
TSC1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol TSC1
Entrez Gene ID 7248
Full Name tuberous sclerosis 1
Synonyms LAM, TSC
General protein information
Preferred Names
tumor suppressor
tuberous sclerosis 1 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]. lac of sum
Disorder MIM:


Disorder Html: Tuberous sclerosis-1, 191100 (3); Lymphangioleiomyomatosis, 606690

mRNA and Protein(s)

mRNA Protein Name
XM_005272211 XP_005272268 hamartin isoform X1
XM_006717271 XP_006717334 hamartin isoform X1
XM_011518979 XP_011517281 hamartin isoform X1
XM_006717272 XP_006717335 hamartin isoform X2
NM_000368 NP_000359 hamartin isoform 1
NM_001162426 NP_001155898 hamartin isoform 3
NM_001162427 NP_001155899 hamartin isoform 4

hsa04150 mTOR signaling pathway
hsa04910 Insulin signaling pathway
hsa04151 PI3K-Akt signaling pathway
hsa04152 AMPK signaling pathway
hsa05231 Choline metabolism in cancer
R-HSA-162582 Signal Transduction
R-HSA-74751 Insulin receptor signalling cascade
R-HSA-112399 IRS-mediated signalling
R-HSA-74752 Signaling by Insulin receptor
R-HSA-109704 PI3K Cascade
R-HSA-380972 Energy dependent regulation of mTOR by LKB1-AMPK
R-HSA-109703 PKB-mediated events
R-HSA-165181 Inhibition of TSC complex formation by PKB
R-HSA-165159 mTOR signalling
R-HSA-74160 Gene Expression
R-HSA-2428928 IRS-related events triggered by IGF1R
R-HSA-212436 Generic Transcription Pathway
R-HSA-2404192 Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
R-HSA-2428924 IGF1R signaling cascade
R-HSA-2262752 Cellular responses to stress
R-HSA-1632852 Macroautophagy
Pathway Interaction Database
mtor_4pathway mTOR signaling pathway
lkb1_pathway LKB1 signaling events
WP1471 TOR signaling
WP481 Insulin Signaling
WP1403 AMPK signaling
WP1984 Integrated Breast Cancer Pathway
WP2263 Prostate Cancer
WP2261 Signaling Pathways in Glioblastoma

Homo sapiens (human) TSC1 NP_000359.1
Pan troglodytes (chimpanzee) TSC1 XP_001168992.1
Macaca mulatta (Rhesus monkey) TSC1 XP_001103846.2
Canis lupus familiaris (dog) TSC1 XP_005625233.1
Bos taurus (cattle) TSC1 XP_005213508.1
Mus musculus (house mouse) Tsc1 NP_075025.2
Rattus norvegicus (Norway rat) Tsc1 NP_068626.1
Gallus gallus (chicken) TSC1 XP_415449.2
Danio rerio (zebrafish) tsc1a NP_956346.1
Xenopus (Silurana) tropicalis (western clawed frog) tsc1 XP_002944681.2


ID Name Evidence
GO:0005624 membrane fraction IDA
GO:0005737 cytoplasm IDA
GO:0005792 microsome IEA
GO:0005829 cytosol EXP
GO:0005829 cytosol IDA
GO:0005829 cytosol TAS
GO:0005884 actin filament IDA
GO:0005938 cell cortex IDA
GO:0016020 membrane IEA
GO:0030027 lamellipodium IDA
GO:0030426 growth cone IEA
GO:0033596 TSC1-TSC2 complex IDA
GO:0043234 protein complex IDA


ID Name Evidence
GO:0005515 protein binding IPI
GO:0030695 GTPase regulator activity IEA
GO:0032794 GTPase activating protein binding IEA
GO:0047485 protein N-terminus binding IPI
GO:0051087 chaperone binding IPI


ID Name Evidence
GO:0001952 regulation of cell-matrix adhesion IMP
GO:0006407 rRNA export from nucleus IMP
GO:0006417 regulation of translation IDA
GO:0007050 cell cycle arrest TAS
GO:0007160 cell-matrix adhesion IMP
GO:0008285 negative regulation of cell proliferation IMP
GO:0008286 insulin receptor signaling pathway TAS
GO:0017148 negative regulation of translation IMP
GO:0031397 negative regulation of protein ubiquitination IDA
GO:0032007 negative regulation of TOR signaling cascade IMP
GO:0032862 activation of Rho GTPase activity IDA
GO:0032868 response to insulin stimulus IDA
GO:0032956 regulation of actin cytoskeleton organization IEA
GO:0043666 regulation of phosphoprotein phosphatase activity IMP
GO:0051291 protein heterooligomerization IEA
GO:0051492 regulation of stress fiber assembly IDA
GO:0051894 positive regulation of focal adhesion assembly IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following TSC1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the TSC1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_005272211 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
XM_006717271 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
XM_011518979 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu43494 XM_006717272 PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
NM_000368 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu17622 NM_001162426 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu17591 NM_001162427 Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu18443
Accession Version XM_005272211.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3495bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product hamartin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)283..2436(+)
Misc Feature(2)2551..3033(+)
Misc Feature(3)2575..3075(+)
Position Chain Variation Link
1 1 c, t dbSNP:374151059
21 21 g, t dbSNP:569842500
28 28 a, g dbSNP:550763141
29 29 a, g dbSNP:539145535
31 31 -, g dbSNP:544305928
67 67 g, t dbSNP:571288003
69 69 c, t dbSNP:45522535
72 72 g, t dbSNP:528753909
83 83 a, g dbSNP:561295374
88 88 c, t dbSNP:549656840
151 151 a, t dbSNP:116951280
181 181 c, t dbSNP:114755636
212 212 c, t dbSNP:529212875
216 216 a, g dbSNP:561540358
236 236 a, g dbSNP:773447503
244 244 c, t dbSNP:772626361
245 245 a, g dbSNP:370122384
258 258 -, cagc dbSNP:776033881
260 260 c, t dbSNP:377001111
263 263 c, t dbSNP:768441689
264 264 a, g, t dbSNP:114970627
268 268 c, t dbSNP:755999334
269 269 a, c, t dbSNP:570705364
270 270 a, g dbSNP:756989263
273 273 c, g, t dbSNP:62621221
276 276 g, t dbSNP:755266452
289 289 c, t dbSNP:753838459
300 300 c, g, t dbSNP:145987906
301 301 a, g dbSNP:773784532
316 316 a, g dbSNP:768147590
321 321 a, g dbSNP:762233181
326 326 c, g dbSNP:774900322
330 330 c, g dbSNP:768175095
331 331 a, t dbSNP:762059806
343 343 c, t dbSNP:749030456
344 344 a, g dbSNP:141736779
348 348 c, t dbSNP:769282604
349 349 -, g dbSNP:118203330
351 351 c, t dbSNP:376527838
366 366 c, t dbSNP:745384145
372 372 g, t dbSNP:781059342
378 378 c, t dbSNP:757216373
386 386 a, t dbSNP:148468036
388 388 -, c dbSNP:118203333
389 389 a, g dbSNP:750441497
393 393 c, g dbSNP:776158461
395 395 c, g dbSNP:770831962
400 400 a, c, t dbSNP:118203334
403 403 c, g dbSNP:777537794
405 405 a, c dbSNP:118203335
409 409 -, a dbSNP:118203336
411 411 -, c, cc dbSNP:118203337
412 412 c, t dbSNP:755226092
414 414 a, g dbSNP:149278759
424 424 -, t dbSNP:118203339
425 425 -, a dbSNP:397514861
427 427 -, c dbSNP:118203340
428 428 c, t dbSNP:118203341
432 432 a, c dbSNP:118203342
438 438 c, t dbSNP:756335238
442 442 c, t dbSNP:118203343
446 446 c, t dbSNP:750512029
447 447 a, g dbSNP:781483110
455 455 a, t dbSNP:757837986
456 456 c, t dbSNP:767647768
460 460 -, ctgaccacc dbSNP:118203344
460 460 c, t dbSNP:752047592
461 461 c, g, t dbSNP:118203345
470 470 -, tgcaagagc dbSNP:118203346
474 474 a, g dbSNP:764523181
480 480 a, g dbSNP:371555137
482 482 a, g dbSNP:118203347
492 492 a, c dbSNP:765578482
493 493 c, t dbSNP:759183842
494 494 c, t dbSNP:118203354
506 506 a, t dbSNP:118203355
510 510 c, t dbSNP:397514809
515 515 a, g dbSNP:373855276
516 516 c, t dbSNP:761596603
524 524 a, c dbSNP:118203356
526 526 a, c, g dbSNP:76667066
528 528 c, t dbSNP:145783693
529 529 a, g dbSNP:118203357
530 530 a, c dbSNP:761717715
531 531 -, c dbSNP:118203358
539 539 -, ga dbSNP:118203359
539 539 g, t dbSNP:397514776
549 549 c, t dbSNP:142325036
550 550 -, tc dbSNP:118203360
551 551 a, c, t dbSNP:118203361
552 552 a, g, t dbSNP:115097221
555 555 -, a, aa dbSNP:118203362
557 557 g, t dbSNP:118203363
564 564 c, t dbSNP:113042347
566 566 c, t dbSNP:370243092
568 568 a, g, t dbSNP:138541569
587 587 a, g dbSNP:118203364
588 588 a, g dbSNP:118203365
593 593 a, g dbSNP:758924121
603 603 -, tc dbSNP:397514795
604 604 c, t dbSNP:397514774
610 610 c, t dbSNP:748669519
614 614 -, ct dbSNP:118203366
617 617 -, t dbSNP:118203367
619 619 c, t dbSNP:779395169
621 621 c, g, t dbSNP:754220721
625 625 g, t dbSNP:199620268
627 627 a, t dbSNP:755799702
629 629 c, t dbSNP:118203368
641 641 a, g dbSNP:118203369
642 642 a, g dbSNP:118203370
649 649 a, g dbSNP:745871522
650 650 c, g dbSNP:747251435
651 651 -, t dbSNP:118203377
654 654 c, t dbSNP:560863078
655 655 a, g dbSNP:397514843
657 657 c, t dbSNP:373173550
658 658 -, gtt dbSNP:118203378
658 658 a, g dbSNP:372215435
660 660 -, tgt dbSNP:118203379
664 664 -, c dbSNP:397514852
668 668 c, t dbSNP:779340088
674 674 ca, gcgtcttggtgt dbSNP:118203380
674 674 a, c, g dbSNP:397514784
675 675 c, t dbSNP:368922726
676 676 a, g, t dbSNP:118203381
681 681 a, g dbSNP:147125501
694 694 a, g dbSNP:780442112
712 712 -, ca dbSNP:118203383
712 712 c, t dbSNP:118203382
724 724 c, t dbSNP:118203384
734 734 c, t dbSNP:755791846
752 752 c, g, t dbSNP:118203385
758 758 a, g dbSNP:749979841
768 768 a, t dbSNP:118203386
770 770 a, g dbSNP:118203387
774 774 a, c dbSNP:118203388
783 783 -, a dbSNP:118203389
785 785 a, c dbSNP:767215560
792 792 c, t dbSNP:377196837
794 794 g, t dbSNP:751092692
797 797 c, t dbSNP:777484049
798 798 a, g dbSNP:768999400
799 799 g, t dbSNP:118203392
803 803 -, t dbSNP:118203393
805 805 -, ta dbSNP:118203394
809 809 -, t dbSNP:397514794
810 810 c, t dbSNP:752615412
811 811 a, g dbSNP:118203395
818 818 c, t dbSNP:118203396
819 819 c, t dbSNP:201562103
821 821 a, c, g, t dbSNP:397515294
822 822 g, t dbSNP:762139762
828 828 c, t dbSNP:774398322
831 831 c, g dbSNP:118203397
834 834 c, t dbSNP:118203398
842 842 -, tt dbSNP:118203399
847 847 c, t dbSNP:118203400
848 848 a, c, g dbSNP:118203402
848 848 -, g dbSNP:118203401
851 851 a, g, t dbSNP:118203403
853 853 c, t dbSNP:786202831
854 854 -, a dbSNP:118203405
855 855 g, t dbSNP:118203406
860 860 c, t dbSNP:746188529
864 864 a, c dbSNP:118203407
869 869 -, g dbSNP:397514868
870 870 -, c dbSNP:397514836
872 872 -, act dbSNP:118203408
872 872 a, g dbSNP:577983115
876 876 -, cgtctcc dbSNP:118203409
876 876 c, t dbSNP:202242304
877 877 a, g dbSNP:118203410
878 878 -, t dbSNP:118203411
881 881 -, cct dbSNP:118203412
882 882 a, c dbSNP:777571943
887 887 -, tt dbSNP:118203413
890 890 c, g dbSNP:397514834
894 894 c, t dbSNP:118203414
897 897 c, t dbSNP:118203415
901 901 a, c dbSNP:778671811
903 903 -, t dbSNP:397514837
904 904 a, g dbSNP:754980229
912 912 a, g dbSNP:753550247
926 926 -, tt dbSNP:118203417
926 926 c, t dbSNP:118203416
927 927 -, t dbSNP:397514835
930 930 a, g dbSNP:766250769
933 933 -, a dbSNP:118203418
936 936 c, g dbSNP:755910789
937 937 a, g, t dbSNP:397514830
944 944 -, c dbSNP:118203425
945 945 a, c dbSNP:754853512
949 949 a, t dbSNP:535397245
950 950 g, t dbSNP:118203426
952 952 a, g dbSNP:572899352
961 961 c, t dbSNP:118203427
972 972 a, g dbSNP:749311040
973 973 -, g dbSNP:118203428
973 973 g, t dbSNP:118203429
988 988 -, t dbSNP:118203430
991 991 a, t dbSNP:397514816
999 999 -, a dbSNP:118203431
999 999 g, t dbSNP:779872953
1003 1003 c, t dbSNP:118203432
1011 1011 -, t dbSNP:118203433
1012 1012 c, t dbSNP:118203434
1013 1013 a, g dbSNP:755859330
1016 1016 a, c, g dbSNP:118203436
1016 1016 -, g dbSNP:118203435
1017 1017 a, g dbSNP:118203441
1021 1021 a, t dbSNP:118203442
1024 1024 -, a dbSNP:118203444
1024 1024 a, t dbSNP:118203443
1028 1028 -, t dbSNP:118203446
1028 1028 a, g, t dbSNP:118203447
1028 1028 -, t dbSNP:118203445
1038 1038 c, t dbSNP:748775797
1041 1041 c, t dbSNP:780005416
1049 1049 a, c, t dbSNP:745640752
1050 1050 -, c dbSNP:118203449
1051 1051 a, g, t dbSNP:118203450
1058 1058 c, g dbSNP:758617649
1061 1061 a, g dbSNP:371225009
1065 1065 c, g dbSNP:779015004
1077 1077 c, t dbSNP:770704462
1083 1083 a, g dbSNP:753895570
1086 1086 c, t dbSNP:766961309
1089 1089 a, g dbSNP:142336706
1091 1091 -, at dbSNP:118203451
1092 1092 a, t dbSNP:118203452
1093 1093 a, g, t dbSNP:397514872
1096 1096 a, c dbSNP:2106347
1097 1097 a, t dbSNP:768057796
1098 1098 g, t dbSNP:148756522
1104 1104 -, at dbSNP:118203453
1104 1104 g, t dbSNP:118203454
1105 1105 c, t dbSNP:774009225
1109 1109 -, tg dbSNP:118203455
1109 1109 c, t dbSNP:200749357
1110 1110 -, gt dbSNP:118203456
1113 1113 -, tc dbSNP:118203457
1117 1117 c, t dbSNP:118203458
1124 1124 a, c dbSNP:118203459
1125 1125 -, a dbSNP:118203460
1125 1125 a, g dbSNP:768226293
1129 1129 c, t dbSNP:140544652
1130 1130 a, g dbSNP:151309813
1131 1131 c, t dbSNP:769706203
1132 1132 g, t dbSNP:377076733
1136 1136 c, g dbSNP:375144225
1141 1141 c, t dbSNP:770653972
1145 1145 c, g dbSNP:397514867
1149 1149 c, g, t dbSNP:779155575
1150 1150 a, g dbSNP:755195460
1152 1152 c, t dbSNP:753928162
1155 1155 c, t dbSNP:116756594
1157 1157 c, t dbSNP:756681916
1165 1165 c, t dbSNP:750890263
1170 1170 a, g, t dbSNP:118203461
1178 1178 c, t dbSNP:370916731
1180 1180 -, ca dbSNP:118203464
1180 1180 c, t dbSNP:118203463
1182 1182 c, g dbSNP:762200890
1191 1191 c, g, t dbSNP:118203466
1192 1192 a, g, t dbSNP:118203468
1194 1194 a, c, g, t dbSNP:397515293
1195 1195 g, t dbSNP:34876281
1196 1196 a, g dbSNP:752290177
1197 1197 g, t dbSNP:34610255
1199 1199 c, t dbSNP:572611259
1200 1200 c, t dbSNP:397514826
1209 1209 c, t dbSNP:759004332
1211 1211 c, g dbSNP:776158460
1215 1215 a, c dbSNP:118203472
1217 1217 c, t dbSNP:766317920
1220 1220 c, t dbSNP:373454700
1221 1221 a, g dbSNP:144208203
1222 1222 a, t dbSNP:185815387
1225 1225 c, t dbSNP:535868591
1226 1226 a, g dbSNP:375956049
1236 1236 -, gtt dbSNP:755655903
1239 1239 a, g dbSNP:770183315
1244 1244 c, t dbSNP:1073123
1245 1245 a, g dbSNP:397514807
1246 1246 c, g dbSNP:781189978
1251 1251 a, g dbSNP:118203473
1252 1252 c, t dbSNP:118203474
1256 1256 c, t dbSNP:757779597
1262 1262 -, a dbSNP:118203475
1266 1266 g, t dbSNP:202091845
1267 1267 -, c dbSNP:118203476
1267 1267 -, ct dbSNP:118203477
1268 1268 -, t dbSNP:118203478
1268 1268 -, tg dbSNP:118203479
1268 1268 -, t dbSNP:397514870
1273 1273 -, a dbSNP:118203480
1280 1280 a, c, t dbSNP:118203481
1281 1281 a, c, g dbSNP:200820603
1284 1284 a, g dbSNP:753091213
1285 1285 a, c, t dbSNP:118203483
1286 1286 -, ggctgataac dbSNP:397514849
1286 1286 a, g dbSNP:397514808
1294 1294 a, t dbSNP:570809282
1299 1299 -, a dbSNP:118203484
1299 1299 a, g dbSNP:760233114
1309 1309 -, g dbSNP:118203486
1317 1317 c, t dbSNP:753360364
1319 1319 a, g dbSNP:118203490
1320 1320 a, g dbSNP:118203491
1324 1324 c, g dbSNP:779767990
1326 1326 a, g dbSNP:118203492
1329 1329 c, t dbSNP:150777389
1330 1330 a, g dbSNP:781312535
1332 1332 a, g dbSNP:757404847
1357 1357 a, g dbSNP:201738258
1358 1358 a, c dbSNP:118203493
1363 1363 c, t dbSNP:397514864
1371 1371 -, tgtcccacctgatc dbSNP:118203494
1376 1376 -, cacctgatctgtca dbSNP:118203495
1376 1376 c, t dbSNP:763915012
1384 1384 c, t dbSNP:118203496
1389 1389 -, a dbSNP:118203497
1389 1389 a, t dbSNP:371648887
1392 1392 -, ac dbSNP:118203498
1392 1392 a, c, t dbSNP:771217333
1393 1393 c, g dbSNP:760638759
1397 1397 -, a dbSNP:118203499
1423 1423 a, g dbSNP:367564729
1431 1431 -, a dbSNP:118203501
1439 1439 c, t dbSNP:764150061
1442 1442 c, t dbSNP:377598226
1445 1445 a, g dbSNP:752575728
1445 1445 -, g dbSNP:397514832
1457 1457 c, t dbSNP:201452238
1469 1469 c, t dbSNP:766487204
1470 1470 a, g dbSNP:370281825
1475 1475 -, cactctgtcattcg dbSNP:118203502
1475 1475 c, t dbSNP:761014195
1477 1477 c, t dbSNP:773160913
1479 1479 c, g dbSNP:767514820
1482 1482 a, t dbSNP:761890555
1482 1482 -, t dbSNP:118203503
1487 1487 c, t dbSNP:118203504
1488 1488 a, g dbSNP:141184479
1496 1496 a, g dbSNP:143502728
1497 1497 c, t dbSNP:373465241
1498 1498 a, g dbSNP:769331772
1500 1500 a, g dbSNP:745463008
1503 1503 c, t dbSNP:781006583
1510 1510 a, c dbSNP:397514840
1511 1511 a, t dbSNP:140410001
1518 1518 a, g dbSNP:786203715
1523 1523 c, t dbSNP:746550630
1527 1527 c, t dbSNP:777823426
1528 1528 -, a dbSNP:397514792
1529 1529 -, c dbSNP:397514778
1529 1529 c, t dbSNP:77464996
1530 1530 a, g dbSNP:147127442
1534 1534 c, g dbSNP:765145057
1536 1536 -, c dbSNP:756865130
1536 1536 a, c, g dbSNP:369642207
1536 1536 -, c dbSNP:118203506
1549 1549 -, ag dbSNP:118203509
1552 1552 a, g dbSNP:753199284
1555 1555 g, t dbSNP:765695557
1558 1558 -, t dbSNP:118203510
1561 1561 ct, gc dbSNP:587778721
1569 1569 a, g dbSNP:759914505
1570 1570 c, t dbSNP:762688935
1582 1582 c, t dbSNP:118203511
1594 1594 c, g dbSNP:199800297
1596 1596 c, g dbSNP:770692313
1606 1606 a, g dbSNP:760470520
1610 1610 a, c, g dbSNP:118203512
1611 1611 a, g dbSNP:773003016
1614 1614 a, g dbSNP:7862221
1617 1617 -, g dbSNP:118203517
1619 1619 c, t dbSNP:772868048
1621 1621 c, t dbSNP:118203518
1622 1622 c, t dbSNP:397514848
1623 1623 c, t dbSNP:530908428
1629 1629 c, t dbSNP:773780814
1633 1633 c, g dbSNP:118203519
1634 1634 c, g dbSNP:371093730
1640 1640 -, tcactctaagtgatcttccagggtttttaggtgatctg dbSNP:118203520
1643 1643 -, c dbSNP:118203521
1645 1645 -, ct dbSNP:397514798
1645 1645 -, ga dbSNP:118203522
1647 1647 a, c dbSNP:397514856
1648 1648 -, a dbSNP:118203523
1648 1648 a, c dbSNP:587778722
1650 1650 c, t dbSNP:118203524
1658 1658 -, c dbSNP:118203525
1661 1661 a, g dbSNP:140953644
1662 1662 c, g dbSNP:779981609
1669 1669 c, g dbSNP:769529472
1690 1690 -, t dbSNP:118203526
1696 1696 a, g dbSNP:745697913
1697 1697 c, t dbSNP:185159716
1710 1710 -, agaa dbSNP:118203527
1710 1710 -, a dbSNP:397514858
1712 1712 -, ga dbSNP:118203528
1712 1712 a, g dbSNP:118203529
1721 1721 a, c dbSNP:775367219
1731 1731 -, a dbSNP:397514797
1739 1739 c, g dbSNP:118203532
1741 1741 g, t dbSNP:118203533
1749 1749 -, c dbSNP:118203534
1758 1758 c, g dbSNP:745657743
1760 1760 -, c dbSNP:118203535
1769 1769 -, tg dbSNP:118203536
1777 1777 c, t dbSNP:118203537
1778 1778 a, g dbSNP:118203538
1780 1780 g, t dbSNP:118203539
1782 1782 -, a dbSNP:397514876
1782 1782 a, c dbSNP:201810746
1785 1785 c, t dbSNP:772337076
1794 1794 -, t dbSNP:118203540
1795 1795 -, tc dbSNP:281875358
1804 1804 c, t dbSNP:118203542
1805 1805 a, g dbSNP:118203543
1807 1807 a, g dbSNP:779206386
1808 1808 -, ac dbSNP:118203544
1812 1812 -, t dbSNP:118203545
1814 1814 -, tc dbSNP:397514823
1818 1818 a, g dbSNP:755055358
1821 1821 -, g dbSNP:118203546
1823 1823 c, g dbSNP:749410972
1829 1829 a, g dbSNP:371908551
1838 1838 -, a dbSNP:118203547
1841 1841 c, t dbSNP:759379027
1846 1846 c, g dbSNP:118203548
1851 1851 c, g dbSNP:397514810
1853 1853 c, g dbSNP:750784794
1858 1858 c, t dbSNP:118203549
1859 1859 -, ag dbSNP:118203550
1859 1859 a, g dbSNP:767708806
1861 1861 -, ggcgccagcgtgaaccctgag dbSNP:766376606
1863 1863 c, t dbSNP:149439187
1864 1864 a, g dbSNP:751125011
1868 1868 c, g dbSNP:368481360
1869 1869 c, t dbSNP:762424091
1870 1870 a, g dbSNP:377279170
1873 1873 a, t dbSNP:765149885
1875 1875 c, t dbSNP:759461471
1886 1886 c, t dbSNP:776633158
1894 1894 -, t dbSNP:118203551
1905 1905 a, g dbSNP:756935981
1909 1909 -, gggcctgacacaccaaa dbSNP:118203552
1910 1910 a, g dbSNP:770570830
1914 1914 c, t dbSNP:372284519
1915 1915 g, t dbSNP:774671298
1919 1919 c, t dbSNP:769040084
1927 1927 c, g dbSNP:118203553
1930 1930 a, g dbSNP:780338343
1941 1941 -, c dbSNP:118203554
1943 1943 -, t dbSNP:397514829
1948 1948 -, c dbSNP:118203556
1948 1948 c, t dbSNP:118203555
1950 1950 -, gccctgcggcagtgctgatgaaa dbSNP:118203557
1955 1955 -, g dbSNP:118203558
1956 1956 c, t dbSNP:368317116
1957 1957 a, g dbSNP:746304922
1959 1959 -, cagtgctgatgaaagccctgcgg dbSNP:397514818
1964 1964 c, g dbSNP:377185303
1966 1966 -, g dbSNP:118203561
1971 1971 -, aa dbSNP:118203562
1976 1976 -, c dbSNP:118203563
1979 1979 c, t dbSNP:397514880
1980 1980 a, g dbSNP:35478675
1981 1981 -, cagtgctgatgaaagccctgcgg dbSNP:118203559
1982 1982 -, g dbSNP:397514777
1983 1983 -, gtgctgatgaaagccctgcggga dbSNP:118203560
1987 1987 -, ag dbSNP:118203564
1989 1989 a, g dbSNP:777386797
1993 1993 c, t dbSNP:758107610
1995 1995 c, t dbSNP:752202276
1996 1996 a, c, t dbSNP:118203565
2000 2000 c, g, t dbSNP:548002938
2003 2003 c, t dbSNP:118203566
2005 2005 c, t dbSNP:118203567
2006 2006 g, tggagaccagtatcttcactcc dbSNP:118203569
2006 2006 -, tggagaccagtatctt dbSNP:118203568
2008 2008 g, t dbSNP:118203570
2010 2010 c, g dbSNP:118203571
2015 2015 -, g dbSNP:118203572
2025 2025 -, t dbSNP:118203573
2028 2028 -, ca dbSNP:118203574
2030 2030 c, g dbSNP:786203799
2032 2032 c, t dbSNP:766367103
2035 2035 c, t dbSNP:760356610
2036 2036 ca, gtaaaattccac dbSNP:397514857
2036 2036 -, gtaaaattc dbSNP:118203575
2038 2038 a, t dbSNP:397514846
2039 2039 a, g dbSNP:118203576
2040 2040 a, g dbSNP:118203577
2045 2045 -, c dbSNP:397514811
2046 2046 a, g dbSNP:118203578
2051 2051 a, c dbSNP:768985094
2052 2052 a, g dbSNP:146578402
2053 2053 -, ga dbSNP:118203579
2054 2054 c, t dbSNP:775869914
2055 2055 a, g, t dbSNP:118203580
2056 2056 a, t dbSNP:118203581
2067 2067 -, t dbSNP:118203582
2071 2071 -, a, aa dbSNP:118203583
2073 2073 c, t dbSNP:766438395
2074 2074 a, g dbSNP:761959210
2081 2081 c, t dbSNP:543077026
2085 2085 a, c dbSNP:771521648
2087 2087 c, t dbSNP:751247705
2088 2088 a, g, t dbSNP:112434645
2097 2097 a, t dbSNP:758769193
2102 2102 -, tt dbSNP:118203585
2103 2103 -, tt dbSNP:118203586
2104 2104 g, t dbSNP:118203587
2118 2118 a, g dbSNP:118203588
2120 2120 -, a dbSNP:118203589
2127 2127 c, t dbSNP:752286096
2128 2128 c, g dbSNP:397514854
2130 2130 -, t dbSNP:118203590
2136 2136 -, t dbSNP:118203591
2148 2148 a, g dbSNP:778556382
2150 2150 c, t dbSNP:754401816
2155 2155 g, t dbSNP:397514815
2157 2157 a, g dbSNP:753424167
2160 2160 a, g dbSNP:766204646
2161 2161 c, t dbSNP:375534013
2162 2162 a, g, t dbSNP:118203592
2163 2163 -, aaagaaagcaaaaggaaacaca dbSNP:397514796
2165 2165 -, a dbSNP:118203594
2167 2167 -, aaag dbSNP:118203595
2169 2169 -, a dbSNP:118203596
2182 2182 -, ac dbSNP:118203597
2183 2183 -, ca dbSNP:118203598
2186 2186 -, ag dbSNP:118203599
2188 2188 a, g dbSNP:575639692
2190 2190 -, a dbSNP:397514801
2195 2195 a, g, t dbSNP:372583166
2196 2196 g, t dbSNP:775816560
2200 2200 c, t dbSNP:374222196
2201 2201 a, c dbSNP:397514863
2207 2207 c, t dbSNP:368016548
2215 2215 a, g dbSNP:145741748
2221 2221 -, g dbSNP:118203600
2222 2222 c, t dbSNP:771341361
2233 2233 c, t dbSNP:747452647
2234 2234 -, tg dbSNP:118203601
2237 2237 -, ta dbSNP:118203602
2238 2238 -, a dbSNP:118203603
2239 2239 c, g, t dbSNP:75820036
2242 2242 c, t dbSNP:118203606
2243 2243 -, a dbSNP:397514793
2247 2247 a, c dbSNP:118203607
2253 2253 c, g, t dbSNP:118203608
2255 2255 c, t dbSNP:118203609
2256 2256 a, g dbSNP:35958226
2271 2271 a, g dbSNP:775799075
2274 2274 a, c dbSNP:748733167
2277 2277 a, g dbSNP:118203616
2282 2282 c, t dbSNP:772603060
2285 2285 g, t dbSNP:118203617
2288 2288 c, g dbSNP:754679411
2295 2295 c, g dbSNP:748487106
2297 2297 a, c dbSNP:774835995
2301 2301 -, c dbSNP:118203619
2301 2301 c, t dbSNP:118203618
2302 2302 c, g dbSNP:768189353
2302 2302 -, g dbSNP:118203620
2305 2305 a, t dbSNP:748901883
2307 2307 a, g dbSNP:118203621
2309 2309 -, cccactttgga dbSNP:118203622
2309 2309 c, t dbSNP:779584449
2311 2311 c, t dbSNP:755647717
2312 2312 a, g dbSNP:745413532
2313 2313 c, t dbSNP:201392975
2317 2317 a, g dbSNP:757322533
2318 2318 a, g dbSNP:118203623
2320 2320 a, g dbSNP:118203624
2325 2325 -, tc dbSNP:397514869
2329 2329 -, cct dbSNP:397514799
2329 2329 c, t dbSNP:746909024
2333 2333 a, c dbSNP:118203629
2336 2336 a, g dbSNP:786201465
2344 2344 c, t dbSNP:202241429
2345 2345 a, g dbSNP:200827913
2347 2347 a, g dbSNP:752473063
2348 2348 acactt, ccctcc dbSNP:118203630
2349 2349 c, t dbSNP:780223819
2353 2353 c, t dbSNP:118203631
2354 2354 a, g dbSNP:199755731
2356 2356 c, g dbSNP:397514800
2359 2359 c, t dbSNP:397514789
2361 2361 -, g dbSNP:118203632
2364 2364 a, g dbSNP:767518902
2369 2369 -, t dbSNP:118203633
2371 2371 c, t dbSNP:551954460
2372 2372 g, t dbSNP:397514802
2373 2373 -, g dbSNP:118203634
2375 2375 -, nnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:672601250
2376 2376 -, c, cctccgagaccagttgcttttactgcac dbSNP:118203635
2380 2380 -, cagttac dbSNP:397514791
2380 2380 -, ca dbSNP:118203637
2380 2380 -, c dbSNP:118203636
2381 2381 -, agtt dbSNP:118203638
2382 2382 -, gtta dbSNP:118203640
2382 2382 g, t dbSNP:118203639
2383 2383 -, tagtt dbSNP:118203642
2385 2385 -, gtta dbSNP:397514779
2385 2385 a, gt dbSNP:397514838
2388 2388 -, ct dbSNP:118203643
2388 2388 -, gttactc dbSNP:118203641
2389 2389 -, t dbSNP:118203644
2390 2390 -, at dbSNP:118203645
2390 2390 a, g dbSNP:752054698
2391 2391 a, t dbSNP:118203646
2394 2394 a, g dbSNP:142662480
2407 2407 c, t dbSNP:397514874
2410 2410 c, t dbSNP:118203647
2413 2413 -, catgc dbSNP:118203648
2414 2414 -, atgcc dbSNP:118203649
2424 2424 -, g dbSNP:118203650
2430 2430 -, g dbSNP:118203651
2432 2432 -, aacaggcg dbSNP:397514803
2440 2440 c, t dbSNP:763357144
2441 2441 a, c, g dbSNP:769566267
2443 2443 a, t dbSNP:397514772
2448 2448 -, g dbSNP:118203652
2452 2452 -, aaag dbSNP:118203653
2454 2454 -, a dbSNP:118203654
2456 2456 a, c dbSNP:118203655
2470 2470 -, g dbSNP:118203656
2470 2470 g, t dbSNP:397514820
2473 2473 c, t dbSNP:118203657
2475 2475 c, t dbSNP:776441369
2482 2482 a, g dbSNP:770518730
2483 2483 a, c dbSNP:746535706
2500 2500 a, c dbSNP:587778723
2505 2505 a, g dbSNP:397514878
2506 2506 c, t dbSNP:118203661
2514 2514 a, g dbSNP:753265422
2515 2515 g, t dbSNP:786203007
2528 2528 a, g dbSNP:118203662
2529 2529 a, g dbSNP:118203663
2533 2533 a, g dbSNP:765643529
2539 2539 c, t dbSNP:118203664
2547 2547 -, agaa dbSNP:118203665
2547 2547 a, g dbSNP:760004541
2551 2551 c, t dbSNP:397514783
2558 2558 -, gatacaatcagctcca dbSNP:118203666
2560 2560 c, t dbSNP:776386313
2562 2562 a, c, g dbSNP:118203668
2563 2563 -, taca dbSNP:118203667
2564 2564 a, g dbSNP:118203670
2566 2566 c, t dbSNP:118203671
2570 2570 -, t dbSNP:118203672
2572 2572 c, t dbSNP:118203673
2577 2577 -, gcagcgtgacactatggtaacca dbSNP:118203674
2578 2578 c, t dbSNP:118203675
2591 2591 c, t dbSNP:760208449
2596 2596 -, a dbSNP:118203676
2596 2596 a, c dbSNP:772652234
2598 2598 -, c dbSNP:118203677
2601 2601 a, g dbSNP:772038670
2607 2607 -, ca dbSNP:118203678
2608 2608 -, a dbSNP:397514780
2611 2611 c, t dbSNP:118203679
2620 2620 c, t dbSNP:118203680
2621 2621 -, aa dbSNP:397514855
2625 2625 a, g dbSNP:747968526
2626 2626 c, t dbSNP:118203681
2627 2627 a, g dbSNP:774284355
2630 2630 a, g dbSNP:768390011
2635 2635 c, t dbSNP:118203682
2636 2636 -, g dbSNP:118203683
2639 2639 -, aggaa dbSNP:118203684
2641 2641 g, t dbSNP:118203685
2643 2643 -, a dbSNP:118203686
2648 2648 a, g dbSNP:749111647
2659 2659 a, c dbSNP:781371665
2666 2666 -, t dbSNP:397514786
2668 2668 c, t dbSNP:397514862
2680 2680 g, t dbSNP:118203687
2686 2686 -, t dbSNP:118203688
2690 2690 -, ggaacatgattgcg dbSNP:118203689
2699 2699 c, t dbSNP:118203690
2700 2700 -, t dbSNP:118203691
2700 2700 c, t dbSNP:754248661
2702 2702 c, g, t dbSNP:756514375
2703 2703 a, g dbSNP:200651872
2704 2704 c, g dbSNP:118203692
2710 2710 c, g dbSNP:397514814
2711 2711 a, g dbSNP:761281095
2713 2713 a, g dbSNP:751128287
2719 2719 c, t dbSNP:199517042
2735 2735 -, acaa dbSNP:118203693
2742 2742 c, g dbSNP:764014190
2744 2744 -, gt dbSNP:118203694
2747 2747 -, g dbSNP:118203696
2747 2747 -, a dbSNP:118203695
2749 2749 -, ac dbSNP:118203697
2750 2750 -, ct dbSNP:118203698
2751 2751 g, t dbSNP:762811821
2757 2757 a, c, g dbSNP:149719514
2764 2764 a, c, t dbSNP:118203699
2770 2770 c, g dbSNP:773279842
2776 2776 c, t dbSNP:118203700
2780 2780 -, a dbSNP:118203701
2784 2784 c, t dbSNP:112384441
2786 2786 c, g dbSNP:118203706
2787 2787 -, aaac dbSNP:118203707
2788 2788 -, aaca dbSNP:118203708
2789 2789 -, a dbSNP:118203709
2793 2793 c, t dbSNP:786203259
2794 2794 -, gagt dbSNP:794727320
2799 2799 a, c, g dbSNP:547498792
2800 2800 -, g dbSNP:397514850
2802 2802 c, t dbSNP:397514825
2806 2806 c, g dbSNP:749414404
2807 2807 -, agcagat dbSNP:118203710
2821 2821 c, t dbSNP:780394011
2835 2835 c, g dbSNP:770381040
2838 2838 -, ggtt dbSNP:118203711
2839 2839 a, g dbSNP:746215028
2848 2848 -, g dbSNP:118203713
2848 2848 -, g dbSNP:118203712
2856 2856 c, t dbSNP:781553258
2861 2861 -, t dbSNP:397514865
2874 2874 -, a dbSNP:118203714
2883 2883 c, t dbSNP:147163264
2893 2893 a, c, g dbSNP:746607455
2902 2902 a, c dbSNP:78260659
2904 2904 a, g dbSNP:777437357
2905 2905 g, t dbSNP:747602915
2914 2914 a, g dbSNP:778416424
2915 2915 c, t dbSNP:754457018
2925 2925 c, t dbSNP:118203720
2926 2926 a, g dbSNP:118203721
2929 2929 -, t dbSNP:118203722
2931 2931 a, t dbSNP:397514805
2932 2932 c, t dbSNP:118203723
2933 2933 a, g dbSNP:200514807
2936 2936 -, aa dbSNP:397514828
2937 2937 -, a dbSNP:397514788
2937 2937 a, g dbSNP:368212910
2938 2938 a, g dbSNP:763169786
2944 2944 at, ga dbSNP:587778724
2944 2944 a, g dbSNP:775589156
2945 2945 a, t dbSNP:765314309
2947 2947 a, g dbSNP:543892243
2948 2948 a, g dbSNP:759567710
2951 2951 -, a, aa dbSNP:118203724
2951 2951 -, a dbSNP:397514875
2953 2953 -, ag dbSNP:118203726
2958 2958 c, t dbSNP:374311456
2961 2961 c, t dbSNP:771479673
2962 2962 a, g dbSNP:576476807
2965 2965 a, c dbSNP:377132822
2968 2968 c, t dbSNP:118203727
2969 2969 a, t dbSNP:772324460
2970 2970 a, g dbSNP:372915963
2971 2971 c, t dbSNP:118203728
2973 2973 -, g dbSNP:118203729
2975 2975 c, g dbSNP:76801599
2977 2977 c, t dbSNP:397514871
2978 2978 -, a dbSNP:118203731
2979 2979 a, g dbSNP:560986491
2995 2995 c, t dbSNP:118203732
3001 3001 c, t dbSNP:748845915
3002 3002 a, g dbSNP:780115763
3007 3007 g, t dbSNP:756176990
3018 3018 a, c dbSNP:750238092
3026 3026 c, t dbSNP:781076347
3028 3028 c, g dbSNP:397514873
3032 3032 a, g dbSNP:757025842
3045 3045 g, t dbSNP:546119844
3055 3055 c, g, t dbSNP:397514879
3060 3060 -, gaaa dbSNP:397514845
3060 3060 a, g dbSNP:118203733
3065 3065 -, at dbSNP:118203734
3066 3066 c, t dbSNP:753980869
3075 3075 c, t dbSNP:766871150
3085 3085 c, t dbSNP:118203735
3099 3099 -, aggacag dbSNP:750627858
3106 3106 g, t dbSNP:781023778
3108 3108 -, ggcct dbSNP:118203739
3108 3108 c, t dbSNP:4962081
3109 3109 a, g dbSNP:751362258
3113 3113 a, t dbSNP:779185959
3114 3114 a, g dbSNP:371301169
3144 3144 c, t dbSNP:45468995
3156 3156 a, g dbSNP:754067582
3157 3157 c, t dbSNP:766383986
3161 3161 a, g dbSNP:760762170
3174 3174 a, g dbSNP:750886491
3175 3175 c, t dbSNP:767946427
3176 3176 a, g dbSNP:762213436
3180 3180 c, t dbSNP:774634388
3184 3184 g, t dbSNP:768350176
3189 3189 a, g dbSNP:762627301
3192 3192 a, g dbSNP:775305403
3195 3195 g, t dbSNP:775179927
3201 3201 c, t dbSNP:769389702
3203 3203 a, t dbSNP:549467159
3211 3211 c, g dbSNP:397514859
3212 3212 g, t dbSNP:770834438
3219 3219 a, g dbSNP:557674294
3228 3228 -, agaagcagc dbSNP:767902029
3228 3228 a, g dbSNP:202223925
3244 3244 g, t dbSNP:537585211
3247 3247 a, g dbSNP:200398750
3250 3250 c, g dbSNP:758199199
3259 3259 g, t dbSNP:78868727
3261 3261 c, t dbSNP:199919348
3263 3263 a, g dbSNP:144314195
3266 3266 a, g dbSNP:771810884
3274 3274 a, c, g dbSNP:780224196
3277 3277 g, t dbSNP:756384645
3279 3279 c, g dbSNP:552217429
3284 3284 a, t dbSNP:202121327
3289 3289 a, t dbSNP:371879917
3290 3290 c, t dbSNP:757370776
3291 3291 a, g dbSNP:751970451
3298 3298 c, t dbSNP:764738792
3302 3302 -, at dbSNP:775387289
3303 3303 c, g, t dbSNP:142954164
3309 3309 g, t dbSNP:118203741
3313 3313 a, t dbSNP:764979889
3324 3324 c, t dbSNP:759047948
3327 3327 c, t dbSNP:786203900
3346 3346 c, t dbSNP:138445573
3354 3354 c, t dbSNP:765753157
3355 3355 a, g, t dbSNP:533565295
3356 3356 c, t dbSNP:566430298
3358 3358 c, t dbSNP:375394001
3370 3370 a, g dbSNP:772043928
3382 3382 a, g dbSNP:118203742
3386 3386 a, g dbSNP:774196458
3391 3391 a, g dbSNP:768443391
3400 3400 -, agcagcagc dbSNP:759531937
3402 3402 c, g dbSNP:753374839
3403 3403 -, agcagc dbSNP:769722545
3404 3404 g, t dbSNP:148931779
3406 3406 (agc)6, 7, 8 dbSNP:2234980
3406 3406 -, agc dbSNP:397514812
3408 3408 -, agc, agcagc dbSNP:118203743
3408 3408 c, t dbSNP:201192125
3412 3412 c, g dbSNP:747162992
3419 3419 c, t dbSNP:587778726
3426 3426 c, g dbSNP:397514831
3429 3429 -, a dbSNP:777361506
3438 3438 c, t dbSNP:778413037
3447 3447 aggc, ggtg dbSNP:587778725
3448 3448 a, g dbSNP:587778727
3451 3451 c, t dbSNP:112066743
3456 3456 c, g dbSNP:753263747
3463 3463 c, t dbSNP:118203745
3464 3464 a, g dbSNP:755396992
3473 3473 c, t dbSNP:753388676
3474 3474 a, g dbSNP:118203746
3489 3489 a, g dbSNP:201165286
3494 3494 c, t dbSNP:779369226
3495 3495 c, t dbSNP:118203747
3507 3507 a, c, t dbSNP:140622357
3510 3510 c, t dbSNP:118203748
3516 3516 c, t dbSNP:749995749
3524 3524 c, g dbSNP:767439431
3528 3528 c, t dbSNP:761673589
3536 3536 a, g dbSNP:774286125
3545 3545 a, c, g dbSNP:762845573
3547 3547 a, g dbSNP:776694051
3549 3549 a, g dbSNP:771241484
3553 3553 g, t dbSNP:747053008
3557 3557 a, g dbSNP:550526986
3558 3558 a, c dbSNP:772288584
3561 3561 a, g dbSNP:116747861
3568 3568 c, t dbSNP:779599439
3569 3569 a, g dbSNP:118203750
3579 3579 c, t dbSNP:754282309
3582 3582 a, g dbSNP:118203751
3600 3600 c, t dbSNP:118203752
3601 3601 a, g dbSNP:118203753
3603 3603 c, t dbSNP:35593170
3615 3615 a, c dbSNP:761334590
3624 3624 a, g dbSNP:751467429
3626 3626 a, g dbSNP:764140399
3629 3629 c, t dbSNP:762641110
3635 3635 c, t dbSNP:775420987
3640 3640 c, t dbSNP:769478982
3643 3643 a, g dbSNP:760918561
3660 3660 a, g dbSNP:773586317
3665 3665 c, t dbSNP:772233665
3666 3666 c, t dbSNP:200200869
3670 3670 a, c dbSNP:761577419
3675 3675 c, t dbSNP:774980129
3681 3681 c, t dbSNP:769266225
3682 3682 c, t dbSNP:749612772
3684 3684 a, g dbSNP:568004490
3687 3687 a, t dbSNP:751398082
3692 3692 a, c dbSNP:756449737
3693 3693 c, t dbSNP:745475737
3695 3695 a, c dbSNP:764018144
3696 3696 a, c, t dbSNP:756737864
3698 3698 c, t dbSNP:751126355
3699 3699 a, g dbSNP:763931959
3705 3705 c, t dbSNP:758286878
3706 3706 c, g dbSNP:574823234
3707 3707 c, t dbSNP:201867031
3708 3708 a, g dbSNP:759431801
3712 3712 c, g dbSNP:773541137
3713 3713 c, t dbSNP:767904247
3714 3714 a, g dbSNP:140352085
3715 3715 c, g, t dbSNP:397514806
3718 3718 a, g dbSNP:768624733
3765 3765 a, t dbSNP:749746550
3776 3776 a, g dbSNP:775883753
3788 3788 -, atca dbSNP:771669937
3788 3788 a, g, t dbSNP:200574927
3789 3789 -, tcagtgtta dbSNP:779193014
3791 3791 -, ag dbSNP:747806078
3798 3798 a, g dbSNP:371327323
3802 3802 a, g dbSNP:780808150
3807 3807 c, t dbSNP:756968900
3810 3810 c, t dbSNP:746666326
3814 3814 c, t dbSNP:368088063
3834 3834 g, t dbSNP:577329896
3881 3881 c, t dbSNP:116917669
3890 3890 a, c, g dbSNP:181486656
3892 3892 a, g dbSNP:547814206
3896 3896 c, t dbSNP:760841318
3972 3972 c, t dbSNP:7037703
3978 3978 c, t dbSNP:773545079
3979 3979 a, g dbSNP:142517227
4003 4003 c, t dbSNP:755219758
4030 4030 c, t dbSNP:531195720
4053 4053 g, t dbSNP:554637460
4061 4061 -, t dbSNP:397819014
4063 4063 c, t dbSNP:115091888
4063 4063 -, t dbSNP:11323835
4064 4064 -, c dbSNP:199959286
4068 4068 c, g dbSNP:536230220
4069 4069 a, c, g dbSNP:113549339
4084 4084 c, t dbSNP:748518884
4094 4094 a, g dbSNP:532216079
4132 4132 c, t dbSNP:147729052
4135 4135 c, t dbSNP:397514844
4143 4143 a, g dbSNP:546473176
4150 4150 c, t dbSNP:114064768
4179 4179 a, g dbSNP:560193480
4261 4261 c, t dbSNP:541843034
4273 4273 c, t dbSNP:530003850
4280 4280 a, g dbSNP:563052235
4291 4291 c, t dbSNP:181111365
4348 4348 c, t dbSNP:576831542
4361 4361 c, t dbSNP:559148790
4376 4376 c, t dbSNP:755527309
4417 4417 c, g dbSNP:540812085
4425 4425 c, g dbSNP:369911288
4451 4451 c, g dbSNP:189890583
4456 4456 c, t dbSNP:75252898
4554 4554 a, g dbSNP:184321915
4580 4580 c, t dbSNP:191614777
4604 4604 a, c, g dbSNP:534651131
4615 4615 c, t dbSNP:149902841
4616 4616 a, g dbSNP:575246018
4687 4687 c, t dbSNP:117425923
4697 4697 a, g dbSNP:368824230
4715 4715 a, g dbSNP:189368676
4716 4716 c, t dbSNP:565743323
4769 4769 c, g dbSNP:758217339
4824 4824 c, t dbSNP:530042727
4826 4826 a, g dbSNP:562950766
4858 4858 g, t dbSNP:752538602
4880 4880 a, g dbSNP:544273113
4901 4901 c, t dbSNP:139119563
4926 4926 a, t dbSNP:367801115
4934 4934 c, t dbSNP:765244801
4968 4968 c, g dbSNP:565416605
5018 5018 g, t dbSNP:540849136
5023 5023 c, t dbSNP:760805774
5025 5025 c, t dbSNP:773490178
5049 5049 g, t dbSNP:2809244
5096 5096 a, c, g, t dbSNP:2809243
5098 5098 c, t dbSNP:774716260
5106 5106 c, t dbSNP:397514841
5117 5117 a, g dbSNP:768858045
5129 5129 a, c dbSNP:749683153
5146 5146 g, t dbSNP:58612431
5147 5147 g, t dbSNP:575245339
5170 5170 c, t dbSNP:397514790
5192 5192 c, t dbSNP:556956686
5236 5236 c, t dbSNP:538239408
5242 5242 c, t dbSNP:72759433
5243 5243 g, t dbSNP:552958137
5257 5257 c, g dbSNP:185039865
5261 5261 c, t dbSNP:79277527
5262 5262 c, t dbSNP:739442
5264 5264 c, t dbSNP:536391268
5281 5281 a, g dbSNP:739441
5282 5282 a, g dbSNP:552190342
5289 5289 -, aa dbSNP:536648576
5315 5315 -, t dbSNP:748099884
5392 5392 c, t dbSNP:756774572
5395 5395 c, t dbSNP:759483755
5428 5428 c, g dbSNP:746598492
5454 5454 a, g dbSNP:532372427
5464 5464 a, c, g dbSNP:192562699
5544 5544 a, c dbSNP:1801987
5559 5559 a, g dbSNP:74362385
5576 5576 a, c dbSNP:188259612
5580 5580 g, t dbSNP:752575824
5594 5594 c, t dbSNP:765079072
5635 5635 a, g dbSNP:561511694
5676 5676 g, t dbSNP:142038787
5685 5685 -, ctc dbSNP:758358370
5708 5708 a, g dbSNP:10491534
5716 5716 a, g dbSNP:563209868
5766 5766 c, t dbSNP:75053229
5795 5795 c, t dbSNP:577527391
5796 5796 a, g dbSNP:568052856
5801 5801 a, g dbSNP:748182713
5805 5805 a, t dbSNP:552852803
5846 5846 -, c dbSNP:5900999
5859 5859 c, t dbSNP:781713466
5868 5868 a, g dbSNP:534649062
5883 5883 c, t dbSNP:73552808
5900 5900 a, g dbSNP:183690096
5916 5916 c, t dbSNP:112314368
5942 5942 c, t dbSNP:532469694
5960 5960 c, g dbSNP:138008061
5987 5987 c, t dbSNP:539030496
5994 5994 a, g, t dbSNP:192554915
5996 5996 c, t dbSNP:146254737
6002 6002 a, g dbSNP:528833042
6004 6004 a, g dbSNP:397514781
6021 6021 a, g dbSNP:188426740
6022 6022 c, t dbSNP:532670371
6076 6076 g, t dbSNP:563584509
6110 6110 c, t dbSNP:770192563
6128 6128 a, g dbSNP:114877981
6136 6136 c, t dbSNP:530978157
6162 6162 g, t dbSNP:563408425
6179 6179 c, t dbSNP:777129120
6192 6192 a, g dbSNP:114415181
6211 6211 a, g dbSNP:149587565
6220 6220 a, g dbSNP:558966777
6235 6235 a, g dbSNP:73552806
6243 6243 a, c dbSNP:182128629
6292 6292 a, g dbSNP:138187401
6320 6320 c, t dbSNP:777270810
6332 6332 a, g dbSNP:115516164
6362 6362 a, g dbSNP:576114208
6402 6402 c, g dbSNP:189852768
6411 6411 c, g dbSNP:538802838
6412 6412 c, t dbSNP:373845353
6415 6415 g, t dbSNP:397514827
6419 6419 c, t dbSNP:778965195
6425 6425 g, t dbSNP:55660990
6448 6448 a, t dbSNP:534994012
6482 6482 c, g dbSNP:150433809
6489 6489 a, g dbSNP:778711100
6498 6498 c, t dbSNP:749535135
6499 6499 a, g dbSNP:141399920
6507 6507 a, g dbSNP:73552805
6517 6517 a, g dbSNP:753784286
6540 6540 a, g dbSNP:780158617
6553 6553 a, t dbSNP:139067673
6604 6604 c, t dbSNP:551944711
6612 6612 a, g dbSNP:532920974
6621 6621 a, g dbSNP:559004498
6646 6646 a, g dbSNP:2106345
6648 6648 a, g dbSNP:111832812
6664 6664 -, aaaa dbSNP:752640867
6664 6664 -, a dbSNP:771261397
6667 6667 -, a dbSNP:143549363
6678 6678 g, t dbSNP:559978998
6792 6792 a, g dbSNP:543304631
6808 6808 c, t dbSNP:764220703
6819 6819 a, g dbSNP:746365344
6840 6840 a, c dbSNP:752880069
6881 6881 c, t dbSNP:576281564
6916 6916 g, t dbSNP:765522631
6944 6944 a, g dbSNP:367605870
6992 6992 c, t dbSNP:759925810
7002 7002 c, t dbSNP:781746755
7031 7031 a, g dbSNP:757870931
7032 7032 c, g dbSNP:397514877
7034 7034 c, g dbSNP:397514782
7054 7054 c, g dbSNP:557707101
7067 7067 a, t dbSNP:545961219
7103 7103 g, t dbSNP:578163954
7104 7104 a, g dbSNP:553475307
7160 7160 a, t dbSNP:540869574
7180 7180 -, ca dbSNP:759013461
7184 7184 a, g dbSNP:771479576
7206 7206 c, t dbSNP:186713016
7222 7222 c, t dbSNP:201092466
7234 7234 c, t dbSNP:555730718
7238 7238 c, g dbSNP:537386509
7284 7284 c, t dbSNP:183150354
7293 7293 a, g dbSNP:192313622
7312 7312 a, g dbSNP:533324867
7339 7339 c, t dbSNP:771494783
7340 7340 a, g dbSNP:565450993
7417 7417 c, t dbSNP:373424021
7422 7422 c, t dbSNP:113313202
7440 7440 a, c dbSNP:530313938
7443 7443 a, g dbSNP:547046358
7453 7453 a, g dbSNP:1050700
7458 7458 c, t dbSNP:768518987
7471 7471 c, t dbSNP:111450858
7503 7503 g, t dbSNP:543396172
7506 7506 c, t dbSNP:749141370
7524 7524 a, g dbSNP:758064113
7585 7585 -, a dbSNP:753493781
7585 7585 a, g dbSNP:186586639
7602 7602 a, g dbSNP:142666298
7604 7604 c, t dbSNP:544931538
7607 7607 a, c dbSNP:575812223
7610 7610 a, g dbSNP:572231078
7629 7629 c, t dbSNP:558930752
7635 7635 c, t dbSNP:765057102
7653 7653 g, t dbSNP:143740161
7687 7687 c, t dbSNP:751581381
7709 7709 c, t dbSNP:397514787
7710 7710 c, t dbSNP:397514853
7726 7726 a, g dbSNP:114454155
7729 7729 -, t dbSNP:754744080
7762 7762 a, g dbSNP:563835484
7770 7770 c, t dbSNP:555515069
7771 7771 a, g dbSNP:148982924
7773 7773 a, g dbSNP:758417405
7782 7782 c, t dbSNP:576689814
7783 7783 c, t dbSNP:752925196
7794 7794 c, t dbSNP:111543364
7795 7795 c, t dbSNP:182163633
7831 7831 a, g dbSNP:17149898
7837 7837 c, g dbSNP:565885149
7841 7841 a, g dbSNP:547579970
7895 7895 c, t dbSNP:149697824
7910 7910 c, g dbSNP:766856579
7923 7923 a, g dbSNP:568131325
7986 7986 c, t dbSNP:550488189
8028 8028 a, g dbSNP:139801034
8050 8050 a, g dbSNP:766234756
8061 8061 a, g dbSNP:567187061
8085 8085 -, t dbSNP:34809769
8133 8133 c, t dbSNP:564238927
8159 8159 g, t dbSNP:552453527
8167 8167 c, g dbSNP:766619507
8182 8182 c, t dbSNP:553706984
8211 8211 a, g dbSNP:11553763
8221 8221 c, t dbSNP:112968492
8268 8268 c, t dbSNP:771570729
8314 8314 a, c dbSNP:571533135
8365 8365 g, t dbSNP:397514821
8372 8372 a, g dbSNP:560429673
8398 8398 -, t dbSNP:761574558
8405 8405 -, t dbSNP:567915647
8405 8405 -, t dbSNP:60000611
8423 8423 c, t dbSNP:542031984
8454 8454 g, t dbSNP:747969932
8464 8464 a, t dbSNP:574215824
8481 8481 a, t dbSNP:562186340
8537 8537 c, t dbSNP:79470094
8562 8562 a, c dbSNP:576342925
8578 8578 a, t dbSNP:768793452
8599 8599 a, g dbSNP:554300720

Target ORF information:

RefSeq Version XM_005272211
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens tuberous sclerosis 1 (TSC1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18443
Accession Version XM_006717271.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3495bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product hamartin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)218..2371(+)
Misc Feature(2)2486..2968(+)
Misc Feature(3)2510..3010(+)
Position Chain Variation Link
60 60 c, g dbSNP:530965070
66 66 a, g dbSNP:751231310
86 86 a, t dbSNP:116951280
116 116 c, t dbSNP:114755636
147 147 c, t dbSNP:529212875
151 151 a, g dbSNP:561540358
171 171 a, g dbSNP:773447503
179 179 c, t dbSNP:772626361
180 180 a, g dbSNP:370122384
193 193 -, cagc dbSNP:776033881
195 195 c, t dbSNP:377001111
198 198 c, t dbSNP:768441689
199 199 a, g, t dbSNP:114970627
203 203 c, t dbSNP:755999334
204 204 a, c, t dbSNP:570705364
205 205 a, g dbSNP:756989263
208 208 c, g, t dbSNP:62621221
211 211 g, t dbSNP:755266452
224 224 c, t dbSNP:753838459
235 235 c, g, t dbSNP:145987906
236 236 a, g dbSNP:773784532
251 251 a, g dbSNP:768147590
256 256 a, g dbSNP:762233181
261 261 c, g dbSNP:774900322
265 265 c, g dbSNP:768175095
266 266 a, t dbSNP:762059806
278 278 c, t dbSNP:749030456
279 279 a, g dbSNP:141736779
283 283 c, t dbSNP:769282604
284 284 -, g dbSNP:118203330
286 286 c, t dbSNP:376527838
301 301 c, t dbSNP:745384145
307 307 g, t dbSNP:781059342
313 313 c, t dbSNP:757216373
321 321 a, t dbSNP:148468036
323 323 -, c dbSNP:118203333
324 324 a, g dbSNP:750441497
328 328 c, g dbSNP:776158461
330 330 c, g dbSNP:770831962
335 335 a, c, t dbSNP:118203334
338 338 c, g dbSNP:777537794
340 340 a, c dbSNP:118203335
344 344 -, a dbSNP:118203336
346 346 -, c, cc dbSNP:118203337
347 347 c, t dbSNP:755226092
349 349 a, g dbSNP:149278759
359 359 -, t dbSNP:118203339
360 360 -, a dbSNP:397514861
362 362 -, c dbSNP:118203340
363 363 c, t dbSNP:118203341
367 367 a, c dbSNP:118203342
373 373 c, t dbSNP:756335238
377 377 c, t dbSNP:118203343
381 381 c, t dbSNP:750512029
382 382 a, g dbSNP:781483110
390 390 a, t dbSNP:757837986
391 391 c, t dbSNP:767647768
395 395 -, ctgaccacc dbSNP:118203344
395 395 c, t dbSNP:752047592
396 396 c, g, t dbSNP:118203345
405 405 -, tgcaagagc dbSNP:118203346
409 409 a, g dbSNP:764523181
415 415 a, g dbSNP:371555137
417 417 a, g dbSNP:118203347
427 427 a, c dbSNP:765578482
428 428 c, t dbSNP:759183842
429 429 c, t dbSNP:118203354
441 441 a, t dbSNP:118203355
445 445 c, t dbSNP:397514809
450 450 a, g dbSNP:373855276
451 451 c, t dbSNP:761596603
459 459 a, c dbSNP:118203356
461 461 a, c, g dbSNP:76667066
463 463 c, t dbSNP:145783693
464 464 a, g dbSNP:118203357
465 465 a, c dbSNP:761717715
466 466 -, c dbSNP:118203358
474 474 -, ga dbSNP:118203359
474 474 g, t dbSNP:397514776
484 484 c, t dbSNP:142325036
485 485 -, tc dbSNP:118203360
486 486 a, c, t dbSNP:118203361
487 487 a, g, t dbSNP:115097221
490 490 -, a, aa dbSNP:118203362
492 492 g, t dbSNP:118203363
499 499 c, t dbSNP:113042347
501 501 c, t dbSNP:370243092
503 503 a, g, t dbSNP:138541569
522 522 a, g dbSNP:118203364
523 523 a, g dbSNP:118203365
528 528 a, g dbSNP:758924121
538 538 -, tc dbSNP:397514795
539 539 c, t dbSNP:397514774
545 545 c, t dbSNP:748669519
549 549 -, ct dbSNP:118203366
552 552 -, t dbSNP:118203367
554 554 c, t dbSNP:779395169
556 556 c, g, t dbSNP:754220721
560 560 g, t dbSNP:199620268
562 562 a, t dbSNP:755799702
564 564 c, t dbSNP:118203368
576 576 a, g dbSNP:118203369
577 577 a, g dbSNP:118203370
584 584 a, g dbSNP:745871522
585 585 c, g dbSNP:747251435
586 586 -, t dbSNP:118203377
589 589 c, t dbSNP:560863078
590 590 a, g dbSNP:397514843
592 592 c, t dbSNP:373173550
593 593 -, gtt dbSNP:118203378
593 593 a, g dbSNP:372215435
595 595 -, tgt dbSNP:118203379
599 599 -, c dbSNP:397514852
603 603 c, t dbSNP:779340088
609 609 ca, gcgtcttggtgt dbSNP:118203380
609 609 a, c, g dbSNP:397514784
610 610 c, t dbSNP:368922726
611 611 a, g, t dbSNP:118203381
616 616 a, g dbSNP:147125501
629 629 a, g dbSNP:780442112
647 647 -, ca dbSNP:118203383
647 647 c, t dbSNP:118203382
659 659 c, t dbSNP:118203384
669 669 c, t dbSNP:755791846
687 687 c, g, t dbSNP:118203385
693 693 a, g dbSNP:749979841
703 703 a, t dbSNP:118203386
705 705 a, g dbSNP:118203387
709 709 a, c dbSNP:118203388
718 718 -, a dbSNP:118203389
720 720 a, c dbSNP:767215560
727 727 c, t dbSNP:377196837
729 729 g, t dbSNP:751092692
732 732 c, t dbSNP:777484049
733 733 a, g dbSNP:768999400
734 734 g, t dbSNP:118203392
738 738 -, t dbSNP:118203393
740 740 -, ta dbSNP:118203394
744 744 -, t dbSNP:397514794
745 745 c, t dbSNP:752615412
746 746 a, g dbSNP:118203395
753 753 c, t dbSNP:118203396
754 754 c, t dbSNP:201562103
756 756 a, c, g, t dbSNP:397515294
757 757 g, t dbSNP:762139762
763 763 c, t dbSNP:774398322
766 766 c, g dbSNP:118203397
769 769 c, t dbSNP:118203398
777 777 -, tt dbSNP:118203399
782 782 c, t dbSNP:118203400
783 783 a, c, g dbSNP:118203402
783 783 -, g dbSNP:118203401
786 786 a, g, t dbSNP:118203403
788 788 c, t dbSNP:786202831
789 789 -, a dbSNP:118203405
790 790 g, t dbSNP:118203406
795 795 c, t dbSNP:746188529
799 799 a, c dbSNP:118203407
804 804 -, g dbSNP:397514868
805 805 -, c dbSNP:397514836
807 807 -, act dbSNP:118203408
807 807 a, g dbSNP:577983115
811 811 -, cgtctcc dbSNP:118203409
811 811 c, t dbSNP:202242304
812 812 a, g dbSNP:118203410
813 813 -, t dbSNP:118203411
816 816 -, cct dbSNP:118203412
817 817 a, c dbSNP:777571943
822 822 -, tt dbSNP:118203413
825 825 c, g dbSNP:397514834
829 829 c, t dbSNP:118203414
832 832 c, t dbSNP:118203415
836 836 a, c dbSNP:778671811
838 838 -, t dbSNP:397514837
839 839 a, g dbSNP:754980229
847 847 a, g dbSNP:753550247
861 861 -, tt dbSNP:118203417
861 861 c, t dbSNP:118203416
862 862 -, t dbSNP:397514835
865 865 a, g dbSNP:766250769
868 868 -, a dbSNP:118203418
871 871 c, g dbSNP:755910789
872 872 a, g, t dbSNP:397514830
879 879 -, c dbSNP:118203425
880 880 a, c dbSNP:754853512
884 884 a, t dbSNP:535397245
885 885 g, t dbSNP:118203426
887 887 a, g dbSNP:572899352
896 896 c, t dbSNP:118203427
907 907 a, g dbSNP:749311040
908 908 -, g dbSNP:118203428
908 908 g, t dbSNP:118203429
923 923 -, t dbSNP:118203430
926 926 a, t dbSNP:397514816
934 934 -, a dbSNP:118203431
934 934 g, t dbSNP:779872953
938 938 c, t dbSNP:118203432
946 946 -, t dbSNP:118203433
947 947 c, t dbSNP:118203434
948 948 a, g dbSNP:755859330
951 951 a, c, g dbSNP:118203436
951 951 -, g dbSNP:118203435
952 952 a, g dbSNP:118203441
956 956 a, t dbSNP:118203442
959 959 -, a dbSNP:118203444
959 959 a, t dbSNP:118203443
963 963 -, t dbSNP:118203446
963 963 a, g, t dbSNP:118203447
963 963 -, t dbSNP:118203445
973 973 c, t dbSNP:748775797
976 976 c, t dbSNP:780005416
984 984 a, c, t dbSNP:745640752
985 985 -, c dbSNP:118203449
986 986 a, g, t dbSNP:118203450
993 993 c, g dbSNP:758617649
996 996 a, g dbSNP:371225009
1000 1000 c, g dbSNP:779015004
1012 1012 c, t dbSNP:770704462
1018 1018 a, g dbSNP:753895570
1021 1021 c, t dbSNP:766961309
1024 1024 a, g dbSNP:142336706
1026 1026 -, at dbSNP:118203451
1027 1027 a, t dbSNP:118203452
1028 1028 a, g, t dbSNP:397514872
1031 1031 a, c dbSNP:2106347
1032 1032 a, t dbSNP:768057796
1033 1033 g, t dbSNP:148756522
1039 1039 -, at dbSNP:118203453
1039 1039 g, t dbSNP:118203454
1040 1040 c, t dbSNP:774009225
1044 1044 -, tg dbSNP:118203455
1044 1044 c, t dbSNP:200749357
1045 1045 -, gt dbSNP:118203456
1048 1048 -, tc dbSNP:118203457
1052 1052 c, t dbSNP:118203458
1059 1059 a, c dbSNP:118203459
1060 1060 -, a dbSNP:118203460
1060 1060 a, g dbSNP:768226293
1064 1064 c, t dbSNP:140544652
1065 1065 a, g dbSNP:151309813
1066 1066 c, t dbSNP:769706203
1067 1067 g, t dbSNP:377076733
1071 1071 c, g dbSNP:375144225
1076 1076 c, t dbSNP:770653972
1080 1080 c, g dbSNP:397514867
1084 1084 c, g, t dbSNP:779155575
1085 1085 a, g dbSNP:755195460
1087 1087 c, t dbSNP:753928162
1090 1090 c, t dbSNP:116756594
1092 1092 c, t dbSNP:756681916
1100 1100 c, t dbSNP:750890263
1105 1105 a, g, t dbSNP:118203461
1113 1113 c, t dbSNP:370916731
1115 1115 -, ca dbSNP:118203464
1115 1115 c, t dbSNP:118203463
1117 1117 c, g dbSNP:762200890
1126 1126 c, g, t dbSNP:118203466
1127 1127 a, g, t dbSNP:118203468
1129 1129 a, c, g, t dbSNP:397515293
1130 1130 g, t dbSNP:34876281
1131 1131 a, g dbSNP:752290177
1132 1132 g, t dbSNP:34610255
1134 1134 c, t dbSNP:572611259
1135 1135 c, t dbSNP:397514826
1144 1144 c, t dbSNP:759004332
1146 1146 c, g dbSNP:776158460
1150 1150 a, c dbSNP:118203472
1152 1152 c, t dbSNP:766317920
1155 1155 c, t dbSNP:373454700
1156 1156 a, g dbSNP:144208203
1157 1157 a, t dbSNP:185815387
1160 1160 c, t dbSNP:535868591
1161 1161 a, g dbSNP:375956049
1171 1171 -, gtt dbSNP:755655903
1174 1174 a, g dbSNP:770183315
1179 1179 c, t dbSNP:1073123
1180 1180 a, g dbSNP:397514807
1181 1181 c, g dbSNP:781189978
1186 1186 a, g dbSNP:118203473
1187 1187 c, t dbSNP:118203474
1191 1191 c, t dbSNP:757779597
1197 1197 -, a dbSNP:118203475
1201 1201 g, t dbSNP:202091845
1202 1202 -, c dbSNP:118203476
1202 1202 -, ct dbSNP:118203477
1203 1203 -, t dbSNP:118203478
1203 1203 -, tg dbSNP:118203479
1203 1203 -, t dbSNP:397514870
1208 1208 -, a dbSNP:118203480
1215 1215 a, c, t dbSNP:118203481
1216 1216 a, c, g dbSNP:200820603
1219 1219 a, g dbSNP:753091213
1220 1220 a, c, t dbSNP:118203483
1221 1221 -, ggctgataac dbSNP:397514849
1221 1221 a, g dbSNP:397514808
1229 1229 a, t dbSNP:570809282
1234 1234 -, a dbSNP:118203484
1234 1234 a, g dbSNP:760233114
1244 1244 -, g dbSNP:118203486
1252 1252 c, t dbSNP:753360364
1254 1254 a, g dbSNP:118203490
1255 1255 a, g dbSNP:118203491
1259 1259 c, g dbSNP:779767990
1261 1261 a, g dbSNP:118203492
1264 1264 c, t dbSNP:150777389
1265 1265 a, g dbSNP:781312535
1267 1267 a, g dbSNP:757404847
1292 1292 a, g dbSNP:201738258
1293 1293 a, c dbSNP:118203493
1298 1298 c, t dbSNP:397514864
1306 1306 -, tgtcccacctgatc dbSNP:118203494
1311 1311 -, cacctgatctgtca dbSNP:118203495
1311 1311 c, t dbSNP:763915012
1319 1319 c, t dbSNP:118203496
1324 1324 -, a dbSNP:118203497
1324 1324 a, t dbSNP:371648887
1327 1327 -, ac dbSNP:118203498
1327 1327 a, c, t dbSNP:771217333
1328 1328 c, g dbSNP:760638759
1332 1332 -, a dbSNP:118203499
1358 1358 a, g dbSNP:367564729
1366 1366 -, a dbSNP:118203501
1374 1374 c, t dbSNP:764150061
1377 1377 c, t dbSNP:377598226
1380 1380 a, g dbSNP:752575728
1380 1380 -, g dbSNP:397514832
1392 1392 c, t dbSNP:201452238
1404 1404 c, t dbSNP:766487204
1405 1405 a, g dbSNP:370281825
1410 1410 -, cactctgtcattcg dbSNP:118203502
1410 1410 c, t dbSNP:761014195
1412 1412 c, t dbSNP:773160913
1414 1414 c, g dbSNP:767514820
1417 1417 a, t dbSNP:761890555
1417 1417 -, t dbSNP:118203503
1422 1422 c, t dbSNP:118203504
1423 1423 a, g dbSNP:141184479
1431 1431 a, g dbSNP:143502728
1432 1432 c, t dbSNP:373465241
1433 1433 a, g dbSNP:769331772
1435 1435 a, g dbSNP:745463008
1438 1438 c, t dbSNP:781006583
1445 1445 a, c dbSNP:397514840
1446 1446 a, t dbSNP:140410001
1453 1453 a, g dbSNP:786203715
1458 1458 c, t dbSNP:746550630
1462 1462 c, t dbSNP:777823426
1463 1463 -, a dbSNP:397514792
1464 1464 -, c dbSNP:397514778
1464 1464 c, t dbSNP:77464996
1465 1465 a, g dbSNP:147127442
1469 1469 c, g dbSNP:765145057
1471 1471 -, c dbSNP:756865130
1471 1471 a, c, g dbSNP:369642207
1471 1471 -, c dbSNP:118203506
1484 1484 -, ag dbSNP:118203509
1487 1487 a, g dbSNP:753199284
1490 1490 g, t dbSNP:765695557
1493 1493 -, t dbSNP:118203510
1496 1496 ct, gc dbSNP:587778721
1504 1504 a, g dbSNP:759914505
1505 1505 c, t dbSNP:762688935
1517 1517 c, t dbSNP:118203511
1529 1529 c, g dbSNP:199800297
1531 1531 c, g dbSNP:770692313
1541 1541 a, g dbSNP:760470520
1545 1545 a, c, g dbSNP:118203512
1546 1546 a, g dbSNP:773003016
1549 1549 a, g dbSNP:7862221
1552 1552 -, g dbSNP:118203517
1554 1554 c, t dbSNP:772868048
1556 1556 c, t dbSNP:118203518
1557 1557 c, t dbSNP:397514848
1558 1558 c, t dbSNP:530908428
1564 1564 c, t dbSNP:773780814
1568 1568 c, g dbSNP:118203519
1569 1569 c, g dbSNP:371093730
1575 1575 -, tcactctaagtgatcttccagggtttttaggtgatctg dbSNP:118203520
1578 1578 -, c dbSNP:118203521
1580 1580 -, ct dbSNP:397514798
1580 1580 -, ga dbSNP:118203522
1582 1582 a, c dbSNP:397514856
1583 1583 -, a dbSNP:118203523
1583 1583 a, c dbSNP:587778722
1585 1585 c, t dbSNP:118203524
1593 1593 -, c dbSNP:118203525
1596 1596 a, g dbSNP:140953644
1597 1597 c, g dbSNP:779981609
1604 1604 c, g dbSNP:769529472
1625 1625 -, t dbSNP:118203526
1631 1631 a, g dbSNP:745697913
1632 1632 c, t dbSNP:185159716
1645 1645 -, agaa dbSNP:118203527
1645 1645 -, a dbSNP:397514858
1647 1647 -, ga dbSNP:118203528
1647 1647 a, g dbSNP:118203529
1656 1656 a, c dbSNP:775367219
1666 1666 -, a dbSNP:397514797
1674 1674 c, g dbSNP:118203532
1676 1676 g, t dbSNP:118203533
1684 1684 -, c dbSNP:118203534
1693 1693 c, g dbSNP:745657743
1695 1695 -, c dbSNP:118203535
1704 1704 -, tg dbSNP:118203536
1712 1712 c, t dbSNP:118203537
1713 1713 a, g dbSNP:118203538
1715 1715 g, t dbSNP:118203539
1717 1717 -, a dbSNP:397514876
1717 1717 a, c dbSNP:201810746
1720 1720 c, t dbSNP:772337076
1729 1729 -, t dbSNP:118203540
1730 1730 -, tc dbSNP:281875358
1739 1739 c, t dbSNP:118203542
1740 1740 a, g dbSNP:118203543
1742 1742 a, g dbSNP:779206386
1743 1743 -, ac dbSNP:118203544
1747 1747 -, t dbSNP:118203545
1749 1749 -, tc dbSNP:397514823
1753 1753 a, g dbSNP:755055358
1756 1756 -, g dbSNP:118203546
1758 1758 c, g dbSNP:749410972
1764 1764 a, g dbSNP:371908551
1773 1773 -, a dbSNP:118203547
1776 1776 c, t dbSNP:759379027
1781 1781 c, g dbSNP:118203548
1786 1786 c, g dbSNP:397514810
1788 1788 c, g dbSNP:750784794
1793 1793 c, t dbSNP:118203549
1794 1794 -, ag dbSNP:118203550
1794 1794 a, g dbSNP:767708806
1796 1796 -, ggcgccagcgtgaaccctgag dbSNP:766376606
1798 1798 c, t dbSNP:149439187
1799 1799 a, g dbSNP:751125011
1803 1803 c, g dbSNP:368481360
1804 1804 c, t dbSNP:762424091
1805 1805 a, g dbSNP:377279170
1808 1808 a, t dbSNP:765149885
1810 1810 c, t dbSNP:759461471
1821 1821 c, t dbSNP:776633158
1829 1829 -, t dbSNP:118203551
1840 1840 a, g dbSNP:756935981
1844 1844 -, gggcctgacacaccaaa dbSNP:118203552
1845 1845 a, g dbSNP:770570830
1849 1849 c, t dbSNP:372284519
1850 1850 g, t dbSNP:774671298
1854 1854 c, t dbSNP:769040084
1862 1862 c, g dbSNP:118203553
1865 1865 a, g dbSNP:780338343
1876 1876 -, c dbSNP:118203554
1878 1878 -, t dbSNP:397514829
1883 1883 -, c dbSNP:118203556
1883 1883 c, t dbSNP:118203555
1885 1885 -, gccctgcggcagtgctgatgaaa dbSNP:118203557
1890 1890 -, g dbSNP:118203558
1891 1891 c, t dbSNP:368317116
1892 1892 a, g dbSNP:746304922
1894 1894 -, cagtgctgatgaaagccctgcgg dbSNP:397514818
1899 1899 c, g dbSNP:377185303
1901 1901 -, g dbSNP:118203561
1906 1906 -, aa dbSNP:118203562
1911 1911 -, c dbSNP:118203563
1914 1914 c, t dbSNP:397514880
1915 1915 a, g dbSNP:35478675
1916 1916 -, cagtgctgatgaaagccctgcgg dbSNP:118203559
1917 1917 -, g dbSNP:397514777
1918 1918 -, gtgctgatgaaagccctgcggga dbSNP:118203560
1922 1922 -, ag dbSNP:118203564
1924 1924 a, g dbSNP:777386797
1928 1928 c, t dbSNP:758107610
1930 1930 c, t dbSNP:752202276
1931 1931 a, c, t dbSNP:118203565
1935 1935 c, g, t dbSNP:548002938
1938 1938 c, t dbSNP:118203566
1940 1940 c, t dbSNP:118203567
1941 1941 g, tggagaccagtatcttcactcc dbSNP:118203569
1941 1941 -, tggagaccagtatctt dbSNP:118203568
1943 1943 g, t dbSNP:118203570
1945 1945 c, g dbSNP:118203571
1950 1950 -, g dbSNP:118203572
1960 1960 -, t dbSNP:118203573
1963 1963 -, ca dbSNP:118203574
1965 1965 c, g dbSNP:786203799
1967 1967 c, t dbSNP:766367103
1970 1970 c, t dbSNP:760356610
1971 1971 ca, gtaaaattccac dbSNP:397514857
1971 1971 -, gtaaaattc dbSNP:118203575
1973 1973 a, t dbSNP:397514846
1974 1974 a, g dbSNP:118203576
1975 1975 a, g dbSNP:118203577
1980 1980 -, c dbSNP:397514811
1981 1981 a, g dbSNP:118203578
1986 1986 a, c dbSNP:768985094
1987 1987 a, g dbSNP:146578402
1988 1988 -, ga dbSNP:118203579
1989 1989 c, t dbSNP:775869914
1990 1990 a, g, t dbSNP:118203580
1991 1991 a, t dbSNP:118203581
2002 2002 -, t dbSNP:118203582
2006 2006 -, a, aa dbSNP:118203583
2008 2008 c, t dbSNP:766438395
2009 2009 a, g dbSNP:761959210
2016 2016 c, t dbSNP:543077026
2020 2020 a, c dbSNP:771521648
2022 2022 c, t dbSNP:751247705
2023 2023 a, g, t dbSNP:112434645
2032 2032 a, t dbSNP:758769193
2037 2037 -, tt dbSNP:118203585
2038 2038 -, tt dbSNP:118203586
2039 2039 g, t dbSNP:118203587
2053 2053 a, g dbSNP:118203588
2055 2055 -, a dbSNP:118203589
2062 2062 c, t dbSNP:752286096
2063 2063 c, g dbSNP:397514854
2065 2065 -, t dbSNP:118203590
2071 2071 -, t dbSNP:118203591
2083 2083 a, g dbSNP:778556382
2085 2085 c, t dbSNP:754401816
2090 2090 g, t dbSNP:397514815
2092 2092 a, g dbSNP:753424167
2095 2095 a, g dbSNP:766204646
2096 2096 c, t dbSNP:375534013
2097 2097 a, g, t dbSNP:118203592
2098 2098 -, aaagaaagcaaaaggaaacaca dbSNP:397514796
2100 2100 -, a dbSNP:118203594
2102 2102 -, aaag dbSNP:118203595
2104 2104 -, a dbSNP:118203596
2117 2117 -, ac dbSNP:118203597
2118 2118 -, ca dbSNP:118203598
2121 2121 -, ag dbSNP:118203599
2123 2123 a, g dbSNP:575639692
2125 2125 -, a dbSNP:397514801
2130 2130 a, g, t dbSNP:372583166
2131 2131 g, t dbSNP:775816560
2135 2135 c, t dbSNP:374222196
2136 2136 a, c dbSNP:397514863
2142 2142 c, t dbSNP:368016548
2150 2150 a, g dbSNP:145741748
2156 2156 -, g dbSNP:118203600
2157 2157 c, t dbSNP:771341361
2168 2168 c, t dbSNP:747452647
2169 2169 -, tg dbSNP:118203601
2172 2172 -, ta dbSNP:118203602
2173 2173 -, a dbSNP:118203603
2174 2174 c, g, t dbSNP:75820036
2177 2177 c, t dbSNP:118203606
2178 2178 -, a dbSNP:397514793
2182 2182 a, c dbSNP:118203607
2188 2188 c, g, t dbSNP:118203608
2190 2190 c, t dbSNP:118203609
2191 2191 a, g dbSNP:35958226
2206 2206 a, g dbSNP:775799075
2209 2209 a, c dbSNP:748733167
2212 2212 a, g dbSNP:118203616
2217 2217 c, t dbSNP:772603060
2220 2220 g, t dbSNP:118203617
2223 2223 c, g dbSNP:754679411
2230 2230 c, g dbSNP:748487106
2232 2232 a, c dbSNP:774835995
2236 2236 -, c dbSNP:118203619
2236 2236 c, t dbSNP:118203618
2237 2237 c, g dbSNP:768189353
2237 2237 -, g dbSNP:118203620
2240 2240 a, t dbSNP:748901883
2242 2242 a, g dbSNP:118203621
2244 2244 -, cccactttgga dbSNP:118203622
2244 2244 c, t dbSNP:779584449
2246 2246 c, t dbSNP:755647717
2247 2247 a, g dbSNP:745413532
2248 2248 c, t dbSNP:201392975
2252 2252 a, g dbSNP:757322533
2253 2253 a, g dbSNP:118203623
2255 2255 a, g dbSNP:118203624
2260 2260 -, tc dbSNP:397514869
2264 2264 -, cct dbSNP:397514799
2264 2264 c, t dbSNP:746909024
2268 2268 a, c dbSNP:118203629
2271 2271 a, g dbSNP:786201465
2279 2279 c, t dbSNP:202241429
2280 2280 a, g dbSNP:200827913
2282 2282 a, g dbSNP:752473063
2283 2283 acactt, ccctcc dbSNP:118203630
2284 2284 c, t dbSNP:780223819
2288 2288 c, t dbSNP:118203631
2289 2289 a, g dbSNP:199755731
2291 2291 c, g dbSNP:397514800
2294 2294 c, t dbSNP:397514789
2296 2296 -, g dbSNP:118203632
2299 2299 a, g dbSNP:767518902
2304 2304 -, t dbSNP:118203633
2306 2306 c, t dbSNP:551954460
2307 2307 g, t dbSNP:397514802
2308 2308 -, g dbSNP:118203634
2310 2310 -, nnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:672601250
2311 2311 -, c, cctccgagaccagttgcttttactgcac dbSNP:118203635
2315 2315 -, cagttac dbSNP:397514791
2315 2315 -, ca dbSNP:118203637
2315 2315 -, c dbSNP:118203636
2316 2316 -, agtt dbSNP:118203638
2317 2317 -, gtta dbSNP:118203640
2317 2317 g, t dbSNP:118203639
2318 2318 -, tagtt dbSNP:118203642
2320 2320 -, gtta dbSNP:397514779
2320 2320 a, gt dbSNP:397514838
2323 2323 -, ct dbSNP:118203643
2323 2323 -, gttactc dbSNP:118203641
2324 2324 -, t dbSNP:118203644
2325 2325 -, at dbSNP:118203645
2325 2325 a, g dbSNP:752054698
2326 2326 a, t dbSNP:118203646
2329 2329 a, g dbSNP:142662480
2342 2342 c, t dbSNP:397514874
2345 2345 c, t dbSNP:118203647
2348 2348 -, catgc dbSNP:118203648
2349 2349 -, atgcc dbSNP:118203649
2359 2359 -, g dbSNP:118203650
2365 2365 -, g dbSNP:118203651
2367 2367 -, aacaggcg dbSNP:397514803
2375 2375 c, t dbSNP:763357144
2376 2376 a, c, g dbSNP:769566267
2378 2378 a, t dbSNP:397514772
2383 2383 -, g dbSNP:118203652
2387 2387 -, aaag dbSNP:118203653
2389 2389 -, a dbSNP:118203654
2391 2391 a, c dbSNP:118203655
2405 2405 -, g dbSNP:118203656
2405 2405 g, t dbSNP:397514820
2408 2408 c, t dbSNP:118203657
2410 2410 c, t dbSNP:776441369
2417 2417 a, g dbSNP:770518730
2418 2418 a, c dbSNP:746535706
2435 2435 a, c dbSNP:587778723
2440 2440 a, g dbSNP:397514878
2441 2441 c, t dbSNP:118203661
2449 2449 a, g dbSNP:753265422
2450 2450 g, t dbSNP:786203007
2463 2463 a, g dbSNP:118203662
2464 2464 a, g dbSNP:118203663
2468 2468 a, g dbSNP:765643529
2474 2474 c, t dbSNP:118203664
2482 2482 -, agaa dbSNP:118203665
2482 2482 a, g dbSNP:760004541
2486 2486 c, t dbSNP:397514783
2493 2493 -, gatacaatcagctcca dbSNP:118203666
2495 2495 c, t dbSNP:776386313
2497 2497 a, c, g dbSNP:118203668
2498 2498 -, taca dbSNP:118203667
2499 2499 a, g dbSNP:118203670
2501 2501 c, t dbSNP:118203671
2505 2505 -, t dbSNP:118203672
2507 2507 c, t dbSNP:118203673
2512 2512 -, gcagcgtgacactatggtaacca dbSNP:118203674
2513 2513 c, t dbSNP:118203675
2526 2526 c, t dbSNP:760208449
2531 2531 -, a dbSNP:118203676
2531 2531 a, c dbSNP:772652234
2533 2533 -, c dbSNP:118203677
2536 2536 a, g dbSNP:772038670
2542 2542 -, ca dbSNP:118203678
2543 2543 -, a dbSNP:397514780
2546 2546 c, t dbSNP:118203679
2555 2555 c, t dbSNP:118203680
2556 2556 -, aa dbSNP:397514855
2560 2560 a, g dbSNP:747968526
2561 2561 c, t dbSNP:118203681
2562 2562 a, g dbSNP:774284355
2565 2565 a, g dbSNP:768390011
2570 2570 c, t dbSNP:118203682
2571 2571 -, g dbSNP:118203683
2574 2574 -, aggaa dbSNP:118203684
2576 2576 g, t dbSNP:118203685
2578 2578 -, a dbSNP:118203686
2583 2583 a, g dbSNP:749111647
2594 2594 a, c dbSNP:781371665
2601 2601 -, t dbSNP:397514786
2603 2603 c, t dbSNP:397514862
2615 2615 g, t dbSNP:118203687
2621 2621 -, t dbSNP:118203688
2625 2625 -, ggaacatgattgcg dbSNP:118203689
2634 2634 c, t dbSNP:118203690
2635 2635 -, t dbSNP:118203691
2635 2635 c, t dbSNP:754248661
2637 2637 c, g, t dbSNP:756514375
2638 2638 a, g dbSNP:200651872
2639 2639 c, g dbSNP:118203692
2645 2645 c, g dbSNP:397514814
2646 2646 a, g dbSNP:761281095
2648 2648 a, g dbSNP:751128287
2654 2654 c, t dbSNP:199517042
2670 2670 -, acaa dbSNP:118203693
2677 2677 c, g dbSNP:764014190
2679 2679 -, gt dbSNP:118203694
2682 2682 -, g dbSNP:118203696
2682 2682 -, a dbSNP:118203695
2684 2684 -, ac dbSNP:118203697
2685 2685 -, ct dbSNP:118203698
2686 2686 g, t dbSNP:762811821
2692 2692 a, c, g dbSNP:149719514
2699 2699 a, c, t dbSNP:118203699
2705 2705 c, g dbSNP:773279842
2711 2711 c, t dbSNP:118203700
2715 2715 -, a dbSNP:118203701
2719 2719 c, t dbSNP:112384441
2721 2721 c, g dbSNP:118203706
2722 2722 -, aaac dbSNP:118203707
2723 2723 -, aaca dbSNP:118203708
2724 2724 -, a dbSNP:118203709
2728 2728 c, t dbSNP:786203259
2729 2729 -, gagt dbSNP:794727320
2734 2734 a, c, g dbSNP:547498792
2735 2735 -, g dbSNP:397514850
2737 2737 c, t dbSNP:397514825
2741 2741 c, g dbSNP:749414404
2742 2742 -, agcagat dbSNP:118203710
2756 2756 c, t dbSNP:780394011
2770 2770 c, g dbSNP:770381040
2773 2773 -, ggtt dbSNP:118203711
2774 2774 a, g dbSNP:746215028
2783 2783 -, g dbSNP:118203713
2783 2783 -, g dbSNP:118203712
2791 2791 c, t dbSNP:781553258
2796 2796 -, t dbSNP:397514865
2809 2809 -, a dbSNP:118203714
2818 2818 c, t dbSNP:147163264
2828 2828 a, c, g dbSNP:746607455
2837 2837 a, c dbSNP:78260659
2839 2839 a, g dbSNP:777437357
2840 2840 g, t dbSNP:747602915
2849 2849 a, g dbSNP:778416424
2850 2850 c, t dbSNP:754457018
2860 2860 c, t dbSNP:118203720
2861 2861 a, g dbSNP:118203721
2864 2864 -, t dbSNP:118203722
2866 2866 a, t dbSNP:397514805
2867 2867 c, t dbSNP:118203723
2868 2868 a, g dbSNP:200514807
2871 2871 -, aa dbSNP:397514828
2872 2872