:786203298
961 961 c, g, t dbSNP:35993958
964 964 a, g dbSNP:587781663
967 967 g, t dbSNP:768803947
969 969 a, g dbSNP:745751553
975 975 c, t dbSNP:267605075
978 978 g, t dbSNP:17881470
982 982 a, g dbSNP:749150541
984 984 c, t dbSNP:786204227
995 995 a, c dbSNP:765530090
1002 1002 a, c, g, t dbSNP:587781858
1007 1007 a, g dbSNP:764011631
1007 1007 -, g dbSNP:730882017
1010 1010 c, t dbSNP:760820708
1011 1011 -, a dbSNP:770970987
1011 1011 a, c dbSNP:774269719
1014 1014 c, t dbSNP:80184930
1017 1017 a, c, t dbSNP:749061599
1019 1019 c, t dbSNP:786202368
1029 1029 c, t dbSNP:150842067
1031 1031 c, t dbSNP:373710656
1032 1032 a, g dbSNP:730882009
1045 1045 a, c dbSNP:587781736
1047 1047 g, t dbSNP:587783064
1049 1049 -, g dbSNP:749817236
1057 1057 a, c dbSNP:769664911
1070 1070 a, c, t dbSNP:369567704
1073 1073 a, c dbSNP:8065799
1079 1079 c, t dbSNP:374294340
1094 1094 g, t dbSNP:746581308
1098 1098 c, t dbSNP:545818827
1101 1101 a, g, t dbSNP:1042526
1102 1102 c, t dbSNP:759018180
1115 1115 c, t dbSNP:760698953
1169 1169 c, t dbSNP:35919705
1170 1170 a, g dbSNP:375913211
1206 1206 a, g dbSNP:771458013
1208 1208 a, g dbSNP:371002418
1258 1258 -, a dbSNP:140346117
1258 1258 a, g dbSNP:560862596
1269 1269 a, g dbSNP:16956880
1339 1339 -, a dbSNP:771579509
1373 1373 g, t dbSNP:79516338
1378 1378 a, g dbSNP:34486624
1392 1392 a, g dbSNP:17881366
1421 1421 c, t dbSNP:534624315
1451 1451 a, c dbSNP:558662880
1473 1473 a, c dbSNP:191918079
1491 1491 g, t dbSNP:774263885
1531 1531 a, c dbSNP:377621596
1545 1545 a, t dbSNP:546208790
1549 1549 a, g dbSNP:4968187
1555 1555 a, g dbSNP:916131
1566 1566 c, t dbSNP:569519287
1578 1578 c, t dbSNP:916132
1593 1593 c, g dbSNP:551213894
1598 1598 ct, tc dbSNP:35944977
1633 1633 -, gt dbSNP:200962122
1633 1633 -, gt dbSNP:386545301
1659 1659 -, c dbSNP:34607064
1671 1671 c, g dbSNP:554283011
1677 1677 a, c dbSNP:17879353
1698 1698 c, g dbSNP:1042535
1698 1698 cg, ga dbSNP:371242826
1729 1729 c, t dbSNP:773742778
1738 1738 -, c dbSNP:34182553
1760 1760 c, t dbSNP:568571322
1762 1762 c, t dbSNP:563401383
1818 1818 -, c dbSNP:778421206
1818 1818 -, c dbSNP:368059785
1818 1818 c, t dbSNP:199729221
1827 1827 c, t dbSNP:547075078
1836 1836 c, t dbSNP:376415575
1836 1836 -, t dbSNP:200757381
1837 1837 c, t dbSNP:200378797
1846 1846 c, t dbSNP:564370767
1861 1861 -, t dbSNP:35940853
1889 1889 c, t dbSNP:552520476
1890 1890 a, g dbSNP:17884306
1919 1919 c, t dbSNP:17884586
1927 1927 c, t dbSNP:541641686
1950 1950 a, g dbSNP:35659787
2000 2000 a, g dbSNP:55817367
2037 2037 a, g dbSNP:746517601
2055 2055 g, t dbSNP:540817365
2060 2060 a, t dbSNP:373069673
2120 2120 cc, gg dbSNP:34734132
2127 2127 a, g dbSNP:576851964
2134 2134 c, t dbSNP:114831472
2137 2137 c, t dbSNP:779644413
2161 2161 a, t dbSNP:139396032
2239 2239 a, c dbSNP:78378222

Target ORF information:

RefSeq Version NM_001126115
Organism Homo sapiens (human)
Definition Homo sapiens tumor protein p53 (TP53), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18420
Accession Version NM_001126116.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 630bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cellular tumor antigen p53 isoform e
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC087388.9, DQ186651.1 and AK223026.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons (PMIDs: 12032546, 20937277). [provided by RefSeq, Feb 2013]. Transcript Variant: This variant (6) uses an alternate promoter and lacks multiple 5' exons, compared to variant 1. This variant can initiate translation from two in-frame AUG start codons. The isoform represented in this variant (e, also known as delta133p53beta) results from translation initiation at the upstream start codon. It has a shorter N-terminus and a distinct C-terminus, compared to isoform a. This variant is supported by data in PMID:16131611. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## NMD candidate :: PMID: 16131611, 16601753, 18289041 ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: DQ186651.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)135..137(+)
Misc Feature(2)279..746(+)
Misc Feature(3)360..362(+)
Misc Feature(4)408..608(+)
Misc Feature(5)411..425(+)
Misc Feature(6)597..722(+)
Exon (1)1..441
Gene Synonym:
Exon (2)442..554
Gene Synonym:
Exon (3)555..664
Gene Synonym:
Exon (4)665..801
Gene Synonym:
Exon (5)802..875
Gene Synonym:
Exon (6)876..1008
Gene Synonym:
Exon (7)1009..1115
Gene Synonym:
Exon (8)1116..2404
Gene Synonym:
Position Chain Variation Link
19 19 a, g dbSNP:530780060
40 40 a, c dbSNP:563612371
67 67 -, ag dbSNP:17880765
83 83 -, aaa dbSNP:5819162
87 87 a, c dbSNP:75785681
97 97 -, aaaa dbSNP:754750418
97 97 -, aaa dbSNP:752947053
97 97 a, g dbSNP:75821853
98 98 -, aaa dbSNP:141204613
101 101 -, gaa dbSNP:376546152
104 104 a, g dbSNP:77624624
133 133 c, t dbSNP:9895829
141 141 a, g dbSNP:35850753
157 157 a, t dbSNP:145153611
167 167 a, g dbSNP:2909430
172 172 c, t dbSNP:113530090
189 189 a, g dbSNP:537058017
191 191 c, g dbSNP:2856920
211 211 g, t dbSNP:774330271
218 218 c, t dbSNP:770686190
223 223 c, t dbSNP:576912263
235 235 c, t dbSNP:773029752
240 240 -, t dbSNP:756417643
241 241 c, t dbSNP:376713749
247 247 g, t dbSNP:747705704
256 256 -, a dbSNP:751253294
256 256 a, g dbSNP:786202799
262 262 c, t dbSNP:730881999
268 268 c, t dbSNP:137852792
272 272 c, t dbSNP:781537596
273 273 a, t dbSNP:587782160
275 275 a, c dbSNP:769270327
276 276 -, aagatgttttgccaac dbSNP:786203589
276 276 a, g dbSNP:747342068
280 280 c, t dbSNP:28934873
282 282 c, t dbSNP:267605077
283 283 g, t dbSNP:780442292
286 286 a, g dbSNP:587781991
290 290 a, c, g dbSNP:758781593
294 294 c, g dbSNP:28934875
295 295 -, c dbSNP:137852794
295 295 c, t dbSNP:750600586
301 301 a, c dbSNP:786202561
304 304 a, g dbSNP:587781288
307 307 c, t dbSNP:779196500
309 309 a, g, t dbSNP:587782620
312 312 c, t dbSNP:757274881
313 313 a, c dbSNP:786203071
314 314 a, g dbSNP:786201419
315 315 c, t dbSNP:786203928
316 316 c, t dbSNP:587782197
318 318 g, t dbSNP:786203064
329 329 -, cacacccccgccc dbSNP:587782393
330 330 -, acacccccgccc dbSNP:137852790
332 332 -, acccccgccc dbSNP:137852791
332 332 a, g dbSNP:754020850
333 333 a, c, t dbSNP:28934874
336 336 c, t dbSNP:767328513
337 337 -, c dbSNP:730882019
337 337 c, t dbSNP:587782705
341 341 c, t dbSNP:72661116
342 342 a, g dbSNP:137852789
343 343 a, g dbSNP:762846821
344 344 c, t dbSNP:137852793
345 345 a, g dbSNP:772683278
346 346 c, g dbSNP:786202752
347 347 a, c dbSNP:786202992
348 348 c, t dbSNP:563378859
349 349 a, g dbSNP:371524413
350 350 c, t dbSNP:761222871
351 351 a, g, t dbSNP:121912654
354 354 c, t dbSNP:587780068
355 355 a, g dbSNP:587782144
356 356 c, t dbSNP:139200646
357 357 gc, tt dbSNP:730882022
357 357 c, g dbSNP:730882000
360 360 a, t dbSNP:377274728
362 362 a, g dbSNP:772354334
363 363 a, g dbSNP:193920817
367 367 g, t dbSNP:587780069
369 369 g, t dbSNP:786203436
370 370 a, g dbSNP:148924904
375 375 c, t dbSNP:730882001
386 386 c, t dbSNP:746293837
390 390 a, g dbSNP:587780729
391 391 c, t dbSNP:779000871
392 392 a, g dbSNP:757544615
393 393 a, g dbSNP:587781845
397 397 -, gaggt dbSNP:786202514
398 398 g, t dbSNP:749309577
405 405 c, g, t dbSNP:138729528
406 406 a, g, t dbSNP:28934578
409 409 a, g dbSNP:786202962
411 411 c, t dbSNP:147002414
412 412 c, g dbSNP:751477326
414 414 -, ccc dbSNP:786202525
417 417 c, t dbSNP:587780070
423 423 c, t dbSNP:587782596
424 424 a, g, t dbSNP:397514495
432 432 a, g dbSNP:72661117
436 436 a, g dbSNP:150607408
437 437 c, t dbSNP:367560109
440 440 a, c, t dbSNP:375275361
441 441 a, g dbSNP:776167460
448 448 c, t dbSNP:121912665
449 449 a, c dbSNP:55764374
454 454 c, g dbSNP:587778718
457 457 a, g dbSNP:730882002
460 460 a, g, t dbSNP:786201838
462 462 c, t dbSNP:587780071
464 464 c, t dbSNP:370216745
466 466 c, t dbSNP:760043106
468 468 c, t dbSNP:397516435
469 469 g, t dbSNP:483352697
471 471 a, g dbSNP:786204041
485 485 g, t dbSNP:730882024
486 486 c, t dbSNP:587780072
487 487 a, g, t dbSNP:587778719
489 489 a, g dbSNP:730882003
494 494 a, g dbSNP:749629973
497 497 a, t dbSNP:786202222
500 500 a, g dbSNP:142813240
509 509 -, aa dbSNP:587776768
519 519 c, t dbSNP:397516436
520 520 a, g dbSNP:587778720
521 521 a, g, t dbSNP:1800372
524 524 c, g, t dbSNP:587781386
526 526 c, g dbSNP:587782177
528 528 a, g dbSNP:730882025
530 530