Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

XRCC3 X-ray repair complementing defective repair in Chinese hamster cells 3 [Homo sapiens (human)]

Gene Symbol XRCC3
Entrez Gene ID 7517
Full Name X-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms CMM6
General protein information
Preferred Names
DNA repair protein XRCC3
DNA repair protein XRCC3
X-ray repair cross-complementing protein 3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Melanoma, cutaneous malignant, susceptibility to, 6} (3); {Breast
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu25309 XM_011537138 PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25309 XM_005268046 PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25309 NM_005432 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25309 NM_001100118 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25309 NM_001100119 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu25309D
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)367..1374(+)
Misc Feature(2)607..1377(+)
Misc Feature(3)682..705(+)
Misc Feature(4)688..1002(+)
Misc Feature(5)775..1110(+)
Misc Feature(6)988..1002(+)
Position Chain Variation Link
8 8 a, c dbSNP:527896479
14 14 a, g dbSNP:561980080
48 48 a, g dbSNP:1799794
50 50 a, g dbSNP:537473935
67 67 a, g dbSNP:571372232
83 83 c, t dbSNP:45603942
103 103 a, g dbSNP:373604874
126 126 a, g dbSNP:769776166
179 179 c, g dbSNP:571569002
180 180 a, g dbSNP:551369420
181 181 c, t dbSNP:564381445
182 182 a, g dbSNP:528107761
183 183 a, g dbSNP:774462522
198 198 c, t dbSNP:199632866
234 234 c, t dbSNP:577867073
268 268 c, t dbSNP:564460234
269 269 a, c dbSNP:776306927
318 318 a, t dbSNP:373800330
319 319 c, t dbSNP:778350647
325 325 c, t dbSNP:755493221
328 328 c, g dbSNP:370388004
339 339 a, t dbSNP:56018633
343 343 g, t dbSNP:756505421
357 357 c, t dbSNP:750598578
358 358 a, g dbSNP:376582164
378 378 a, g dbSNP:56377012
382 382 a, g dbSNP:751635577
384 384 c, t dbSNP:764138700
390 390 a, t dbSNP:759485767
405 405 a, t dbSNP:776463599
414 414 c, g dbSNP:770709968
431 431 -, c dbSNP:769719777
431 431 c, t dbSNP:748765569
432 432 a, g dbSNP:776001514
438 438 a, g dbSNP:770282151
440 440 -, agg dbSNP:780945006
446 446 -, t dbSNP:766346302
448 448 c, t dbSNP:546983534
454 454 c, t dbSNP:781514761
465 465 a, c dbSNP:757649541
471 471 a, g dbSNP:747203916
473 473 c, g dbSNP:777869466
476 476 c, t dbSNP:758434542
483 483 c, t dbSNP:752712328
486 486 c, g dbSNP:765461939
488 488 a, c dbSNP:569323871
489 489 c, t dbSNP:756095012
495 495 c, t dbSNP:3212045
496 496 a, g dbSNP:767384633
501 501 c, g dbSNP:530093752
504 504 a, g dbSNP:774000795
513 513 a, g dbSNP:763661308
514 514 a, g dbSNP:766540487
515 515 a, g dbSNP:762734728
517 517 -, gtcc dbSNP:762959042
518 518 c, t dbSNP:117761689
519 519 -, ag dbSNP:773320257
519 519 a, g dbSNP:548048987
524 524 -, cct dbSNP:765292788
529 529 a, c, t dbSNP:372985882
530 530 a, g dbSNP:369879767
535 535 c, t dbSNP:143410843
536 536 a, g dbSNP:139963722
542 542 a, g dbSNP:758533921
554 554 c, t dbSNP:748448131
555 555 a, c dbSNP:779101792
580 580 a, g dbSNP:761300047
584 584 a, g dbSNP:372383657
594 594 a, g dbSNP:772522836
595 595 c, g dbSNP:757118786
606 606 c, t dbSNP:574258303
609 609 a, g dbSNP:370617343
622 622 c, t dbSNP:768803063
623 623 c, t dbSNP:749386482
624 624 a, g dbSNP:374354789
644 644 a, g dbSNP:3212057
645 645 c, t dbSNP:751566300
658 658 c, t dbSNP:777400049
663 663 c, t dbSNP:758245729
664 664 a, g dbSNP:752288087
669 669 c, t dbSNP:777169987
681 681 c, g, t dbSNP:368062647
682 682 a, g dbSNP:753331169
684 684 a, g dbSNP:374120119
692 692 c, t dbSNP:577087507
697 697 g, t dbSNP:773795652
702 702 a, g dbSNP:772271531
705 705 c, g dbSNP:762286112
714 714 a, g dbSNP:371455247
715 715 a, c dbSNP:768997440
716 716 c, t dbSNP:749582836
723 723 c, t dbSNP:779977119
725 725 c, g dbSNP:769958215
726 726 c, t dbSNP:746881409
730 730 c, g dbSNP:777779663
739 739 a, t dbSNP:758061550
744 744 a, g dbSNP:752482489
745 745 c, t dbSNP:377685108
746 746 a, g dbSNP:754599485
747 747 c, g dbSNP:753527159
751 751 c, t dbSNP:765763000
753 753 c, t dbSNP:755669319
754 754 a, g dbSNP:750840706
770 770 c, g dbSNP:200124946
774 774 c, t dbSNP:752153707
775 775 a, g dbSNP:146507354
786 786 c, t dbSNP:200567298
788 788 c, t dbSNP:201561134
789 789 a, g dbSNP:765492334
795 795 c, t dbSNP:374168537
796 796 a, g dbSNP:149963487
804 804 a, g, t dbSNP:138987760
811 811 c, t dbSNP:150729160
817 817 c, t dbSNP:141201371
825 825 c, t dbSNP:749117148
827 827 c, t dbSNP:779783228
839 839 c, t dbSNP:199681385
840 840 a, g dbSNP:755779950
841 841 c, t dbSNP:56347206
842 842 a, g dbSNP:546280840
845 845 c, t dbSNP:369021228
847 847 c, t dbSNP:752063855
848 848 a, g dbSNP:778439328
851 851 c, g, t dbSNP:376618856
855 855 c, t dbSNP:28903079
856 856 a, g dbSNP:143171186
865 865 a, g dbSNP:529784964
868 868 c, t dbSNP:759771337
869 869 c, t dbSNP:754035692
870 870 a, g dbSNP:766394376
883 883 c, t dbSNP:56288529
884 884 a, c, g dbSNP:768580716
889 889 c, g dbSNP:762860382
897 897 c, g dbSNP:775335436
901 901 -, ttc dbSNP:774682377
906 906 c, t dbSNP:373040437
907 907 a, g dbSNP:745494547
908 908 a, g dbSNP:781016854
911 911 a, c dbSNP:770508342
912 912 c, t dbSNP:746523890
913 913 a, g dbSNP:777483755
918 918 c, t dbSNP:200230392
919 919 a, g dbSNP:753182555
921 921 c, t dbSNP:544357486
926 926 a, c dbSNP:761343521
930 930 a, c dbSNP:751261262
939 939 a, g dbSNP:146875659
943 943 a, g dbSNP:762464936
949 949 a, t dbSNP:775909166
959 959 c, t dbSNP:372108006
960 960 c, t dbSNP:200213277
961 961 a, g dbSNP:531332562
964 964 c, t dbSNP:761781412
965 965 c, t dbSNP:747150871
967 967 c, t dbSNP:778069090
969 969 -, gt dbSNP:765025885
969 969 a, c, g dbSNP:748230682
973 973 c, t dbSNP:779189770
974 974 a, g dbSNP:756095186
977 977 a, g dbSNP:750418294
978 978 a, c dbSNP:780813014
980 980 g, t dbSNP:776568196
991 991 a, g dbSNP:751118907
995 995 c, t dbSNP:763742114
999 999 c, t dbSNP:41285494
1000 1000 a, g dbSNP:149642280
1003 1003 g, t dbSNP:764778351
1004 1004 c, t dbSNP:759919423
1005 1005 a, g dbSNP:200948313
1009 1009 a, g dbSNP:771142980
1012 1012 a, g dbSNP:761101817
1021 1021 c, t dbSNP:545840795
1022 1022 a, g dbSNP:772408011
1025 1025 a, g dbSNP:201886982
1027 1027 a, g, t dbSNP:768891111
1029 1029 a, t dbSNP:368831796
1039 1039 c, g dbSNP:373720646
1041 1041 a, g dbSNP:376831498
1043 1043 a, c dbSNP:781206798
1045 1045 -, tccgcc dbSNP:761813245
1046 1046 c, t dbSNP:756935758
1047 1047 c, t dbSNP:746816769
1048 1048 a, g dbSNP:777604903
1051 1051 c, t dbSNP:758025766
1066 1066 c, t dbSNP:757719690
1074 1074 c, t dbSNP:138142727
1076 1076 c, t dbSNP:754529357
1080 1080 a, g dbSNP:188768970
1082 1082 a, c dbSNP:766900735
1084 1084 a, c, g dbSNP:773686312
1085 1085 c, t dbSNP:861539
1086 1086 a, g, t dbSNP:79874791
1088 1088 c, t dbSNP:768565346
1090 1090 c, t dbSNP:749394060
1091 1091 a, g dbSNP:77381814
1093 1093 a, g dbSNP:770889808
1094 1094 a, g dbSNP:575587037
1098 1098 a, g dbSNP:566710190
1105 1105 a, g dbSNP:777515106
1113 1113 -, cacagc dbSNP:752714158
1119 1119 c, t dbSNP:200657624
1125 1125 a, c, g dbSNP:778540307
1128 1128 -, gc dbSNP:767691806
1128 1128 c, t dbSNP:373638417
1134 1134 c, t dbSNP:754653129
1146 1146 a, g dbSNP:764416609
1150 1150 a, g dbSNP:145063633
1153 1153 a, g dbSNP:752896177
1164 1164 c, t dbSNP:765302014
1173 1173 c, t dbSNP:759615397
1174 1174 a, g dbSNP:28903080
1177 1177 c, t dbSNP:771984433
1179 1179 a, g dbSNP:761784037
1190 1190 a, g dbSNP:140979846
1194 1194 c, t dbSNP:547969139
1195 1195 a, g dbSNP:548084133
1196 1196 a, g dbSNP:775425367
1198 1198 c, t dbSNP:536822410
1199 1199 a, g dbSNP:745564626
1205 1205 c, t dbSNP:776250580
1209 1209 a, g dbSNP:370905714
1215 1215 c, t dbSNP:747503600
1219 1219 a, g dbSNP:368289157
1222 1222 a, g dbSNP:759008998
1224 1224 c, t dbSNP:748447059
1232 1232 a, g dbSNP:538113920
1233 1233 c, g, t dbSNP:757288071
1261 1261 a, c dbSNP:754089796
1262 1262 a, g, t dbSNP:187038000
1267 1267 c, t dbSNP:751449355
1268 1268 a, g, t dbSNP:28903081
1269 1269 c, t dbSNP:370391238
1270 1270 a, g dbSNP:765167812
1276 1276 a, g dbSNP:267603888
1287 1287 c, t dbSNP:759227523
1288 1288 a, g dbSNP:532124840
1290 1290 a, c dbSNP:770496162
1299 1299 c, t dbSNP:746493086
1300 1300 c, t dbSNP:560239798
1301 1301 a, g dbSNP:546709768
1305 1305 c, t dbSNP:748729904
1309 1309 c, t dbSNP:529825639
1310 1310 a, g dbSNP:561421246
1324 1324 c, g, t dbSNP:780262052
1325 1325 c, g dbSNP:756426742
1327 1327 c, t dbSNP:750457573
1328 1328 -, acctgcccccc dbSNP:748760447
1338 1338 -, c dbSNP:770137120
1341 1341 -, c dbSNP:780557423
1355 1355 a, c, g, t dbSNP:200382220
1356 1356 a, g dbSNP:765078097
1366 1366 a, g dbSNP:759419858
1372 1372 -, g dbSNP:34183054
1373 1373 -, t dbSNP:745775675
1375 1375 c, t dbSNP:753750563
1376 1376 a, g dbSNP:766114040
1391 1391 c, t dbSNP:377185194
1396 1396 a, t dbSNP:760421139
1407 1407 c, t dbSNP:772562364
1408 1408 a, g dbSNP:760585240
1409 1409 a, g dbSNP:762177393
1413 1413 c, t dbSNP:774851674
1414 1414 a, g dbSNP:768944628
1424 1424 c, t dbSNP:575828884
1427 1427 c, t dbSNP:372513712
1428 1428 a, c dbSNP:769885082
1431 1431 c, g dbSNP:746146387
1432 1432 -, cctg dbSNP:768250263
1443 1443 a, c dbSNP:781095418
1444 1444 c, t dbSNP:565417023
1445 1445 a, g dbSNP:370272845
1448 1448 a, t dbSNP:752626065
1451 1451 a, c, t dbSNP:376407692
1472 1472 a, g dbSNP:748375579
1487 1487 a, g dbSNP:767258270
1492 1492 a, c dbSNP:545728746
1528 1528 a, g dbSNP:55748757
1533 1533 c, t dbSNP:552955847
1534 1534 a, g dbSNP:759052213
1549 1549 c, t dbSNP:3212116
1551 1551 c, t dbSNP:773918094
1552 1552 a, g dbSNP:781687008
1652 1652 c, g dbSNP:770390236
1677 1677 a, c, g dbSNP:189909594
1718 1718 c, t dbSNP:554712025
1724 1724 a, g dbSNP:755396661
1729 1729 a, g dbSNP:537630445
1770 1770 a, g dbSNP:569064462
1788 1788 a, g dbSNP:558573491
1797 1797 c, t dbSNP:773761112
1811 1811 a, c dbSNP:538978021
1831 1831 g, t dbSNP:566436220
1852 1852 a, c, t dbSNP:3212117
1863 1863 c, t dbSNP:748617408
1866 1866 c, t dbSNP:34023186
1905 1905 c, t dbSNP:3212118
1906 1906 a, g dbSNP:144660634
1924 1924 -, g dbSNP:34231836
1936 1936 a, g dbSNP:3212119
1937 1937 c, t dbSNP:532243901
1942 1942 a, g dbSNP:565514723
1943 1943 a, g dbSNP:77103957
1956 1956 g, t dbSNP:528762137
1958 1958 c, t dbSNP:559291946
1969 1969 a, c dbSNP:140813869
1989 1989 a, g dbSNP:3212120
1993 1993 a, g dbSNP:557155704
2005 2005 a, g dbSNP:118143436
2007 2007 a, g dbSNP:575338872
2017 2017 a, g dbSNP:3212121
2043 2043 g, t dbSNP:538889498
2058 2058 a, g dbSNP:566795325
2083 2083 c, g dbSNP:536177608
2086 2086 a, g dbSNP:552970909
2096 2096 c, t dbSNP:536232000
2102 2102 c, t dbSNP:567300930
2103 2103 a, g dbSNP:574806963
2121 2121 a, g dbSNP:530638739
2148 2148 a, g dbSNP:571700552
2158 2158 c, t dbSNP:11546527
2187 2187 c, t dbSNP:3212122
2192 2192 c, t dbSNP:3212123
2211 2211 c, t dbSNP:3212124
2212 2212 a, g dbSNP:117875015
2213 2213 g, t dbSNP:542944317
2225 2225 c, t dbSNP:529271454
2239 2239 c, t dbSNP:752549180
2259 2259 c, t dbSNP:11546528
2262 2262 c, g dbSNP:563744794
2272 2272 g, t dbSNP:3212125
2286 2286 c, t dbSNP:578052355
2311 2311 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2316 2316 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2316 2316 -, g dbSNP:528769172
2359 2359 c, g dbSNP:186232444
2362 2362 -, tg dbSNP:559884792
2389 2389 a, g dbSNP:545239247
2396 2396 c, t dbSNP:759264703
2453 2453 c, t dbSNP:751125257
2454 2454 a, g dbSNP:78863423
2457 2457 g, t dbSNP:553300152
2464 2464 -, c dbSNP:34975865
2498 2498 a, g dbSNP:3212126
2508 2508 c, t dbSNP:573515775
2518 2518 c, g dbSNP:75104408
2519 2519 a, c dbSNP:536717537
2521 2521 a, t dbSNP:45625536
2523 2523 -, ag dbSNP:540271138
2548 2548 a, g dbSNP:571332532
2589 2589 a, c dbSNP:762493634

Target ORF information:

RefSeq Version XM_011537138
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu25309D
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)421..1428(+)
Misc Feature(2)661..1431(+)
Misc Feature(3)736..759(+)
Misc Feature(4)742..1056(+)
Misc Feature(5)829..1164(+)
Misc Feature(6)1042..1056(+)
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
80 80 a, g dbSNP:760925000
95 95 c, t dbSNP:563666739
96 96 a, c, g dbSNP:55653926
109 109 a, g dbSNP:759662161
112 112 c, g dbSNP:530785814
151 151 c, t dbSNP:549945919
153 153 c, t dbSNP:775350941
180 180 a, g dbSNP:769776166
233 233 c, g dbSNP:571569002
234 234 a, g dbSNP:551369420
235 235 c, t dbSNP:564381445
236 236 a, g dbSNP:528107761
237 237 a, g dbSNP:774462522
252 252 c, t dbSNP:199632866
288 288 c, t dbSNP:577867073
322 322 c, t dbSNP:564460234
323 323 a, c dbSNP:776306927
372 372 a, t dbSNP:373800330
373 373 c, t dbSNP:778350647
379 379 c, t dbSNP:755493221
382 382 c, g dbSNP:370388004
393 393 a, t dbSNP:56018633
397 397 g, t dbSNP:756505421
411 411 c, t dbSNP:750598578
412 412 a, g dbSNP:376582164
432 432 a, g dbSNP:56377012
436 436 a, g dbSNP:751635577
438 438 c, t dbSNP:764138700
444 444 a, t dbSNP:759485767
459 459 a, t dbSNP:776463599
468 468 c, g dbSNP:770709968
485 485 -, c dbSNP:769719777
485 485 c, t dbSNP:748765569
486 486 a, g dbSNP:776001514
492 492 a, g dbSNP:770282151
494 494 -, agg dbSNP:780945006
500 500 -, t dbSNP:766346302
502 502 c, t dbSNP:546983534
508 508 c, t dbSNP:781514761
519 519 a, c dbSNP:757649541
525 525 a, g dbSNP:747203916
527 527 c, g dbSNP:777869466
530 530 c, t dbSNP:758434542
537 537 c, t dbSNP:752712328
540 540 c, g dbSNP:765461939
542 542 a, c dbSNP:569323871
543 543 c, t dbSNP:756095012
549 549 c, t dbSNP:3212045
550 550 a, g dbSNP:767384633
555 555 c, g dbSNP:530093752
558 558 a, g dbSNP:774000795
567 567 a, g dbSNP:763661308
568 568 a, g dbSNP:766540487
569 569 a, g dbSNP:762734728
571 571 -, gtcc dbSNP:762959042
572 572 c, t dbSNP:117761689
573 573 -, ag dbSNP:773320257
573 573 a, g dbSNP:548048987
578 578 -, cct dbSNP:765292788
583 583 a, c, t dbSNP:372985882
584 584 a, g dbSNP:369879767
589 589 c, t dbSNP:143410843
590 590 a, g dbSNP:139963722
596 596 a, g dbSNP:758533921
608 608 c, t dbSNP:748448131
609 609 a, c dbSNP:779101792
634 634 a, g dbSNP:761300047
638 638 a, g dbSNP:372383657
648 648 a, g dbSNP:772522836
649 649 c, g dbSNP:757118786
660 660 c, t dbSNP:574258303
663 663 a, g dbSNP:370617343
676 676 c, t dbSNP:768803063
677 677 c, t dbSNP:749386482
678 678 a, g dbSNP:374354789
698 698 a, g dbSNP:3212057
699 699 c, t dbSNP:751566300
712 712 c, t dbSNP:777400049
717 717 c, t dbSNP:758245729
718 718 a, g dbSNP:752288087
723 723 c, t dbSNP:777169987
735 735 c, g, t dbSNP:368062647
736 736 a, g dbSNP:753331169
738 738 a, g dbSNP:374120119
746 746 c, t dbSNP:577087507
751 751 g, t dbSNP:773795652
756 756 a, g dbSNP:772271531
759 759 c, g dbSNP:762286112
768 768 a, g dbSNP:371455247
769 769 a, c dbSNP:768997440
770 770 c, t dbSNP:749582836
777 777 c, t dbSNP:779977119
779 779 c, g dbSNP:769958215
780 780 c, t dbSNP:746881409
784 784 c, g dbSNP:777779663
793 793 a, t dbSNP:758061550
798 798 a, g dbSNP:752482489
799 799 c, t dbSNP:377685108
800 800 a, g dbSNP:754599485
801 801 c, g dbSNP:753527159
805 805 c, t dbSNP:765763000
807 807 c, t dbSNP:755669319
808 808 a, g dbSNP:750840706
824 824 c, g dbSNP:200124946
828 828 c, t dbSNP:752153707
829 829 a, g dbSNP:146507354
840 840 c, t dbSNP:200567298
842 842 c, t dbSNP:201561134
843 843 a, g dbSNP:765492334
849 849 c, t dbSNP:374168537
850 850 a, g dbSNP:149963487
858 858 a, g, t dbSNP:138987760
865 865 c, t dbSNP:150729160
871 871 c, t dbSNP:141201371
879 879 c, t dbSNP:749117148
881 881 c, t dbSNP:779783228
893 893 c, t dbSNP:199681385
894 894 a, g dbSNP:755779950
895 895 c, t dbSNP:56347206
896 896 a, g dbSNP:546280840
899 899 c, t dbSNP:369021228
901 901 c, t dbSNP:752063855
902 902 a, g dbSNP:778439328
905 905 c, g, t dbSNP:376618856
909 909 c, t dbSNP:28903079
910 910 a, g dbSNP:143171186
919 919 a, g dbSNP:529784964
922 922 c, t dbSNP:759771337
923 923 c, t dbSNP:754035692
924 924 a, g dbSNP:766394376
937 937 c, t dbSNP:56288529
938 938 a, c, g dbSNP:768580716
943 943 c, g dbSNP:762860382
951 951 c, g dbSNP:775335436
955 955 -, ttc dbSNP:774682377
960 960 c, t dbSNP:373040437
961 961 a, g dbSNP:745494547
962 962 a, g dbSNP:781016854
965 965 a, c dbSNP:770508342
966 966 c, t dbSNP:746523890
967 967 a, g dbSNP:777483755
972 972 c, t dbSNP:200230392
973 973 a, g dbSNP:753182555
975 975 c, t dbSNP:544357486
980 980 a, c dbSNP:761343521
984 984 a, c dbSNP:751261262
993 993 a, g dbSNP:146875659
997 997 a, g dbSNP:762464936
1003 1003 a, t dbSNP:775909166
1013 1013 c, t dbSNP:372108006
1014 1014 c, t dbSNP:200213277
1015 1015 a, g dbSNP:531332562
1018 1018 c, t dbSNP:761781412
1019 1019 c, t dbSNP:747150871
1021 1021 c, t dbSNP:778069090
1023 1023 -, gt dbSNP:765025885
1023 1023 a, c, g dbSNP:748230682
1027 1027 c, t dbSNP:779189770
1028 1028 a, g dbSNP:756095186
1031 1031 a, g dbSNP:750418294
1032 1032 a, c dbSNP:780813014
1034 1034 g, t dbSNP:776568196
1045 1045 a, g dbSNP:751118907
1049 1049 c, t dbSNP:763742114
1053 1053 c, t dbSNP:41285494
1054 1054 a, g dbSNP:149642280
1057 1057 g, t dbSNP:764778351
1058 1058 c, t dbSNP:759919423
1059 1059 a, g dbSNP:200948313
1063 1063 a, g dbSNP:771142980
1066 1066 a, g dbSNP:761101817
1075 1075 c, t dbSNP:545840795
1076 1076 a, g dbSNP:772408011
1079 1079 a, g dbSNP:201886982
1081 1081 a, g, t dbSNP:768891111
1083 1083 a, t dbSNP:368831796
1093 1093 c, g dbSNP:373720646
1095 1095 a, g dbSNP:376831498
1097 1097 a, c dbSNP:781206798
1099 1099 -, tccgcc dbSNP:761813245
1100 1100 c, t dbSNP:756935758
1101 1101 c, t dbSNP:746816769
1102 1102 a, g dbSNP:777604903
1105 1105 c, t dbSNP:758025766
1120 1120 c, t dbSNP:757719690
1128 1128 c, t dbSNP:138142727
1130 1130 c, t dbSNP:754529357
1134 1134 a, g dbSNP:188768970
1136 1136 a, c dbSNP:766900735
1138 1138 a, c, g dbSNP:773686312
1139 1139 c, t dbSNP:861539
1140 1140 a, g, t dbSNP:79874791
1142 1142 c, t dbSNP:768565346
1144 1144 c, t dbSNP:749394060
1145 1145 a, g dbSNP:77381814
1147 1147 a, g dbSNP:770889808
1148 1148 a, g dbSNP:575587037
1152 1152 a, g dbSNP:566710190
1159 1159 a, g dbSNP:777515106
1167 1167 -, cacagc dbSNP:752714158
1173 1173 c, t dbSNP:200657624
1179 1179 a, c, g dbSNP:778540307
1182 1182 -, gc dbSNP:767691806
1182 1182 c, t dbSNP:373638417
1188 1188 c, t dbSNP:754653129
1200 1200 a, g dbSNP:764416609
1204 1204 a, g dbSNP:145063633
1207 1207 a, g dbSNP:752896177
1218 1218 c, t dbSNP:765302014
1227 1227 c, t dbSNP:759615397
1228 1228 a, g dbSNP:28903080
1231 1231 c, t dbSNP:771984433
1233 1233 a, g dbSNP:761784037
1244 1244 a, g dbSNP:140979846
1248 1248 c, t dbSNP:547969139
1249 1249 a, g dbSNP:548084133
1250 1250 a, g dbSNP:775425367
1252 1252 c, t dbSNP:536822410
1253 1253 a, g dbSNP:745564626
1259 1259 c, t dbSNP:776250580
1263 1263 a, g dbSNP:370905714
1269 1269 c, t dbSNP:747503600
1273 1273 a, g dbSNP:368289157
1276 1276 a, g dbSNP:759008998
1278 1278 c, t dbSNP:748447059
1286 1286 a, g dbSNP:538113920
1287 1287 c, g, t dbSNP:757288071
1315 1315 a, c dbSNP:754089796
1316 1316 a, g, t dbSNP:187038000
1321 1321 c, t dbSNP:751449355
1322 1322 a, g, t dbSNP:28903081
1323 1323 c, t dbSNP:370391238
1324 1324 a, g dbSNP:765167812
1330 1330 a, g dbSNP:267603888
1341 1341 c, t dbSNP:759227523
1342 1342 a, g dbSNP:532124840
1344 1344 a, c dbSNP:770496162
1353 1353 c, t dbSNP:746493086
1354 1354 c, t dbSNP:560239798
1355 1355 a, g dbSNP:546709768
1359 1359 c, t dbSNP:748729904
1363 1363 c, t dbSNP:529825639
1364 1364 a, g dbSNP:561421246
1378 1378 c, g, t dbSNP:780262052
1379 1379 c, g dbSNP:756426742
1381 1381 c, t dbSNP:750457573
1382 1382 -, acctgcccccc dbSNP:748760447
1392 1392 -, c dbSNP:770137120
1395 1395 -, c dbSNP:780557423
1409 1409 a, c, g, t dbSNP:200382220
1410 1410 a, g dbSNP:765078097
1420 1420 a, g dbSNP:759419858
1426 1426 -, g dbSNP:34183054
1427 1427 -, t dbSNP:745775675
1429 1429 c, t dbSNP:753750563
1430 1430 a, g dbSNP:766114040
1445 1445 c, t dbSNP:377185194
1450 1450 a, t dbSNP:760421139
1461 1461 c, t dbSNP:772562364
1462 1462 a, g dbSNP:760585240
1463 1463 a, g dbSNP:762177393
1467 1467 c, t dbSNP:774851674
1468 1468 a, g dbSNP:768944628
1478 1478 c, t dbSNP:575828884
1481 1481 c, t dbSNP:372513712
1482 1482 a, c dbSNP:769885082
1485 1485 c, g dbSNP:746146387
1486 1486 -, cctg dbSNP:768250263
1497 1497 a, c dbSNP:781095418
1498 1498 c, t dbSNP:565417023
1499 1499 a, g dbSNP:370272845
1502 1502 a, t dbSNP:752626065
1505 1505 a, c, t dbSNP:376407692
1526 1526 a, g dbSNP:748375579
1541 1541 a, g dbSNP:767258270
1546 1546 a, c dbSNP:545728746
1582 1582 a, g dbSNP:55748757
1587 1587 c, t dbSNP:552955847
1588 1588 a, g dbSNP:759052213
1603 1603 c, t dbSNP:3212116
1605 1605 c, t dbSNP:773918094
1606 1606 a, g dbSNP:781687008
1706 1706 c, g dbSNP:770390236
1731 1731 a, c, g dbSNP:189909594
1772 1772 c, t dbSNP:554712025
1778 1778 a, g dbSNP:755396661
1783 1783 a, g dbSNP:537630445
1824 1824 a, g dbSNP:569064462
1842 1842 a, g dbSNP:558573491
1851 1851 c, t dbSNP:773761112
1865 1865 a, c dbSNP:538978021
1885 1885 g, t dbSNP:566436220
1906 1906 a, c, t dbSNP:3212117
1917 1917 c, t dbSNP:748617408
1920 1920 c, t dbSNP:34023186
1959 1959 c, t dbSNP:3212118
1960 1960 a, g dbSNP:144660634
1978 1978 -, g dbSNP:34231836
1990 1990 a, g dbSNP:3212119
1991 1991 c, t dbSNP:532243901
1996 1996 a, g dbSNP:565514723
1997 1997 a, g dbSNP:77103957
2010 2010 g, t dbSNP:528762137
2012 2012 c, t dbSNP:559291946
2023 2023 a, c dbSNP:140813869
2043 2043 a, g dbSNP:3212120
2047 2047 a, g dbSNP:557155704
2059 2059 a, g dbSNP:118143436
2061 2061 a, g dbSNP:575338872
2071 2071 a, g dbSNP:3212121
2097 2097 g, t dbSNP:538889498
2112 2112 a, g dbSNP:566795325
2137 2137 c, g dbSNP:536177608
2140 2140 a, g dbSNP:552970909
2150 2150 c, t dbSNP:536232000
2156 2156 c, t dbSNP:567300930
2157 2157 a, g dbSNP:574806963
2175 2175 a, g dbSNP:530638739
2202 2202 a, g dbSNP:571700552
2212 2212 c, t dbSNP:11546527
2241 2241 c, t dbSNP:3212122
2246 2246 c, t dbSNP:3212123
2265 2265 c, t dbSNP:3212124
2266 2266 a, g dbSNP:117875015
2267 2267 g, t dbSNP:542944317
2279 2279 c, t dbSNP:529271454
2293 2293 c, t dbSNP:752549180
2313 2313 c, t dbSNP:11546528
2316 2316 c, g dbSNP:563744794
2326 2326 g, t dbSNP:3212125
2340 2340 c, t dbSNP:578052355
2365 2365 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2370 2370 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2370 2370 -, g dbSNP:528769172
2413 2413 c, g dbSNP:186232444
2416 2416 -, tg dbSNP:559884792
2443 2443 a, g dbSNP:545239247
2450 2450 c, t dbSNP:759264703
2507 2507 c, t dbSNP:751125257
2508 2508 a, g dbSNP:78863423
2511 2511 g, t dbSNP:553300152
2518 2518 -, c dbSNP:34975865
2552 2552 a, g dbSNP:3212126
2562 2562 c, t dbSNP:573515775
2572 2572 c, g dbSNP:75104408
2573 2573 a, c dbSNP:536717537
2575 2575 a, t dbSNP:45625536
2577 2577 -, ag dbSNP:540271138
2602 2602 a, g dbSNP:571332532
2643 2643 a, c dbSNP:762493634

Target ORF information:

RefSeq Version XM_005268046
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu25309D
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, AK023646.1, BX161398.1 and BC002949.1. On Jul 26, 2007 this sequence version replaced gi:12408644. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks a segment in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC001036.1, AK023646.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)297..299(+)
Misc Feature(2)381..383(+)
Misc Feature(3)384..1391(+)
Misc Feature(4)624..1394(+)
Misc Feature(5)699..722(+)
Misc Feature(6)705..1019(+)
Misc Feature(7)792..1127(+)
Misc Feature(8)1005..1019(+)
Misc Feature(9)1053..1055(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..120
Gene Synonym:
Exon (3)121..222
Gene Synonym:
Exon (4)223..435
Gene Synonym:
Exon (5)436..573
Gene Synonym:
Exon (6)574..786
Gene Synonym:
Exon (7)787..941
Gene Synonym:
Exon (8)942..1154
Gene Synonym:
Exon (9)1155..1201
Gene Synonym:
Exon (10)1202..2602
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
65 65 a, g dbSNP:1799794
67 67 a, g dbSNP:537473935
84 84 a, g dbSNP:571372232
100 100 c, t dbSNP:45603942
120 120 a, g dbSNP:373604874
143 143 a, g dbSNP:769776166
196 196 c, g dbSNP:571569002
197 197 a, g dbSNP:551369420
198 198 c, t dbSNP:564381445
199 199 a, g dbSNP:528107761
200 200 a, g dbSNP:774462522
215 215 c, t dbSNP:199632866
251 251 c, t dbSNP:577867073
285 285 c, t dbSNP:564460234
286 286 a, c dbSNP:776306927
335 335 a, t dbSNP:373800330
336 336 c, t dbSNP:778350647
342 342 c, t dbSNP:755493221
345 345 c, g dbSNP:370388004
356 356 a, t dbSNP:56018633
360 360 g, t dbSNP:756505421
374 374 c, t dbSNP:750598578
375 375 a, g dbSNP:376582164
395 395 a, g dbSNP:56377012
399 399 a, g dbSNP:751635577
401 401 c, t dbSNP:764138700
407 407 a, t dbSNP:759485767
422 422 a, t dbSNP:776463599
431 431 c, g dbSNP:770709968
448 448 -, c dbSNP:769719777
448 448 c, t dbSNP:748765569
449 449 a, g dbSNP:776001514
455 455 a, g dbSNP:770282151
457 457 -, agg dbSNP:780945006
463 463 -, t dbSNP:766346302
465 465 c, t dbSNP:546983534
471 471 c, t dbSNP:781514761
482 482 a, c dbSNP:757649541
488 488 a, g dbSNP:747203916
490 490 c, g dbSNP:777869466
493 493 c, t dbSNP:758434542
500 500 c, t dbSNP:752712328
503 503 c, g dbSNP:765461939
505 505 a, c dbSNP:569323871
506 506 c, t dbSNP:756095012
512 512 c, t dbSNP:3212045
513 513 a, g dbSNP:767384633
518 518 c, g dbSNP:530093752
521 521 a, g dbSNP:774000795
530 530 a, g dbSNP:763661308
531 531 a, g dbSNP:766540487
532 532 a, g dbSNP:762734728
534 534 -, gtcc dbSNP:762959042
535 535 c, t dbSNP:117761689
536 536 -, ag dbSNP:773320257
536 536 a, g dbSNP:548048987
541 541 -, cct dbSNP:765292788
546 546 a, c, t dbSNP:372985882
547 547 a, g dbSNP:369879767
552 552 c, t dbSNP:143410843
553 553 a, g dbSNP:139963722
559 559 a, g dbSNP:758533921
571 571 c, t dbSNP:748448131
572 572 a, c dbSNP:779101792
597 597 a, g dbSNP:761300047
601 601 a, g dbSNP:372383657
611 611 a, g dbSNP:772522836
612 612 c, g dbSNP:757118786
623 623 c, t dbSNP:574258303
626 626 a, g dbSNP:370617343
639 639 c, t dbSNP:768803063
640 640 c, t dbSNP:749386482
641 641 a, g dbSNP:374354789
661 661 a, g dbSNP:3212057
662 662 c, t dbSNP:751566300
675 675 c, t dbSNP:777400049
680 680 c, t dbSNP:758245729
681 681 a, g dbSNP:752288087
686 686 c, t dbSNP:777169987
698 698 c, g, t dbSNP:368062647
699 699 a, g dbSNP:753331169
701 701 a, g dbSNP:374120119
709 709 c, t dbSNP:577087507
714 714 g, t dbSNP:773795652
719 719 a, g dbSNP:772271531
722 722 c, g dbSNP:762286112
731 731 a, g dbSNP:371455247
732 732 a, c dbSNP:768997440
733 733 c, t dbSNP:749582836
740 740 c, t dbSNP:779977119
742 742 c, g dbSNP:769958215
743 743 c, t dbSNP:746881409
747 747 c, g dbSNP:777779663
756 756 a, t dbSNP:758061550
761 761 a, g dbSNP:752482489
762 762 c, t dbSNP:377685108
763 763 a, g dbSNP:754599485
764 764 c, g dbSNP:753527159
768 768 c, t dbSNP:765763000
770 770 c, t dbSNP:755669319
771 771 a, g dbSNP:750840706
787 787 c, g dbSNP:200124946
791 791 c, t dbSNP:752153707
792 792 a, g dbSNP:146507354
803 803 c, t dbSNP:200567298
805 805 c, t dbSNP:201561134
806 806 a, g dbSNP:765492334
812 812 c, t dbSNP:374168537
813 813 a, g dbSNP:149963487
821 821 a, g, t dbSNP:138987760
828 828 c, t dbSNP:150729160
834 834 c, t dbSNP:141201371
842 842 c, t dbSNP:749117148
844 844 c, t dbSNP:779783228
856 856 c, t dbSNP:199681385
857 857 a, g dbSNP:755779950
858 858 c, t dbSNP:56347206
859 859 a, g dbSNP:546280840
862 862 c, t dbSNP:369021228
864 864 c, t dbSNP:752063855
865 865 a, g dbSNP:778439328
868 868 c, g, t dbSNP:376618856
872 872 c, t dbSNP:28903079
873 873 a, g dbSNP:143171186
882 882 a, g dbSNP:529784964
885 885 c, t dbSNP:759771337
886 886 c, t dbSNP:754035692
887 887 a, g dbSNP:766394376
900 900 c, t dbSNP:56288529
901 901 a, c, g dbSNP:768580716
906 906 c, g dbSNP:762860382
914 914 c, g dbSNP:775335436
918 918 -, ttc dbSNP:774682377
923 923 c, t dbSNP:373040437
924 924 a, g dbSNP:745494547
925 925 a, g dbSNP:781016854
928 928 a, c dbSNP:770508342
929 929 c, t dbSNP:746523890
930 930 a, g dbSNP:777483755
935 935 c, t dbSNP:200230392
936 936 a, g dbSNP:753182555
938 938 c, t dbSNP:544357486
943 943 a, c dbSNP:761343521
947 947 a, c dbSNP:751261262
956 956 a, g dbSNP:146875659
960 960 a, g dbSNP:762464936
966 966 a, t dbSNP:775909166
976 976 c, t dbSNP:372108006
977 977 c, t dbSNP:200213277
978 978 a, g dbSNP:531332562
981 981 c, t dbSNP:761781412
982 982 c, t dbSNP:747150871
984 984 c, t dbSNP:778069090
986 986 -, gt dbSNP:765025885
986 986 a, c, g dbSNP:748230682
990 990 c, t dbSNP:779189770
991 991 a, g dbSNP:756095186
994 994 a, g dbSNP:750418294
995 995 a, c dbSNP:780813014
997 997 g, t dbSNP:776568196
1008 1008 a, g dbSNP:751118907
1012 1012 c, t dbSNP:763742114
1016 1016 c, t dbSNP:41285494
1017 1017 a, g dbSNP:149642280
1020 1020 g, t dbSNP:764778351
1021 1021 c, t dbSNP:759919423
1022 1022 a, g dbSNP:200948313
1026 1026 a, g dbSNP:771142980
1029 1029 a, g dbSNP:761101817
1038 1038 c, t dbSNP:545840795
1039 1039 a, g dbSNP:772408011
1042 1042 a, g dbSNP:201886982
1044 1044 a, g, t dbSNP:768891111
1046 1046 a, t dbSNP:368831796
1056 1056 c, g dbSNP:373720646
1058 1058 a, g dbSNP:376831498
1060 1060 a, c dbSNP:781206798
1062 1062 -, tccgcc dbSNP:761813245
1063 1063 c, t dbSNP:756935758
1064 1064 c, t dbSNP:746816769
1065 1065 a, g dbSNP:777604903
1068 1068 c, t dbSNP:758025766
1083 1083 c, t dbSNP:757719690
1091 1091 c, t dbSNP:138142727
1093 1093 c, t dbSNP:754529357
1097 1097 a, g dbSNP:188768970
1099 1099 a, c dbSNP:766900735
1101 1101 a, c, g dbSNP:773686312
1102 1102 c, t dbSNP:861539
1103 1103 a, g, t dbSNP:79874791
1105 1105 c, t dbSNP:768565346
1107 1107 c, t dbSNP:749394060
1108 1108 a, g dbSNP:77381814
1110 1110 a, g dbSNP:770889808
1111 1111 a, g dbSNP:575587037
1115 1115 a, g dbSNP:566710190
1122 1122 a, g dbSNP:777515106
1130 1130 -, cacagc dbSNP:752714158
1136 1136 c, t dbSNP:200657624
1142 1142 a, c, g dbSNP:778540307
1145 1145 -, gc dbSNP:767691806
1145 1145 c, t dbSNP:373638417
1151 1151 c, t dbSNP:754653129
1163 1163 a, g dbSNP:764416609
1167 1167 a, g dbSNP:145063633
1170 1170 a, g dbSNP:752896177
1181 1181 c, t dbSNP:765302014
1190 1190 c, t dbSNP:759615397
1191 1191 a, g dbSNP:28903080
1194 1194 c, t dbSNP:771984433
1196 1196 a, g dbSNP:761784037
1207 1207 a, g dbSNP:140979846
1211 1211 c, t dbSNP:547969139
1212 1212 a, g dbSNP:548084133
1213 1213 a, g dbSNP:775425367
1215 1215 c, t dbSNP:536822410
1216 1216 a, g dbSNP:745564626
1222 1222 c, t dbSNP:776250580
1226 1226 a, g dbSNP:370905714
1232 1232 c, t dbSNP:747503600
1236 1236 a, g dbSNP:368289157
1239 1239 a, g dbSNP:759008998
1241 1241 c, t dbSNP:748447059
1249 1249 a, g dbSNP:538113920
1250 1250 c, g, t dbSNP:757288071
1278 1278 a, c dbSNP:754089796
1279 1279 a, g, t dbSNP:187038000
1284 1284 c, t dbSNP:751449355
1285 1285 a, g, t dbSNP:28903081
1286 1286 c, t dbSNP:370391238
1287 1287 a, g dbSNP:765167812
1293 1293 a, g dbSNP:267603888
1304 1304 c, t dbSNP:759227523
1305 1305 a, g dbSNP:532124840
1307 1307 a, c dbSNP:770496162
1316 1316 c, t dbSNP:746493086
1317 1317 c, t dbSNP:560239798
1318 1318 a, g dbSNP:546709768
1322 1322 c, t dbSNP:748729904
1326 1326 c, t dbSNP:529825639
1327 1327 a, g dbSNP:561421246
1341 1341 c, g, t dbSNP:780262052
1342 1342 c, g dbSNP:756426742
1344 1344 c, t dbSNP:750457573
1345 1345 -, acctgcccccc dbSNP:748760447
1355 1355 -, c dbSNP:770137120
1358 1358 -, c dbSNP:780557423
1372 1372 a, c, g, t dbSNP:200382220
1373 1373 a, g dbSNP:765078097
1383 1383 a, g dbSNP:759419858
1389 1389 -, g dbSNP:34183054
1390 1390 -, t dbSNP:745775675
1392 1392 c, t dbSNP:753750563
1393 1393 a, g dbSNP:766114040
1408 1408 c, t dbSNP:377185194
1413 1413 a, t dbSNP:760421139
1424 1424 c, t dbSNP:772562364
1425 1425 a, g dbSNP:760585240
1426 1426 a, g dbSNP:762177393
1430 1430 c, t dbSNP:774851674
1431 1431 a, g dbSNP:768944628
1441 1441 c, t dbSNP:575828884
1444 1444 c, t dbSNP:372513712
1445 1445 a, c dbSNP:769885082
1448 1448 c, g dbSNP:746146387
1449 1449 -, cctg dbSNP:768250263
1460 1460 a, c dbSNP:781095418
1461 1461 c, t dbSNP:565417023
1462 1462 a, g dbSNP:370272845
1465 1465 a, t dbSNP:752626065
1468 1468 a, c, t dbSNP:376407692
1489 1489 a, g dbSNP:748375579
1504 1504 a, g dbSNP:767258270
1509 1509 a, c dbSNP:545728746
1545 1545 a, g dbSNP:55748757
1550 1550 c, t dbSNP:552955847
1551 1551 a, g dbSNP:759052213
1566 1566 c, t dbSNP:3212116
1568 1568 c, t dbSNP:773918094
1569 1569 a, g dbSNP:781687008
1669 1669 c, g dbSNP:770390236
1694 1694 a, c, g dbSNP:189909594
1735 1735 c, t dbSNP:554712025
1741 1741 a, g dbSNP:755396661
1746 1746 a, g dbSNP:537630445
1787 1787 a, g dbSNP:569064462
1805 1805 a, g dbSNP:558573491
1814 1814 c, t dbSNP:773761112
1828 1828 a, c dbSNP:538978021
1848 1848 g, t dbSNP:566436220
1869 1869 a, c, t dbSNP:3212117
1880 1880 c, t dbSNP:748617408
1883 1883 c, t dbSNP:34023186
1922 1922 c, t dbSNP:3212118
1923 1923 a, g dbSNP:144660634
1941 1941 -, g dbSNP:34231836
1953 1953 a, g dbSNP:3212119
1954 1954 c, t dbSNP:532243901
1959 1959 a, g dbSNP:565514723
1960 1960 a, g dbSNP:77103957
1973 1973 g, t dbSNP:528762137
1975 1975 c, t dbSNP:559291946
1986 1986 a, c dbSNP:140813869
2006 2006 a, g dbSNP:3212120
2010 2010 a, g dbSNP:557155704
2022 2022 a, g dbSNP:118143436
2024 2024 a, g dbSNP:575338872
2034 2034 a, g dbSNP:3212121
2060 2060 g, t dbSNP:538889498
2075 2075 a, g dbSNP:566795325
2100 2100 c, g dbSNP:536177608
2103 2103 a, g dbSNP:552970909
2113 2113 c, t dbSNP:536232000
2119 2119 c, t dbSNP:567300930
2120 2120 a, g dbSNP:574806963
2138 2138 a, g dbSNP:530638739
2165 2165 a, g dbSNP:571700552
2175 2175 c, t dbSNP:11546527
2204 2204 c, t dbSNP:3212122
2209 2209 c, t dbSNP:3212123
2228 2228 c, t dbSNP:3212124
2229 2229 a, g dbSNP:117875015
2230 2230 g, t dbSNP:542944317
2242 2242 c, t dbSNP:529271454
2256 2256 c, t dbSNP:752549180
2276 2276 c, t dbSNP:11546528
2279 2279 c, g dbSNP:563744794
2289 2289 g, t dbSNP:3212125
2303 2303 c, t dbSNP:578052355
2328 2328 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2333 2333 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2333 2333 -, g dbSNP:528769172
2376 2376 c, g dbSNP:186232444
2379 2379 -, tg dbSNP:559884792
2406 2406 a, g dbSNP:545239247
2413 2413 c, t dbSNP:759264703
2470 2470 c, t dbSNP:751125257
2471 2471 a, g dbSNP:78863423
2474 2474 g, t dbSNP:553300152
2481 2481 -, c dbSNP:34975865
2515 2515 a, g dbSNP:3212126
2525 2525 c, t dbSNP:573515775
2535 2535 c, g dbSNP:75104408
2536 2536 a, c dbSNP:536717537
2538 2538 a, t dbSNP:45625536
2540 2540 -, ag dbSNP:540271138
2565 2565 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_005432
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu25309D
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, BX161398.1 and BC002949.1. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) lacks a segment in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC011725.2, BX161398.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)240..242(+)
Misc Feature(2)324..326(+)
Misc Feature(3)327..1334(+)
Misc Feature(4)567..1337(+)
Misc Feature(5)642..665(+)
Misc Feature(6)648..962(+)
Misc Feature(7)735..1070(+)
Misc Feature(8)948..962(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..165
Gene Synonym:
Exon (3)166..378
Gene Synonym:
Exon (4)379..516
Gene Synonym:
Exon (5)517..729
Gene Synonym:
Exon (6)730..884
Gene Synonym:
Exon (7)885..1097
Gene Synonym:
Exon (8)1098..1144
Gene Synonym:
Exon (9)1145..2545
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
86 86 a, g dbSNP:769776166
139 139 c, g dbSNP:571569002
140 140 a, g dbSNP:551369420
141 141 c, t dbSNP:564381445
142 142 a, g dbSNP:528107761
143 143 a, g dbSNP:774462522
158 158 c, t dbSNP:199632866
194 194 c, t dbSNP:577867073
228 228 c, t dbSNP:564460234
229 229 a, c dbSNP:776306927
278 278 a, t dbSNP:373800330
279 279 c, t dbSNP:778350647
285 285 c, t dbSNP:755493221
288 288 c, g dbSNP:370388004
299 299 a, t dbSNP:56018633
303 303 g, t dbSNP:756505421
317 317 c, t dbSNP:750598578
318 318 a, g dbSNP:376582164
338 338 a, g dbSNP:56377012
342 342 a, g dbSNP:751635577
344 344 c, t dbSNP:764138700
350 350 a, t dbSNP:759485767
365 365 a, t dbSNP:776463599
374 374 c, g dbSNP:770709968
391 391 -, c dbSNP:769719777
391 391 c, t dbSNP:748765569
392 392 a, g dbSNP:776001514
398 398 a, g dbSNP:770282151
400 400 -, agg dbSNP:780945006
406 406 -, t dbSNP:766346302
408 408 c, t dbSNP:546983534
414 414 c, t dbSNP:781514761
425 425 a, c dbSNP:757649541
431 431 a, g dbSNP:747203916
433 433 c, g dbSNP:777869466
436 436 c, t dbSNP:758434542
443 443 c, t dbSNP:752712328
446 446 c, g dbSNP:765461939
448 448 a, c dbSNP:569323871
449 449 c, t dbSNP:756095012
455 455 c, t dbSNP:3212045
456 456 a, g dbSNP:767384633
461 461 c, g dbSNP:530093752
464 464 a, g dbSNP:774000795
473 473 a, g dbSNP:763661308
474 474 a, g dbSNP:766540487
475 475 a, g dbSNP:762734728
477 477 -, gtcc dbSNP:762959042
478 478 c, t dbSNP:117761689
479 479 -, ag dbSNP:773320257
479 479 a, g dbSNP:548048987
484 484 -, cct dbSNP:765292788
489 489 a, c, t dbSNP:372985882
490 490 a, g dbSNP:369879767
495 495 c, t dbSNP:143410843
496 496 a, g dbSNP:139963722
502 502 a, g dbSNP:758533921
514 514 c, t dbSNP:748448131
515 515 a, c dbSNP:779101792
540 540 a, g dbSNP:761300047
544 544 a, g dbSNP:372383657
554 554 a, g dbSNP:772522836
555 555 c, g dbSNP:757118786
566 566 c, t dbSNP:574258303
569 569 a, g dbSNP:370617343
582 582 c, t dbSNP:768803063
583 583 c, t dbSNP:749386482
584 584 a, g dbSNP:374354789
604 604 a, g dbSNP:3212057
605 605 c, t dbSNP:751566300
618 618 c, t dbSNP:777400049
623 623 c, t dbSNP:758245729
624 624 a, g dbSNP:752288087
629 629 c, t dbSNP:777169987
641 641 c, g, t dbSNP:368062647
642 642 a, g dbSNP:753331169
644 644 a, g dbSNP:374120119
652 652 c, t dbSNP:577087507
657 657 g, t dbSNP:773795652
662 662 a, g dbSNP:772271531
665 665 c, g dbSNP:762286112
674 674 a, g dbSNP:371455247
675 675 a, c dbSNP:768997440
676 676 c, t dbSNP:749582836
683 683 c, t dbSNP:779977119
685 685 c, g dbSNP:769958215
686 686 c, t dbSNP:746881409
690 690 c, g dbSNP:777779663
699 699 a, t dbSNP:758061550
704 704 a, g dbSNP:752482489
705 705 c, t dbSNP:377685108
706 706 a, g dbSNP:754599485
707 707 c, g dbSNP:753527159
711 711 c, t dbSNP:765763000
713 713 c, t dbSNP:755669319
714 714 a, g dbSNP:750840706
730 730 c, g dbSNP:200124946
734 734 c, t dbSNP:752153707
735 735 a, g dbSNP:146507354
746 746 c, t dbSNP:200567298
748 748 c, t dbSNP:201561134
749 749 a, g dbSNP:765492334
755 755 c, t dbSNP:374168537
756 756 a, g dbSNP:149963487
764 764 a, g, t dbSNP:138987760
771 771 c, t dbSNP:150729160
777 777 c, t dbSNP:141201371
785 785 c, t dbSNP:749117148
787 787 c, t dbSNP:779783228
799 799 c, t dbSNP:199681385
800 800 a, g dbSNP:755779950
801 801 c, t dbSNP:56347206
802 802 a, g dbSNP:546280840
805 805 c, t dbSNP:369021228
807 807 c, t dbSNP:752063855
808 808 a, g dbSNP:778439328
811 811 c, g, t dbSNP:376618856
815 815 c, t dbSNP:28903079
816 816 a, g dbSNP:143171186
825 825 a, g dbSNP:529784964
828 828 c, t dbSNP:759771337
829 829 c, t dbSNP:754035692
830 830 a, g dbSNP:766394376
843 843 c, t dbSNP:56288529
844 844 a, c, g dbSNP:768580716
849 849 c, g dbSNP:762860382
857 857 c, g dbSNP:775335436
861 861 -, ttc dbSNP:774682377
866 866 c, t dbSNP:373040437
867 867 a, g dbSNP:745494547
868 868 a, g dbSNP:781016854
871 871 a, c dbSNP:770508342
872 872 c, t dbSNP:746523890
873 873 a, g dbSNP:777483755
878 878 c, t dbSNP:200230392
879 879 a, g dbSNP:753182555
881 881 c, t dbSNP:544357486
886 886 a, c dbSNP:761343521
890 890 a, c dbSNP:751261262
899 899 a, g dbSNP:146875659
903 903 a, g dbSNP:762464936
909 909 a, t dbSNP:775909166
919 919 c, t dbSNP:372108006
920 920 c, t dbSNP:200213277
921 921 a, g dbSNP:531332562
924 924 c, t dbSNP:761781412
925 925 c, t dbSNP:747150871
927 927 c, t dbSNP:778069090
929 929 -, gt dbSNP:765025885
929 929 a, c, g dbSNP:748230682
933 933 c, t dbSNP:779189770
934 934 a, g dbSNP:756095186
937 937 a, g dbSNP:750418294
938 938 a, c dbSNP:780813014
940 940 g, t dbSNP:776568196
951 951 a, g dbSNP:751118907
955 955 c, t dbSNP:763742114
959 959 c, t dbSNP:41285494
960 960 a, g dbSNP:149642280
963 963 g, t dbSNP:764778351
964 964 c, t dbSNP:759919423
965 965 a, g dbSNP:200948313
969 969 a, g dbSNP:771142980
972 972 a, g dbSNP:761101817
981 981 c, t dbSNP:545840795
982 982 a, g dbSNP:772408011
985 985 a, g dbSNP:201886982
987 987 a, g, t dbSNP:768891111
989 989 a, t dbSNP:368831796
999 999 c, g dbSNP:373720646
1001 1001 a, g dbSNP:376831498
1003 1003 a, c dbSNP:781206798
1005 1005 -, tccgcc dbSNP:761813245
1006 1006 c, t dbSNP:756935758
1007 1007 c, t dbSNP:746816769
1008 1008 a, g dbSNP:777604903
1011 1011 c, t dbSNP:758025766
1026 1026 c, t dbSNP:757719690
1034 1034 c, t dbSNP:138142727
1036 1036 c, t dbSNP:754529357
1040 1040 a, g dbSNP:188768970
1042 1042 a, c dbSNP:766900735
1044 1044 a, c, g dbSNP:773686312
1045 1045 c, t dbSNP:861539
1046 1046 a, g, t dbSNP:79874791
1048 1048 c, t dbSNP:768565346
1050 1050 c, t dbSNP:749394060
1051 1051 a, g dbSNP:77381814
1053 1053 a, g dbSNP:770889808
1054 1054 a, g dbSNP:575587037
1058 1058 a, g dbSNP:566710190
1065 1065 a, g dbSNP:777515106
1073 1073 -, cacagc dbSNP:752714158
1079 1079 c, t dbSNP:200657624
1085 1085 a, c, g dbSNP:778540307
1088 1088 -, gc dbSNP:767691806
1088 1088 c, t dbSNP:373638417
1094 1094 c, t dbSNP:754653129
1106 1106 a, g dbSNP:764416609
1110 1110 a, g dbSNP:145063633
1113 1113 a, g dbSNP:752896177
1124 1124 c, t dbSNP:765302014
1133 1133 c, t dbSNP:759615397
1134 1134 a, g dbSNP:28903080
1137 1137 c, t dbSNP:771984433
1139 1139 a, g dbSNP:761784037
1150 1150 a, g dbSNP:140979846
1154 1154 c, t dbSNP:547969139
1155 1155 a, g dbSNP:548084133
1156 1156 a, g dbSNP:775425367
1158 1158 c, t dbSNP:536822410
1159 1159 a, g dbSNP:745564626
1165 1165 c, t dbSNP:776250580
1169 1169 a, g dbSNP:370905714
1175 1175 c, t dbSNP:747503600
1179 1179 a, g dbSNP:368289157
1182 1182 a, g dbSNP:759008998
1184 1184 c, t dbSNP:748447059
1192 1192 a, g dbSNP:538113920
1193 1193 c, g, t dbSNP:757288071
1221 1221 a, c dbSNP:754089796
1222 1222 a, g, t dbSNP:187038000
1227 1227 c, t dbSNP:751449355
1228 1228 a, g, t dbSNP:28903081
1229 1229 c, t dbSNP:370391238
1230 1230 a, g dbSNP:765167812
1236 1236 a, g dbSNP:267603888
1247 1247 c, t dbSNP:759227523
1248 1248 a, g dbSNP:532124840
1250 1250 a, c dbSNP:770496162
1259 1259 c, t dbSNP:746493086
1260 1260 c, t dbSNP:560239798
1261 1261 a, g dbSNP:546709768
1265 1265 c, t dbSNP:748729904
1269 1269 c, t dbSNP:529825639
1270 1270 a, g dbSNP:561421246
1284 1284 c, g, t dbSNP:780262052
1285 1285 c, g dbSNP:756426742
1287 1287 c, t dbSNP:750457573
1288 1288 -, acctgcccccc dbSNP:748760447
1298 1298 -, c dbSNP:770137120
1301 1301 -, c dbSNP:780557423
1315 1315 a, c, g, t dbSNP:200382220
1316 1316 a, g dbSNP:765078097
1326 1326 a, g dbSNP:759419858
1332 1332 -, g dbSNP:34183054
1333 1333 -, t dbSNP:745775675
1335 1335 c, t dbSNP:753750563
1336 1336 a, g dbSNP:766114040
1351 1351 c, t dbSNP:377185194
1356 1356 a, t dbSNP:760421139
1367 1367 c, t dbSNP:772562364
1368 1368 a, g dbSNP:760585240
1369 1369 a, g dbSNP:762177393
1373 1373 c, t dbSNP:774851674
1374 1374 a, g dbSNP:768944628
1384 1384 c, t dbSNP:575828884
1387 1387 c, t dbSNP:372513712
1388 1388 a, c dbSNP:769885082
1391 1391 c, g dbSNP:746146387
1392 1392 -, cctg dbSNP:768250263
1403 1403 a, c dbSNP:781095418
1404 1404 c, t dbSNP:565417023
1405 1405 a, g dbSNP:370272845
1408 1408 a, t dbSNP:752626065
1411 1411 a, c, t dbSNP:376407692
1432 1432 a, g dbSNP:748375579
1447 1447 a, g dbSNP:767258270
1452 1452 a, c dbSNP:545728746
1488 1488 a, g dbSNP:55748757
1493 1493 c, t dbSNP:552955847
1494 1494 a, g dbSNP:759052213
1509 1509 c, t dbSNP:3212116
1511 1511 c, t dbSNP:773918094
1512 1512 a, g dbSNP:781687008
1612 1612 c, g dbSNP:770390236
1637 1637 a, c, g dbSNP:189909594
1678 1678 c, t dbSNP:554712025
1684 1684 a, g dbSNP:755396661
1689 1689 a, g dbSNP:537630445
1730 1730 a, g dbSNP:569064462
1748 1748 a, g dbSNP:558573491
1757 1757 c, t dbSNP:773761112
1771 1771 a, c dbSNP:538978021
1791 1791 g, t dbSNP:566436220
1812 1812 a, c, t dbSNP:3212117
1823 1823 c, t dbSNP:748617408
1826 1826 c, t dbSNP:34023186
1865 1865 c, t dbSNP:3212118
1866 1866 a, g dbSNP:144660634
1884 1884 -, g dbSNP:34231836
1896 1896 a, g dbSNP:3212119
1897 1897 c, t dbSNP:532243901
1902 1902 a, g dbSNP:565514723
1903 1903 a, g dbSNP:77103957
1916 1916 g, t dbSNP:528762137
1918 1918 c, t dbSNP:559291946
1929 1929 a, c dbSNP:140813869
1949 1949 a, g dbSNP:3212120
1953 1953 a, g dbSNP:557155704
1965 1965 a, g dbSNP:118143436
1967 1967 a, g dbSNP:575338872
1977 1977 a, g dbSNP:3212121
2003 2003 g, t dbSNP:538889498
2018 2018 a, g dbSNP:566795325
2043 2043 c, g dbSNP:536177608
2046 2046 a, g dbSNP:552970909
2056 2056 c, t dbSNP:536232000
2062 2062 c, t dbSNP:567300930
2063 2063 a, g dbSNP:574806963
2081 2081 a, g dbSNP:530638739
2108 2108 a, g dbSNP:571700552
2118 2118 c, t dbSNP:11546527
2147 2147 c, t dbSNP:3212122
2152 2152 c, t dbSNP:3212123
2171 2171 c, t dbSNP:3212124
2172 2172 a, g dbSNP:117875015
2173 2173 g, t dbSNP:542944317
2185 2185 c, t dbSNP:529271454
2199 2199 c, t dbSNP:752549180
2219 2219 c, t dbSNP:11546528
2222 2222 c, g dbSNP:563744794
2232 2232 g, t dbSNP:3212125
2246 2246 c, t dbSNP:578052355
2271 2271 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2276 2276 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2276 2276 -, g dbSNP:528769172
2319 2319 c, g dbSNP:186232444
2322 2322 -, tg dbSNP:559884792
2349 2349 a, g dbSNP:545239247
2356 2356 c, t dbSNP:759264703
2413 2413 c, t dbSNP:751125257
2414 2414 a, g dbSNP:78863423
2417 2417 g, t dbSNP:553300152
2424 2424 -, c dbSNP:34975865
2458 2458 a, g dbSNP:3212126
2468 2468 c, t dbSNP:573515775
2478 2478 c, g dbSNP:75104408
2479 2479 a, c dbSNP:536717537
2481 2481 a, t dbSNP:45625536
2483 2483 -, ag dbSNP:540271138
2508 2508 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_001100118
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu25309D
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, AK022829.1, BX161398.1 and BC002949.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC001036.1, AK022829.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)334..336(+)
Misc Feature(2)418..420(+)
Misc Feature(3)421..1428(+)
Misc Feature(4)661..1431(+)
Misc Feature(5)736..759(+)
Misc Feature(6)742..1056(+)
Misc Feature(7)829..1164(+)
Misc Feature(8)1042..1056(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..157
Gene Synonym:
Exon (3)158..259
Gene Synonym:
Exon (4)260..472
Gene Synonym:
Exon (5)473..610
Gene Synonym:
Exon (6)611..823
Gene Synonym:
Exon (7)824..978
Gene Synonym:
Exon (8)979..1191
Gene Synonym:
Exon (9)1192..1238
Gene Synonym:
Exon (10)1239..2639
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
72 72 c, t dbSNP:750918816
76 76 a, g dbSNP:567960399
102 102 a, g dbSNP:1799794
104 104 a, g dbSNP:537473935
121 121 a, g dbSNP:571372232
137 137 c, t dbSNP:45603942
157 157 a, g dbSNP:373604874
180 180 a, g dbSNP:769776166
233 233 c, g dbSNP:571569002
234 234 a, g dbSNP:551369420
235 235 c, t dbSNP:564381445
236 236 a, g dbSNP:528107761
237 237 a, g dbSNP:774462522
252 252 c, t dbSNP:199632866
288 288 c, t dbSNP:577867073
322 322 c, t dbSNP:564460234
323 323 a, c dbSNP:776306927
372 372 a, t dbSNP:373800330
373 373 c, t dbSNP:778350647
379 379 c, t dbSNP:755493221
382 382 c, g dbSNP:370388004
393 393 a, t dbSNP:56018633
397 397 g, t dbSNP:756505421
411 411 c, t dbSNP:750598578
412 412 a, g dbSNP:376582164
432 432 a, g dbSNP:56377012
436 436 a, g dbSNP:751635577
438 438 c, t dbSNP:764138700
444 444 a, t dbSNP:759485767
459 459 a, t dbSNP:776463599
468 468 c, g dbSNP:770709968
485 485 -, c dbSNP:769719777
485 485 c, t dbSNP:748765569
486 486 a, g dbSNP:776001514
492 492 a, g dbSNP:770282151
494 494 -, agg dbSNP:780945006
500 500 -, t dbSNP:766346302
502 502 c, t dbSNP:546983534
508 508 c, t dbSNP:781514761
519 519 a, c dbSNP:757649541
525 525 a, g dbSNP:747203916
527 527 c, g dbSNP:777869466
530 530 c, t dbSNP:758434542
537 537 c, t dbSNP:752712328
540 540 c, g dbSNP:765461939
542 542 a, c dbSNP:569323871
543 543 c, t dbSNP:756095012
549 549 c, t dbSNP:3212045
550 550 a, g dbSNP:767384633
555 555 c, g dbSNP:530093752
558 558 a, g dbSNP:774000795
567 567 a, g dbSNP:763661308
568 568 a, g dbSNP:766540487
569 569 a, g dbSNP:762734728
571 571 -, gtcc dbSNP:762959042
572 572 c, t dbSNP:117761689
573 573 -, ag dbSNP:773320257
573 573 a, g dbSNP:548048987
578 578 -, cct dbSNP:765292788
583 583 a, c, t dbSNP:372985882
584 584 a, g dbSNP:369879767
589 589 c, t dbSNP:143410843
590 590 a, g dbSNP:139963722
596 596 a, g dbSNP:758533921
608 608 c, t dbSNP:748448131
609 609 a, c dbSNP:779101792
634 634 a, g dbSNP:761300047
638 638 a, g dbSNP:372383657
648 648 a, g dbSNP:772522836
649 649 c, g dbSNP:757118786
660 660 c, t dbSNP:574258303
663 663 a, g dbSNP:370617343
676 676 c, t dbSNP:768803063
677 677 c, t dbSNP:749386482
678 678 a, g dbSNP:374354789
698 698 a, g dbSNP:3212057
699 699 c, t dbSNP:751566300
712 712 c, t dbSNP:777400049
717 717 c, t dbSNP:758245729
718 718 a, g dbSNP:752288087
723 723 c, t dbSNP:777169987
735 735 c, g, t dbSNP:368062647
736 736 a, g dbSNP:753331169
738 738 a, g dbSNP:374120119
746 746 c, t dbSNP:577087507
751 751 g, t dbSNP:773795652
756 756 a, g dbSNP:772271531
759 759 c, g dbSNP:762286112
768 768 a, g dbSNP:371455247
769 769 a, c dbSNP:768997440
770 770 c, t dbSNP:749582836
777 777 c, t dbSNP:779977119
779 779 c, g dbSNP:769958215
780 780 c, t dbSNP:746881409
784 784 c, g dbSNP:777779663
793 793 a, t dbSNP:758061550
798 798 a, g dbSNP:752482489
799 799 c, t dbSNP:377685108
800 800 a, g dbSNP:754599485
801 801 c, g dbSNP:753527159
805 805 c, t dbSNP:765763000
807 807 c, t dbSNP:755669319
808 808 a, g dbSNP:750840706
824 824 c, g dbSNP:200124946
828 828 c, t dbSNP:752153707
829 829 a, g dbSNP:146507354
840 840 c, t dbSNP:200567298
842 842 c, t dbSNP:201561134
843 843 a, g dbSNP:765492334
849 849 c, t dbSNP:374168537
850 850 a, g dbSNP:149963487
858 858 a, g, t dbSNP:138987760
865 865 c, t dbSNP:150729160
871 871 c, t dbSNP:141201371
879 879 c, t dbSNP:749117148
881 881 c, t dbSNP:779783228
893 893 c, t dbSNP:199681385
894 894 a, g dbSNP:755779950
895 895 c, t dbSNP:56347206
896 896 a, g dbSNP:546280840
899 899 c, t dbSNP:369021228
901 901 c, t dbSNP:752063855
902 902 a, g dbSNP:778439328
905 905 c, g, t dbSNP:376618856
909 909 c, t dbSNP:28903079
910 910 a, g dbSNP:143171186
919 919 a, g dbSNP:529784964
922 922 c, t dbSNP:759771337
923 923 c, t dbSNP:754035692
924 924 a, g dbSNP:766394376
937 937 c, t dbSNP:56288529
938 938 a, c, g dbSNP:768580716
943 943 c, g dbSNP:762860382
951 951 c, g dbSNP:775335436
955 955 -, ttc dbSNP:774682377
960 960 c, t dbSNP:373040437
961 961 a, g dbSNP:745494547
962 962 a, g dbSNP:781016854
965 965 a, c dbSNP:770508342
966 966 c, t dbSNP:746523890
967 967 a, g dbSNP:777483755
972 972 c, t dbSNP:200230392
973 973 a, g dbSNP:753182555
975 975 c, t dbSNP:544357486
980 980 a, c dbSNP:761343521
984 984 a, c dbSNP:751261262
993 993 a, g dbSNP:146875659
997 997 a, g dbSNP:762464936
1003 1003 a, t dbSNP:775909166
1013 1013 c, t dbSNP:372108006
1014 1014 c, t dbSNP:200213277
1015 1015 a, g dbSNP:531332562
1018 1018 c, t dbSNP:761781412
1019 1019 c, t dbSNP:747150871
1021 1021 c, t dbSNP:778069090
1023 1023 -, gt dbSNP:765025885
1023 1023 a, c, g dbSNP:748230682
1027 1027 c, t dbSNP:779189770
1028 1028 a, g dbSNP:756095186
1031 1031 a, g dbSNP:750418294
1032 1032 a, c dbSNP:780813014
1034 1034 g, t dbSNP:776568196
1045 1045 a, g dbSNP:751118907
1049 1049 c, t dbSNP:763742114
1053 1053 c, t dbSNP:41285494
1054 1054 a, g dbSNP:149642280
1057 1057 g, t dbSNP:764778351
1058 1058 c, t dbSNP:759919423
1059 1059 a, g dbSNP:200948313
1063 1063 a, g dbSNP:771142980
1066 1066 a, g dbSNP:761101817
1075 1075 c, t dbSNP:545840795
1076 1076 a, g dbSNP:772408011
1079 1079 a, g dbSNP:201886982
1081 1081 a, g, t dbSNP:768891111
1083 1083 a, t dbSNP:368831796
1093 1093 c, g dbSNP:373720646
1095 1095 a, g dbSNP:376831498
1097 1097 a, c dbSNP:781206798
1099 1099 -, tccgcc dbSNP:761813245
1100 1100 c, t dbSNP:756935758
1101 1101 c, t dbSNP:746816769
1102 1102 a, g dbSNP:777604903
1105 1105 c, t dbSNP:758025766
1120 1120 c, t dbSNP:757719690
1128 1128 c, t dbSNP:138142727
1130 1130 c, t dbSNP:754529357
1134 1134 a, g dbSNP:188768970
1136 1136 a, c dbSNP:766900735
1138 1138 a, c, g dbSNP:773686312
1139 1139 c, t dbSNP:861539
1140 1140 a, g, t dbSNP:79874791
1142 1142 c, t dbSNP:768565346
1144 1144 c, t dbSNP:749394060
1145 1145 a, g dbSNP:77381814
1147 1147 a, g dbSNP:770889808
1148 1148 a, g dbSNP:575587037
1152 1152 a, g dbSNP:566710190
1159 1159 a, g dbSNP:777515106
1167 1167 -, cacagc dbSNP:752714158
1173 1173 c, t dbSNP:200657624
1179 1179 a, c, g dbSNP:778540307
1182 1182 -, gc dbSNP:767691806
1182 1182 c, t dbSNP:373638417
1188 1188 c, t dbSNP:754653129
1200 1200 a, g dbSNP:764416609
1204 1204 a, g dbSNP:145063633
1207 1207 a, g dbSNP:752896177
1218 1218 c, t dbSNP:765302014
1227 1227 c, t dbSNP:759615397
1228 1228 a, g dbSNP:28903080
1231 1231 c, t dbSNP:771984433
1233 1233 a, g dbSNP:761784037
1244 1244 a, g dbSNP:140979846
1248 1248 c, t dbSNP:547969139
1249 1249 a, g dbSNP:548084133
1250 1250 a, g dbSNP:775425367
1252 1252 c, t dbSNP:536822410
1253 1253 a, g dbSNP:745564626
1259 1259 c, t dbSNP:776250580
1263 1263 a, g dbSNP:370905714
1269 1269 c, t dbSNP:747503600
1273 1273 a, g dbSNP:368289157
1276 1276 a, g dbSNP:759008998
1278 1278 c, t dbSNP:748447059
1286 1286 a, g dbSNP:538113920
1287 1287 c, g, t dbSNP:757288071
1315 1315 a, c dbSNP:754089796
1316 1316 a, g, t dbSNP:187038000
1321 1321 c, t dbSNP:751449355
1322 1322 a, g, t dbSNP:28903081
1323 1323 c, t dbSNP:370391238
1324 1324 a, g dbSNP:765167812
1330 1330 a, g dbSNP:267603888
1341 1341 c, t dbSNP:759227523
1342 1342 a, g dbSNP:532124840
1344 1344 a, c dbSNP:770496162
1353 1353 c, t dbSNP:746493086
1354 1354 c, t dbSNP:560239798
1355 1355 a, g dbSNP:546709768
1359 1359 c, t dbSNP:748729904
1363 1363 c, t dbSNP:529825639
1364 1364 a, g dbSNP:561421246
1378 1378 c, g, t dbSNP:780262052
1379 1379 c, g dbSNP:756426742
1381 1381 c, t dbSNP:750457573
1382 1382 -, acctgcccccc dbSNP:748760447
1392 1392 -, c dbSNP:770137120
1395 1395 -, c dbSNP:780557423
1409 1409 a, c, g, t dbSNP:200382220
1410 1410 a, g dbSNP:765078097
1420 1420 a, g dbSNP:759419858
1426 1426 -, g dbSNP:34183054
1427 1427 -, t dbSNP:745775675
1429 1429 c, t dbSNP:753750563
1430 1430 a, g dbSNP:766114040
1445 1445 c, t dbSNP:377185194
1450 1450 a, t dbSNP:760421139
1461 1461 c, t dbSNP:772562364
1462 1462 a, g dbSNP:760585240
1463 1463 a, g dbSNP:762177393
1467 1467 c, t dbSNP:774851674
1468 1468 a, g dbSNP:768944628
1478 1478 c, t dbSNP:575828884
1481 1481 c, t dbSNP:372513712
1482 1482 a, c dbSNP:769885082
1485 1485 c, g dbSNP:746146387
1486 1486 -, cctg dbSNP:768250263
1497 1497 a, c dbSNP:781095418
1498 1498 c, t dbSNP:565417023
1499 1499 a, g dbSNP:370272845
1502 1502 a, t dbSNP:752626065
1505 1505 a, c, t dbSNP:376407692
1526 1526 a, g dbSNP:748375579
1541 1541 a, g dbSNP:767258270
1546 1546 a, c dbSNP:545728746
1582 1582 a, g dbSNP:55748757
1587 1587 c, t dbSNP:552955847
1588 1588 a, g dbSNP:759052213
1603 1603 c, t dbSNP:3212116
1605 1605 c, t dbSNP:773918094
1606 1606 a, g dbSNP:781687008
1706 1706 c, g dbSNP:770390236
1731 1731 a, c, g dbSNP:189909594
1772 1772 c, t dbSNP:554712025
1778 1778 a, g dbSNP:755396661
1783 1783 a, g dbSNP:537630445
1824 1824 a, g dbSNP:569064462
1842 1842 a, g dbSNP:558573491
1851 1851 c, t dbSNP:773761112
1865 1865 a, c dbSNP:538978021
1885 1885 g, t dbSNP:566436220
1906 1906 a, c, t dbSNP:3212117
1917 1917 c, t dbSNP:748617408
1920 1920 c, t dbSNP:34023186
1959 1959 c, t dbSNP:3212118
1960 1960 a, g dbSNP:144660634
1978 1978 -, g dbSNP:34231836
1990 1990 a, g dbSNP:3212119
1991 1991 c, t dbSNP:532243901
1996 1996 a, g dbSNP:565514723
1997 1997 a, g dbSNP:77103957
2010 2010 g, t dbSNP:528762137
2012 2012 c, t dbSNP:559291946
2023 2023 a, c dbSNP:140813869
2043 2043 a, g dbSNP:3212120
2047 2047 a, g dbSNP:557155704
2059 2059 a, g dbSNP:118143436
2061 2061 a, g dbSNP:575338872
2071 2071 a, g dbSNP:3212121
2097 2097 g, t dbSNP:538889498
2112 2112 a, g dbSNP:566795325
2137 2137 c, g dbSNP:536177608
2140 2140 a, g dbSNP:552970909
2150 2150 c, t dbSNP:536232000
2156 2156 c, t dbSNP:567300930
2157 2157 a, g dbSNP:574806963
2175 2175 a, g dbSNP:530638739
2202 2202 a, g dbSNP:571700552
2212 2212 c, t dbSNP:11546527
2241 2241 c, t dbSNP:3212122
2246 2246 c, t dbSNP:3212123
2265 2265 c, t dbSNP:3212124
2266 2266 a, g dbSNP:117875015
2267 2267 g, t dbSNP:542944317
2279 2279 c, t dbSNP:529271454
2293 2293 c, t dbSNP:752549180
2313 2313 c, t dbSNP:11546528
2316 2316 c, g dbSNP:563744794
2326 2326 g, t dbSNP:3212125
2340 2340 c, t dbSNP:578052355
2365 2365 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2370 2370 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2370 2370 -, g dbSNP:528769172
2413 2413 c, g dbSNP:186232444
2416 2416 -, tg dbSNP:559884792
2443 2443 a, g dbSNP:545239247
2450 2450 c, t dbSNP:759264703
2507 2507 c, t dbSNP:751125257
2508 2508 a, g dbSNP:78863423
2511 2511 g, t dbSNP:553300152
2518 2518 -, c dbSNP:34975865
2552 2552 a, g dbSNP:3212126
2562 2562 c, t dbSNP:573515775
2572 2572 c, g dbSNP:75104408
2573 2573 a, c dbSNP:536717537
2575 2575 a, t dbSNP:45625536
2577 2577 -, ag dbSNP:540271138
2602 2602 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_001100119
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.