Email to GenScript

VWF von Willebrand factor [Homo sapiens (human)]

Gene Symbol VWF
Entrez Gene ID 7450
Full Name von Willebrand factor
Synonyms F8VWF, VWD
General protein information
Preferred Names
von Willebrand factor
von Willebrand factor
coagulation factor VIII VWF
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-vessel wall mediator in the blood coagulation system. It is crucial to the hemostasis process. Mutations in this gene or deficiencies in this protein result in von Willebrand's disease. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: von Willebrand disease, type 2A, 2B, 2M, and 2N, 613554 (3); von

The following VWF gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the VWF gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26652 NM_000552 Homo sapiens von Willebrand factor (VWF), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26652
Accession Version NM_000552.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 8442bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product von Willebrand factor preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC005845.13, X04385.1, DB293903.1, M10321.1, BQ898017.1 and BG951111.1. This sequence is a reference standard in the RefSeqGene project. On Mar 5, 2006 this sequence version replaced gi:9257255. Summary: The glycoprotein encoded by this gene functions as both an antihemophilic factor carrier and a platelet-vessel wall mediator in the blood coagulation system. It is crucial to the hemostasis process. Mutations in this gene or deficiencies in this protein result in von Willebrand's disease. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X04385.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)170..172(+)
Misc Feature(2)347..784(+)
Misc Feature(3)914..1123(+)
Misc Feature(4)1133..1294(+)
Misc Feature(5)1298..>1432(+)
Misc Feature(6)1379..1870(+)
Misc Feature(7)1979..2197(+)
Misc Feature(8)2204..2371(+)
Misc Feature(9)2540..2611(+)
Misc Feature(10)2549..2674(+)
Misc Feature(11)2576..2662(+)
Misc Feature(12)2612..2749(+)
Misc Feature(13)2678..2713(+)
Misc Feature(14)2726..2809(+)
Misc Feature(15)2816..3283(+)
Misc Feature(16)2849..3238(+)
Misc Feature(17)2915..3343(+)
Misc Feature(18)2942..3229(+)
Misc Feature(19)2990..3013(+)
Misc Feature(20)3407..3631(+)
Misc Feature(21)3428..3502(+)
Misc Feature(22)3626..3640(+)
Misc Feature(23)3686..3838(+)
Misc Feature(24)3695..3757(+)
Misc Feature(25)3707..3745(+)
Misc Feature(26)3836..3847(+)
Misc Feature(27)4064..4624(+)
Misc Feature(28)4076..4564(+)
Misc Feature(29)4076..4564(+)
Misc Feature(30)4097..4408(+)
Misc Feature(31)4103..4315(+)
Misc Feature(32)4193..4279(+)
Misc Feature(33)4220..4351(+)
Misc Feature(34)4739..5185(+)
Misc Feature(35)4739..5128(+)
Misc Feature(36)4760..4978(+)
Misc Feature(37)4766..4978(+)
Misc Feature(38)4793..4795(+)
Misc Feature(39)4856..4942(+)
Misc Feature(40)4883..5014(+)
Misc Feature(41)5063..5065(+)
Misc Feature(42)5255..5260(+)
Misc Feature(43)5306..5866(+)
Misc Feature(44)5318..5797(+)
Misc Feature(45)5318..5797(+)
Misc Feature(46)5339..5554(+)
Misc Feature(47)5345..5554(+)
Misc Feature(48)5435..5521(+)
Misc Feature(49)5462..5590(+)
Misc Feature(50)5885..5962(+)
Misc Feature(51)6029..6514(+)
Misc Feature(52)6062..6553(+)
Misc Feature(53)6098..6505(+)
Misc Feature(54)6164..6619(+)
Misc Feature(55)6227..6253(+)
Misc Feature(56)6656..6850(+)
Misc Feature(57)6857..7012(+)
Misc Feature(58)6896..7033(+)
Misc Feature(59)7031..7213(+)
Misc Feature(60)7541..7732(+)
Misc Feature(61)7769..7777(+)
Misc Feature(62)7994..8182(+)
Misc Feature(63)8420..8572(+)
Misc Feature(64)8429..8674(+)
Misc Feature(65)8465..8614(+)
Misc Feature(66)8498..8662(+)
Misc Feature(67)8510..8668(+)
Misc Feature(68)8561..8563(+)
Misc Feature(69)8567..8569(+)
Misc Feature(70)8681..8683(+)
Exon (1)1..250
Gene Synonym:
Exon (2)251..305
Gene Synonym:
Exon (3)306..470
Gene Synonym:
Exon (4)471..573
Gene Synonym:
Exon (5)574..782
Gene Synonym:
Exon (6)783..907
Gene Synonym:
Exon (7)908..1124
Gene Synonym:
Exon (8)1125..1247
Gene Synonym:
Exon (9)1248..1359
Gene Synonym:
Exon (10)1360..1406
Gene Synonym:
Exon (11)1407..1543
Gene Synonym:
Exon (12)1544..1682
Gene Synonym:
Exon (13)1683..1783
Gene Synonym:
Exon (14)1784..1979
Gene Synonym:
Exon (15)1980..2195
Gene Synonym:
Exon (16)2196..2436
Gene Synonym:
Exon (17)2437..2531
Gene Synonym:
Exon (18)2532..2692
Gene Synonym:
Exon (19)2693..2796
Gene Synonym:
Exon (20)2797..2935
Gene Synonym:
Exon (21)2936..3070
Gene Synonym:
Exon (22)3071..3217
Gene Synonym:
Exon (23)3218..3358
Gene Synonym:
Exon (24)3359..3472
Gene Synonym:
Exon (25)3473..3629
Gene Synonym:
Exon (26)3630..3788
Gene Synonym:
Exon (27)3789..3924
Gene Synonym:
Exon (28)3925..5303
Gene Synonym:
Exon (29)5304..5420
Gene Synonym:
Exon (30)5421..5561
Gene Synonym:
Exon (31)5562..5705
Gene Synonym:
Exon (32)5706..5870
Gene Synonym:
Exon (33)5871..5914
Gene Synonym:
Exon (34)5915..6092
Gene Synonym:
Exon (35)6093..6313
Gene Synonym:
Exon (36)6314..6506
Gene Synonym:
Exon (37)6507..6848
Gene Synonym:
Exon (38)6849..7048
Gene Synonym:
Exon (39)7049..7151
Gene Synonym:
Exon (40)7152..7226
Gene Synonym:
Exon (41)7227..7331
Gene Synonym:
Exon (42)7332..7537
Gene Synonym:
Exon (43)7538..7687
Gene Synonym:
Exon (44)7688..7798
Gene Synonym:
Exon (45)7799..7979
Gene Synonym:
Exon (46)7980..8020
Gene Synonym:
Exon (47)8021..8137
Gene Synonym:
Exon (48)8138..8236
Gene Synonym:
Exon (49)8237..8365
Gene Synonym:
Exon (50)8366..8405
Gene Synonym:
Exon (51)8406..8503
Gene Synonym:
Exon (52)8504..8833
Gene Synonym:
Position Chain Variation Link
55 55 a, g dbSNP:559318257
113 113 a, g dbSNP:144257680
119 119 c, t dbSNP:577252454
127 127 c, t dbSNP:187439551
136 136 g, t dbSNP:767965922
173 173 c, g dbSNP:538065041
192 192 c, g dbSNP:575462122
214 214 c, t dbSNP:555706036
228 228 a, g dbSNP:552155985
231 231 g, t dbSNP:535735839
262 262 a, c dbSNP:770954146
271 271 c, t dbSNP:144128523
272 272 a, g, t dbSNP:201015235
275 275 a, c, g, t dbSNP:768885457
278 278 c, t dbSNP:761855421
291 291 a, c dbSNP:747049949
300 300 -, t dbSNP:751286556
305 305 a, g dbSNP:61753983
306 306 a, g dbSNP:267603621
310 310 c, g dbSNP:770031169
313 313 g, t dbSNP:762386347
322 322 a, g dbSNP:777251593
323 323 a, g dbSNP:768896863
327 327 c, g dbSNP:747404115
330 330 a, g dbSNP:773817619
331 331 a, c, t dbSNP:140419498
332 332 a, g dbSNP:777235699
336 336 a, g dbSNP:755672837
344 344 a, g dbSNP:772515993
345 345 c, t dbSNP:537944350
346 346 a, g dbSNP:146778712
347 347 c, g dbSNP:368132716
350 350 c, g, t dbSNP:61753984
351 351 a, g dbSNP:766468461
357 357 a, g dbSNP:374601266
358 358 c, t dbSNP:750720570
364 364 c, t dbSNP:2229443
366 366 a, g dbSNP:762049443
369 369 a, g, t dbSNP:138001833
370 370 c, t dbSNP:760899524
376 376 c, t dbSNP:200710351
377 377 a, g dbSNP:772466729
385 385 c, t dbSNP:370840325
389 389 c, g dbSNP:61753985
397 397 a, c, g dbSNP:61753986
403 403 c, t dbSNP:769292275
404 404 a, t dbSNP:747701551
411 411 c, t dbSNP:200901782
412 412 g, t dbSNP:148741727
415 415 a, t dbSNP:376119507
419 419 a, t dbSNP:779874391
421 421 a, c dbSNP:61753987
425 425 c, t dbSNP:758324527
439 439 a, g dbSNP:144310330
441 441 -, g dbSNP:62643618
442 442 c, t dbSNP:750669013
447 447 a, g dbSNP:765560613
452 452 c, t dbSNP:757353387
453 453 a, g dbSNP:753973552
457 457 c, t dbSNP:764469679
462 462 a, c, t dbSNP:62643619
466 466 c, t dbSNP:775912215
471 471 c, g dbSNP:777859406
472 472 a, g dbSNP:756159469
475 475 c, t dbSNP:753178808
483 483 a, g dbSNP:768075585
500 500 c, t dbSNP:372664002
502 502 c, g dbSNP:751964864
503 503 c, t dbSNP:62643620
505 505 a, c, t dbSNP:369017115
506 506 a, g dbSNP:140044866
508 508 c, g dbSNP:768147964
510 510 a, c dbSNP:62643621
516 516 a, g dbSNP:751410490
521 521 a, t dbSNP:760170954
526 526 -, t dbSNP:61753989
526 526 -, t dbSNP:61753988
538 538 a, g dbSNP:775556852
553 553 c, g, t dbSNP:745627685
554 554 a, g dbSNP:147514785
558 558 a, c dbSNP:770652563
559 559 a, g dbSNP:749467330
563 563 c, g dbSNP:777859270
565 565 a, g dbSNP:756211916
574 574 a, g dbSNP:749101961
577 577 c, t dbSNP:369305347
579 579 c, t dbSNP:769955003
588 588 a, g dbSNP:374854636
599 599 a, g dbSNP:748190942
604 604 a, g dbSNP:781203277
608 608 c, g, t dbSNP:777585191
616 616 c, t dbSNP:780494426
624 624 -, ggtactacaagctg dbSNP:63749066
625 625 c, gt dbSNP:267607300
625 625 a, g, t dbSNP:750803573
635 635 a, c dbSNP:61753991
640 640 c, t dbSNP:2229444
641 641 a, g dbSNP:76505074
659 659 g, t dbSNP:71582882
665 665 a, g dbSNP:545695166
668 668 a, g dbSNP:148218885
670 670 c, t dbSNP:766282227
671 671 a, g, t dbSNP:61753992
672 672 a, g dbSNP:61753993
673 673 c, t dbSNP:762783476
676 676 a, c dbSNP:772915855
679 679 c, t dbSNP:202062122
680 680 a, g dbSNP:781180895
689 689 c, t dbSNP:199939434
698 698 c, g dbSNP:768721653
699 699 a, c, t dbSNP:61753994
704 704 c, g dbSNP:754806588
706 706 c, t dbSNP:747152070
712 712 c, t dbSNP:780590656
717 717 a, g dbSNP:371953822
719 719 a, g dbSNP:553810662
723 723 c, t dbSNP:779098641
727 727 c, t dbSNP:369559140
728 728 g, t dbSNP:61753995
730 730 a, g dbSNP:752329572
731 731 c, t dbSNP:781055990
741 741 a, g dbSNP:747744741
743 743 g, t dbSNP:754520488
745 745 c, t dbSNP:537085069
747 747 a, t dbSNP:62643622
755 755 a, g dbSNP:751076191
756 756 c, t dbSNP:201312416
764 764 a, g dbSNP:766305860
765 765 a, g dbSNP:200764995
770 770 a, g dbSNP:762755471
771 771 -, tg dbSNP:764881408
772 772 a, g dbSNP:750391930
774 774 c, t dbSNP:201368895
784 784 a, g dbSNP:763907829
785 785 a, g dbSNP:760760518
787 787 c, t dbSNP:376006842
795 795 c, t dbSNP:372719492
796 796 a, g dbSNP:143054357
801 801 c, g dbSNP:774705733
812 812 a, g dbSNP:771612011
814 814 c, t dbSNP:200204308
819 819 c, t dbSNP:778239123
820 820 a, g dbSNP:770301728
851 851 c, g dbSNP:746578867
855 855 a, g dbSNP:369737556
859 859 a, g dbSNP:757836378
871 871 a, c dbSNP:745435568
873 873 c, g dbSNP:377057638
874 874 c, t dbSNP:757146723
882 882 a, g dbSNP:753796586
888 888 c, t dbSNP:763817902
893 893 c, g dbSNP:755941786
895 895 a, g dbSNP:752857167
896 896 a, g dbSNP:767837153
902 902 c, t dbSNP:62643623
912 912 g, t dbSNP:770423079
916 916 a, g dbSNP:62643624
920 920 c, t dbSNP:748853071
932 932 c, t dbSNP:371453614
943 943 c, g dbSNP:527344390
945 945 c, t dbSNP:367571869
946 946 a, g dbSNP:565372101
947 947 a, g dbSNP:754738949
956 956 c, t dbSNP:140912382
957 957 a, g dbSNP:780485557
959 959 a, t dbSNP:374004459
967 967 g, t dbSNP:758531765
973 973 a, g dbSNP:769621986
977 977 a, c, t dbSNP:372100774
978 978 c, t dbSNP:370654988
979 979 c, t dbSNP:754315625
980 980 a, g dbSNP:137987854
986 986 g, t dbSNP:761093365
1006 1006 g, t dbSNP:773979952
1011 1011 c, t dbSNP:770617263
1024 1024 c, t dbSNP:556427593
1027 1027 c, g dbSNP:772735264
1030 1030 -, g dbSNP:760130928
1036 1036 c, g dbSNP:769207315
1038 1038 -, gcgcctgccctgccctcctggagt dbSNP:63749067
1039 1039 c, t dbSNP:748057326
1040 1040 a, c, g dbSNP:145476045
1046 1046 c, g dbSNP:201450675
1049 1049 a, g dbSNP:140388695
1052 1052 c, t dbSNP:780395497
1060 1060 a, g dbSNP:758657154
1063 1063 c, t dbSNP:750697933
1064 1064 a, g, t dbSNP:747799959
1067 1067 c, t dbSNP:61753997
1068 1068 a, g dbSNP:764566111
1073 1073 a, c, t dbSNP:61753998
1076 1076 a, g dbSNP:761003216
1077 1077 c, t dbSNP:753099465
1082 1082 a, g dbSNP:767897472
1084 1084 a, g dbSNP:762540901
1095 1095 c, t dbSNP:781455398
1096 1096 a, g dbSNP:769278119
1099 1099 c, t dbSNP:761290578
1100 1100 a, g dbSNP:376461502
1108 1108 c, t dbSNP:776206258
1117 1117 c, t dbSNP:746977731
1118 1118 a, c, g dbSNP:772006599
1119 1119 a, c, t dbSNP:375397606
1120 1120 a, g dbSNP:150192701
1134 1134 a, g dbSNP:770781601
1143 1143 -, g dbSNP:267607303
1155 1155 c, g dbSNP:140911166
1165 1165 a, g dbSNP:773422295
1167 1167 a, c, g, t dbSNP:200097381
1171 1171 c, t dbSNP:769006866
1174 1174 c, g, t dbSNP:557379500
1175 1175 g, t dbSNP:200615283
1176 1176 c, t dbSNP:758796468
1180 1180 a, g dbSNP:753536993
1181 1181 a, g dbSNP:777628949
1182 1182 c, t dbSNP:201496129
1202 1202 a, g dbSNP:752292917
1203 1203 a, g dbSNP:767084830
1204 1204 a, t dbSNP:1800387
1208 1208 a, g dbSNP:751525114
1212 1212 a, g dbSNP:766016814
1213 1213 c, t dbSNP:762870016
1220 1220 c, t dbSNP:61754000
1221 1221 a, g dbSNP:61754001
1224 1224 g, t dbSNP:11837584
1225 1225 c, t dbSNP:199928277
1238 1238 -, a dbSNP:267607304
1242 1242 a, g dbSNP:140004667
1243 1243 a, c dbSNP:147924974
1244 1244 c, t dbSNP:780678562
1248 1248 a, g dbSNP:746407466
1252 1252 a, t dbSNP:368187449
1259 1259 c, t dbSNP:760387797
1269 1269 c, g, t dbSNP:370201773
1275 1275 -, g dbSNP:771376802
1276 1276 c, t dbSNP:780960745
1277 1277 a, g, t dbSNP:746575545
1278 1278 c, t dbSNP:779463835
1279 1279 a, g dbSNP:373418673
1282 1282 a, g dbSNP:758285268
1287 1287 c, t dbSNP:111971143
1288 1288 c, t dbSNP:764950457
1289 1289 a, g dbSNP:757111785
1300 1300 c, t dbSNP:141009309
1301 1301 a, g dbSNP:535978867
1305 1305 a, g dbSNP:760642864
1309 1309 c, g, t dbSNP:767726061
1310 1310 a, g dbSNP:760061887
1311 1311 a, g dbSNP:775002681
1316 1316 c, t dbSNP:771413750
1317 1317 a, g dbSNP:377580592
1321 1321 a, c dbSNP:61754002
1325 1325 c, t dbSNP:146154234
1327 1327 c, t dbSNP:71582884
1328 1328 a, g dbSNP:199570108
1332 1332 c, t dbSNP:746666406
1337 1337 c, g dbSNP:779561353
1341 1341 c, t dbSNP:373521756
1343 1343 c, t dbSNP:61754003
1348 1348 c, t dbSNP:745805859
1351 1351 c, t dbSNP:778879639
1356 1356 c, t dbSNP:370984009
1357 1357 c, g dbSNP:149640698
1359 1359 a, g dbSNP:763827767
1367 1367 c, t dbSNP:62643625
1368 1368 a, g, t dbSNP:78516266
1369 1369 a, t dbSNP:751725234
1371 1371 a, c dbSNP:201185151
1372 1372 -, c dbSNP:141400724
1381 1381 g, t dbSNP:62643626
1385 1385 g, t dbSNP:763461692
1389 1389 a, g dbSNP:750901816
1396 1396 a, t dbSNP:765633902
1400 1400 c, t dbSNP:762146804
1401 1401 a, g dbSNP:775101417
1407 1407 g, t dbSNP:367556535
1409 1409 c, g dbSNP:768578418
1423 1423 a, t dbSNP:1800375
1427 1427 c, g dbSNP:765582225
1429 1429 a, g dbSNP:367960031
1432 1432 a, c dbSNP:1800376
1436 1436 c, t dbSNP:780724123
1441 1441 c, g dbSNP:745975177
1455 1455 a, g dbSNP:779082753
1462 1462 -, aatccc dbSNP:61754006
1472 1472 a, g dbSNP:201306785
1482 1482 a, c dbSNP:757658534
1489 1489 -, g dbSNP:770203987
1489 1489 g, t dbSNP:754357872
1490 1490 a, c dbSNP:375451251
1494 1494 c, t dbSNP:549641611
1496 1496 c, t dbSNP:185908682
1497 1497 a, g dbSNP:137950753
1505 1505 c, t dbSNP:201379649
1512 1512 a, g dbSNP:751199609
1515 1515 c, t dbSNP:765997490
1530 1530 a, c, t dbSNP:61754007
1533 1533 a, t dbSNP:370628384
1536 1536 c, g dbSNP:764823369
1542 1542 a, g dbSNP:552315432
1545 1545 g, t dbSNP:779213804
1556 1556 c, t dbSNP:145443126
1557 1557 a, g dbSNP:770245302
1558 1558 c, t dbSNP:748709779
1559 1559 -, gacgctgtgtgcacccgc dbSNP:267607305
1559 1559 g, t dbSNP:375486035
1561 1561 c, t dbSNP:374722386
1562 1562 a, g dbSNP:756620872
1569 1569 a, g dbSNP:372938917
1574 1574 c, t dbSNP:148247755
1575 1575 a, g dbSNP:199665748
1579 1579 c, t dbSNP:142404899
1580 1580 a, g dbSNP:149116506
1582 1582 c, t dbSNP:112620124
1583 1583 a, c dbSNP:752687986
1585 1585 c, t dbSNP:368896272
1586 1586 a, g dbSNP:767209816
1588 1588 a, c dbSNP:759430407
1589 1589 c, t dbSNP:372495746
1590 1590 a, g dbSNP:771179169
1593 1593 c, t dbSNP:377243998
1601 1601 c, t dbSNP:754056398
1605 1605 a, c dbSNP:773227284
1606 1606 c, t dbSNP:769875003
1608 1608 -, aca dbSNP:768444709
1610 1610 a, g dbSNP:748534787
1613 1613 c, t dbSNP:781753473
1643 1643 c, g dbSNP:372738366
1645 1645 c, t dbSNP:747442596
1646 1646 a, g dbSNP:201345218
1647 1647 c, t dbSNP:780597852
1660 1660 c, t dbSNP:111867665
1661 1661 a, g dbSNP:1800377
1663 1663 c, g dbSNP:777355555
1669 1669 c, t dbSNP:756364693
1672 1672 a, c, g, t dbSNP:770754230
1673 1673 c, g dbSNP:751311885
1676 1676 a, c dbSNP:766183710
1682 1682 c, g dbSNP:763102998
1683 1683 a, g dbSNP:761973219
1685 1685 g, t dbSNP:776723859
1687 1687 a, c dbSNP:764099274
1690 1690 c, t dbSNP:761181476
1691 1691 c, t dbSNP:186112213
1692 1692 a, g dbSNP:772554807
1696 1696 c, g dbSNP:569669757
1700 1700 a, c, t dbSNP:199771680
1701 1701 a, g, t dbSNP:1800378
1702 1702 a, t dbSNP:147913451
1706 1706 a, g dbSNP:372734168
1709 1709 a, g dbSNP:535991479
1710 1710 c, t dbSNP:780016761
1711 1711 a, g dbSNP:369933210
1713 1713 c, g dbSNP:144817575
1717 1717 c, t dbSNP:377066810
1718 1718 a, g dbSNP:757446283
1720 1720 c, g dbSNP:547046344
1721 1721 c, t dbSNP:372904370
1722 1722 a, g dbSNP:553537150
1726 1726 c, t dbSNP:551665619
1729 1729 -, c dbSNP:779876879
1732 1732 c, t dbSNP:760898182
1733 1733 a, g dbSNP:369852695
1734 1734 g, t dbSNP:768176218
1737 1737 a, t dbSNP:760147730
1747 1747 c, g dbSNP:774725519
1749 1749 c, t dbSNP:771212649
1758 1758 a, t dbSNP:761461711
1763 1763 c, t dbSNP:776211220
1764 1764 a, g dbSNP:139830291
1765 1765 c, t dbSNP:377198574
1766 1766 a, g dbSNP:201456647
1767 1767 a, g dbSNP:771947987
1769 1769 a, g dbSNP:189409574
1774 1774 a, g dbSNP:778706749
1777 1777 a, g dbSNP:757070653
1780 1780 a, g dbSNP:754080208
1798 1798 c, t dbSNP:1800379
1801 1801 a, c, g, t dbSNP:142956629
1802 1802 g, t dbSNP:767005834
1812 1812 c, g dbSNP:148591481
1813 1813 c, t dbSNP:575601321
1821 1821 a, g dbSNP:772428931
1823 1823 a, g dbSNP:267607306
1825 1825 a, g, t dbSNP:749268075
1833 1833 a, g dbSNP:61754010
1840 1840 a, c dbSNP:769713195
1844 1844 c, g dbSNP:200291678
1846 1846 c, g, t dbSNP:111240043
1856 1856 c, t dbSNP:377501452
1860 1860 -, c dbSNP:35879738
1860 1860 c, t dbSNP:747097782
1861 1861 a, c, t dbSNP:769666818
1862 1862 c, t dbSNP:758774591
1863 1863 a, c, g, t dbSNP:139196998
1864 1864 -, c dbSNP:758131794
1864 1864 c, t dbSNP:138268387
1866 1866 c, t dbSNP:767200162
1867 1867 c, t dbSNP:759260751
1873 1873 c, g dbSNP:750981698
1874 1874 a, g dbSNP:765922774
1875 1875 c, g dbSNP:141649383
1876 1876 a, c, g dbSNP:35365059
1879 1879 a, g dbSNP:769698846
1881 1881 c, t dbSNP:761746851
1884 1884 c, g dbSNP:776960730
1885 1885 c, g dbSNP:768712780
1886 1886 g, t dbSNP:747270990
1888 1888 a, g dbSNP:370416209
1897 1897 -, g dbSNP:34625593
1898 1898 a, g dbSNP:61754011
1904 1904 a, g dbSNP:779932077
1907 1907 -, t dbSNP:267607307
1910 1910 a, c dbSNP:772261688
1913 1913 c, g, t dbSNP:779449782
1918 1918 c, t dbSNP:531761442
1921 1921 c, g dbSNP:754165419
1924 1924 c, t dbSNP:778129607
1929 1929 a, g dbSNP:754526458
1931 1931 a, g, t dbSNP:376162697
1940 1940 a, c dbSNP:762581251
1943 1943 c, g dbSNP:750364485
1946 1946 -, c dbSNP:745667020
1956 1956 c, t dbSNP:765304952
1959 1959 c, g dbSNP:61754013
1961 1961 c, g dbSNP:761871643
1972 1972 a, g dbSNP:368329035
1973 1973 c, g dbSNP:768503443
1978 1978 g, t dbSNP:150146744
1980 1980 c, g dbSNP:759780661
1989 1989 c, g dbSNP:774353488
1990 1990 c, t dbSNP:770999203
1993 1993 a, g dbSNP:749787965
1998 1998 a, c dbSNP:773824205
1999 1999 a, g dbSNP:770030713
2002 2002 c, t dbSNP:748584672
2003 2003 a, g dbSNP:141777100
2004 2004 a, c dbSNP:758074950
2020 2020 c, g dbSNP:745521318
2026 2026 c, t dbSNP:370058863
2031 2031 c, g dbSNP:267607308
2039 2039 c, t dbSNP:756887965
2044 2044 c, g, t dbSNP:35302737
2045 2045 g, t dbSNP:756040607
2048 2048 a, t dbSNP:752491954
2056 2056 a, g dbSNP:767226175
2060 2060 c, t dbSNP:759684646
2066 2066 c, t dbSNP:759819747
2067 2067 a, g dbSNP:200586078
2068 2068 a, g dbSNP:766430886
2080 2080 a, c, t dbSNP:61754015
2084 2084 g, t dbSNP:562188657
2086 2086 a, g dbSNP:770295213
2091 2091 c, g, t dbSNP:776987924
2098 2098 c, g, t dbSNP:372835093
2108 2108 c, g, t dbSNP:61754016
2119 2119 c, g dbSNP:61754017
2120 2120 a, g dbSNP:542226383
2121 2121 a, g dbSNP:756800153
2123 2123 -, gcg dbSNP:61754018
2134 2134 c, t dbSNP:34237676
2142 2142 c, t dbSNP:199963222
2144 2144 a, g dbSNP:777174824
2151 2151 c, t dbSNP:761282513
2161 2161 c, t dbSNP:752577539
2164 2164 a, g dbSNP:780957241
2165 2165 c, t dbSNP:546850070
2172 2172 c, t dbSNP:61754019
2176 2176 a, g dbSNP:61754666
2180 2180 g, t dbSNP:61748460
2190 2190 a, g dbSNP:762909392
2191 2191 a, c dbSNP:773299242
2208 2208 c, t dbSNP:11064012
2209 2209 a, g dbSNP:779846741
2212 2212 a, g dbSNP:758588093
2214 2214 a, g dbSNP:750678981
2215 2215 c, t dbSNP:765347068
2217 2217 a, g dbSNP:527703280
2219 2219 c, g dbSNP:754367354
2223 2223 a, c dbSNP:764659038
2224 2224 c, t dbSNP:761288966
2233 2233 c, t dbSNP:775943373
2234 2234 a, g dbSNP:772573308
2237 2237 a, c dbSNP:762658939
2238 2238 c, t dbSNP:772793595
2241 2241 c, t dbSNP:202186148
2245 2245 c, t dbSNP:747649578
2247 2247 a, c dbSNP:780709880
2252 2252 a, c dbSNP:201886182
2258 2258 c, t dbSNP:746961815
2263 2263 g, t dbSNP:779757026
2266 2266 -, ctct dbSNP:61748462
2269 2269 -, ct dbSNP:371126726
2270 2270 c, t dbSNP:758185902
2274 2274 c, t dbSNP:200087139
2275 2275 a, g dbSNP:779045480
2277 2277 a, g dbSNP:772709356
2282 2282 a, g dbSNP:267603620
2291 2291 a, g dbSNP:757532502
2295 2295 c, t dbSNP:753922791
2298 2298 a, g dbSNP:764286793
2300 2300 c, t dbSNP:756626693
2305 2305 a, g dbSNP:753318543
2308 2308 c, t dbSNP:767906888
2312 2312 c, t dbSNP:759864277
2317 2317 a, c, t dbSNP:764755360
2320 2320 a, c dbSNP:761476221
2321 2321 a, c dbSNP:199623726
2322 2322 a, c dbSNP:768159207
2322 2322 -, c dbSNP:267607309
2326 2326 c, g dbSNP:746935989
2329 2329 c, g dbSNP:776879238
2331 2331 a, t dbSNP:771871090
2343 2343 a, g dbSNP:745612376
2344 2344 a, g dbSNP:141590700
2346 2346 a, g dbSNP:778794495
2348 2348 c, g, t dbSNP:377672051
2353 2353 c, g, t dbSNP:78995469
2354 2354 a, g, t dbSNP:767946240
2358 2358 c, g, t dbSNP:377240952
2359 2359 c, t dbSNP:766778121
2363 2363 a, g dbSNP:761387526
2366 2366 c, t dbSNP:61748463
2374 2374 -, ct dbSNP:61748464
2384 2384 a, g dbSNP:372280803
2386 2386 c, t dbSNP:146468788
2388 2388 a, g dbSNP:760218536
2396 2396 a, g, t dbSNP:771858185
2407 2407 -, a dbSNP:62643628
2408 2408 a, g dbSNP:745833693
2414 2414 g, t dbSNP:773954330
2423 2423 c, t dbSNP:770830710
2426 2426 c, t dbSNP:369273301
2433 2433 c, t dbSNP:749503392
2444 2444 a, g dbSNP:770089534
2449 2449 c, t dbSNP:200848454
2457 2457 c, t dbSNP:149168790
2459 2459 c, t dbSNP:748413451
2469 2469 c, t dbSNP:781064814
2470 2470 a, g dbSNP:2228317
2482 2482 c, t dbSNP:186850965
2483 2483 a, g dbSNP:367811486
2500 2500 a, c, t dbSNP:765691813
2503 2503 g, t dbSNP:779264540
2514 2514 g, t dbSNP:755699566
2517 2517 c, g dbSNP:752465256
2519 2519 -, ct dbSNP:61748465
2519 2519 c, g dbSNP:540645545
2522 2522 a, t dbSNP:759131281
2523 2523 a, c dbSNP:751417437
2528 2528 c, t dbSNP:61748466
2529 2529 a, g dbSNP:61748467
2532 2532 a, g dbSNP:77853528
2534 2534 a, g dbSNP:267607310
2537 2537 a, g dbSNP:61748469
2541 2541 a, g dbSNP:761717107
2542 2542 a, c dbSNP:776321440
2545 2545 a, g dbSNP:150043098
2548 2548 c, g dbSNP:760819654
2552 2552 c, t dbSNP:775479826
2553 2553 a, g dbSNP:772203447
2555 2555 a, c, t dbSNP:143145764
2558 2558 c, t dbSNP:149051646
2560 2560 -, c dbSNP:776747320
2562 2562 c, t dbSNP:199588249
2563 2563 g, t dbSNP:61748470
2567 2567 a, c dbSNP:778023824
2581 2581 c, t dbSNP:754603154
2582 2582 a, g dbSNP:146892641
2586 2586 a, g dbSNP:779708332
2589 2589 a, g dbSNP:756566834
2590 2590 c, g dbSNP:143904314
2591 2591 c, t dbSNP:189056533
2594 2594 c, t dbSNP:61748471
2595 2595 a, c, g dbSNP:61748472
2604 2604 a, g dbSNP:61748473
2608 2608 c, g dbSNP:201435268
2609 2609 a, g dbSNP:61748474
2612 2612 c, t dbSNP:61748475
2613 2613 a, g dbSNP:61748476
2615 2615 a, c, g dbSNP:1063856
2621 2621 a, g dbSNP:767559740
2622 2622 c, t dbSNP:61748477
2631 2631 a, c dbSNP:759648147
2634 2634 a, g dbSNP:61748478
2635 2635 c, t dbSNP:1063857
2636 2636 a, g dbSNP:771423537
2638 2638 a, c dbSNP:763386439
2639 2639 c, t dbSNP:374016797
2647 2647 c, t dbSNP:377151690
2648 2648 a, g, t dbSNP:61748479
2659 2659 c, g dbSNP:369828268
2661 2661 g, t dbSNP:62643630
2680 2680 c, t dbSNP:746648486
2681 2681 c, t dbSNP:779902513
2685 2685 -, c dbSNP:768730800
2685 2685 -, c dbSNP:62643632
2685 2685 c, t dbSNP:62643631
2686 2686 a, g dbSNP:745322229
2688 2688 -, g dbSNP:758895722
2688 2688 a, g dbSNP:778299428
2689 2689 c, t dbSNP:757149909
2690 2690 a, g dbSNP:753783777
2693 2693 a, g dbSNP:777607730
2696 2696 c, t dbSNP:121964894
2697 2697 a, g dbSNP:62643634
2700 2700 a, g dbSNP:752443680
2701 2701 a, t dbSNP:57950734
2716 2716 a, g dbSNP:755129782
2727 2727 a, g dbSNP:368825064
2728 2728 c, g dbSNP:374958989
2740 2740 c, g, t dbSNP:750911635
2747 2747 a, g dbSNP:151048762
2759 2759 a, g dbSNP:561063693
2760 2760 a, c dbSNP:75645183
2763 2763 c, t dbSNP:149520234
2765 2765 -, g dbSNP:61748481
2766 2766 -, g dbSNP:747151839
2774 2774 a, g dbSNP:759248794
2775 2775 a, t dbSNP:773921894
2786 2786 g, t dbSNP:200106723
2790 2790 -, a dbSNP:267607311
2790 2790 a, g dbSNP:748704250
2796 2796 g, t dbSNP:772796741
2804 2804 c, g, t dbSNP:772534075
2805 2805 a, g dbSNP:216321
2810 2810 c, t dbSNP:61748482
2811 2811 a, g dbSNP:41276738
2818 2818 c, g dbSNP:768410690
2820 2820 a, g dbSNP:765163545
2823 2823 g, t dbSNP:61748484
2824 2824 c, g dbSNP:184227165
2825 2825 a, g dbSNP:371017187
2833 2833 c, t dbSNP:758482771
2836 2836 a, g, t dbSNP:34510401
2841 2841 a, g dbSNP:146405753
2842 2842 c, t dbSNP:754363142
2845 2845 c, t dbSNP:764652954
2848 2848 a, g dbSNP:756662315
2853 2853 c, g, t dbSNP:376980353
2855 2855 a, g dbSNP:767931609
2857 2857 a, g dbSNP:762512650
2860 2860 c, t dbSNP:141982646
2861 2861 a, g dbSNP:148122508
2866 2866 a, g dbSNP:761354900
2876 2876 c, t dbSNP:143762054
2881 2881 c, t dbSNP:768430494
2882 2882 a, t dbSNP:148969007
2884 2884 c, t dbSNP:113240752
2885 2885 a, g dbSNP:61748485
2888 2888 a, g dbSNP:771958869
2891 2891 -, c dbSNP:61748486
2891 2891 c, g dbSNP:746053613
2892 2892 c, t dbSNP:779314631
2901 2901 g, t dbSNP:146850658
2902 2902 a, g dbSNP:749328757
2903 2903 c, t dbSNP:760242174
2904 2904 c, t dbSNP:11064002
2906 2906 c, t dbSNP:141451322
2909 2909 a, g dbSNP:756515188
2912 2912 c, g dbSNP:373780244
2923 2923 a, c dbSNP:753317915
2924 2924 a, g dbSNP:201072235
2931 2931 -, t dbSNP:748924210
2944 2944 c, t dbSNP:201892996
2945 2945 a, g dbSNP:142135013
2947 2947 c, g, t dbSNP:747325784
2948 2948 a, g dbSNP:780411422
2950 2950 c, t dbSNP:756897461
2953 2953 a, c dbSNP:753545906
2954 2954 c, g dbSNP:763488500
2965 2965 c, t dbSNP:755688033
2966 2966 c, t dbSNP:752176819
2967 2967 a, g, t dbSNP:542975251
2968 2968 g, t dbSNP:774219233
2974 2974 a, g dbSNP:766346430
2977 2977 a, g dbSNP:763257958
2984 2984 -, t dbSNP:61748490
2986 2986 c, g dbSNP:773534134
2989 2989 a, c, t dbSNP:35191786
2994 2994 a, g dbSNP:776598010
3018 3018 a, g dbSNP:769093954
3020 3020 c, t dbSNP:61748491
3021 3021 a, g dbSNP:33978901
3023 3023 a, g dbSNP:758811865
3025 3025 c, t dbSNP:369167738
3035 3035 a, g dbSNP:376037865
3041 3041 a, g dbSNP:777440637
3045 3045 a, g dbSNP:755741472
3051 3051 c, t dbSNP:142563352
3053 3053 a, g dbSNP:752191528
3064 3064 c, t dbSNP:139622018
3065 3065 a, g dbSNP:147408448
3079 3079 a, g dbSNP:760704953
3089 3089 a, g dbSNP:142861582
3090 3090 g, t dbSNP:772506779
3113 3113 a, g, t dbSNP:374622681
3118 3118 a, g dbSNP:771255305
3128 3128 c, g, t dbSNP:370984712
3129 3129 c, g dbSNP:781033577
3130 3130 a, g dbSNP:1800380
3145 3145 c, g dbSNP:144225315
3149 3149 a, g dbSNP:149573046
3150 3150 a, g dbSNP:141087261
3151 3151 c, t dbSNP:758288938
3156 3156 c, t dbSNP:202175420
3163 3163 a, c, t dbSNP:372588372
3164 3164 a, g dbSNP:150418484
3176 3176 c, t dbSNP:764251476
3177 3177 a, g dbSNP:181452677
3186 3186 a, c, g dbSNP:267607312
3188 3188 a, g dbSNP:767647904
3193 3193 c, t dbSNP:369031938
3194 3194 a, c, g dbSNP:376548659
3216 3216 a, g dbSNP:763191895
3223 3223 a, g dbSNP:760392989
3235 3235 c, g dbSNP:775320140
3236 3236 g, t dbSNP:61748493
3250 3250 c, t dbSNP:771785483
3258 3258 a, c, g dbSNP:141477932
3263 3263 a, g dbSNP:367549408
3264 3264 a, g dbSNP:749285654
3271 3271 c, t dbSNP:777527681
3272 3272 a, g dbSNP:138940478
3273 3273 a, c, t dbSNP:374126602
3274 3274 c, t dbSNP:755254180
3279 3279 a, g dbSNP:751539842
3280 3280 c, g dbSNP:766485706
3290 3290 a, g dbSNP:758969074
3299 3299 a, g dbSNP:751031390
3302 3302 c, t dbSNP:765676204
3303 3303 c, g dbSNP:534377998
3316 3316 a, g dbSNP:777156745
3321 3321 c, t dbSNP:767019732
3322 3322 -, c dbSNP:267607313
3336 3336 c, t dbSNP:572012161
3337 3337 a, g dbSNP:372073860
3339 3339 a, g dbSNP:145125264
3340 3340 g, t dbSNP:762852594
3342 3342 a, g dbSNP:141412860
3345 3345 c, t dbSNP:531867007
3349 3349 -, gac dbSNP:752219725
3351 3351 -, cca dbSNP:368366214
3353 3353 a, g dbSNP:146648301
3368 3368 g, t dbSNP:747177751
3375 3375 c, t dbSNP:571875867
3379 3379 -, tgcca dbSNP:750783538
3383 3383 a, c dbSNP:780365988
3390 3390 a, g dbSNP:772443177
3394 3394 c, t dbSNP:201874365
3396 3396 -, aca dbSNP:765654021
3409 3409 g, t dbSNP:61748496
3411 3411 c, t dbSNP:757834200
3412 3412 a, g dbSNP:754421736
3413 3413 a, g dbSNP:777974061
3425 3425 c, t dbSNP:374339543
3428 3428 c, t dbSNP:61748497
3429 3429 a, g dbSNP:267607314
3429 3429 -, g dbSNP:762105711
3431 3431 a, g dbSNP:753032917
3439 3439 -, t dbSNP:776853073
3441 3441 a, c dbSNP:143024162
3442 3442 c, t dbSNP:762611094
3449 3449 a, g dbSNP:749872924
3451 3451 c, g dbSNP:764799214
3458 3458 a, g dbSNP:761643822
3462 3462 g, t dbSNP:267607315
3466 3466 c, t dbSNP:776680647
3472 3472 a, g dbSNP:763767613
3477 3477 a, c dbSNP:764705104
3480 3480 c, g dbSNP:756834308
3481 3481 c, g, t dbSNP:764032940
3482 3482 -, g dbSNP:764226459
3482 3482 a, g dbSNP:267607316
3487 3487 a, g dbSNP:760532696
3490 3490 c, t dbSNP:4021576
3495 3495 a, g dbSNP:767478373
3501 3501 a, g dbSNP:759805079
3502 3502 -, c dbSNP:760804402
3508 3508 c, t dbSNP:112634786
3509 3509 a, g dbSNP:771087646
3514 3514 c, t dbSNP:749337729
3519 3519 c, t dbSNP:529227474
3520 3520 -, c dbSNP:775596301
3531 3531 c, t dbSNP:267607317
3536 3536 a, g dbSNP:748673885
3541 3541 c, t dbSNP:149895348
3542 3542 a, g dbSNP:755385279
3551 3551 c, g, t dbSNP:202034414
3553 3553 c, g, t dbSNP:267607318
3554 3554 a, g dbSNP:778499185
3557 3557 a, c dbSNP:113805591
3570 3570 a, g dbSNP:267607319
3571 3571 c, t dbSNP:199851395
3576 3576 a, g dbSNP:756884497
3577 3577 c, t dbSNP:753321680
3578 3578 a, g dbSNP:763577959
3579 3579 a, t dbSNP:756064548
3580 3580 g, t dbSNP:564250853
3582 3582 a, g dbSNP:267607320
3589 3589 c, g dbSNP:543974370
3598 3598 a, g dbSNP:767386475
3601 3601 a, g dbSNP:759362230
3606 3606 c, t dbSNP:751419967
3609 3609 c, g dbSNP:267607321
3615 3615 c, t dbSNP:183119284
3616 3616 a, g dbSNP:373172467
3620 3620 a, g dbSNP:763092699
3625 3625 a, g, t dbSNP:769825878
3629 3629 c, t dbSNP:139579968
3635 3635 -, ag dbSNP:267607322
3638 3638 c, g, t dbSNP:267607323
3639 3639 g, t dbSNP:267607324
3664 3664 c, t dbSNP:560397436
3676 3676 c, t dbSNP:535693463
3680 3680 g, t dbSNP:267607325
3687 3687 a, g dbSNP:267607326
3695 3695 c, t dbSNP:61748511
3710 3710 c, t dbSNP:267607327
3717 3717 c, t dbSNP:267607328
3720 3720 g, t dbSNP:267607329
3735 3735 c, t dbSNP:566672558
3736 3736 a, g dbSNP:546732699
3761 3761 c, g dbSNP:267607330
3788 3788 a, g dbSNP:267607332
3789 3789 a, g, t dbSNP:780855722
3790 3790 a, g, t dbSNP:751606322
3797 3797 c, g dbSNP:147818186
3799 3799 c, g dbSNP:144447692
3808 3808 g, t dbSNP:3741908
3812 3812 a, c dbSNP:758171853
3818 3818 c, t dbSNP:61749364
3820 3820 c, t dbSNP:372114325
3821 3821 a, g dbSNP:368327275
3829 3829 c, g, t dbSNP:16933969
3833 3833 g, t dbSNP:374591991
3836 3836 c, t dbSNP:61749365
3838 3838 g, t dbSNP:761144403
3840 3840 c, t dbSNP:372171661
3844 3844 a, g, t dbSNP:368522060
3855 3855 c, t dbSNP:759769683
3858 3858 a, g dbSNP:774790905
3860 3860 c, t dbSNP:769502210
3863 3863 c, t dbSNP:373787920
3864 3864 a, g, t dbSNP:121964895
3869 3869 g, t dbSNP:776268929
3872 3872 c, t dbSNP:768331524
3898 3898 c, g dbSNP:565199357
3904 3904 c, g dbSNP:746935137
3916 3916 c, t dbSNP:779819811
3923 3923 g, t dbSNP:267607333
3929 3929 c, t dbSNP:61749366
3935 3935 a, g dbSNP:771840215
3936 3936 g, t dbSNP:61749367
3942 3942 a, c, g dbSNP:61749368
3944 3944 c, t dbSNP:749109451
3946 3946 c, t dbSNP:777922408
3952 3952 g, t dbSNP:61749369
3957 3957 c, t dbSNP:756371665
3963 3963 -, a dbSNP:774296321
3969 3969 c, t dbSNP:150576611
3970 3970 a, c, g dbSNP:141792415
3978 3978 c, t dbSNP:752162086
3979 3979 c, g dbSNP:766820467
3981 3981 c, t dbSNP:540839573
3985 3985 a, g, t dbSNP:148499318
3986 3986 c, t dbSNP:763785588
3994 3994 a, g dbSNP:760382496
3996 3996 a, t dbSNP:780840625
3997 3997 c, t dbSNP:200893595
3999 3999 c, g, t dbSNP:144691240
4002 4002 c, t dbSNP:770872838
4003 4003 a, c, g dbSNP:527609551
4004 4004 c, g dbSNP:769901328
4012 4012 c, t dbSNP:748462325
4023 4023 a, g dbSNP:781111573
4031 4031 a, g dbSNP:755127078
4032 4032 a, g dbSNP:751720834
4033 4033 c, t dbSNP:780663180
4038 4038 c, t dbSNP:758991219
4039 4039 a, g dbSNP:199831474
4044 4044 c, t dbSNP:765703178
4045 4045 a, g dbSNP:2228319
4045 4045 a, g dbSNP:386561681
4047 4047 a, c, t dbSNP:61749370
4048 4048 a, g dbSNP:759033374
4052 4052 a, c, g dbSNP:61749371
4054 4054 c, t dbSNP:773863759
4055 4055 a, g dbSNP:770786924
4064 4064 -, atttctact dbSNP:63524160
4064 4064 c, g, t dbSNP:61749372
4065 4065 c, g, t dbSNP:63524161
4073 4073 a, c dbSNP:762943129
4075 4075 a, g dbSNP:772976020
4077 4077 c, t dbSNP:61749374
4081 4081 -, cct dbSNP:61749375
4085 4085 a, g, t dbSNP:61749376
4087 4087 c, t dbSNP:748289333
4093 4093 g, t dbSNP:781436640
4095 4095 -, tcctgct dbSNP:61749377
4095 4095 g, t dbSNP:61749378
4103 4103 c, t dbSNP:61749379
4104 4104 c, t dbSNP:61749380
4111 4111 a, g dbSNP:542759684
4112 4112 c, t dbSNP:768784024
4113 4113 g, t dbSNP:267607334
4114 4114 g, t dbSNP:747032800
4117 4117 c, t dbSNP:375398751
4118 4118 a, g dbSNP:138900040
4127 4127 c, t dbSNP:267607335
4134 4134 c, t dbSNP:746438161
4137 4137 c, t dbSNP:61749381
4143 4143 c, t dbSNP:554436297
4144 4144 c, t dbSNP:757599733
4148 4148 g, t dbSNP:754172743
4155 4155 a, g dbSNP:61749382
4160 4160 a, g dbSNP:267607336
4161 4161 c, t dbSNP:767135898
4162 4162 -, atg dbSNP:61749383
4166 4166 c, t dbSNP:61749384
4167 4167 a, g, t dbSNP:61749385
4170 4170 c, t dbSNP:61749386
4172 4172 c, t dbSNP:61749387
4173 4173 a, c, g, t dbSNP:61749388
4174 4174 c, t dbSNP:765929946
4175 4175 a, g dbSNP:61749389
4179 4179 c, t dbSNP:61749390
4181 4181 a, c, t dbSNP:267607337
4189 4189 c, g dbSNP:61749392
4190 4190 c, g, t dbSNP:61749393
4191 4191 a, t dbSNP:61749394
4193 4193 c, t dbSNP:61749395
4194 4194 a, g, t dbSNP:61749396
4195 4195 c, t dbSNP:143009893
4196 4196 a, c, g dbSNP:61749397
4201 4201 c, t dbSNP:561155315
4202 4202 a, g dbSNP:372028373
4214 4214 c, t dbSNP:775702030
4216 4216 c, t dbSNP:772315276
4217 4217 a, g dbSNP:369628563
4219 4219 a, c, t dbSNP:558167224
4220 4220 a, g dbSNP:61749398
4221 4221 c, g dbSNP:61749399
4224 4224 c, t dbSNP:538488005
4228 4228 c, t dbSNP:568918496
4229 4229 a, g dbSNP:751260845
4230 4230 c, t dbSNP:765845488
4235 4235 a, g dbSNP:757866123
4237 4237 c, g, t dbSNP:138413641
4238 4238 a, g dbSNP:548929810
4246 4246 a, g dbSNP:776485375
4247 4247 a, g dbSNP:764041417
4250 4250 c, t dbSNP:746810319
4251 4251 a, g dbSNP:775812331
4258 4258 a, t dbSNP:529365979
4260 4260 c, t dbSNP:61749400
4261 4261 a, g dbSNP:1800381
4262 4262 g, t dbSNP:771464323
4263 4263 c, g dbSNP:61749401
4271 4271 c, t dbSNP:61749402
4272 4272 a, c, g, t dbSNP:61749403
4274 4274 c, t dbSNP:61749404
4275 4275 a, g dbSNP:527483960
4276 4276 c, g dbSNP:748544746
4277 4277 a, g dbSNP:150923481
4279 4279 a, t dbSNP:758060480
4285 4285 c, t dbSNP:565230241
4286 4286 c, t dbSNP:61749405
4287 4287 a, g dbSNP:778358708
4292 4292 a, g dbSNP:757208857
4294 4294 a, g dbSNP:753772379
4299 4299 c, t dbSNP:764155969
4300 4300 a, g dbSNP:143459496
4309 4309 g, t dbSNP:752550181
4312 4312 a, g dbSNP:767777214
4315 4315 c, g dbSNP:759742994
4320 4320 c, g dbSNP:774476528
4324 4324 c, t dbSNP:531603223
4325 4325 a, g dbSNP:61749407
4329 4329 c, t dbSNP:267607338
4330 4330 c, t dbSNP:562489969
4332 4332 c, t dbSNP:61749408
4333 4333 a, g dbSNP:748454636
4335 4335 a, c dbSNP:61750067
4340 4340 a, t dbSNP:781543243
4342 4342 -, ac dbSNP:61750068
4342 4342 a, g dbSNP:375193686
4344 4344 a, t dbSNP:745569482
4345 4345 a, g, t dbSNP:756761688
4348 4348 c, g dbSNP:753407706
4352 4352 a, g dbSNP:199703097
4353 4353 c, t dbSNP:199675425
4355 4355 a, t dbSNP:61750069
4357 4357 c, t dbSNP:756121534
4365 4365 g, t dbSNP:61750070
4366 4366 c, t dbSNP:767476789
4370 4370 a, c, t dbSNP:61750071
4371 4371 a, g, t dbSNP:61750072
4373 4373 c, t dbSNP:751767496
4380 4380 c, t dbSNP:141211612
4383 4383 c, t dbSNP:61750073
4385 4385 c, t dbSNP:61750074
4386 4386 a, g dbSNP:773292982
4388 4388 a, g dbSNP:11063988
4390 4390 c, t dbSNP:762377320
4391 4391 a, g dbSNP:216311
4393 4393 c, t dbSNP:768953693
4396 4396 g, t dbSNP:140464171
4397 4397 c, t dbSNP:773823592
4398 4398 c, g, t dbSNP:61750075
4414 4414 a, g dbSNP:770628259
4417 4417 a, c, g dbSNP:201895432
4423 4423 -, acggatgtcccggaactttgtccgctacgtcca dbSNP:63749069
4423 4423 a, g dbSNP:145009516
4424 4424 a, c, t dbSNP:555891676
4427 4427 a, g dbSNP:781101010
4432 4432 c, t dbSNP:139215659
4433 4433 c, t dbSNP:751394243
4434 4434 a, g dbSNP:766456147
4436 4436 a, c dbSNP:758651560
4437 4437 a, t dbSNP:750498610
4445 4445 c, t dbSNP:61750077
4446 4446 a, g dbSNP:1800382
4448 4448 c, t dbSNP:777165972
4449 4449 a, g dbSNP:764695443
4450 4450 c, t dbSNP:760887338
4451 4451 a, g dbSNP:536484748
4456 4456 a, g dbSNP:368639720
4472 4472 -, aag dbSNP:61750078
4472 4472 a, c, g dbSNP:141990425
4477 4477 a, c dbSNP:769467272
4480 4480 c, t dbSNP:747690875
4485 4485 c, t dbSNP:780941826
4488 4488 c, t dbSNP:61750079
4489 4489 a, g dbSNP:746717649
4494 4494 a, g dbSNP:61750080
4497 4497 a, t dbSNP:61750081
4505 4505 a, c, t dbSNP:375498783
4507 4507 g, t dbSNP:569177726
4508 4508 a, g dbSNP:765274536
4513 4513 c, g dbSNP:61750082
4518 4518 a, g dbSNP:757291698
4523 4523 a, t dbSNP:61750083
4526 4526 a, c, t dbSNP:555366738
4527 4527 g, t dbSNP:761308466
4529 4529 c, g dbSNP:752988023
4531 4531 c, t dbSNP:140077306
4532 4532 a, g dbSNP:762661828
4534 4534 c, t dbSNP:772959925
4535 4535 a, g dbSNP:371554756
4536 4536 a, g dbSNP:761350219
4544 4544 a, g dbSNP:764656927
4554 4554 a, g dbSNP:11063987
4557 4557 a, g, t dbSNP:761133732
4559 4559 a, g dbSNP:61750084
4565 4565 a, g dbSNP:150077670
4589 4589 c, g dbSNP:61750085
4594 4594 a, g dbSNP:546773767
4603 4603 c, t dbSNP:367638908
4604 4604 a, g dbSNP:757471243
4609 4609 c, t dbSNP:572962707
4610 4610 a, g dbSNP:533417176
4616 4616 g, t dbSNP:756553861
4618 4618 a, c, g dbSNP:61750086
4623 4623 a, g dbSNP:61750087
4628 4628 c, g, t dbSNP:61750088
4632 4632 a, c, t dbSNP:61750089
4634 4634 c, g dbSNP:61750090
4639 4639 a, c dbSNP:759931005
4641 4641 c, t dbSNP:751985873
4643 4643 c, t dbSNP:764916576
4649 4649 c, t dbSNP:61750091
4658 4658 c, t dbSNP:761625938
4660 4660 c, g dbSNP:775992080
4661 4661 a, c dbSNP:768264558
4663 4663 c, t dbSNP:374092740
4664 4664 -, c dbSNP:267607339
4664 4664 c, g, t dbSNP:1800383
4665 4665 -, g dbSNP:61750093
4673 4673 c, t dbSNP:61750094
4681 4681 c, t dbSNP:531665985
4689 4689 c, t dbSNP:778742589
4690 4690 a, g dbSNP:771126175
4693 4693 g, t dbSNP:144796763
4701 4701 a, g dbSNP:267603619
4702 4702 a, g dbSNP:777683033
4703 4703 -, g dbSNP:61750095
4707 4707 c, t dbSNP:149424724
4708 4708 a, g dbSNP:138966048
4716 4716 g, t dbSNP:781740850
4718 4718 c, t dbSNP:755546877
4731 4731 c, t dbSNP:751967839
4736 4736 a, g dbSNP:766910271
4739 4739 c, t dbSNP:756949464
4749 4749 a, c, t dbSNP:61750096
4750 4750 a, g dbSNP:560049911
4753 4753 c, t dbSNP:760188056
4754 4754 a, g dbSNP:774879567
4758 4758 a, c, g, t dbSNP:61750097
4763 4763 c, g dbSNP:61750098
4764 4764 a, g dbSNP:61750099
4765 4765 a, g, t dbSNP:370799437
4767 4767 c, t dbSNP:61750100
4768 4768 a, g dbSNP:146928422
4776 4776 c, t dbSNP:770750061
4777 4777 c, t dbSNP:141174823
4786 4786 c, t dbSNP:773433634
4787 4787 a, g dbSNP:769921684
4791 4791 g, t dbSNP:61750101
4798 4798 a, g dbSNP:577629495
4802 4802 a, g dbSNP:61750102
4812 4812 c, t dbSNP:781489378
4820 4820 -, g dbSNP:61750103
4826 4826 c, t dbSNP:267603618
4827 4827 a, g dbSNP:755528551
4829 4829 c, t dbSNP:747570522
4830 4830 a, g dbSNP:780538558
4834 4834 g, t dbSNP:564544500
4835 4835 a, c, g dbSNP:138670575
4840 4840 a, g, t dbSNP:752185839
4846 4846 a, g dbSNP:767060922
4847 4847 c, g dbSNP:759435371
4849 4849 a, c dbSNP:774230893
4850 4850 a, g dbSNP:766324620
4854 4854 -, tccacgtca dbSNP:267607340
4858 4858 c, t dbSNP:544376688
4859 4859 a, g dbSNP:772887330
4863 4863 c, t dbSNP:377512022
4864 4864 a, g dbSNP:748377348
4866 4866 a, t dbSNP:267607341
4869 4869 c, t dbSNP:267607342
4876 4876 c, g dbSNP:267607343
4878 4878 c, t dbSNP:267607344
4885 4885 -, g dbSNP:267607345
4886 4886 c, g dbSNP:776831620
4887 4887 -, tgactgtgg dbSNP:267607346
4891 4891 c, t dbSNP:216310
4895 4895 a, g dbSNP:267607347
4898 4898 c, t dbSNP:747120629
4901 4901 a, c, t dbSNP:186559034
4906 4906 c, t dbSNP:746181055
4908 4908 a, g dbSNP:779199328
4909 4909 c, t dbSNP:375675510
4910 4910 a, g dbSNP:752384122
4911 4911 a, g dbSNP:182250388
4915 4915 a, c dbSNP:1800384
4917 4917 a, g dbSNP:61750110
4920 4920 c, t dbSNP:751081188
4923 4923 a, t dbSNP:766271288
4928 4928 a, g dbSNP:762864472
4931 4931 -, a dbSNP:777481512
4933 4933 a, c dbSNP:750219929
4935 4935 c, t dbSNP:61750111
4940 4940 c, t dbSNP:370854023
4943 4943 g, t dbSNP:1800385
4946 4946 c, t dbSNP:61750112
4953 4953 a, t dbSNP:267607348
4955 4955 c, t dbSNP:61909722
4956 4956 a, g dbSNP:769025840
4963 4963 g, t dbSNP:144474530
4966 4966 c, t dbSNP:199604081
4967 4967 a, g dbSNP:267607349
4971 4971 a, c dbSNP:775720629
4973 4973 a, c dbSNP:772614781
4984 4984 a, c, t dbSNP:779302623
4985 4985 a, g dbSNP:61750113
4988 4988 c, g dbSNP:61750114
4989 4989 c, t dbSNP:61750115
4990 4990 a, g dbSNP:771157496
4997 4997 c, t dbSNP:61750116
4998 4998 a, g dbSNP:538030800
5001 5001 a, g dbSNP:1800386
5007 5007 c, t dbSNP:373898451
5014 5014 c, t dbSNP:779488283
5031 5031 a, g dbSNP:758335641
5036 5036 c, g dbSNP:750369682
5037 5037 a, t dbSNP:765253214
5038 5038 c, t dbSNP:773159741
5039 5039 c, g, t dbSNP:61750117
5040 5040 a, g, t dbSNP:61750577
5042 5042 a, g dbSNP:753701755
5044 5044 a, g dbSNP:764348317
5049 5049 c, t dbSNP:376943868
5050 5050 a, g dbSNP:201264909
5058 5058 c, t dbSNP:267607350
5060 5060 g, t dbSNP:61750578
5066 5066 a, g dbSNP:549303552
5070 5070 a, t dbSNP:61750579
5074 5074 c, g, t dbSNP:142635883
5075 5075 a, g dbSNP:61750580
5085 5085 c, t dbSNP:771480690
5086 5086 c, t dbSNP:749585632
5087 5087 c, t dbSNP:61750581
5091 5091 a, g dbSNP:61750582
5098 5098 c, t dbSNP:778176378
5100 5100 a, g dbSNP:559911446
5104 5104 a, g dbSNP:372494165
5107 5107 g, t dbSNP:779585816
5119 5119 a, c dbSNP:757808009
5126 5126 g, t dbSNP:369291547
5130 5130 a, c dbSNP:61750583
5133 5133 c, t dbSNP:61750584
5135 5135 a, g dbSNP:61750585
5136 5136 -, g dbSNP:61750586
5139 5139 a, t dbSNP:61750587
5154 5154 a, t dbSNP:778661133
5155 5155 c, t dbSNP:148901164
5156 5156 a, g dbSNP:145676400
5162 5162 a, g dbSNP:61750588
5166 5166 c, t dbSNP:61750589
5167 5167 a, g dbSNP:146596289
5173 5173 a, g dbSNP:140001946
5175 5175 c, t dbSNP:752818760
5176 5176 c, t dbSNP:200147615
5189 5189 a, g dbSNP:767800116
5192 5192 c, t dbSNP:61750590
5193 5193 c, g, t dbSNP:267607351
5194 5194 c, t dbSNP:201825372
5194 5194 -, t dbSNP:61750591
5201 5201 a, c dbSNP:774492504
5203 5203 c, t dbSNP:564190961
5215 5215 a, g dbSNP:763509536
5217 5217 c, t dbSNP:773544469
5218 5218 a, g dbSNP:143838793
5219 5219 a, c dbSNP:61750592
5220 5220 a, t dbSNP:61750593
5221 5221 -, c dbSNP:61750594
5225 5225 c, t dbSNP:61750595
5226 5226 a, g dbSNP:781675955
5236 5236 c, t dbSNP:544442717
5244 5244 a, t dbSNP:61750596
5251 5251 a, g dbSNP:575428870
5254 5254 a, g, t dbSNP:61750597
5259 5259 c, g dbSNP:749273878
5263 5263 c, t dbSNP:561897849
5264 5264 a, g dbSNP:61750598
5267 5267 a, g dbSNP:752547341
5273 5273 ct, ta dbSNP:61750599
5273 5273 c, t dbSNP:767567453
5281 5281 c, t dbSNP:755292966
5285 5285 a, g dbSNP:751577332
5288 5288 c, t dbSNP:573448801
5289 5289 g, t dbSNP:397840484
5297 5297 a, g dbSNP:763419756
5299 5299 a, c, g dbSNP:200368994
5301 5301 c, g dbSNP:765757461
5315 5315 a, c dbSNP:139320345
5317 5317 c, g, t dbSNP:765667845
5323 5323 c, t dbSNP:549367616
5324 5324 a, g dbSNP:548269199
5330 5330 c, t dbSNP:764555265
5342 5342 a, g dbSNP:760973223
5349 5349 c, t dbSNP:369529543
5351 5351 a, g dbSNP:770714844
5357 5357 c, t dbSNP:534379046
5360 5360 a, g dbSNP:566275530
5363 5363 a, t dbSNP:769616393
5364 5364 c, t dbSNP:552464208
5374 5374 g, t dbSNP:780827503
5375 5375 a, g dbSNP:768448504
5379 5379 c, t dbSNP:375946218
5386 5386 a, t dbSNP:780181623
5389 5389 c, t dbSNP:150873446
5390 5390 a, g dbSNP:750486293
5393 5393 a, g dbSNP:563959776
5394 5394 a, g dbSNP:776792833
5406 5406 a, c dbSNP:74509284
5414 5414 a, g dbSNP:757670823
5415 5415 a, g dbSNP:372748722
5423 5423 c, t dbSNP:78302129
5426 5426 c, t dbSNP:751816462
5427 5427 a, g, t dbSNP:147313320
5430 5430 -, tt dbSNP:61750602
5441 5441 a, t dbSNP:61750603
5442 5442 c, t dbSNP:764077750
5443 5443 a, g dbSNP:760670000
5450 5450 c, t dbSNP:374707563
5460 5460 c, g dbSNP:771900602
5462 5462 a, g dbSNP:745681357
5466 5466 c, t dbSNP:774570138
5469 5469 c, t dbSNP:371539649
5472 5472 c, t dbSNP:749377211
5473 5473 g, t dbSNP:777783627
5476 5476 c, g, t dbSNP:748715084
5477 5477 a, g dbSNP:781770261
5485 5485 g, t dbSNP:267607352
5488 5488 c, t dbSNP:755353703
5496 5496 c, t dbSNP:751874044
5497 5497 a, g dbSNP:764884764
5499 5499 a, c dbSNP:766882631
5516 5516 a, g dbSNP:756915371
5519 5519 c, t dbSNP:376888924
5525 5525 a, g dbSNP:763549909
5527 5527 c, g, t dbSNP:41276736
5528 5528 a, c, g dbSNP:61750604
5534 5534 c, t dbSNP:774075149
5535 5535 a, g dbSNP:199729586
5537 5537 c, t dbSNP:763126601
5538 5538 a, g dbSNP:373074982
5558 5558 a, g dbSNP:769947073
5560 5560 c, t dbSNP:748269722
5561 5561 a, g dbSNP:370016586
5563 5563 g, t dbSNP:2229448
5566 5566 c, t dbSNP:765542489
5570 5570 c, t dbSNP:762190414
5571 5571 c, t dbSNP:61750605
5575 5575 c, t dbSNP:776819357
5585 5585 c, t dbSNP:61750606
5586 5586 a, g dbSNP:760828829
5588 5588 g, t dbSNP:372002214
5597 5597 g, t dbSNP:267607353
5604 5604 c, t dbSNP:150349730
5606 5606 c, g dbSNP:267607354
5609 5609 a, g dbSNP:774768100
5619 5619 c, t dbSNP:551649729
5620 5620 a, g dbSNP:71582868
5622 5622 a, g dbSNP:747848982
5630 5630 a, g dbSNP:267607355
5634 5634 c, t dbSNP:146729537
5637 5637 c, t dbSNP:754405864
5639 5639 a, g dbSNP:374312131
5644 5644 c, t dbSNP:746534666
5652 5652 c, t dbSNP:779797296
5653 5653 a, g dbSNP:367952240
5656 5656 c, t dbSNP:565224789
5663 5663 a, g dbSNP:765163531
5692 5692 c, t dbSNP:757527506
5693 5693 a, g dbSNP:754062706
5695 5695 c, g dbSNP:764404048
5703 5703 a, g dbSNP:61750608
5706 5706 a, g dbSNP:767687582
5708 5708 a, g dbSNP:759635862
5713 5713 a, g dbSNP:375662234
5715 5715 g, t dbSNP:61750609
5721 5721 a, c dbSNP:61750610
5723 5723 a, g dbSNP:372430819
5724 5724 c, t dbSNP:766877030
5732 5732 a, g dbSNP:763246893
5736 5736 a, g dbSNP:143445274
5738 5738 c, t dbSNP:768189363
5739 5739 a, g dbSNP:370511668
5742 5742 a, g dbSNP:186798928
5743 5743 c, t dbSNP:769268109
5751 5751 c, g dbSNP:745399451
5758 5758 a, g dbSNP:778923778
5760 5760 a, g dbSNP:545304154
5763 5763 c, t dbSNP:575249185
5765 5765 c, t dbSNP:141134620
5768 5768 g, t dbSNP:376350586
5769 5769 c, t dbSNP:752918966
5770 5770 a, c dbSNP:535600018
5782 5782 c, t dbSNP:754986617
5783 5783 a, g dbSNP:201548925
5790 5790 a, g dbSNP:766858874
5791 5791 c, t dbSNP:146540001
5792 5792 a, g, t dbSNP:376993019
5795 5795 a, g dbSNP:61750611
5800 5800 g, t dbSNP:775165212
5807 5807 c, t dbSNP:61750612
5812 5812 c, t dbSNP:759054869
5813 5813 a, g dbSNP:139711566
5816 5816 a, g, t dbSNP:770964353
5818 5818 c, t dbSNP:749300895
5830 5830 a, g dbSNP:777597265
5833 5833 c, t dbSNP:769595112
5836 5836 c, t dbSNP:747902510
5842 5842 c, t dbSNP:781418089
5845 5845 g, t dbSNP:755252307
5847 5847 c, t dbSNP:267603617
5850 5850 c, t dbSNP:200461577
5853 5853 c, t dbSNP:747086590
5856 5856 a, c dbSNP:780146973
5863 5863 -, g dbSNP:779575058
5874 5874 g, t dbSNP:747963607
5876 5876 a, g dbSNP:776478608
5881 5881 a, g dbSNP:144221902
5889 5889 c, t dbSNP:747278782
5890 5890 a, g dbSNP:535766882
5892 5892 a, g dbSNP:780276684
5896 5896 a, g dbSNP:758463173
5917 5917 c, g, t dbSNP:56981471
5918 5918 a, g dbSNP:746837624
5923 5923 c, g, t dbSNP:369450995
5924 5924 a, g dbSNP:745945911
5932 5932 c, t dbSNP:778924759
5937 5937 c, t dbSNP:771450152
5942 5942 c, t dbSNP:749765999
5945 5945 c, t dbSNP:559785610
5950 5950 c, t dbSNP:756483628
5953 5953 a, c, t dbSNP:779743771
5954 5954 a, g dbSNP:144757652
5963 5963 a, c dbSNP:749919428
5971 5971 a, t dbSNP:552647960
5973 5973 c, g dbSNP:761406405
5989 5989 c, g dbSNP:753735116
5994 5994 a, g, t dbSNP:532551665
5996 5996 c, t dbSNP:775318319
5997 5997 a, g dbSNP:772331230
6002 6002 a, g dbSNP:759714903
6011 6011 c, t dbSNP:563631823
6012 6012 a, g dbSNP:770879215
6014 6014 a, g dbSNP:749386904
6018 6018 c, t dbSNP:778370191
6027 6027 c, t dbSNP:375136778
6033 6033 c, g dbSNP:543952558
6035 6035 a, t dbSNP:149799233
6037 6037 c, t dbSNP:781451818
6043 6043 a, c, g dbSNP:574811308
6045 6045 c, t dbSNP:778657980
6047 6047 c, t dbSNP:372572865
6051 6051 g, t dbSNP:139845585
6056 6056 a, g dbSNP:756689204
6066 6066 a, c dbSNP:561950510
6068 6068 c, t dbSNP:764001779
6094 6094 c, t dbSNP:216902
6095 6095 a, g dbSNP:374459416
6101 6101 a, g dbSNP:144072210
6102 6102 c, t dbSNP:752540502
6104 6104 a, g dbSNP:113237579
6114 6114 c, t dbSNP:767497450
6116 6116 a, c, t dbSNP:751433166
6117 6117 a, g dbSNP:766705058
6122 6122 a, g dbSNP:763307365
6124 6124 c, t dbSNP:773406142
6125 6125 a, g dbSNP:765357873
6128 6128 a, g dbSNP:762012588
6134 6134 c, g dbSNP:561973646
6140 6140 a, c dbSNP:267607356
6159 6159 a, g dbSNP:370223669
6161 6161 a, g dbSNP:769219244
6163 6163 c, g dbSNP:747318535
6171 6171 a, g dbSNP:775987118
6191 6191 g, t dbSNP:61750613
6195 6195 a, g dbSNP:770537385
6197 6197 g, t dbSNP:748986187
6202 6202 a, g dbSNP:777436174
6213 6213 c, t dbSNP:755558381
6215 6215 c, g dbSNP:199924971
6216 6216 a, g dbSNP:780982814
6229 6229 c, t dbSNP:200642838
6242 6242 -, a dbSNP:752950172
6244 6244 g, t dbSNP:755010612
6246 6246 a, t dbSNP:751282313
6250 6250 c, t dbSNP:376954444
6263 6263 a, c dbSNP:758292026
6265 6265 c, t dbSNP:575042694
6266 6266 a, g dbSNP:140229844
6275 6275 c, t dbSNP:761740133
6285 6285 c, t dbSNP:776829848
6289 6289 c, t dbSNP:200034511
6290 6290 a, g dbSNP:761281536
6293 6293 a, g dbSNP:775806908
6302 6302 a, g dbSNP:185374140
6306 6306 a, t dbSNP:759901328
6308 6308 a, c, g dbSNP:769498397
6315 6315 c, t dbSNP:772460346
6318 6318 c, t dbSNP:761576269
6319 6319 a, g dbSNP:375810839
6337 6337 c, g dbSNP:371791695
6347 6347 a, t dbSNP:746504900
6349 6349 c, t dbSNP:55784921
6350 6350 a, g dbSNP:772192840
6353 6353 a, g, t dbSNP:778887346
6354 6354 a, g dbSNP:186806674
6355 6355 g, t dbSNP:754039481
6356 6356 a, g dbSNP:777887085
6358 6358 a, g dbSNP:756163194
6362 6362 a, g dbSNP:752835830
6363 6363 c, t dbSNP:768011948
6367 6367 a, c dbSNP:760081155
6372 6372 a, g dbSNP:141949957
6374 6374 a, g dbSNP:779004919
6375 6375 a, t dbSNP:771176447
6376 6376 c, t dbSNP:201819291
6381 6381 g, t dbSNP:763260567
6388 6388 c, g dbSNP:183640579
6398 6398 a, g dbSNP:763665546
6408 6408 a, g dbSNP:760247929
6413 6413 c, t dbSNP:552465061
6432 6432 g, t dbSNP:772100394
6432 6432 -, t dbSNP:61750614
6433 6433 c, g dbSNP:745846395
6437 6437 c, t dbSNP:61750615
6438 6438 -, c dbSNP:774210583
6438 6438 c, t dbSNP:770716495
6447 6447 a, g dbSNP:777974428
6466 6466 c, t dbSNP:778046417
6469 6469 c, t dbSNP:147982896
6487 6487 a, g dbSNP:748199230
6492 6492 c, t dbSNP:368207430
6493 6493 a, g dbSNP:755072784
6497 6497 a, g dbSNP:752022525
6500 6500 c, g dbSNP:192374602
6505 6505 c, t dbSNP:201189728
6508 6508 a, g dbSNP:757717683
6521 6521 a, c dbSNP:752356198
6524 6524 a, g dbSNP:767280593
6527 6527 c, g dbSNP:149274687
6531 6531 a, g dbSNP:199546602
6535 6535 c, g dbSNP:766310019
6537 6537 a, t dbSNP:762847913
6552 6552 a, g dbSNP:371105544
6553 6553 a, c dbSNP:115914543
6561 6561 c, t dbSNP:61750616
6564 6564 c, t dbSNP:761604165
6568 6568 c, t dbSNP:776779205
6570 6570 a, g, t dbSNP:377640206
6589 6589 a, g dbSNP:373520757
6595 6595 a, t dbSNP:11537642
6602 6602 c, t dbSNP:200719767
6603 6603 a, g dbSNP:375779188
6615 6615 c, t dbSNP:779593487
6616 6616 a, g dbSNP:141097321
6620 6620 c, t dbSNP:750099637
6625 6625 c, g, t dbSNP:373120381
6626 6626 a, g dbSNP:754719008
6627 6627 c, t dbSNP:71579338
6630 6630 c, t dbSNP:765758844
6635 6635 g, t dbSNP:61750617
6649 6649 c, g dbSNP:762560548
6651 6651 c, t dbSNP:750265377
6653 6653 a, g dbSNP:765176386
6655 6655 c, g dbSNP:146529302
6661 6661 c, t dbSNP:776475071
6674 6674 c, t dbSNP:190741083
6677 6677 -, ctc dbSNP:769453980
6683 6683 a, c, t dbSNP:61750618
6685 6685 a, t dbSNP:772003768
6691 6691 c, t dbSNP:745963903
6713 6713 a, g, t dbSNP:368419568
6723 6723 c, t dbSNP:201394479
6725 6725 c, t dbSNP:534005857
6728 6728 c, t dbSNP:756524650
6729 6729 a, g, t dbSNP:779764302
6734 6734 a, g dbSNP:757791706
6736 6736 c, t dbSNP:749995829
6759 6759 a, t dbSNP:752711827
6763 6763 a, g, t dbSNP:572231700
6770 6770 g, t dbSNP:61750619
6781 6781 a, c, t dbSNP:781225932
6782 6782 a, g, t dbSNP:34230288
6784 6784 c, t dbSNP:538963110
6786 6786 c, t dbSNP:61750620
6789 6789 a, t dbSNP:767792047
6790 6790 c, t dbSNP:759518968
6791 6791 a, g, t dbSNP:771544504
6797 6797 c, t dbSNP:749765595
6802 6802 c, t dbSNP:773886807
6803 6803 c, t dbSNP:569962285
6804 6804 a, g dbSNP:2229446
6811 6811 c, t dbSNP:151250563
6817 6817 c, g, t dbSNP:745348747
6820 6820 c, t dbSNP:368877141
6821 6821 a, g dbSNP:756778806
6822 6822 c, t dbSNP:753731128
6833 6833 a, g, t dbSNP:536264084
6835 6835 a, c dbSNP:752594033
6848 6848 g, t dbSNP:767604556
6861 6861 c, t dbSNP:777556669
6863 6863 c, t dbSNP:756142336
6867 6867 c, t dbSNP:543536638
6870 6870 c, t dbSNP:61750622
6875 6875 a, t dbSNP:752414005
6879 6879 a, g dbSNP:780993393
6889 6889 g, t dbSNP:754851946
6890 6890 c, t dbSNP:201195374
6891 6891 a, c dbSNP:553943046
6894 6894 a, g dbSNP:779819874
6902 6902 c, t dbSNP:200382972
6903 6903 a, g dbSNP:766725540
6916 6916 a, c dbSNP:199831766
6918 6918 a, c dbSNP:369015684
6919 6919 c, t dbSNP:149847513
6924 6924 a, g dbSNP:142316574
6927 6927 a, c dbSNP:181987927
6930 6930 g, t dbSNP:777023647
6933 6933 g, t dbSNP:769020774
6943 6943 c, g dbSNP:745607861
6946 6946 c, t dbSNP:573735469
6947 6947 c, g dbSNP:61750623
6949 6949 a, g dbSNP:553793764
6959 6959 c, t dbSNP:770625592
6968 6968 c, g dbSNP:748791680
6972 6972 a, g dbSNP:777393949
6988 6988 c, t dbSNP:61731159
6998 6998 c, t dbSNP:769211574
7006 7006 a, g dbSNP:71581020
7013 7013 a, g dbSNP:780997211
7015 7015 c, t dbSNP:754765995
7018 7018 c, g dbSNP:200300292
7019 7019 a, t dbSNP:62643638
7022 7022 a, g dbSNP:780422165
7030 7030 a, g dbSNP:758736968
7034 7034 a, g dbSNP:147715696
7046 7046 a, c dbSNP:765308636
7055 7055 a, g dbSNP:759824731
7064 7064 a, g dbSNP:772864135
7066 7066 a, c dbSNP:764859816
7068 7068 c, t dbSNP:761386093
7075 7075 c, t dbSNP:776323909
7079 7079 c, g dbSNP:767257065
7088 7088 a, g dbSNP:760493208
7093 7093 c, t dbSNP:768694992
7094 7094 a, g dbSNP:746891722
7095 7095 c, t dbSNP:775597704
7096 7096 a, g dbSNP:1053523
7105 7105 c, t dbSNP:745659470
7106 7106 a, g dbSNP:779181955
7107 7107 a, g dbSNP:757486690
7109 7109 c, g, t dbSNP:61750625
7110 7110 a, g dbSNP:563856279
7122 7122 c, g dbSNP:753138371
7123 7123 c, t dbSNP:768026301
7124 7124 a, g dbSNP:540687510
7125 7125 a, c dbSNP:755358165
7128 7128 c, t dbSNP:142921275
7129 7129 a, g dbSNP:764917249
7140 7140 c, t dbSNP:201372397
7143 7143 c, t dbSNP:774051063
7144 7144 a, g dbSNP:147523582
7146 7146 c, t dbSNP:573454985
7153 7153 g, t dbSNP:759439017
7156 7156 c, t dbSNP:774366470
7158 7158 a, c, t dbSNP:149432685
7159 7159 a, g dbSNP:371531354
7161 7161 a, g dbSNP:61750626
7166 7166 c, t dbSNP:138997660
7168 7168 c, g dbSNP:144777030
7173 7173 a, g dbSNP:748199105
7174 7174 a, c dbSNP:781181388
7181 7181 c, t dbSNP:150725355
7182 7182 a, g dbSNP:267607357
7187 7187 a, c, t dbSNP:184921605
7188 7188 a, g dbSNP:62641242
7191 7191 a, g dbSNP:777559810
7199 7199 a, g dbSNP:138618444
7201 7201 c, g dbSNP:755869272
7211 7211 c, t dbSNP:543900335
7213 7213 c, t dbSNP:556030217
7215 7215 a, t dbSNP:201792015
7228 7228 a, g, t dbSNP:372561152
7230 7230 a, g dbSNP:764980510
7239 7239 g, t dbSNP:761604234
7241 7241 a, g dbSNP:776655299
7254 7254 a, c dbSNP:764430521
7255 7255 c, t dbSNP:760663602
7256 7256 c, t dbSNP:775676532
7257 7257 c, t dbSNP:144769404
7258 7258 a, c dbSNP:746325869
7259 7259 c, g dbSNP:775029177
7268 7268 c, t dbSNP:61750628
7273 7273 a, g dbSNP:778368322
7274 7274 c, t dbSNP:142612858
7275 7275 a, g dbSNP:34120165
7278 7278 g, t dbSNP:61750629
7282 7282 c, t dbSNP:749720005
7286 7286 a, c dbSNP:780706642
7291 7291 a, g dbSNP:754701092
7306 7306 c, t dbSNP:746482504
7307 7307 a, g dbSNP:779492794
7309 7309 c, g dbSNP:112319661
7320 7320 a, c, t dbSNP:750296925
7321 7321 c, t dbSNP:765168583
7330 7330 c, t dbSNP:111597150
7333 7333 c, g dbSNP:557817663
7335 7335 g, t dbSNP:61750630
7346 7346 a, g dbSNP:763471709
7352 7352 a, g dbSNP:773625561
7358 7358 a, g dbSNP:770133697
7367 7367 c, t dbSNP:148908677
7375 7375 -, c dbSNP:267607359
7376 7376 c, t dbSNP:775107211
7380 7380 -, c dbSNP:267607360
7380 7380 c, t dbSNP:368646629
7381 7381 a, g dbSNP:745348661
7385 7385 c, t dbSNP:61751283
7386 7386 a, g dbSNP:758156301
7387 7387 -, t dbSNP:267607361
7394 7394 a, g dbSNP:749206995
7399 7399 g, t dbSNP:777576742
7400 7400 c, t dbSNP:145697622
7401 7401 a, g dbSNP:150201871
7408 7408 c, g dbSNP:533568072
7420 7420 c, t dbSNP:781534139
7423 7423 a, g dbSNP:374329353
7424 7424 c, t dbSNP:181290699
7426 7426 g, t dbSNP:61751285
7428 7428 a, c dbSNP:766444913
7441 7441 c, t dbSNP:142422347
7449 7449 a, c dbSNP:750888785
7456 7456 a, c dbSNP:752356435
7457 7457 a, g dbSNP:147705313
7458 7458 c, t dbSNP:762156577
7460 7460 a, c dbSNP:777016887
7461 7461 a, g dbSNP:767130840
7462 7462 c, g dbSNP:759137155
7466 7466 -, tgtc dbSNP:752860551
7466 7466 c, g dbSNP:774020679
7470 7470 c, t dbSNP:201494706
7475 7475 a, t dbSNP:748759913
7482 7482 a, c dbSNP:773187867
7486 7486 a, c dbSNP:145450160
7487 7487 a, t dbSNP:747934541
7489 7489 c, t dbSNP:216867
7490 7490 a, g dbSNP:754853953
7497 7497 a, g dbSNP:747165661
7503 7503 a, g dbSNP:780157825
7508 7508 a, t dbSNP:758495824
7512 7512 c, t dbSNP:750530966
7520 7520 a, g dbSNP:765740267
7531 7531 c, t dbSNP:151303589
7532 7532 a, g dbSNP:754363583
7534 7534 a, c dbSNP:764400779
7538 7538 a, g dbSNP:756456376
7544 7544 -, gt dbSNP:62643639
7550 7550 c, g, t dbSNP:62643640
7551 7551 a, g dbSNP:370600984
7567 7567 c, t dbSNP:766033386
7571 7571 a, g, t dbSNP:62643641
7576 7576 g, t dbSNP:139290955
7578 7578 c, t dbSNP:764775440
7579 7579 c, t dbSNP:142444263
7588 7588 a, g dbSNP:776700534
7594 7594 c, t dbSNP:55944252
7595 7595 a, g dbSNP:760482755
7609 7609 a, c dbSNP:775194189
7611 7611 a, c, t dbSNP:200486416
7612 7612 c, t dbSNP:146504585
7613 7613 a, c, g dbSNP:763541335
7617 7617 c, t dbSNP:778247950
7627 7627 a, c, t dbSNP:142452106
7628 7628 a, g dbSNP:149677556
7639 7639 c, t dbSNP:781372316
7640 7640 c, t dbSNP:61751286
7641 7641 a, g, t dbSNP:373896832
7642 7642 c, t dbSNP:149984396
7643 7643 -, cgtgatgggcctccgcg dbSNP:267607362
7643 7643 a, g dbSNP:375655409
7655 7655 c, t dbSNP:61751287
7658 7658 c, t dbSNP:61751288
7672 7672 a, g dbSNP:760477339
7674 7674 a, g dbSNP:775525534
7680 7680 a, c, g dbSNP:61751289
7682 7682 c, t dbSNP:771694902
7683 7683 a, g dbSNP:111752224
7685 7685 g, t dbSNP:774541336
7686 7686 c, t dbSNP:771209761
7687 7687 a, g dbSNP:267607363
7699 7699 -, a dbSNP:61751291
7699 7699 c, t dbSNP:369629756
7700 7700 a, g dbSNP:139864572
7702 7702 a, t dbSNP:773426144
7703 7703 c, t dbSNP:769702619
7709 7709 a, g dbSNP:748315151
7712 7712 c, g dbSNP:776996931
7715 7715 a, g dbSNP:769241795
7718 7718 c, t dbSNP:747351776
7739 7739 c, t dbSNP:61751292
7743 7743 a, c dbSNP:369669154
7747 7747 c, t dbSNP:748886645
7751 7751 a, g dbSNP:777584185
7754 7754 a, g dbSNP:755568210
7756 7756 a, g dbSNP:752320274
7767 7767 c, t dbSNP:181094101
7768 7768 a, g dbSNP:368010532
7769 7769 a, c, t dbSNP:368286307
7770 7770 a, g dbSNP:762748393
7775 7775 a, g dbSNP:757915054
7785 7785 c, t dbSNP:543595163
7797 7797 a, g dbSNP:761764663
7798 7798 a, c, t dbSNP:768645164
7801 7801 c, t dbSNP:145955543
7802 7802 a, g dbSNP:61751293
7809 7809 a, c dbSNP:61751294
7821 7821 c, t dbSNP:374690023
7822 7822 a, g dbSNP:562305031
7828 7828 a, c dbSNP:779932835
7829 7829 c, t dbSNP:758376829
7840 7840 a, c, g dbSNP:369878547
7842 7842 a, g dbSNP:757011174
7849 7849 a, t dbSNP:61751295
7850 7850 a, g dbSNP:754037205
7853 7853 c, t dbSNP:61751296
7854 7854 a, g dbSNP:137987906
7866 7866 a, c dbSNP:752865231
7869 7869 c, t dbSNP:150778949
7874 7874 a, g dbSNP:532963814
7875 7875 a, t dbSNP:201213029
7879 7879 a, t dbSNP:774724224
7880 7880 c, t dbSNP:61751297
7886 7886 a, t dbSNP:61751298
7888 7888 c, t dbSNP:780588032
7889 7889 a, g dbSNP:763283384
7899 7899 c, t dbSNP:376366370
7901 7901 c, t dbSNP:776340794
7906 7906 a, g dbSNP:768335080
7914 7914 -, ag dbSNP:267607364
7916 7916 a, g dbSNP:372582651
7920 7920 a, g dbSNP:774929265
7922 7922 c, t dbSNP:202068340
7923 7923 c, t dbSNP:373158962
7924 7924 -, c dbSNP:267607365
7926 7926 c, t dbSNP:778732929
7927 7927 a, g dbSNP:546185888
7928 7928 a, g dbSNP:749106300
7930 7930 c, t dbSNP:758747918
7932 7932 a, t dbSNP:35335161
7933 7933 c, t dbSNP:752991654
7933 7933 -, t dbSNP:61751300
7940 7940 a, c dbSNP:767664790
7948 7948 a, g dbSNP:16932285
7956 7956 c, t dbSNP:752093211
7957 7957 a, g dbSNP:143235468
7964 7964 c, t dbSNP:368810263
7969 7969 a, c dbSNP:192262780
7973 7973 c, t dbSNP:375991463
7974 7974 a, g dbSNP:373321657
7978 7978 c, t dbSNP:369734683
7981 7981 a, g dbSNP:767144434
7982 7982 c, t dbSNP:369970893
7983 7983 a, g, t dbSNP:770499408
7990 7990 g, t dbSNP:762759559
7997 7997 a, c dbSNP:371687405
7999 7999 g, t dbSNP:769698712
8005 8005 c, t dbSNP:748022353
8007 8007 c, g dbSNP:781531963
8011 8011 c, t dbSNP:367671063
8012 8012 a, g dbSNP:747274989
8016 8016 a, c, t dbSNP:374131634
8017 8017 c, t dbSNP:750868060
8019 8019 a, g dbSNP:779457972
8023 8023 c, t dbSNP:375117638
8024 8024 a, g dbSNP:142316324
8026 8026 a, c, g dbSNP:760572511
8028 8028 -, aga dbSNP:762835479
8041 8041 c, t dbSNP:775574792
8042 8042 a, g dbSNP:772325737
8044 8044 c, t dbSNP:745928802
8049 8049 g, t dbSNP:774367706
8050 8050 c, t dbSNP:200209213
8052 8052 c, t dbSNP:138303680
8053 8053 a, g, t dbSNP:756429337
8056 8056 c, g dbSNP:748585085
8060 8060 c, t dbSNP:760515060
8061 8061 a, g dbSNP:147052620
8075 8075 a, g dbSNP:750127803
8076 8076 g, t dbSNP:764771186
8080 8080 c, g dbSNP:538980670
8083 8083 c, t dbSNP:111619561
8085 8085 a, t dbSNP:753701276
8096 8096 a, c dbSNP:764162698
8099 8099 a, c, t dbSNP:371948517
8101 8101 c, g dbSNP:767325051
8102 8102 c, g dbSNP:759715664
8111 8111 a, t dbSNP:774563410
8116 8116 a, c dbSNP:569891707
8126 8126 a, c dbSNP:141666705
8129 8129 c, t dbSNP:773560179
8131 8131 c, t dbSNP:770381255
8134 8134 c, g dbSNP:748622872
8136 8136 a, g, t dbSNP:112100565
8139 8139 a, g dbSNP:781166200
8140 8140 g, t dbSNP:754764925
8148 8148 a, t dbSNP:751403940
8155 8155 c, g, t dbSNP:201953086
8167 8167 a, g dbSNP:750614443
8172 8172 a, g dbSNP:765299984
8183 8183 g, t dbSNP:761852479
8184 8184 g, t dbSNP:777271299
8186 8186 c, t dbSNP:553284346
8189 8189 a, g dbSNP:769324223
8190 8190 c, t dbSNP:61751302
8191 8191 a, g dbSNP:748920233
8196 8196 g, t dbSNP:202052078
8197 8197 c, t dbSNP:748907832
8198 8198 a, c dbSNP:777305420
8214 8214 a, g dbSNP:769335635
8216 8216 -, gga dbSNP:768488894
8231 8231 c, t dbSNP:199968654
8237 8237 c, t dbSNP:370662678
8238 8238 a, c, g dbSNP:149834874
8247 8247 c, t dbSNP:78353028
8248 8248 a, g dbSNP:201890452
8251 8251 c, t dbSNP:768159245
8258 8258 a, g dbSNP:746890802
8260 8260 c, t dbSNP:779909907
8262 8262 a, g dbSNP:61751303
8285 8285 a, g dbSNP:377514450
8286 8286 a, g dbSNP:151129435
8295 8295 a, g dbSNP:538486039
8298 8298 a, g dbSNP:144511926
8317 8317 a, g dbSNP:569569052
8318 8318 g, t dbSNP:200389567
8320 8320 c, t dbSNP:764207234
8328 8328 a, g dbSNP:62641243
8329 8329 c, t dbSNP:41276732
8334 8334 c, g, t dbSNP:76459136
8335 8335 c, t dbSNP:759914522
8337 8337 c, t dbSNP:774529699
8344 8344 a, g dbSNP:144030544
8350 8350 a, g dbSNP:761387678
8363 8363 a, g dbSNP:7962217
8379 8379 a, g dbSNP:766672651
8396 8396 c, t dbSNP:763365172
8401 8401 c, t dbSNP:753482100
8408 8408 a, g dbSNP:765610294
8410 8410 a, g dbSNP:368802960
8411 8411 a, g dbSNP:752402059
8414 8414 c, g dbSNP:62641244
8424 8424 a, g dbSNP:530699221
8425 8425 c, t dbSNP:759147832
8426 8426 a, g dbSNP:774426276
8432 8432 a, t dbSNP:199871749
8437 8437 -, caggctgc dbSNP:267607367
8437 8437 c, g dbSNP:375985267
8440 8440 c, g dbSNP:762820546
8448 8448 a, g dbSNP:773094944
8466 8466 a, g dbSNP:61751305
8477 8477 a, g dbSNP:748259003
8478 8478 c, t dbSNP:776969304
8491 8491 -, ccactactg dbSNP:267607368
8493 8493 a, g dbSNP:768614382
8508 8508 a, t dbSNP:764927154
8512 8512 g, t dbSNP:61751306
8523 8523 c, t dbSNP:144542595
8525 8525 a, g dbSNP:776211115
8526 8526 c, t dbSNP:776681874
8539 8539 c, t dbSNP:149309674
8545 8545 c, t dbSNP:573289245
8546 8546 a, g dbSNP:775506247
8553 8553 a, g dbSNP:772146195
8560 8560 a, g dbSNP:746318855
8561 8561 a, t dbSNP:61751307
8562 8562 a, g dbSNP:61751308
8566 8566 -, c dbSNP:61751309
8567 8567 c, t dbSNP:61751310
8568 8568 c, g dbSNP:61751311
8574 8574 c, t dbSNP:376285757
8575 8575 c, t dbSNP:138588762
8577 8577 c, t dbSNP:61751312
8578 8578 a, g dbSNP:780686569
8582 8582