Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

TSC1 tuberous sclerosis 1 [Homo sapiens (human)]

Gene Symbol TSC1
Entrez Gene ID 7248
Full Name tuberous sclerosis 1
Synonyms LAM, TSC
General protein information
Preferred Names
tumor suppressor
tuberous sclerosis 1 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]. lac of sum
Disorder MIM:


Disorder Html: Tuberous sclerosis-1, 191100 (3); Lymphangioleiomyomatosis, 606690
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu18443 XM_005272211 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu18443 XM_006717271 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu18443 XM_011518979 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu43494 XM_006717272 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu18443 NM_000368 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00
OHu17622 NM_001162426 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu17591 NM_001162427 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu18443D
Sequence Information ORF Nucleotide Sequence (Length: 3495bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product hamartin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)283..2436(+)
Misc Feature(2)2551..3033(+)
Misc Feature(3)2575..3075(+)
Position Chain Variation Link
1 1 c, t dbSNP:374151059
21 21 g, t dbSNP:569842500
28 28 a, g dbSNP:550763141
29 29 a, g dbSNP:539145535
31 31 -, g dbSNP:544305928
67 67 g, t dbSNP:571288003
69 69 c, t dbSNP:45522535
72 72 g, t dbSNP:528753909
83 83 a, g dbSNP:561295374
88 88 c, t dbSNP:549656840
151 151 a, t dbSNP:116951280
181 181 c, t dbSNP:114755636
212 212 c, t dbSNP:529212875
216 216 a, g dbSNP:561540358
236 236 a, g dbSNP:773447503
244 244 c, t dbSNP:772626361
245 245 a, g dbSNP:370122384
258 258 -, cagc dbSNP:776033881
260 260 c, t dbSNP:377001111
263 263 c, t dbSNP:768441689
264 264 a, g, t dbSNP:114970627
268 268 c, t dbSNP:755999334
269 269 a, c, t dbSNP:570705364
270 270 a, g dbSNP:756989263
273 273 c, g, t dbSNP:62621221
276 276 g, t dbSNP:755266452
289 289 c, t dbSNP:753838459
300 300 c, g, t dbSNP:145987906
301 301 a, g dbSNP:773784532
316 316 a, g dbSNP:768147590
321 321 a, g dbSNP:762233181
326 326 c, g dbSNP:774900322
330 330 c, g dbSNP:768175095
331 331 a, t dbSNP:762059806
343 343 c, t dbSNP:749030456
344 344 a, g dbSNP:141736779
348 348 c, t dbSNP:769282604
349 349 -, g dbSNP:118203330
351 351 c, t dbSNP:376527838
366 366 c, t dbSNP:745384145
372 372 g, t dbSNP:781059342
378 378 c, t dbSNP:757216373
386 386 a, t dbSNP:148468036
388 388 -, c dbSNP:118203333
389 389 a, g dbSNP:750441497
393 393 c, g dbSNP:776158461
395 395 c, g dbSNP:770831962
400 400 a, c, t dbSNP:118203334
403 403 c, g dbSNP:777537794
405 405 a, c dbSNP:118203335
409 409 -, a dbSNP:118203336
411 411 -, c, cc dbSNP:118203337
412 412 c, t dbSNP:755226092
414 414 a, g dbSNP:149278759
424 424 -, t dbSNP:118203339
425 425 -, a dbSNP:397514861
427 427 -, c dbSNP:118203340
428 428 c, t dbSNP:118203341
432 432 a, c dbSNP:118203342
438 438 c, t dbSNP:756335238
442 442 c, t dbSNP:118203343
446 446 c, t dbSNP:750512029
447 447 a, g dbSNP:781483110
455 455 a, t dbSNP:757837986
456 456 c, t dbSNP:767647768
460 460 -, ctgaccacc dbSNP:118203344
460 460 c, t dbSNP:752047592
461 461 c, g, t dbSNP:118203345
470 470 -, tgcaagagc dbSNP:118203346
474 474 a, g dbSNP:764523181
480 480 a, g dbSNP:371555137
482 482 a, g dbSNP:118203347
492 492 a, c dbSNP:765578482
493 493 c, t dbSNP:759183842
494 494 c, t dbSNP:118203354
506 506 a, t dbSNP:118203355
510 510 c, t dbSNP:397514809
515 515 a, g dbSNP:373855276
516 516 c, t dbSNP:761596603
524 524 a, c dbSNP:118203356
526 526 a, c, g dbSNP:76667066
528 528 c, t dbSNP:145783693
529 529 a, g dbSNP:118203357
530 530 a, c dbSNP:761717715
531 531 -, c dbSNP:118203358
539 539 -, ga dbSNP:118203359
539 539 g, t dbSNP:397514776
549 549 c, t dbSNP:142325036
550 550 -, tc dbSNP:118203360
551 551 a, c, t dbSNP:118203361
552 552 a, g, t dbSNP:115097221
555 555 -, a, aa dbSNP:118203362
557 557 g, t dbSNP:118203363
564 564 c, t dbSNP:113042347
566 566 c, t dbSNP:370243092
568 568 a, g, t dbSNP:138541569
587 587 a, g dbSNP:118203364
588 588 a, g dbSNP:118203365
593 593 a, g dbSNP:758924121
603 603 -, tc dbSNP:397514795
604 604 c, t dbSNP:397514774
610 610 c, t dbSNP:748669519
614 614 -, ct dbSNP:118203366
617 617 -, t dbSNP:118203367
619 619 c, t dbSNP:779395169
621 621 c, g, t dbSNP:754220721
625 625 g, t dbSNP:199620268
627 627 a, t dbSNP:755799702
629 629 c, t dbSNP:118203368
641 641 a, g dbSNP:118203369
642 642 a, g dbSNP:118203370
649 649 a, g dbSNP:745871522
650 650 c, g dbSNP:747251435
651 651 -, t dbSNP:118203377
654 654 c, t dbSNP:560863078
655 655 a, g dbSNP:397514843
657 657 c, t dbSNP:373173550
658 658 -, gtt dbSNP:118203378
658 658 a, g dbSNP:372215435
660 660 -, tgt dbSNP:118203379
664 664 -, c dbSNP:397514852
668 668 c, t dbSNP:779340088
674 674 ca, gcgtcttggtgt dbSNP:118203380
674 674 a, c, g dbSNP:397514784
675 675 c, t dbSNP:368922726
676 676 a, g, t dbSNP:118203381
681 681 a, g dbSNP:147125501
694 694 a, g dbSNP:780442112
712 712 -, ca dbSNP:118203383
712 712 c, t dbSNP:118203382
724 724 c, t dbSNP:118203384
734 734 c, t dbSNP:755791846
752 752 c, g, t dbSNP:118203385
758 758 a, g dbSNP:749979841
768 768 a, t dbSNP:118203386
770 770 a, g dbSNP:118203387
774 774 a, c dbSNP:118203388
783 783 -, a dbSNP:118203389
785 785 a, c dbSNP:767215560
792 792 c, t dbSNP:377196837
794 794 g, t dbSNP:751092692
797 797 c, t dbSNP:777484049
798 798 a, g dbSNP:768999400
799 799 g, t dbSNP:118203392
803 803 -, t dbSNP:118203393
805 805 -, ta dbSNP:118203394
809 809 -, t dbSNP:397514794
810 810 c, t dbSNP:752615412
811 811 a, g dbSNP:118203395
818 818 c, t dbSNP:118203396
819 819 c, t dbSNP:201562103
821 821 a, c, g, t dbSNP:397515294
822 822 g, t dbSNP:762139762
828 828 c, t dbSNP:774398322
831 831 c, g dbSNP:118203397
834 834 c, t dbSNP:118203398
842 842 -, tt dbSNP:118203399
847 847 c, t dbSNP:118203400
848 848 a, c, g dbSNP:118203402
848 848 -, g dbSNP:118203401
851 851 a, g, t dbSNP:118203403
853 853 c, t dbSNP:786202831
854 854 -, a dbSNP:118203405
855 855 g, t dbSNP:118203406
860 860 c, t dbSNP:746188529
864 864 a, c dbSNP:118203407
869 869 -, g dbSNP:397514868
870 870 -, c dbSNP:397514836
872 872 -, act dbSNP:118203408
872 872 a, g dbSNP:577983115
876 876 -, cgtctcc dbSNP:118203409
876 876 c, t dbSNP:202242304
877 877 a, g dbSNP:118203410
878 878 -, t dbSNP:118203411
881 881 -, cct dbSNP:118203412
882 882 a, c dbSNP:777571943
887 887 -, tt dbSNP:118203413
890 890 c, g dbSNP:397514834
894 894 c, t dbSNP:118203414
897 897 c, t dbSNP:118203415
901 901 a, c dbSNP:778671811
903 903 -, t dbSNP:397514837
904 904 a, g dbSNP:754980229
912 912 a, g dbSNP:753550247
926 926 -, tt dbSNP:118203417
926 926 c, t dbSNP:118203416
927 927 -, t dbSNP:397514835
930 930 a, g dbSNP:766250769
933 933 -, a dbSNP:118203418
936 936 c, g dbSNP:755910789
937 937 a, g, t dbSNP:397514830
944 944 -, c dbSNP:118203425
945 945 a, c dbSNP:754853512
949 949 a, t dbSNP:535397245
950 950 g, t dbSNP:118203426
952 952 a, g dbSNP:572899352
961 961 c, t dbSNP:118203427
972 972 a, g dbSNP:749311040
973 973 -, g dbSNP:118203428
973 973 g, t dbSNP:118203429
988 988 -, t dbSNP:118203430
991 991 a, t dbSNP:397514816
999 999 -, a dbSNP:118203431
999 999 g, t dbSNP:779872953
1003 1003 c, t dbSNP:118203432
1011 1011 -, t dbSNP:118203433
1012 1012 c, t dbSNP:118203434
1013 1013 a, g dbSNP:755859330
1016 1016 a, c, g dbSNP:118203436
1016 1016 -, g dbSNP:118203435
1017 1017 a, g dbSNP:118203441
1021 1021 a, t dbSNP:118203442
1024 1024 -, a dbSNP:118203444
1024 1024 a, t dbSNP:118203443
1028 1028 -, t dbSNP:118203446
1028 1028 a, g, t dbSNP:118203447
1028 1028 -, t dbSNP:118203445
1038 1038 c, t dbSNP:748775797
1041 1041 c, t dbSNP:780005416
1049 1049 a, c, t dbSNP:745640752
1050 1050 -, c dbSNP:118203449
1051 1051 a, g, t dbSNP:118203450
1058 1058 c, g dbSNP:758617649
1061 1061 a, g dbSNP:371225009
1065 1065 c, g dbSNP:779015004
1077 1077 c, t dbSNP:770704462
1083 1083 a, g dbSNP:753895570
1086 1086 c, t dbSNP:766961309
1089 1089 a, g dbSNP:142336706
1091 1091 -, at dbSNP:118203451
1092 1092 a, t dbSNP:118203452
1093 1093 a, g, t dbSNP:397514872
1096 1096 a, c dbSNP:2106347
1097 1097 a, t dbSNP:768057796
1098 1098 g, t dbSNP:148756522
1104 1104 -, at dbSNP:118203453
1104 1104 g, t dbSNP:118203454
1105 1105 c, t dbSNP:774009225
1109 1109 -, tg dbSNP:118203455
1109 1109 c, t dbSNP:200749357
1110 1110 -, gt dbSNP:118203456
1113 1113 -, tc dbSNP:118203457
1117 1117 c, t dbSNP:118203458
1124 1124 a, c dbSNP:118203459
1125 1125 -, a dbSNP:118203460
1125 1125 a, g dbSNP:768226293
1129 1129 c, t dbSNP:140544652
1130 1130 a, g dbSNP:151309813
1131 1131 c, t dbSNP:769706203
1132 1132 g, t dbSNP:377076733
1136 1136 c, g dbSNP:375144225
1141 1141 c, t dbSNP:770653972
1145 1145 c, g dbSNP:397514867
1149 1149 c, g, t dbSNP:779155575
1150 1150 a, g dbSNP:755195460
1152 1152 c, t dbSNP:753928162
1155 1155 c, t dbSNP:116756594
1157 1157 c, t dbSNP:756681916
1165 1165 c, t dbSNP:750890263
1170 1170 a, g, t dbSNP:118203461
1178 1178 c, t dbSNP:370916731
1180 1180 -, ca dbSNP:118203464
1180 1180 c, t dbSNP:118203463
1182 1182 c, g dbSNP:762200890
1191 1191 c, g, t dbSNP:118203466
1192 1192 a, g, t dbSNP:118203468
1194 1194 a, c, g, t dbSNP:397515293
1195 1195 g, t dbSNP:34876281
1196 1196 a, g dbSNP:752290177
1197 1197 g, t dbSNP:34610255
1199 1199 c, t dbSNP:572611259
1200 1200 c, t dbSNP:397514826
1209 1209 c, t dbSNP:759004332
1211 1211 c, g dbSNP:776158460
1215 1215 a, c dbSNP:118203472
1217 1217 c, t dbSNP:766317920
1220 1220 c, t dbSNP:373454700
1221 1221 a, g dbSNP:144208203
1222 1222 a, t dbSNP:185815387
1225 1225 c, t dbSNP:535868591
1226 1226 a, g dbSNP:375956049
1236 1236 -, gtt dbSNP:755655903
1239 1239 a, g dbSNP:770183315
1244 1244 c, t dbSNP:1073123
1245 1245 a, g dbSNP:397514807
1246 1246 c, g dbSNP:781189978
1251 1251 a, g dbSNP:118203473
1252 1252 c, t dbSNP:118203474
1256 1256 c, t dbSNP:757779597
1262 1262 -, a dbSNP:118203475
1266 1266 g, t dbSNP:202091845
1267 1267 -, c dbSNP:118203476
1267 1267 -, ct dbSNP:118203477
1268 1268 -, t dbSNP:118203478
1268 1268 -, tg dbSNP:118203479
1268 1268 -, t dbSNP:397514870
1273 1273 -, a dbSNP:118203480
1280 1280 a, c, t dbSNP:118203481
1281 1281 a, c, g dbSNP:200820603
1284 1284 a, g dbSNP:753091213
1285 1285 a, c, t dbSNP:118203483
1286 1286 -, ggctgataac dbSNP:397514849
1286 1286 a, g dbSNP:397514808
1294 1294 a, t dbSNP:570809282
1299 1299 -, a dbSNP:118203484
1299 1299 a, g dbSNP:760233114
1309 1309 -, g dbSNP:118203486
1317 1317 c, t dbSNP:753360364
1319 1319 a, g dbSNP:118203490
1320 1320 a, g dbSNP:118203491
1324 1324 c, g dbSNP:779767990
1326 1326 a, g dbSNP:118203492
1329 1329 c, t dbSNP:150777389
1330 1330 a, g dbSNP:781312535
1332 1332 a, g dbSNP:757404847
1357 1357 a, g dbSNP:201738258
1358 1358 a, c dbSNP:118203493
1363 1363 c, t dbSNP:397514864
1371 1371 -, tgtcccacctgatc dbSNP:118203494
1376 1376 -, cacctgatctgtca dbSNP:118203495
1376 1376 c, t dbSNP:763915012
1384 1384 c, t dbSNP:118203496
1389 1389 -, a dbSNP:118203497
1389 1389 a, t dbSNP:371648887
1392 1392 -, ac dbSNP:118203498
1392 1392 a, c, t dbSNP:771217333
1393 1393 c, g dbSNP:760638759
1397 1397 -, a dbSNP:118203499
1423 1423 a, g dbSNP:367564729
1431 1431 -, a dbSNP:118203501
1439 1439 c, t dbSNP:764150061
1442 1442 c, t dbSNP:377598226
1445 1445 a, g dbSNP:752575728
1445 1445 -, g dbSNP:397514832
1457 1457 c, t dbSNP:201452238
1469 1469 c, t dbSNP:766487204
1470 1470 a, g dbSNP:370281825
1475 1475 -, cactctgtcattcg dbSNP:118203502
1475 1475 c, t dbSNP:761014195
1477 1477 c, t dbSNP:773160913
1479 1479 c, g dbSNP:767514820
1482 1482 a, t dbSNP:761890555
1482 1482 -, t dbSNP:118203503
1487 1487 c, t dbSNP:118203504
1488 1488 a, g dbSNP:141184479
1496 1496 a, g dbSNP:143502728
1497 1497 c, t dbSNP:373465241
1498 1498 a, g dbSNP:769331772
1500 1500 a, g dbSNP:745463008
1503 1503 c, t dbSNP:781006583
1510 1510 a, c dbSNP:397514840
1511 1511 a, t dbSNP:140410001
1518 1518 a, g dbSNP:786203715
1523 1523 c, t dbSNP:746550630
1527 1527 c, t dbSNP:777823426
1528 1528 -, a dbSNP:397514792
1529 1529 -, c dbSNP:397514778
1529 1529 c, t dbSNP:77464996
1530 1530 a, g dbSNP:147127442
1534 1534 c, g dbSNP:765145057
1536 1536 -, c dbSNP:756865130
1536 1536 a, c, g dbSNP:369642207
1536 1536 -, c dbSNP:118203506
1549 1549 -, ag dbSNP:118203509
1552 1552 a, g dbSNP:753199284
1555 1555 g, t dbSNP:765695557
1558 1558 -, t dbSNP:118203510
1561 1561 ct, gc dbSNP:587778721
1569 1569 a, g dbSNP:759914505
1570 1570 c, t dbSNP:762688935
1582 1582 c, t dbSNP:118203511
1594 1594 c, g dbSNP:199800297
1596 1596 c, g dbSNP:770692313
1606 1606 a, g dbSNP:760470520
1610 1610 a, c, g dbSNP:118203512
1611 1611 a, g dbSNP:773003016
1614 1614 a, g dbSNP:7862221
1617 1617 -, g dbSNP:118203517
1619 1619 c, t dbSNP:772868048
1621 1621 c, t dbSNP:118203518
1622 1622 c, t dbSNP:397514848
1623 1623 c, t dbSNP:530908428
1629 1629 c, t dbSNP:773780814
1633 1633 c, g dbSNP:118203519
1634 1634 c, g dbSNP:371093730
1640 1640 -, tcactctaagtgatcttccagggtttttaggtgatctg dbSNP:118203520
1643 1643 -, c dbSNP:118203521
1645 1645 -, ct dbSNP:397514798
1645 1645 -, ga dbSNP:118203522
1647 1647 a, c dbSNP:397514856
1648 1648 -, a dbSNP:118203523
1648 1648 a, c dbSNP:587778722
1650 1650 c, t dbSNP:118203524
1658 1658 -, c dbSNP:118203525
1661 1661 a, g dbSNP:140953644
1662 1662 c, g dbSNP:779981609
1669 1669 c, g dbSNP:769529472
1690 1690 -, t dbSNP:118203526
1696 1696 a, g dbSNP:745697913
1697 1697 c, t dbSNP:185159716
1710 1710 -, agaa dbSNP:118203527
1710 1710 -, a dbSNP:397514858
1712 1712 -, ga dbSNP:118203528
1712 1712 a, g dbSNP:118203529
1721 1721 a, c dbSNP:775367219
1731 1731 -, a dbSNP:397514797
1739 1739 c, g dbSNP:118203532
1741 1741 g, t dbSNP:118203533
1749 1749 -, c dbSNP:118203534
1758 1758 c, g dbSNP:745657743
1760 1760 -, c dbSNP:118203535
1769 1769 -, tg dbSNP:118203536
1777 1777 c, t dbSNP:118203537
1778 1778 a, g dbSNP:118203538
1780 1780 g, t dbSNP:118203539
1782 1782 -, a dbSNP:397514876
1782 1782 a, c dbSNP:201810746
1785 1785 c, t dbSNP:772337076
1794 1794 -, t dbSNP:118203540
1795 1795 -, tc dbSNP:281875358
1804 1804 c, t dbSNP:118203542
1805 1805 a, g dbSNP:118203543
1807 1807 a, g dbSNP:779206386
1808 1808 -, ac dbSNP:118203544
1812 1812 -, t dbSNP:118203545
1814 1814 -, tc dbSNP:397514823
1818 1818 a, g dbSNP:755055358
1821 1821 -, g dbSNP:118203546
1823 1823 c, g dbSNP:749410972
1829 1829 a, g dbSNP:371908551
1838 1838 -, a dbSNP:118203547
1841 1841 c, t dbSNP:759379027
1846 1846 c, g dbSNP:118203548
1851 1851 c, g dbSNP:397514810
1853 1853 c, g dbSNP:750784794
1858 1858 c, t dbSNP:118203549
1859 1859 -, ag dbSNP:118203550
1859 1859 a, g dbSNP:767708806
1861 1861 -, ggcgccagcgtgaaccctgag dbSNP:766376606
1863 1863 c, t dbSNP:149439187
1864 1864 a, g dbSNP:751125011
1868 1868 c, g dbSNP:368481360
1869 1869 c, t dbSNP:762424091
1870 1870 a, g dbSNP:377279170
1873 1873 a, t dbSNP:765149885
1875 1875 c, t dbSNP:759461471
1886 1886 c, t dbSNP:776633158
1894 1894 -, t dbSNP:118203551
1905 1905 a, g dbSNP:756935981
1909 1909 -, gggcctgacacaccaaa dbSNP:118203552
1910 1910 a, g dbSNP:770570830
1914 1914 c, t dbSNP:372284519
1915 1915 g, t dbSNP:774671298
1919 1919 c, t dbSNP:769040084
1927 1927 c, g dbSNP:118203553
1930 1930 a, g dbSNP:780338343
1941 1941 -, c dbSNP:118203554
1943 1943 -, t dbSNP:397514829
1948 1948 -, c dbSNP:118203556
1948 1948 c, t dbSNP:118203555
1950 1950 -, gccctgcggcagtgctgatgaaa dbSNP:118203557
1955 1955 -, g dbSNP:118203558
1956 1956 c, t dbSNP:368317116
1957 1957 a, g dbSNP:746304922
1959 1959 -, cagtgctgatgaaagccctgcgg dbSNP:397514818
1964 1964 c, g dbSNP:377185303
1966 1966 -, g dbSNP:118203561
1971 1971 -, aa dbSNP:118203562
1976 1976 -, c dbSNP:118203563
1979 1979 c, t dbSNP:397514880
1980 1980 a, g dbSNP:35478675
1981 1981 -, cagtgctgatgaaagccctgcgg dbSNP:118203559
1982 1982 -, g dbSNP:397514777
1983 1983 -, gtgctgatgaaagccctgcggga dbSNP:118203560
1987 1987 -, ag dbSNP:118203564
1989 1989 a, g dbSNP:777386797
1993 1993 c, t dbSNP:758107610
1995 1995 c, t dbSNP:752202276
1996 1996 a, c, t dbSNP:118203565
2000 2000 c, g, t dbSNP:548002938
2003 2003 c, t dbSNP:118203566
2005 2005 c, t dbSNP:118203567
2006 2006 g, tggagaccagtatcttcactcc dbSNP:118203569
2006 2006 -, tggagaccagtatctt dbSNP:118203568
2008 2008 g, t dbSNP:118203570
2010 2010 c, g dbSNP:118203571
2015 2015 -, g dbSNP:118203572
2025 2025 -, t dbSNP:118203573
2028 2028 -, ca dbSNP:118203574
2030 2030 c, g dbSNP:786203799
2032 2032 c, t dbSNP:766367103
2035 2035 c, t dbSNP:760356610
2036 2036 ca, gtaaaattccac dbSNP:397514857
2036 2036 -, gtaaaattc dbSNP:118203575
2038 2038 a, t dbSNP:397514846
2039 2039 a, g dbSNP:118203576
2040 2040 a, g dbSNP:118203577
2045 2045 -, c dbSNP:397514811
2046 2046 a, g dbSNP:118203578
2051 2051 a, c dbSNP:768985094
2052 2052 a, g dbSNP:146578402
2053 2053 -, ga dbSNP:118203579
2054 2054 c, t dbSNP:775869914
2055 2055 a, g, t dbSNP:118203580
2056 2056 a, t dbSNP:118203581
2067 2067 -, t dbSNP:118203582
2071 2071 -, a, aa dbSNP:118203583
2073 2073 c, t dbSNP:766438395
2074 2074 a, g dbSNP:761959210
2081 2081 c, t dbSNP:543077026
2085 2085 a, c dbSNP:771521648
2087 2087 c, t dbSNP:751247705
2088 2088 a, g, t dbSNP:112434645
2097 2097 a, t dbSNP:758769193
2102 2102 -, tt dbSNP:118203585
2103 2103 -, tt dbSNP:118203586
2104 2104 g, t dbSNP:118203587
2118 2118 a, g dbSNP:118203588
2120 2120 -, a dbSNP:118203589
2127 2127 c, t dbSNP:752286096
2128 2128 c, g dbSNP:397514854
2130 2130 -, t dbSNP:118203590
2136 2136 -, t dbSNP:118203591
2148 2148 a, g dbSNP:778556382
2150 2150 c, t dbSNP:754401816
2155 2155 g, t dbSNP:397514815
2157 2157 a, g dbSNP:753424167
2160 2160 a, g dbSNP:766204646
2161 2161 c, t dbSNP:375534013
2162 2162 a, g, t dbSNP:118203592
2163 2163 -, aaagaaagcaaaaggaaacaca dbSNP:397514796
2165 2165 -, a dbSNP:118203594
2167 2167 -, aaag dbSNP:118203595
2169 2169 -, a dbSNP:118203596
2182 2182 -, ac dbSNP:118203597
2183 2183 -, ca dbSNP:118203598
2186 2186 -, ag dbSNP:118203599
2188 2188 a, g dbSNP:575639692
2190 2190 -, a dbSNP:397514801
2195 2195 a, g, t dbSNP:372583166
2196 2196 g, t dbSNP:775816560
2200 2200 c, t dbSNP:374222196
2201 2201 a, c dbSNP:397514863
2207 2207 c, t dbSNP:368016548
2215 2215 a, g dbSNP:145741748
2221 2221 -, g dbSNP:118203600
2222 2222 c, t dbSNP:771341361
2233 2233 c, t dbSNP:747452647
2234 2234 -, tg dbSNP:118203601
2237 2237 -, ta dbSNP:118203602
2238 2238 -, a dbSNP:118203603
2239 2239 c, g, t dbSNP:75820036
2242 2242 c, t dbSNP:118203606
2243 2243 -, a dbSNP:397514793
2247 2247 a, c dbSNP:118203607
2253 2253 c, g, t dbSNP:118203608
2255 2255 c, t dbSNP:118203609
2256 2256 a, g dbSNP:35958226
2271 2271 a, g dbSNP:775799075
2274 2274 a, c dbSNP:748733167
2277 2277 a, g dbSNP:118203616
2282 2282 c, t dbSNP:772603060
2285 2285 g, t dbSNP:118203617
2288 2288 c, g dbSNP:754679411
2295 2295 c, g dbSNP:748487106
2297 2297 a, c dbSNP:774835995
2301 2301 -, c dbSNP:118203619
2301 2301 c, t dbSNP:118203618
2302 2302 c, g dbSNP:768189353
2302 2302 -, g dbSNP:118203620
2305 2305 a, t dbSNP:748901883
2307 2307 a, g dbSNP:118203621
2309 2309 -, cccactttgga dbSNP:118203622
2309 2309 c, t dbSNP:779584449
2311 2311 c, t dbSNP:755647717
2312 2312 a, g dbSNP:745413532
2313 2313 c, t dbSNP:201392975
2317 2317 a, g dbSNP:757322533
2318 2318 a, g dbSNP:118203623
2320 2320 a, g dbSNP:118203624
2325 2325 -, tc dbSNP:397514869
2329 2329 -, cct dbSNP:397514799
2329 2329 c, t dbSNP:746909024
2333 2333 a, c dbSNP:118203629
2336 2336 a, g dbSNP:786201465
2344 2344 c, t dbSNP:202241429
2345 2345 a, g dbSNP:200827913
2347 2347 a, g dbSNP:752473063
2348 2348 acactt, ccctcc dbSNP:118203630
2349 2349 c, t dbSNP:780223819
2353 2353 c, t dbSNP:118203631
2354 2354 a, g dbSNP:199755731
2356 2356 c, g dbSNP:397514800
2359 2359 c, t dbSNP:397514789
2361 2361 -, g dbSNP:118203632
2364 2364 a, g dbSNP:767518902
2369 2369 -, t dbSNP:118203633
2371 2371 c, t dbSNP:551954460
2372 2372 g, t dbSNP:397514802
2373 2373 -, g dbSNP:118203634
2375 2375 -, nnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:672601250
2376 2376 -, c, cctccgagaccagttgcttttactgcac dbSNP:118203635
2380 2380 -, cagttac dbSNP:397514791
2380 2380 -, ca dbSNP:118203637
2380 2380 -, c dbSNP:118203636
2381 2381 -, agtt dbSNP:118203638
2382 2382 -, gtta dbSNP:118203640
2382 2382 g, t dbSNP:118203639
2383 2383 -, tagtt dbSNP:118203642
2385 2385 -, gtta dbSNP:397514779
2385 2385 a, gt dbSNP:397514838
2388 2388 -, ct dbSNP:118203643
2388 2388 -, gttactc dbSNP:118203641
2389 2389 -, t dbSNP:118203644
2390 2390 -, at dbSNP:118203645
2390 2390 a, g dbSNP:752054698
2391 2391 a, t dbSNP:118203646
2394 2394 a, g dbSNP:142662480
2407 2407 c, t dbSNP:397514874
2410 2410 c, t dbSNP:118203647
2413 2413 -, catgc dbSNP:118203648
2414 2414 -, atgcc dbSNP:118203649
2424 2424 -, g dbSNP:118203650
2430 2430 -, g dbSNP:118203651
2432 2432 -, aacaggcg dbSNP:397514803
2440 2440 c, t dbSNP:763357144
2441 2441 a, c, g dbSNP:769566267
2443 2443 a, t dbSNP:397514772
2448 2448 -, g dbSNP:118203652
2452 2452 -, aaag dbSNP:118203653
2454 2454 -, a dbSNP:118203654
2456 2456 a, c dbSNP:118203655
2470 2470 -, g dbSNP:118203656
2470 2470 g, t dbSNP:397514820
2473 2473 c, t dbSNP:118203657
2475 2475 c, t dbSNP:776441369
2482 2482 a, g dbSNP:770518730
2483 2483 a, c dbSNP:746535706
2500 2500 a, c dbSNP:587778723
2505 2505 a, g dbSNP:397514878
2506 2506 c, t dbSNP:118203661
2514 2514 a, g dbSNP:753265422
2515 2515 g, t dbSNP:786203007
2528 2528 a, g dbSNP:118203662
2529 2529 a, g dbSNP:118203663
2533 2533 a, g dbSNP:765643529
2539 2539 c, t dbSNP:118203664
2547 2547 -, agaa dbSNP:118203665
2547 2547 a, g dbSNP:760004541
2551 2551 c, t dbSNP:397514783
2558 2558 -, gatacaatcagctcca dbSNP:118203666
2560 2560 c, t dbSNP:776386313
2562 2562 a, c, g dbSNP:118203668
2563 2563 -, taca dbSNP:118203667
2564 2564 a, g dbSNP:118203670
2566 2566 c, t dbSNP:118203671
2570 2570 -, t dbSNP:118203672
2572 2572 c, t dbSNP:118203673
2577 2577 -, gcagcgtgacactatggtaacca dbSNP:118203674
2578 2578 c, t dbSNP:118203675
2591 2591 c, t dbSNP:760208449
2596 2596 -, a dbSNP:118203676
2596 2596 a, c dbSNP:772652234
2598 2598 -, c dbSNP:118203677
2601 2601 a, g dbSNP:772038670
2607 2607 -, ca dbSNP:118203678
2608 2608 -, a dbSNP:397514780
2611 2611 c, t dbSNP:118203679
2620 2620 c, t dbSNP:118203680
2621 2621 -, aa dbSNP:397514855
2625 2625 a, g dbSNP:747968526
2626 2626 c, t dbSNP:118203681
2627 2627 a, g dbSNP:774284355
2630 2630 a, g dbSNP:768390011
2635 2635 c, t dbSNP:118203682
2636 2636 -, g dbSNP:118203683
2639 2639 -, aggaa dbSNP:118203684
2641 2641 g, t dbSNP:118203685
2643 2643 -, a dbSNP:118203686
2648 2648 a, g dbSNP:749111647
2659 2659 a, c dbSNP:781371665
2666 2666 -, t dbSNP:397514786
2668 2668 c, t dbSNP:397514862
2680 2680 g, t dbSNP:118203687
2686 2686 -, t dbSNP:118203688
2690 2690 -, ggaacatgattgcg dbSNP:118203689
2699 2699 c, t dbSNP:118203690
2700 2700 -, t dbSNP:118203691
2700 2700 c, t dbSNP:754248661
2702 2702 c, g, t dbSNP:756514375
2703 2703 a, g dbSNP:200651872
2704 2704 c, g dbSNP:118203692
2710 2710 c, g dbSNP:397514814
2711 2711 a, g dbSNP:761281095
2713 2713 a, g dbSNP:751128287
2719 2719 c, t dbSNP:199517042
2735 2735 -, acaa dbSNP:118203693
2742 2742 c, g dbSNP:764014190
2744 2744 -, gt dbSNP:118203694
2747 2747 -, g dbSNP:118203696
2747 2747 -, a dbSNP:118203695
2749 2749 -, ac dbSNP:118203697
2750 2750 -, ct dbSNP:118203698
2751 2751 g, t dbSNP:762811821
2757 2757 a, c, g dbSNP:149719514
2764 2764 a, c, t dbSNP:118203699
2770 2770 c, g dbSNP:773279842
2776 2776 c, t dbSNP:118203700
2780 2780 -, a dbSNP:118203701
2784 2784 c, t dbSNP:112384441
2786 2786 c, g dbSNP:118203706
2787 2787 -, aaac dbSNP:118203707
2788 2788 -, aaca dbSNP:118203708
2789 2789 -, a dbSNP:118203709
2793 2793 c, t dbSNP:786203259
2794 2794 -, gagt dbSNP:794727320
2799 2799 a, c, g dbSNP:547498792
2800 2800 -, g dbSNP:397514850
2802 2802 c, t dbSNP:397514825
2806 2806 c, g dbSNP:749414404
2807 2807 -, agcagat dbSNP:118203710
2821 2821 c, t dbSNP:780394011
2835 2835 c, g dbSNP:770381040
2838 2838 -, ggtt dbSNP:118203711
2839 2839 a, g dbSNP:746215028
2848 2848 -, g dbSNP:118203713
2848 2848 -, g dbSNP:118203712
2856 2856 c, t dbSNP:781553258
2861 2861 -, t dbSNP:397514865
2874 2874 -, a dbSNP:118203714
2883 2883 c, t dbSNP:147163264
2893 2893 a, c, g dbSNP:746607455
2902 2902 a, c dbSNP:78260659
2904 2904 a, g dbSNP:777437357
2905 2905 g, t dbSNP:747602915
2914 2914 a, g dbSNP:778416424
2915 2915 c, t dbSNP:754457018
2925 2925 c, t dbSNP:118203720
2926 2926 a, g dbSNP:118203721
2929 2929 -, t dbSNP:118203722
2931 2931 a, t dbSNP:397514805
2932 2932 c, t dbSNP:118203723
2933 2933 a, g dbSNP:200514807
2936 2936 -, aa dbSNP:397514828
2937 2937 -, a dbSNP:397514788
2937 2937 a, g dbSNP:368212910
2938 2938 a, g dbSNP:763169786
2944 2944 at, ga dbSNP:587778724
2944 2944 a, g dbSNP:775589156
2945 2945 a, t dbSNP:765314309
2947 2947 a, g dbSNP:543892243
2948 2948 a, g dbSNP:759567710
2951 2951 -, a, aa dbSNP:118203724
2951 2951 -, a dbSNP:397514875
2953 2953 -, ag dbSNP:118203726
2958 2958 c, t dbSNP:374311456
2961 2961 c, t dbSNP:771479673
2962 2962 a, g dbSNP:576476807
2965 2965 a, c dbSNP:377132822
2968 2968 c, t dbSNP:118203727
2969 2969 a, t dbSNP:772324460
2970 2970 a, g dbSNP:372915963
2971 2971 c, t dbSNP:118203728
2973 2973 -, g dbSNP:118203729
2975 2975 c, g dbSNP:76801599
2977 2977 c, t dbSNP:397514871
2978 2978 -, a dbSNP:118203731
2979 2979 a, g dbSNP:560986491
2995 2995 c, t dbSNP:118203732
3001 3001 c, t dbSNP:748845915
3002 3002 a, g dbSNP:780115763
3007 3007 g, t dbSNP:756176990
3018 3018 a, c dbSNP:750238092
3026 3026 c, t dbSNP:781076347
3028 3028 c, g dbSNP:397514873
3032 3032 a, g dbSNP:757025842
3045 3045 g, t dbSNP:546119844
3055 3055 c, g, t dbSNP:397514879
3060 3060 -, gaaa dbSNP:397514845
3060 3060 a, g dbSNP:118203733
3065 3065 -, at dbSNP:118203734
3066 3066 c, t dbSNP:753980869
3075 3075 c, t dbSNP:766871150
3085 3085 c, t dbSNP:118203735
3099 3099 -, aggacag dbSNP:750627858
3106 3106 g, t dbSNP:781023778
3108 3108 -, ggcct dbSNP:118203739
3108 3108 c, t dbSNP:4962081
3109 3109 a, g dbSNP:751362258
3113 3113 a, t dbSNP:779185959
3114 3114 a, g dbSNP:371301169
3144 3144 c, t dbSNP:45468995
3156 3156 a, g dbSNP:754067582
3157 3157 c, t dbSNP:766383986
3161 3161 a, g dbSNP:760762170
3174 3174 a, g dbSNP:750886491
3175 3175 c, t dbSNP:767946427
3176 3176 a, g dbSNP:762213436
3180 3180 c, t dbSNP:774634388
3184 3184 g, t dbSNP:768350176
3189 3189 a, g dbSNP:762627301
3192 3192 a, g dbSNP:775305403
3195 3195 g, t dbSNP:775179927
3201 3201 c, t dbSNP:769389702
3203 3203 a, t dbSNP:549467159
3211 3211 c, g dbSNP:397514859
3212 3212 g, t dbSNP:770834438
3219 3219 a, g dbSNP:557674294
3228 3228 -, agaagcagc dbSNP:767902029
3228 3228 a, g dbSNP:202223925
3244 3244 g, t dbSNP:537585211
3247 3247 a, g dbSNP:200398750
3250 3250 c, g dbSNP:758199199
3259 3259 g, t dbSNP:78868727
3261 3261 c, t dbSNP:199919348
3263 3263 a, g dbSNP:144314195
3266 3266 a, g dbSNP:771810884
3274 3274 a, c, g dbSNP:780224196
3277 3277 g, t dbSNP:756384645
3279 3279 c, g dbSNP:552217429
3284 3284 a, t dbSNP:202121327
3289 3289 a, t dbSNP:371879917
3290 3290 c, t dbSNP:757370776
3291 3291 a, g dbSNP:751970451
3298 3298 c, t dbSNP:764738792
3302 3302 -, at dbSNP:775387289
3303 3303 c, g, t dbSNP:142954164
3309 3309 g, t dbSNP:118203741
3313 3313 a, t dbSNP:764979889
3324 3324 c, t dbSNP:759047948
3327 3327 c, t dbSNP:786203900
3346 3346 c, t dbSNP:138445573
3354 3354 c, t dbSNP:765753157
3355 3355 a, g, t dbSNP:533565295
3356 3356 c, t dbSNP:566430298
3358 3358 c, t dbSNP:375394001
3370 3370 a, g dbSNP:772043928
3382 3382 a, g dbSNP:118203742
3386 3386 a, g dbSNP:774196458
3391 3391 a, g dbSNP:768443391
3400 3400 -, agcagcagc dbSNP:759531937
3402 3402 c, g dbSNP:753374839
3403 3403 -, agcagc dbSNP:769722545
3404 3404 g, t dbSNP:148931779
3406 3406 (agc)6, 7, 8 dbSNP:2234980
3406 3406 -, agc dbSNP:397514812
3408 3408 -, agc, agcagc dbSNP:118203743
3408 3408 c, t dbSNP:201192125
3412 3412 c, g dbSNP:747162992
3419 3419 c, t dbSNP:587778726
3426 3426 c, g dbSNP:397514831
3429 3429 -, a dbSNP:777361506
3438 3438 c, t dbSNP:778413037
3447 3447 aggc, ggtg dbSNP:587778725
3448 3448 a, g dbSNP:587778727
3451 3451 c, t dbSNP:112066743
3456 3456 c, g dbSNP:753263747
3463 3463 c, t dbSNP:118203745
3464 3464 a, g dbSNP:755396992
3473 3473 c, t dbSNP:753388676
3474 3474 a, g dbSNP:118203746
3489 3489 a, g dbSNP:201165286
3494 3494 c, t dbSNP:779369226
3495 3495 c, t dbSNP:118203747
3507 3507 a, c, t dbSNP:140622357
3510 3510 c, t dbSNP:118203748
3516 3516 c, t dbSNP:749995749
3524 3524 c, g dbSNP:767439431
3528 3528 c, t dbSNP:761673589
3536 3536 a, g dbSNP:774286125
3545 3545 a, c, g dbSNP:762845573
3547 3547 a, g dbSNP:776694051
3549 3549 a, g dbSNP:771241484
3553 3553 g, t dbSNP:747053008
3557 3557 a, g dbSNP:550526986
3558 3558 a, c dbSNP:772288584
3561 3561 a, g dbSNP:116747861
3568 3568 c, t dbSNP:779599439
3569 3569 a, g dbSNP:118203750
3579 3579 c, t dbSNP:754282309
3582 3582 a, g dbSNP:118203751
3600 3600 c, t dbSNP:118203752
3601 3601 a, g dbSNP:118203753
3603 3603 c, t dbSNP:35593170
3615 3615 a, c dbSNP:761334590
3624 3624 a, g dbSNP:751467429
3626 3626 a, g dbSNP:764140399
3629 3629 c, t dbSNP:762641110
3635 3635 c, t dbSNP:775420987
3640 3640 c, t dbSNP:769478982
3643 3643 a, g dbSNP:760918561
3660 3660 a, g dbSNP:773586317
3665 3665 c, t dbSNP:772233665
3666 3666 c, t dbSNP:200200869
3670 3670 a, c dbSNP:761577419
3675 3675 c, t dbSNP:774980129
3681 3681 c, t dbSNP:769266225
3682 3682 c, t dbSNP:749612772
3684 3684 a, g dbSNP:568004490
3687 3687 a, t dbSNP:751398082
3692 3692 a, c dbSNP:756449737
3693 3693 c, t dbSNP:745475737
3695 3695 a, c dbSNP:764018144
3696 3696 a, c, t dbSNP:756737864
3698 3698 c, t dbSNP:751126355
3699 3699 a, g dbSNP:763931959
3705 3705 c, t dbSNP:758286878
3706 3706 c, g dbSNP:574823234
3707 3707 c, t dbSNP:201867031
3708 3708 a, g dbSNP:759431801
3712 3712 c, g dbSNP:773541137
3713 3713 c, t dbSNP:767904247
3714 3714 a, g dbSNP:140352085
3715 3715 c, g, t dbSNP:397514806
3718 3718 a, g dbSNP:768624733
3765 3765 a, t dbSNP:749746550
3776 3776 a, g dbSNP:775883753
3788 3788 -, atca dbSNP:771669937
3788 3788 a, g, t dbSNP:200574927
3789 3789 -, tcagtgtta dbSNP:779193014
3791 3791 -, ag dbSNP:747806078
3798 3798 a, g dbSNP:371327323
3802 3802 a, g dbSNP:780808150
3807 3807 c, t dbSNP:756968900
3810 3810 c, t dbSNP:746666326
3814 3814 c, t dbSNP:368088063
3834 3834 g, t dbSNP:577329896
3881 3881 c, t dbSNP:116917669
3890 3890 a, c, g dbSNP:181486656
3892 3892 a, g dbSNP:547814206
3896 3896 c, t dbSNP:760841318
3972 3972 c, t dbSNP:7037703
3978 3978 c, t dbSNP:773545079
3979 3979 a, g dbSNP:142517227
4003 4003 c, t dbSNP:755219758
4030 4030 c, t dbSNP:531195720
4053 4053 g, t dbSNP:554637460
4061 4061 -, t dbSNP:397819014
4063 4063 c, t dbSNP:115091888
4063 4063 -, t dbSNP:11323835
4064 4064 -, c dbSNP:199959286
4068 4068 c, g dbSNP:536230220
4069 4069 a, c, g dbSNP:113549339
4084 4084 c, t dbSNP:748518884
4094 4094 a, g dbSNP:532216079
4132 4132 c, t dbSNP:147729052
4135 4135 c, t dbSNP:397514844
4143 4143 a, g dbSNP:546473176
4150 4150 c, t dbSNP:114064768
4179 4179 a, g dbSNP:560193480
4261 4261 c, t dbSNP:541843034
4273 4273 c, t dbSNP:530003850
4280 4280 a, g dbSNP:563052235
4291 4291 c, t dbSNP:181111365
4348 4348 c, t dbSNP:576831542
4361 4361 c, t dbSNP:559148790
4376 4376 c, t dbSNP:755527309
4417 4417 c, g dbSNP:540812085
4425 4425 c, g dbSNP:369911288
4451 4451 c, g dbSNP:189890583
4456 4456 c, t dbSNP:75252898
4554 4554 a, g dbSNP:184321915
4580 4580 c, t dbSNP:191614777
4604 4604 a, c, g dbSNP:534651131
4615 4615 c, t dbSNP:149902841
4616 4616 a, g dbSNP:575246018
4687 4687 c, t dbSNP:117425923
4697 4697 a, g dbSNP:368824230
4715 4715 a, g dbSNP:189368676
4716 4716 c, t dbSNP:565743323
4769 4769 c, g dbSNP:758217339
4824 4824 c, t dbSNP:530042727
4826 4826 a, g dbSNP:562950766
4858 4858 g, t dbSNP:752538602
4880 4880 a, g dbSNP:544273113
4901 4901 c, t dbSNP:139119563
4926 4926 a, t dbSNP:367801115
4934 4934 c, t dbSNP:765244801
4968 4968 c, g dbSNP:565416605
5018 5018 g, t dbSNP:540849136
5023 5023 c, t dbSNP:760805774
5025 5025 c, t dbSNP:773490178
5049 5049 g, t dbSNP:2809244
5096 5096 a, c, g, t dbSNP:2809243
5098 5098 c, t dbSNP:774716260
5106 5106 c, t dbSNP:397514841
5117 5117 a, g dbSNP:768858045
5129 5129 a, c dbSNP:749683153
5146 5146 g, t dbSNP:58612431
5147 5147 g, t dbSNP:575245339
5170 5170 c, t dbSNP:397514790
5192 5192 c, t dbSNP:556956686
5236 5236 c, t dbSNP:538239408
5242 5242 c, t dbSNP:72759433
5243 5243 g, t dbSNP:552958137
5257 5257 c, g dbSNP:185039865
5261 5261 c, t dbSNP:79277527
5262 5262 c, t dbSNP:739442
5264 5264 c, t dbSNP:536391268
5281 5281 a, g dbSNP:739441
5282 5282 a, g dbSNP:552190342
5289 5289 -, aa dbSNP:536648576
5315 5315 -, t dbSNP:748099884
5392 5392 c, t dbSNP:756774572
5395 5395 c, t dbSNP:759483755
5428 5428 c, g dbSNP:746598492
5454 5454 a, g dbSNP:532372427
5464 5464 a, c, g dbSNP:192562699
5544 5544 a, c dbSNP:1801987
5559 5559 a, g dbSNP:74362385
5576 5576 a, c dbSNP:188259612
5580 5580 g, t dbSNP:752575824
5594 5594 c, t dbSNP:765079072
5635 5635 a, g dbSNP:561511694
5676 5676 g, t dbSNP:142038787
5685 5685 -, ctc dbSNP:758358370
5708 5708 a, g dbSNP:10491534
5716 5716 a, g dbSNP:563209868
5766 5766 c, t dbSNP:75053229
5795 5795 c, t dbSNP:577527391
5796 5796 a, g dbSNP:568052856
5801 5801 a, g dbSNP:748182713
5805 5805 a, t dbSNP:552852803
5846 5846 -, c dbSNP:5900999
5859 5859 c, t dbSNP:781713466
5868 5868 a, g dbSNP:534649062
5883 5883 c, t dbSNP:73552808
5900 5900 a, g dbSNP:183690096
5916 5916 c, t dbSNP:112314368
5942 5942 c, t dbSNP:532469694
5960 5960 c, g dbSNP:138008061
5987 5987 c, t dbSNP:539030496
5994 5994 a, g, t dbSNP:192554915
5996 5996 c, t dbSNP:146254737
6002 6002 a, g dbSNP:528833042
6004 6004 a, g dbSNP:397514781
6021 6021 a, g dbSNP:188426740
6022 6022 c, t dbSNP:532670371
6076 6076 g, t dbSNP:563584509
6110 6110 c, t dbSNP:770192563
6128 6128 a, g dbSNP:114877981
6136 6136 c, t dbSNP:530978157
6162 6162 g, t dbSNP:563408425
6179 6179 c, t dbSNP:777129120
6192 6192 a, g dbSNP:114415181
6211 6211 a, g dbSNP:149587565
6220 6220 a, g dbSNP:558966777
6235 6235 a, g dbSNP:73552806
6243 6243 a, c dbSNP:182128629
6292 6292 a, g dbSNP:138187401
6320 6320 c, t dbSNP:777270810
6332 6332 a, g dbSNP:115516164
6362 6362 a, g dbSNP:576114208
6402 6402 c, g dbSNP:189852768
6411 6411 c, g dbSNP:538802838
6412 6412 c, t dbSNP:373845353
6415 6415 g, t dbSNP:397514827
6419 6419 c, t dbSNP:778965195
6425 6425 g, t dbSNP:55660990
6448 6448 a, t dbSNP:534994012
6482 6482 c, g dbSNP:150433809
6489 6489 a, g dbSNP:778711100
6498 6498 c, t dbSNP:749535135
6499 6499 a, g dbSNP:141399920
6507 6507 a, g dbSNP:73552805
6517 6517 a, g dbSNP:753784286
6540 6540 a, g dbSNP:780158617
6553 6553 a, t dbSNP:139067673
6604 6604 c, t dbSNP:551944711
6612 6612 a, g dbSNP:532920974
6621 6621 a, g dbSNP:559004498
6646 6646 a, g dbSNP:2106345
6648 6648 a, g dbSNP:111832812
6664 6664 -, aaaa dbSNP:752640867
6664 6664 -, a dbSNP:771261397
6667 6667 -, a dbSNP:143549363
6678 6678 g, t dbSNP:559978998
6792 6792 a, g dbSNP:543304631
6808 6808 c, t dbSNP:764220703
6819 6819 a, g dbSNP:746365344
6840 6840 a, c dbSNP:752880069
6881 6881 c, t dbSNP:576281564
6916 6916 g, t dbSNP:765522631
6944 6944 a, g dbSNP:367605870
6992 6992 c, t dbSNP:759925810
7002 7002 c, t dbSNP:781746755
7031 7031 a, g dbSNP:757870931
7032 7032 c, g dbSNP:397514877
7034 7034 c, g dbSNP:397514782
7054 7054 c, g dbSNP:557707101
7067 7067 a, t dbSNP:545961219
7103 7103 g, t dbSNP:578163954
7104 7104 a, g dbSNP:553475307
7160 7160 a, t dbSNP:540869574
7180 7180 -, ca dbSNP:759013461
7184 7184 a, g dbSNP:771479576
7206 7206 c, t dbSNP:186713016
7222 7222 c, t dbSNP:201092466
7234 7234 c, t dbSNP:555730718
7238 7238 c, g dbSNP:537386509
7284 7284 c, t dbSNP:183150354
7293 7293 a, g dbSNP:192313622
7312 7312 a, g dbSNP:533324867
7339 7339 c, t dbSNP:771494783
7340 7340 a, g dbSNP:565450993
7417 7417 c, t dbSNP:373424021
7422 7422 c, t dbSNP:113313202
7440 7440 a, c dbSNP:530313938
7443 7443 a, g dbSNP:547046358
7453 7453 a, g dbSNP:1050700
7458 7458 c, t dbSNP:768518987
7471 7471 c, t dbSNP:111450858
7503 7503 g, t dbSNP:543396172
7506 7506 c, t dbSNP:749141370
7524 7524 a, g dbSNP:758064113
7585 7585 -, a dbSNP:753493781
7585 7585 a, g dbSNP:186586639
7602 7602 a, g dbSNP:142666298
7604 7604 c, t dbSNP:544931538
7607 7607 a, c dbSNP:575812223
7610 7610 a, g dbSNP:572231078
7629 7629 c, t dbSNP:558930752
7635 7635 c, t dbSNP:765057102
7653 7653 g, t dbSNP:143740161
7687 7687 c, t dbSNP:751581381
7709 7709 c, t dbSNP:397514787
7710 7710 c, t dbSNP:397514853
7726 7726 a, g dbSNP:114454155
7729 7729 -, t dbSNP:754744080
7762 7762 a, g dbSNP:563835484
7770 7770 c, t dbSNP:555515069
7771 7771 a, g dbSNP:148982924
7773 7773 a, g dbSNP:758417405
7782 7782 c, t dbSNP:576689814
7783 7783 c, t dbSNP:752925196
7794 7794 c, t dbSNP:111543364
7795 7795 c, t dbSNP:182163633
7831 7831 a, g dbSNP:17149898
7837 7837 c, g dbSNP:565885149
7841 7841 a, g dbSNP:547579970
7895 7895 c, t dbSNP:149697824
7910 7910 c, g dbSNP:766856579
7923 7923 a, g dbSNP:568131325
7986 7986 c, t dbSNP:550488189
8028 8028 a, g dbSNP:139801034
8050 8050 a, g dbSNP:766234756
8061 8061 a, g dbSNP:567187061
8085 8085 -, t dbSNP:34809769
8133 8133 c, t dbSNP:564238927
8159 8159 g, t dbSNP:552453527
8167 8167 c, g dbSNP:766619507
8182 8182 c, t dbSNP:553706984
8211 8211 a, g dbSNP:11553763
8221 8221 c, t dbSNP:112968492
8268 8268 c, t dbSNP:771570729
8314 8314 a, c dbSNP:571533135
8365 8365 g, t dbSNP:397514821
8372 8372 a, g dbSNP:560429673
8398 8398 -, t dbSNP:761574558
8405 8405 -, t dbSNP:567915647
8405 8405 -, t dbSNP:60000611
8423 8423 c, t dbSNP:542031984
8454 8454 g, t dbSNP:747969932
8464 8464 a, t dbSNP:574215824
8481 8481 a, t dbSNP:562186340
8537 8537 c, t dbSNP:79470094
8562 8562 a, c dbSNP:576342925
8578 8578 a, t dbSNP:768793452
8599 8599 a, g dbSNP:554300720

Target ORF information:

RefSeq Version XM_005272211
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu18443D
Sequence Information ORF Nucleotide Sequence (Length: 3495bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product hamartin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)218..2371(+)
Misc Feature(2)2486..2968(+)
Misc Feature(3)2510..3010(+)
Position Chain Variation Link
60 60 c, g dbSNP:530965070
66 66 a, g dbSNP:751231310
86 86 a, t dbSNP:116951280
116 116 c, t dbSNP:114755636
147 147 c, t dbSNP:529212875
151 151 a, g dbSNP:561540358
171 171 a, g dbSNP:773447503
179 179 c, t dbSNP:772626361
180 180 a, g dbSNP:370122384
193 193 -, cagc dbSNP:776033881
195 195 c, t dbSNP:377001111
198 198 c, t dbSNP:768441689
199 199 a, g, t dbSNP:114970627
203 203 c, t dbSNP:755999334
204 204 a, c, t dbSNP:570705364
205 205 a, g dbSNP:756989263
208 208 c, g, t dbSNP:62621221
211 211 g, t dbSNP:755266452
224 224 c, t dbSNP:753838459
235 235 c, g, t dbSNP:145987906
236 236 a, g dbSNP:773784532
251 251 a, g dbSNP:768147590
256 256 a, g dbSNP:762233181
261 261 c, g dbSNP:774900322
265 265 c, g dbSNP:768175095
266 266 a, t dbSNP:762059806
278 278 c, t dbSNP:749030456
279 279 a, g dbSNP:141736779
283 283 c, t dbSNP:769282604
284 284 -, g dbSNP:118203330
286 286 c, t dbSNP:376527838
301 301 c, t dbSNP:745384145
307 307 g, t dbSNP:781059342
313 313 c, t dbSNP:757216373
321 321 a, t dbSNP:148468036
323 323 -, c dbSNP:118203333
324 324 a, g dbSNP:750441497
328 328 c, g dbSNP:776158461
330 330 c, g dbSNP:770831962
335 335 a, c, t dbSNP:118203334
338 338 c, g dbSNP:777537794
340 340 a, c dbSNP:118203335
344 344 -, a dbSNP:118203336
346 346 -, c, cc dbSNP:118203337
347 347 c, t dbSNP:755226092
349 349 a, g dbSNP:149278759
359 359 -, t dbSNP:118203339
360 360 -, a dbSNP:397514861
362 362 -, c dbSNP:118203340
363 363 c, t dbSNP:118203341
367 367 a, c dbSNP:118203342
373 373 c, t dbSNP:756335238
377 377 c, t dbSNP:118203343
381 381 c, t dbSNP:750512029
382 382 a, g dbSNP:781483110
390 390 a, t dbSNP:757837986
391 391 c, t dbSNP:767647768
395 395 -, ctgaccacc dbSNP:118203344
395 395 c, t dbSNP:752047592
396 396 c, g, t dbSNP:118203345
405 405 -, tgcaagagc dbSNP:118203346
409 409 a, g dbSNP:764523181
415 415 a, g dbSNP:371555137
417 417 a, g dbSNP:118203347
427 427 a, c dbSNP:765578482
428 428 c, t dbSNP:759183842
429 429 c, t dbSNP:118203354
441 441 a, t dbSNP:118203355
445 445 c, t dbSNP:397514809
450 450 a, g dbSNP:373855276
451 451 c, t dbSNP:761596603
459 459 a, c dbSNP:118203356
461 461 a, c, g dbSNP:76667066
463 463 c, t dbSNP:145783693
464 464 a, g dbSNP:118203357
465 465 a, c dbSNP:761717715
466 466 -, c dbSNP:118203358
474 474 -, ga dbSNP:118203359
474 474 g, t dbSNP:397514776
484 484 c, t dbSNP:142325036
485 485 -, tc dbSNP:118203360
486 486 a, c, t dbSNP:118203361
487 487 a, g, t dbSNP:115097221
490 490 -, a, aa dbSNP:118203362
492 492 g, t dbSNP:118203363
499 499 c, t dbSNP:113042347
501 501 c, t dbSNP:370243092
503 503 a, g, t dbSNP:138541569
522 522 a, g dbSNP:118203364
523 523 a, g dbSNP:118203365
528 528 a, g dbSNP:758924121
538 538 -, tc dbSNP:397514795
539 539 c, t dbSNP:397514774
545 545 c, t dbSNP:748669519
549 549 -, ct dbSNP:118203366
552 552 -, t dbSNP:118203367
554 554 c, t dbSNP:779395169
556 556 c, g, t dbSNP:754220721
560 560 g, t dbSNP:199620268
562 562 a, t dbSNP:755799702
564 564 c, t dbSNP:118203368
576 576 a, g dbSNP:118203369
577 577 a, g dbSNP:118203370
584 584 a, g dbSNP:745871522
585 585 c, g dbSNP:747251435
586 586 -, t dbSNP:118203377
589 589 c, t dbSNP:560863078
590 590 a, g dbSNP:397514843
592 592 c, t dbSNP:373173550
593 593 -, gtt dbSNP:118203378
593 593 a, g dbSNP:372215435
595 595 -, tgt dbSNP:118203379
599 599 -, c dbSNP:397514852
603 603 c, t dbSNP:779340088
609 609 ca, gcgtcttggtgt dbSNP:118203380
609 609 a, c, g dbSNP:397514784
610 610 c, t dbSNP:368922726
611 611 a, g, t dbSNP:118203381
616 616 a, g dbSNP:147125501
629 629 a, g dbSNP:780442112
647 647 -, ca dbSNP:118203383
647 647 c, t dbSNP:118203382
659 659 c, t dbSNP:118203384
669 669 c, t dbSNP:755791846
687 687 c, g, t dbSNP:118203385
693 693 a, g dbSNP:749979841
703 703 a, t dbSNP:118203386
705 705 a, g dbSNP:118203387
709 709 a, c dbSNP:118203388
718 718 -, a dbSNP:118203389
720 720 a, c dbSNP:767215560
727 727 c, t dbSNP:377196837
729 729 g, t dbSNP:751092692
732 732 c, t dbSNP:777484049
733 733 a, g dbSNP:768999400
734 734 g, t dbSNP:118203392
738 738 -, t dbSNP:118203393
740 740 -, ta dbSNP:118203394
744 744 -, t dbSNP:397514794
745 745 c, t dbSNP:752615412
746 746 a, g dbSNP:118203395
753 753 c, t dbSNP:118203396
754 754 c, t dbSNP:201562103
756 756 a, c, g, t dbSNP:397515294
757 757 g, t dbSNP:762139762
763 763 c, t dbSNP:774398322
766 766 c, g dbSNP:118203397
769 769 c, t dbSNP:118203398
777 777 -, tt dbSNP:118203399
782 782 c, t dbSNP:118203400
783 783 a, c, g dbSNP:118203402
783 783 -, g dbSNP:118203401
786 786 a, g, t dbSNP:118203403
788 788 c, t dbSNP:786202831
789 789 -, a dbSNP:118203405
790 790 g, t dbSNP:118203406
795 795 c, t dbSNP:746188529
799 799 a, c dbSNP:118203407
804 804 -, g dbSNP:397514868
805 805 -, c dbSNP:397514836
807 807 -, act dbSNP:118203408
807 807 a, g dbSNP:577983115
811 811 -, cgtctcc dbSNP:118203409
811 811 c, t dbSNP:202242304
812 812 a, g dbSNP:118203410
813 813 -, t dbSNP:118203411
816 816 -, cct dbSNP:118203412
817 817 a, c dbSNP:777571943
822 822 -, tt dbSNP:118203413
825 825 c, g dbSNP:397514834
829 829 c, t dbSNP:118203414
832 832 c, t dbSNP:118203415
836 836 a, c dbSNP:778671811
838 838 -, t dbSNP:397514837
839 839 a, g dbSNP:754980229
847 847 a, g dbSNP:753550247
861 861 -, tt dbSNP:118203417
861 861 c, t dbSNP:118203416
862 862 -, t dbSNP:397514835
865 865 a, g dbSNP:766250769
868 868 -, a dbSNP:118203418
871 871 c, g dbSNP:755910789
872 872 a, g, t dbSNP:397514830
879 879 -, c dbSNP:118203425
880 880 a, c dbSNP:754853512
884 884 a, t dbSNP:535397245
885 885 g, t dbSNP:118203426
887 887 a, g dbSNP:572899352
896 896 c, t dbSNP:118203427
907 907 a, g dbSNP:749311040
908 908 -, g dbSNP:118203428
908 908 g, t dbSNP:118203429
923 923 -, t dbSNP:118203430
926 926 a, t dbSNP:397514816
934 934 -, a dbSNP:118203431
934 934 g, t dbSNP:779872953
938 938 c, t dbSNP:118203432
946 946 -, t dbSNP:118203433
947 947 c, t dbSNP:118203434
948 948 a, g dbSNP:755859330
951 951 a, c, g dbSNP:118203436
951 951 -, g dbSNP:118203435
952 952 a, g dbSNP:118203441
956 956 a, t dbSNP:118203442
959 959 -, a dbSNP:118203444
959 959 a, t dbSNP:118203443
963 963 -, t dbSNP:118203446
963 963 a, g, t dbSNP:118203447
963 963 -, t dbSNP:118203445
973 973 c, t dbSNP:748775797
976 976 c, t dbSNP:780005416
984 984 a, c, t dbSNP:745640752
985 985 -, c dbSNP:118203449
986 986 a, g, t dbSNP:118203450
993 993 c, g dbSNP:758617649
996 996 a, g dbSNP:371225009
1000 1000 c, g dbSNP:779015004
1012 1012 c, t dbSNP:770704462
1018 1018 a, g dbSNP:753895570
1021 1021 c, t dbSNP:766961309
1024 1024 a, g dbSNP:142336706
1026 1026 -, at dbSNP:118203451
1027 1027 a, t dbSNP:118203452
1028 1028 a, g, t dbSNP:397514872
1031 1031 a, c dbSNP:2106347
1032 1032 a, t dbSNP:768057796
1033 1033 g, t dbSNP:148756522
1039 1039 -, at dbSNP:118203453
1039 1039 g, t dbSNP:118203454
1040 1040 c, t dbSNP:774009225
1044 1044 -, tg dbSNP:118203455
1044 1044 c, t dbSNP:200749357
1045 1045 -, gt dbSNP:118203456
1048 1048 -, tc dbSNP:118203457
1052 1052 c, t dbSNP:118203458
1059 1059 a, c dbSNP:118203459
1060 1060 -, a dbSNP:118203460
1060 1060 a, g dbSNP:768226293
1064 1064 c, t dbSNP:140544652
1065 1065 a, g dbSNP:151309813
1066 1066 c, t dbSNP:769706203
1067 1067 g, t dbSNP:377076733
1071 1071 c, g dbSNP:375144225
1076 1076 c, t dbSNP:770653972
1080 1080 c, g dbSNP:397514867
1084 1084 c, g, t dbSNP:779155575
1085 1085 a, g dbSNP:755195460
1087 1087 c, t dbSNP:753928162
1090 1090 c, t dbSNP:116756594
1092 1092 c, t dbSNP:756681916
1100 1100 c, t dbSNP:750890263
1105 1105 a, g, t dbSNP:118203461
1113 1113 c, t dbSNP:370916731
1115 1115 -, ca dbSNP:118203464
1115 1115 c, t dbSNP:118203463
1117 1117 c, g dbSNP:762200890
1126 1126 c, g, t dbSNP:118203466
1127 1127 a, g, t dbSNP:118203468
1129 1129 a, c, g, t dbSNP:397515293
1130 1130 g, t dbSNP:34876281
1131 1131 a, g dbSNP:752290177
1132 1132 g, t dbSNP:34610255
1134 1134 c, t dbSNP:572611259
1135 1135 c, t dbSNP:397514826
1144 1144 c, t dbSNP:759004332
1146 1146 c, g dbSNP:776158460
1150 1150 a, c dbSNP:118203472
1152 1152 c, t dbSNP:766317920
1155 1155 c, t dbSNP:373454700
1156 1156 a, g dbSNP:144208203
1157 1157 a, t dbSNP:185815387
1160 1160 c, t dbSNP:535868591
1161 1161 a, g dbSNP:375956049
1171 1171 -, gtt dbSNP:755655903
1174 1174 a, g dbSNP:770183315
1179 1179 c, t dbSNP:1073123
1180 1180 a, g dbSNP:397514807
1181 1181 c, g dbSNP:781189978
1186 1186 a, g dbSNP:118203473
1187 1187 c, t dbSNP:118203474
1191 1191 c, t dbSNP:757779597
1197 1197 -, a dbSNP:118203475
1201 1201 g, t dbSNP:202091845
1202 1202 -, c dbSNP:118203476
1202 1202 -, ct dbSNP:118203477
1203 1203 -, t dbSNP:118203478
1203 1203 -, tg dbSNP:118203479
1203 1203 -, t dbSNP:397514870
1208 1208 -, a dbSNP:118203480
1215 1215 a, c, t dbSNP:118203481
1216 1216 a, c, g dbSNP:200820603
1219 1219 a, g dbSNP:753091213
1220 1220 a, c, t dbSNP:118203483
1221 1221 -, ggctgataac dbSNP:397514849
1221 1221 a, g dbSNP:397514808
1229 1229 a, t dbSNP:570809282
1234 1234 -, a dbSNP:118203484
1234 1234 a, g dbSNP:760233114
1244 1244 -, g dbSNP:118203486
1252 1252 c, t dbSNP:753360364
1254 1254 a, g dbSNP:118203490
1255 1255 a, g dbSNP:118203491
1259 1259 c, g dbSNP:779767990
1261 1261 a, g dbSNP:118203492
1264 1264 c, t dbSNP:150777389
1265 1265 a, g dbSNP:781312535
1267 1267 a, g dbSNP:757404847
1292 1292 a, g dbSNP:201738258
1293 1293 a, c dbSNP:118203493
1298 1298 c, t dbSNP:397514864
1306 1306 -, tgtcccacctgatc dbSNP:118203494
1311 1311 -, cacctgatctgtca dbSNP:118203495
1311 1311 c, t dbSNP:763915012
1319 1319 c, t dbSNP:118203496
1324 1324 -, a dbSNP:118203497
1324 1324 a, t dbSNP:371648887
1327 1327 -, ac dbSNP:118203498
1327 1327 a, c, t dbSNP:771217333
1328 1328 c, g dbSNP:760638759
1332 1332 -, a dbSNP:118203499
1358 1358 a, g dbSNP:367564729
1366 1366 -, a dbSNP:118203501
1374 1374 c, t dbSNP:764150061
1377 1377 c, t dbSNP:377598226
1380 1380 a, g dbSNP:752575728
1380 1380 -, g dbSNP:397514832
1392 1392 c, t dbSNP:201452238
1404 1404 c, t dbSNP:766487204
1405 1405 a, g dbSNP:370281825
1410 1410 -, cactctgtcattcg dbSNP:118203502
1410 1410 c, t dbSNP:761014195
1412 1412 c, t dbSNP:773160913
1414 1414 c, g dbSNP:767514820
1417 1417 a, t dbSNP:761890555
1417 1417 -, t dbSNP:118203503
1422 1422 c, t dbSNP:118203504
1423 1423 a, g dbSNP:141184479
1431 1431 a, g dbSNP:143502728
1432 1432 c, t dbSNP:373465241
1433 1433 a, g dbSNP:769331772
1435 1435 a, g dbSNP:745463008
1438 1438 c, t dbSNP:781006583
1445 1445 a, c dbSNP:397514840
1446 1446 a, t dbSNP:140410001
1453 1453 a, g dbSNP:786203715
1458 1458 c, t dbSNP:746550630
1462 1462 c, t dbSNP:777823426
1463 1463 -, a dbSNP:397514792
1464 1464 -, c dbSNP:397514778
1464 1464 c, t dbSNP:77464996
1465 1465 a, g dbSNP:147127442
1469 1469 c, g dbSNP:765145057
1471 1471 -, c dbSNP:756865130
1471 1471 a, c, g dbSNP:369642207
1471 1471 -, c dbSNP:118203506
1484 1484 -, ag dbSNP:118203509
1487 1487 a, g dbSNP:753199284
1490 1490 g, t dbSNP:765695557
1493 1493 -, t dbSNP:118203510
1496 1496 ct, gc dbSNP:587778721
1504 1504 a, g dbSNP:759914505
1505 1505 c, t dbSNP:762688935
1517 1517 c, t dbSNP:118203511
1529 1529 c, g dbSNP:199800297
1531 1531 c, g dbSNP:770692313
1541 1541 a, g dbSNP:760470520
1545 1545 a, c, g dbSNP:118203512
1546 1546 a, g dbSNP:773003016
1549 1549 a, g dbSNP:7862221
1552 1552 -, g dbSNP:118203517
1554 1554 c, t dbSNP:772868048
1556 1556 c, t dbSNP:118203518
1557 1557 c, t dbSNP:397514848
1558 1558 c, t dbSNP:530908428
1564 1564 c, t dbSNP:773780814
1568 1568 c, g dbSNP:118203519
1569 1569 c, g dbSNP:371093730
1575 1575 -, tcactctaagtgatcttccagggtttttaggtgatctg dbSNP:118203520
1578 1578 -, c dbSNP:118203521
1580 1580 -, ct dbSNP:397514798
1580 1580 -, ga dbSNP:118203522
1582 1582 a, c dbSNP:397514856
1583 1583 -, a dbSNP:118203523
1583 1583 a, c dbSNP:587778722
1585 1585 c, t dbSNP:118203524
1593 1593 -, c dbSNP:118203525
1596 1596 a, g dbSNP:140953644
1597 1597 c, g dbSNP:779981609
1604 1604 c, g dbSNP:769529472
1625 1625 -, t dbSNP:118203526
1631 1631 a, g dbSNP:745697913
1632 1632 c, t dbSNP:185159716
1645 1645 -, agaa dbSNP:118203527
1645 1645 -, a dbSNP:397514858
1647 1647 -, ga dbSNP:118203528
1647 1647 a, g dbSNP:118203529
1656 1656 a, c dbSNP:775367219
1666 1666 -, a dbSNP:397514797
1674 1674 c, g dbSNP:118203532
1676 1676 g, t dbSNP:118203533
1684 1684 -, c dbSNP:118203534
1693 1693 c, g dbSNP:745657743
1695 1695 -, c dbSNP:118203535
1704 1704 -, tg dbSNP:118203536
1712 1712 c, t dbSNP:118203537
1713 1713 a, g dbSNP:118203538
1715 1715 g, t dbSNP:118203539
1717 1717 -, a dbSNP:397514876
1717 1717 a, c dbSNP:201810746
1720 1720 c, t dbSNP:772337076
1729 1729 -, t dbSNP:118203540
1730 1730 -, tc dbSNP:281875358
1739 1739 c, t dbSNP:118203542
1740 1740 a, g dbSNP:118203543
1742 1742 a, g dbSNP:779206386
1743 1743 -, ac dbSNP:118203544
1747 1747 -, t dbSNP:118203545
1749 1749 -, tc dbSNP:397514823
1753 1753 a, g dbSNP:755055358
1756 1756 -, g dbSNP:118203546
1758 1758 c, g dbSNP:749410972
1764 1764 a, g dbSNP:371908551
1773 1773 -, a dbSNP:118203547
1776 1776 c, t dbSNP:759379027
1781 1781 c, g dbSNP:118203548
1786 1786 c, g dbSNP:397514810
1788 1788 c, g dbSNP:750784794
1793 1793 c, t dbSNP:118203549
1794 1794 -, ag dbSNP:118203550
1794 1794 a, g dbSNP:767708806
1796 1796 -, ggcgccagcgtgaaccctgag dbSNP:766376606
1798 1798 c, t dbSNP:149439187
1799 1799 a, g dbSNP:751125011
1803 1803 c, g dbSNP:368481360
1804 1804 c, t dbSNP:762424091
1805 1805 a, g dbSNP:377279170
1808 1808 a, t dbSNP:765149885
1810 1810 c, t dbSNP:759461471
1821 1821 c, t dbSNP:776633158
1829 1829 -, t dbSNP:118203551
1840 1840 a, g dbSNP:756935981
1844 1844 -, gggcctgacacaccaaa dbSNP:118203552
1845 1845 a, g dbSNP:770570830
1849 1849 c, t dbSNP:372284519
1850 1850 g, t dbSNP:774671298
1854 1854 c, t dbSNP:769040084
1862 1862 c, g dbSNP:118203553
1865 1865 a, g dbSNP:780338343
1876 1876 -, c dbSNP:118203554
1878 1878 -, t dbSNP:397514829
1883 1883 -, c dbSNP:118203556
1883 1883 c, t dbSNP:118203555
1885 1885 -, gccctgcggcagtgctgatgaaa dbSNP:118203557
1890 1890 -, g dbSNP:118203558
1891 1891 c, t dbSNP:368317116
1892 1892 a, g dbSNP:746304922
1894 1894 -, cagtgctgatgaaagccctgcgg dbSNP:397514818
1899 1899 c, g dbSNP:377185303
1901 1901 -, g dbSNP:118203561
1906 1906 -, aa dbSNP:118203562
1911 1911 -, c dbSNP:118203563
1914 1914 c, t dbSNP:397514880
1915 1915 a, g dbSNP:35478675
1916 1916 -, cagtgctgatgaaagccctgcgg dbSNP:118203559
1917 1917 -, g dbSNP:397514777
1918 1918 -, gtgctgatgaaagccctgcggga dbSNP:118203560
1922 1922 -, ag dbSNP:118203564
1924 1924 a, g dbSNP:777386797
1928 1928 c, t dbSNP:758107610
1930 1930 c, t dbSNP:752202276
1931 1931 a, c, t dbSNP:118203565
1935 1935 c, g, t dbSNP:548002938
1938 1938 c, t dbSNP:118203566
1940 1940 c, t dbSNP:118203567
1941 1941 g, tggagaccagtatcttcactcc dbSNP:118203569
1941 1941 -, tggagaccagtatctt dbSNP:118203568
1943 1943 g, t dbSNP:118203570
1945 1945 c, g dbSNP:118203571
1950 1950 -, g dbSNP:118203572
1960 1960 -, t dbSNP:118203573
1963 1963 -, ca dbSNP:118203574
1965 1965 c, g dbSNP:786203799
1967 1967 c, t dbSNP:766367103
1970 1970 c, t dbSNP:760356610
1971 1971 ca, gtaaaattccac dbSNP:397514857
1971 1971 -, gtaaaattc dbSNP:118203575
1973 1973 a, t dbSNP:397514846
1974 1974 a, g dbSNP:118203576
1975 1975 a, g dbSNP:118203577
1980 1980 -, c dbSNP:397514811
1981 1981 a, g dbSNP:118203578
1986 1986 a, c dbSNP:768985094
1987 1987 a, g dbSNP:146578402
1988 1988 -, ga dbSNP:118203579
1989 1989 c, t dbSNP:775869914
1990 1990 a, g, t dbSNP:118203580
1991 1991 a, t dbSNP:118203581
2002 2002 -, t dbSNP:118203582
2006 2006 -, a, aa dbSNP:118203583
2008 2008 c, t dbSNP:766438395
2009 2009 a, g dbSNP:761959210
2016 2016 c, t dbSNP:543077026
2020 2020 a, c dbSNP:771521648
2022 2022 c, t dbSNP:751247705
2023 2023 a, g, t dbSNP:112434645
2032 2032 a, t dbSNP:758769193
2037 2037 -, tt dbSNP:118203585
2038 2038 -, tt dbSNP:118203586
2039 2039 g, t dbSNP:118203587
2053 2053 a, g dbSNP:118203588
2055 2055 -, a dbSNP:118203589
2062 2062 c, t dbSNP:752286096
2063 2063 c, g dbSNP:397514854
2065 2065 -, t dbSNP:118203590
2071 2071 -, t dbSNP:118203591
2083 2083 a, g dbSNP:778556382
2085 2085 c, t dbSNP:754401816
2090 2090 g, t dbSNP:397514815
2092 2092 a, g dbSNP:753424167
2095 2095 a, g dbSNP:766204646
2096 2096 c, t dbSNP:375534013
2097 2097 a, g, t dbSNP:118203592
2098 2098 -, aaagaaagcaaaaggaaacaca dbSNP:397514796
2100 2100 -, a dbSNP:118203594
2102 2102 -, aaag dbSNP:118203595
2104 2104 -, a dbSNP:118203596
2117 2117 -, ac dbSNP:118203597
2118 2118 -, ca dbSNP:118203598
2121 2121 -, ag dbSNP:118203599
2123 2123 a, g dbSNP:575639692
2125 2125 -, a dbSNP:397514801
2130 2130 a, g, t dbSNP:372583166
2131 2131 g, t dbSNP:775816560
2135 2135 c, t dbSNP:374222196
2136 2136 a, c dbSNP:397514863
2142 2142 c, t dbSNP:368016548
2150 2150 a, g dbSNP:145741748
2156 2156 -, g dbSNP:118203600
2157 2157 c, t dbSNP:771341361
2168 2168 c, t dbSNP:747452647
2169 2169 -, tg dbSNP:118203601
2172 2172 -, ta dbSNP:118203602
2173 2173 -, a dbSNP:118203603
2174 2174 c, g, t dbSNP:75820036
2177 2177 c, t dbSNP:118203606
2178 2178 -, a dbSNP:397514793
2182 2182 a, c dbSNP:118203607
2188 2188 c, g, t dbSNP:118203608
2190 2190 c, t dbSNP:118203609
2191 2191 a, g dbSNP:35958226
2206 2206 a, g dbSNP:775799075
2209 2209 a, c dbSNP:748733167
2212 2212 a, g dbSNP:118203616
2217 2217 c, t dbSNP:772603060
2220 2220 g, t dbSNP:118203617
2223 2223 c, g dbSNP:754679411
2230 2230 c, g dbSNP:748487106
2232 2232 a, c dbSNP:774835995
2236 2236 -, c dbSNP:118203619
2236 2236 c, t dbSNP:118203618
2237 2237 c, g dbSNP:768189353
2237 2237 -, g dbSNP:118203620
2240 2240 a, t dbSNP:748901883
2242 2242 a, g dbSNP:118203621
2244 2244 -, cccactttgga dbSNP:118203622
2244 2244 c, t dbSNP:779584449
2246 2246 c, t dbSNP:755647717
2247 2247 a, g dbSNP:745413532
2248 2248 c, t dbSNP:201392975
2252 2252 a, g dbSNP:757322533
2253 2253 a, g dbSNP:118203623
2255 2255 a, g dbSNP:118203624
2260 2260 -, tc dbSNP:397514869
2264 2264 -, cct dbSNP:397514799
2264 2264 c, t dbSNP:746909024
2268 2268 a, c dbSNP:118203629
2271 2271 a, g dbSNP:786201465
2279 2279 c, t dbSNP:202241429
2280 2280 a, g dbSNP:200827913
2282 2282 a, g dbSNP:752473063
2283 2283 acactt, ccctcc dbSNP:118203630
2284 2284 c, t dbSNP:780223819
2288 2288 c, t dbSNP:118203631
2289 2289 a, g dbSNP:199755731
2291 2291 c, g dbSNP:397514800
2294 2294 c, t dbSNP:397514789
2296 2296 -, g dbSNP:118203632
2299 2299 a, g dbSNP:767518902
2304 2304 -, t dbSNP:118203633
2306 2306 c, t dbSNP:551954460
2307 2307 g, t dbSNP:397514802
2308 2308 -, g dbSNP:118203634
2310 2310 -, nnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:672601250
2311 2311 -, c, cctccgagaccagttgcttttactgcac dbSNP:118203635
2315 2315 -, cagttac dbSNP:397514791
2315 2315 -, ca dbSNP:118203637
2315 2315 -, c dbSNP:118203636
2316 2316 -, agtt dbSNP:118203638
2317 2317 -, gtta dbSNP:118203640
2317 2317 g, t dbSNP:118203639
2318 2318 -, tagtt dbSNP:118203642
2320 2320 -, gtta dbSNP:397514779
2320 2320 a, gt dbSNP:397514838
2323 2323 -, ct dbSNP:118203643
2323 2323 -, gttactc dbSNP:118203641
2324 2324 -, t dbSNP:118203644
2325 2325 -, at dbSNP:118203645
2325 2325 a, g dbSNP:752054698
2326 2326 a, t dbSNP:118203646
2329 2329 a, g dbSNP:142662480
2342 2342 c, t dbSNP:397514874
2345 2345 c, t dbSNP:118203647
2348 2348 -, catgc dbSNP:118203648
2349 2349 -, atgcc dbSNP:118203649
2359 2359 -, g dbSNP:118203650
2365 2365 -, g dbSNP:118203651
2367 2367 -, aacaggcg dbSNP:397514803
2375 2375 c, t dbSNP:763357144
2376 2376 a, c, g dbSNP:769566267
2378 2378 a, t dbSNP:397514772
2383 2383 -, g dbSNP:118203652
2387 2387 -, aaag dbSNP:118203653
2389 2389 -, a dbSNP:118203654
2391 2391 a, c dbSNP:118203655
2405 2405 -, g dbSNP:118203656
2405 2405 g, t dbSNP:397514820
2408 2408 c, t dbSNP:118203657
2410 2410 c, t dbSNP:776441369
2417 2417 a, g dbSNP:770518730
2418 2418 a, c dbSNP:746535706
2435 2435 a, c dbSNP:587778723
2440 2440 a, g dbSNP:397514878
2441 2441 c, t dbSNP:118203661
2449 2449 a, g dbSNP:753265422
2450 2450 g, t dbSNP:786203007
2463 2463 a, g dbSNP:118203662
2464 2464 a, g dbSNP:118203663
2468 2468 a, g dbSNP:765643529
2474 2474 c, t dbSNP:118203664
2482 2482 -, agaa dbSNP:118203665
2482 2482 a, g dbSNP:760004541
2486 2486 c, t dbSNP:397514783
2493 2493 -, gatacaatcagctcca dbSNP:118203666
2495 2495 c, t dbSNP:776386313
2497 2497 a, c, g dbSNP:118203668
2498 2498 -, taca dbSNP:118203667
2499 2499 a, g dbSNP:118203670
2501 2501 c, t dbSNP:118203671
2505 2505 -, t dbSNP:118203672
2507 2507 c, t dbSNP:118203673
2512 2512 -, gcagcgtgacactatggtaacca dbSNP:118203674
2513 2513 c, t dbSNP:118203675
2526 2526 c, t dbSNP:760208449
2531 2531 -, a dbSNP:118203676
2531 2531 a, c dbSNP:772652234
2533 2533 -, c dbSNP:118203677
2536 2536 a, g dbSNP:772038670
2542 2542 -, ca dbSNP:118203678
2543 2543 -, a dbSNP:397514780
2546 2546 c, t dbSNP:118203679
2555 2555 c, t dbSNP:118203680
2556 2556 -, aa dbSNP:397514855
2560 2560 a, g dbSNP:747968526
2561 2561 c, t dbSNP:118203681
2562 2562 a, g dbSNP:774284355
2565 2565 a, g dbSNP:768390011
2570 2570 c, t dbSNP:118203682
2571 2571 -, g dbSNP:118203683
2574 2574 -, aggaa dbSNP:118203684
2576 2576 g, t dbSNP:118203685
2578 2578 -, a dbSNP:118203686
2583 2583 a, g dbSNP:749111647
2594 2594 a, c dbSNP:781371665
2601 2601 -, t dbSNP:397514786
2603 2603 c, t dbSNP:397514862
2615 2615 g, t dbSNP:118203687
2621 2621 -, t dbSNP:118203688
2625 2625 -, ggaacatgattgcg dbSNP:118203689
2634 2634 c, t dbSNP:118203690
2635 2635 -, t dbSNP:118203691
2635 2635 c, t dbSNP:754248661
2637 2637 c, g, t dbSNP:756514375
2638 2638 a, g dbSNP:200651872
2639 2639 c, g dbSNP:118203692
2645 2645 c, g dbSNP:397514814
2646 2646 a, g dbSNP:761281095
2648 2648 a, g dbSNP:751128287
2654 2654 c, t dbSNP:199517042
2670 2670 -, acaa dbSNP:118203693
2677 2677 c, g dbSNP:764014190
2679 2679 -, gt dbSNP:118203694
2682 2682 -, g dbSNP:118203696
2682 2682 -, a dbSNP:118203695
2684 2684 -, ac dbSNP:118203697
2685 2685 -, ct dbSNP:118203698
2686 2686 g, t dbSNP:762811821
2692 2692 a, c, g dbSNP:149719514
2699 2699 a, c, t dbSNP:118203699
2705 2705 c, g dbSNP:773279842
2711 2711 c, t dbSNP:118203700
2715 2715 -, a dbSNP:118203701
2719 2719 c, t dbSNP:112384441
2721 2721 c, g dbSNP:118203706
2722 2722 -, aaac dbSNP:118203707
2723 2723 -, aaca dbSNP:118203708
2724 2724 -, a dbSNP:118203709
2728 2728 c, t dbSNP:786203259
2729 2729 -, gagt dbSNP:794727320
2734 2734 a, c, g dbSNP:547498792
2735 2735 -, g dbSNP:397514850
2737 2737 c, t dbSNP:397514825
2741 2741 c, g dbSNP:749414404
2742 2742 -, agcagat dbSNP:118203710
2756 2756 c, t dbSNP:780394011
2770 2770 c, g dbSNP:770381040
2773 2773 -, ggtt dbSNP:118203711
2774 2774 a, g dbSNP:746215028
2783 2783 -, g dbSNP:118203713
2783 2783 -, g dbSNP:118203712
2791 2791 c, t dbSNP:781553258
2796 2796 -, t dbSNP:397514865
2809 2809 -, a dbSNP:118203714
2818 2818 c, t dbSNP:147163264
2828 2828 a, c, g dbSNP:746607455
2837 2837 a, c dbSNP:78260659
2839 2839 a, g dbSNP:777437357
2840 2840 g, t dbSNP:747602915
2849 2849 a, g dbSNP:778416424
2850 2850 c, t dbSNP:754457018
2860 2860 c, t dbSNP:118203720
2861 2861 a, g dbSNP:118203721
2864 2864 -, t dbSNP:118203722
2866 2866 a, t dbSNP:397514805
2867 2867 c, t dbSNP:118203723
2868 2868 a, g dbSNP:200514807
2871 2871 -, aa dbSNP:397514828
2872 2872 -, a dbSNP:397514788
2872 2872 a, g dbSNP:368212910
2873 2873 a, g dbSNP:763169786
2879 2879 at, ga dbSNP:587778724
2879 2879 a, g dbSNP:775589156
2880 2880 a, t dbSNP:765314309
2882 2882 a, g dbSNP:543892243
2883 2883 a, g dbSNP:759567710
2886 2886 -, a, aa dbSNP:118203724
2886 2886 -, a dbSNP:397514875
2888 2888 -, ag dbSNP:118203726
2893 2893 c, t dbSNP:374311456
2896 2896 c, t dbSNP:771479673
2897 2897 a, g dbSNP:576476807
2900 2900 a, c dbSNP:377132822
2903 2903 c, t dbSNP:118203727
2904 2904 a, t dbSNP:772324460
2905 2905 a, g dbSNP:372915963
2906 2906 c, t dbSNP:118203728
2908 2908 -, g dbSNP:118203729
2910 2910 c, g dbSNP:76801599
2912 2912 c, t dbSNP:397514871
2913 2913 -, a dbSNP:118203731
2914 2914 a, g dbSNP:560986491
2930 2930 c, t dbSNP:118203732
2936 2936 c, t dbSNP:748845915
2937 2937 a, g dbSNP:780115763
2942 2942 g, t dbSNP:756176990
2953 2953 a, c dbSNP:750238092
2961 2961 c, t dbSNP:781076347
2963 2963 c, g dbSNP:397514873
2967 2967 a, g dbSNP:757025842
2980 2980 g, t dbSNP:546119844
2990 2990 c, g, t dbSNP:397514879
2995 2995 -, gaaa dbSNP:397514845
2995 2995 a, g dbSNP:118203733
3000 3000 -, at dbSNP:118203734
3001 3001 c, t dbSNP:753980869
3010 3010 c, t dbSNP:766871150
3020 3020 c, t dbSNP:118203735
3034 3034 -, aggacag dbSNP:750627858
3041 3041 g, t dbSNP:781023778
3043 3043 -, ggcct dbSNP:118203739
3043 3043 c, t dbSNP:4962081
3044 3044 a, g dbSNP:751362258
3048 3048 a, t dbSNP:779185959
3049 3049 a, g dbSNP:371301169
3079 3079 c, t dbSNP:45468995
3091 3091 a, g dbSNP:754067582
3092 3092 c, t dbSNP:766383986
3096 3096 a, g dbSNP:760762170
3109 3109 a, g dbSNP:750886491
3110 3110 c, t dbSNP:767946427
3111 3111 a, g dbSNP:762213436
3115 3115 c, t dbSNP:774634388
3119 3119 g, t dbSNP:768350176
3124 3124 a, g dbSNP:762627301
3127 3127 a, g dbSNP:775305403
3130 3130 g, t dbSNP:775179927
3136 3136 c, t dbSNP:769389702
3138 3138 a, t dbSNP:549467159
3146 3146 c, g dbSNP:397514859
3147 3147 g, t dbSNP:770834438
3154 3154 a, g dbSNP:557674294
3163 3163 -, agaagcagc dbSNP:767902029
3163 3163 a, g dbSNP:202223925
3179 3179 g, t dbSNP:537585211
3182 3182 a, g dbSNP:200398750
3185 3185 c, g dbSNP:758199199
3194 3194 g, t dbSNP:78868727
3196 3196 c, t dbSNP:199919348
3198 3198 a, g dbSNP:144314195
3201 3201 a, g dbSNP:771810884
3209 3209 a, c, g dbSNP:780224196
3212 3212 g, t dbSNP:756384645
3214 3214 c, g dbSNP:552217429
3219 3219 a, t dbSNP:202121327
3224 3224 a, t dbSNP:371879917
3225 3225 c, t dbSNP:757370776
3226 3226 a, g dbSNP:751970451
3233 3233 c, t dbSNP:764738792
3237 3237 -, at dbSNP:775387289
3238 3238 c, g, t dbSNP:142954164
3244 3244 g, t dbSNP:118203741
3248 3248 a, t dbSNP:764979889
3259 3259 c, t dbSNP:759047948
3262 3262 c, t dbSNP:786203900
3281 3281 c, t dbSNP:138445573
3289 3289 c, t dbSNP:765753157
3290 3290 a, g, t dbSNP:533565295
3291 3291 c, t dbSNP:566430298
3293 3293 c, t dbSNP:375394001
3305 3305 a, g dbSNP:772043928
3317 3317 a, g dbSNP:118203742
3321 3321 a, g dbSNP:774196458
3326 3326 a, g dbSNP:768443391
3335 3335 -, agcagcagc dbSNP:759531937
3337 3337 c, g dbSNP:753374839
3338 3338 -, agcagc dbSNP:769722545
3339 3339 g, t dbSNP:148931779
3341 3341 (agc)6, 7, 8 dbSNP:2234980
3341 3341 -, agc dbSNP:397514812
3343 3343 -, agc, agcagc dbSNP:118203743
3343 3343 c, t dbSNP:201192125
3347 3347 c, g dbSNP:747162992
3354 3354 c, t dbSNP:587778726
3361 3361 c, g dbSNP:397514831
3364 3364 -, a dbSNP:777361506
3373 3373 c, t dbSNP:778413037
3382 3382 aggc, ggtg dbSNP:587778725
3383 3383 a, g dbSNP:587778727
3386 3386 c, t dbSNP:112066743
3391 3391 c, g dbSNP:753263747
3398 3398 c, t dbSNP:118203745
3399 3399 a, g dbSNP:755396992
3408 3408 c, t dbSNP:753388676
3409 3409 a, g dbSNP:118203746
3424 3424 a, g dbSNP:201165286
3429 3429 c, t dbSNP:779369226
3430 3430 c, t dbSNP:118203747
3442 3442 a, c, t dbSNP:140622357
3445 3445 c, t dbSNP:118203748
3451 3451 c, t dbSNP:749995749
3459 3459 c, g dbSNP:767439431
3463 3463 c, t dbSNP:761673589
3471 3471 a, g dbSNP:774286125
3480 3480 a, c, g dbSNP:762845573
3482 3482 a, g dbSNP:776694051
3484 3484 a, g dbSNP:771241484
3488 3488 g, t dbSNP:747053008
3492 3492 a, g dbSNP:550526986
3493 3493 a, c dbSNP:772288584
3496 3496 a, g dbSNP:116747861
3503 3503 c, t dbSNP:779599439
3504 3504 a, g dbSNP:118203750
3514 3514 c, t dbSNP:754282309
3517 3517 a, g dbSNP:118203751
3535 3535 c, t dbSNP:118203752
3536 3536 a, g dbSNP:118203753
3538 3538 c, t dbSNP:35593170
3550 3550 a, c dbSNP:761334590
3559 3559 a, g dbSNP:751467429
3561 3561 a, g dbSNP:764140399
3564 3564 c, t dbSNP:762641110
3570 3570 c, t dbSNP:775420987
3575 3575 c, t dbSNP:769478982
3578 3578 a, g dbSNP:760918561
3595 3595 a, g dbSNP:773586317
3600 3600 c, t dbSNP:772233665
3601 3601 c, t dbSNP:200200869
3605 3605 a, c dbSNP:761577419
3610 3610 c, t dbSNP:774980129
3616 3616 c, t dbSNP:769266225
3617 3617 c, t dbSNP:749612772
3619 3619 a, g dbSNP:568004490
3622 3622 a, t dbSNP:751398082
3627 3627 a, c dbSNP:756449737
3628 3628 c, t dbSNP:745475737
3630 3630 a, c dbSNP:764018144
3631 3631 a, c, t dbSNP:756737864
3633 3633 c, t dbSNP:751126355
3634 3634 a, g dbSNP:763931959
3640 3640 c, t dbSNP:758286878
3641 3641 c, g dbSNP:574823234
3642 3642 c, t dbSNP:201867031
3643 3643 a, g dbSNP:759431801
3647 3647 c, g dbSNP:773541137
3648 3648 c, t dbSNP:767904247
3649 3649 a, g dbSNP:140352085
3650 3650 c, g, t dbSNP:397514806
3653 3653 a, g dbSNP:768624733
3700 3700 a, t dbSNP:749746550
3711 3711 a, g dbSNP:775883753
3723 3723 -, atca dbSNP:771669937
3723 3723 a, g, t dbSNP:200574927
3724 3724 -, tcagtgtta dbSNP:779193014
3726 3726 -, ag dbSNP:747806078
3733 3733 a, g dbSNP:371327323
3737 3737 a, g dbSNP:780808150
3742 3742 c, t dbSNP:756968900
3745 3745 c, t dbSNP:746666326
3749 3749 c, t dbSNP:368088063
3769 3769 g, t dbSNP:577329896
3816 3816 c, t dbSNP:116917669
3825 3825 a, c, g dbSNP:181486656
3827 3827 a, g dbSNP:547814206
3831 3831 c, t dbSNP:760841318
3907 3907 c, t dbSNP:7037703
3913 3913 c, t dbSNP:773545079
3914 3914 a, g dbSNP:142517227
3938 3938 c, t dbSNP:755219758
3965 3965 c, t dbSNP:531195720
3988 3988 g, t dbSNP:554637460
3996 3996 -, t dbSNP:397819014
3998 3998 c, t dbSNP:115091888
3998 3998 -, t dbSNP:11323835
3999 3999 -, c dbSNP:199959286
4003 4003 c, g dbSNP:536230220
4004 4004 a, c, g dbSNP:113549339
4019 4019 c, t dbSNP:748518884
4029 4029 a, g dbSNP:532216079
4067 4067 c, t dbSNP:147729052
4070 4070 c, t dbSNP:397514844
4078 4078 a, g dbSNP:546473176
4085 4085 c, t dbSNP:114064768
4114 4114 a, g dbSNP:560193480
4196 4196 c, t dbSNP:541843034
4208 4208 c, t dbSNP:530003850
4215 4215 a, g dbSNP:563052235
4226 4226 c, t dbSNP:181111365
4283 4283 c, t dbSNP:576831542
4296 4296 c, t dbSNP:559148790
4311 4311 c, t dbSNP:755527309
4352 4352 c, g dbSNP:540812085
4360 4360 c, g dbSNP:369911288
4386 4386 c, g dbSNP:189890583
4391 4391 c, t dbSNP:75252898
4489 4489 a, g dbSNP:184321915
4515 4515 c, t dbSNP:191614777
4539 4539 a, c, g dbSNP:534651131
4550 4550 c, t dbSNP:149902841
4551 4551 a, g dbSNP:575246018
4622 4622 c, t dbSNP:117425923
4632 4632 a, g dbSNP:368824230
4650 4650 a, g dbSNP:189368676
4651 4651 c, t dbSNP:565743323
4704 4704 c, g dbSNP:758217339
4759 4759 c, t dbSNP:530042727
4761 4761 a, g dbSNP:562950766
4793 4793 g, t dbSNP:752538602
4815 4815 a, g dbSNP:544273113
4836 4836 c, t dbSNP:139119563
4861 4861 a, t dbSNP:367801115
4869 4869 c, t dbSNP:765244801
4903 4903 c, g dbSNP:565416605
4953 4953 g, t dbSNP:540849136
4958 4958