
XRCC3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol XRCC3
Entrez Gene ID 7517
Full Name X-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms CMM6
General protein information
Preferred Names
DNA repair protein XRCC3
DNA repair protein XRCC3
X-ray repair cross-complementing protein 3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Melanoma, cutaneous malignant, susceptibility to, 6} (3); {Breast

mRNA and Protein(s)

mRNA Protein Name
XM_011537138 XP_011535440 DNA repair protein XRCC3 isoform X1
XM_005268046 XP_005268103 DNA repair protein XRCC3 isoform X1
NM_005432 NP_005423 DNA repair protein XRCC3
NM_001100118 NP_001093588 DNA repair protein XRCC3
NM_001100119 NP_001093589 DNA repair protein XRCC3

hsa03440 Homologous recombination
WP1601 Fluoropyrimidine Activity
WP1984 Integrated Breast Cancer Pathway

Homo sapiens (human) XRCC3 NP_001093588.1
Pan troglodytes (chimpanzee) XRCC3 XP_003314577.1
Macaca mulatta (Rhesus monkey) XRCC3 XP_001083970.1
Canis lupus familiaris (dog) XRCC3 XP_003435154.1
Bos taurus (cattle) XRCC3 NP_001071585.1
Mus musculus (house mouse) Xrcc3 NP_083151.1
Rattus norvegicus (Norway rat) LOC102551085 XP_006240711.1
Gallus gallus (chicken) XRCC3 NP_001006489.1
Danio rerio (zebrafish) xrcc3 NP_001013559.1
Drosophila melanogaster (fruit fly) spn-B NP_476740.1
Arabidopsis thaliana (thale cress) XRCC3 NP_851202.1
Xenopus (Silurana) tropicalis (western clawed frog) xrcc3 NP_001016141.1


ID Name Evidence
GO:0005634 nucleus IDA
GO:0005737 cytoplasm IDA
GO:0005739 mitochondrion IDA
GO:0048471 perinuclear region of cytoplasm IDA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0003677 DNA binding IEA
GO:0005524 ATP binding IEA
GO:0008094 DNA-dependent ATPase activity IEA


ID Name Evidence
GO:0006281 DNA repair IGI
GO:0006310 DNA recombination IEA
GO:0006974 response to DNA damage stimulus TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following XRCC3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the XRCC3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_011537138 PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
XM_005268046 PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_005432 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001100118 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001100119 Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu25309
Accession Version XM_011537138.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)367..1374(+)
Misc Feature(2)607..1377(+)
Misc Feature(3)682..705(+)
Misc Feature(4)688..1002(+)
Misc Feature(5)775..1110(+)
Misc Feature(6)988..1002(+)
Position Chain Variation Link
8 8 a, c dbSNP:527896479
14 14 a, g dbSNP:561980080
48 48 a, g dbSNP:1799794
50 50 a, g dbSNP:537473935
67 67 a, g dbSNP:571372232
83 83 c, t dbSNP:45603942
103 103 a, g dbSNP:373604874
126 126 a, g dbSNP:769776166
179 179 c, g dbSNP:571569002
180 180 a, g dbSNP:551369420
181 181 c, t dbSNP:564381445
182 182 a, g dbSNP:528107761
183 183 a, g dbSNP:774462522
198 198 c, t dbSNP:199632866
234 234 c, t dbSNP:577867073
268 268 c, t dbSNP:564460234
269 269 a, c dbSNP:776306927
318 318 a, t dbSNP:373800330
319 319 c, t dbSNP:778350647
325 325 c, t dbSNP:755493221
328 328 c, g dbSNP:370388004
339 339 a, t dbSNP:56018633
343 343 g, t dbSNP:756505421
357 357 c, t dbSNP:750598578
358 358 a, g dbSNP:376582164
378 378 a, g dbSNP:56377012
382 382 a, g dbSNP:751635577
384 384 c, t dbSNP:764138700
390 390 a, t dbSNP:759485767
405 405 a, t dbSNP:776463599
414 414 c, g dbSNP:770709968
431 431 -, c dbSNP:769719777
431 431 c, t dbSNP:748765569
432 432 a, g dbSNP:776001514
438 438 a, g dbSNP:770282151
440 440 -, agg dbSNP:780945006
446 446 -, t dbSNP:766346302
448 448 c, t dbSNP:546983534
454 454 c, t dbSNP:781514761
465 465 a, c dbSNP:757649541
471 471 a, g dbSNP:747203916
473 473 c, g dbSNP:777869466
476 476 c, t dbSNP:758434542
483 483 c, t dbSNP:752712328
486 486 c, g dbSNP:765461939
488 488 a, c dbSNP:569323871
489 489 c, t dbSNP:756095012
495 495 c, t dbSNP:3212045
496 496 a, g dbSNP:767384633
501 501 c, g dbSNP:530093752
504 504 a, g dbSNP:774000795
513 513 a, g dbSNP:763661308
514 514 a, g dbSNP:766540487
515 515 a, g dbSNP:762734728
517 517 -, gtcc dbSNP:762959042
518 518 c, t dbSNP:117761689
519 519 -, ag dbSNP:773320257
519 519 a, g dbSNP:548048987
524 524 -, cct dbSNP:765292788
529 529 a, c, t dbSNP:372985882
530 530 a, g dbSNP:369879767
535 535 c, t dbSNP:143410843
536 536 a, g dbSNP:139963722
542 542 a, g dbSNP:758533921
554 554 c, t dbSNP:748448131
555 555 a, c dbSNP:779101792
580 580 a, g dbSNP:761300047
584 584 a, g dbSNP:372383657
594 594 a, g dbSNP:772522836
595 595 c, g dbSNP:757118786
606 606 c, t dbSNP:574258303
609 609 a, g dbSNP:370617343
622 622 c, t dbSNP:768803063
623 623 c, t dbSNP:749386482
624 624 a, g dbSNP:374354789
644 644 a, g dbSNP:3212057
645 645 c, t dbSNP:751566300
658 658 c, t dbSNP:777400049
663 663 c, t dbSNP:758245729
664 664 a, g dbSNP:752288087
669 669 c, t dbSNP:777169987
681 681 c, g, t dbSNP:368062647
682 682 a, g dbSNP:753331169
684 684 a, g dbSNP:374120119
692 692 c, t dbSNP:577087507
697 697 g, t dbSNP:773795652
702 702 a, g dbSNP:772271531
705 705 c, g dbSNP:762286112
714 714 a, g dbSNP:371455247
715 715 a, c dbSNP:768997440
716 716 c, t dbSNP:749582836
723 723 c, t dbSNP:779977119
725 725 c, g dbSNP:769958215
726 726 c, t dbSNP:746881409
730 730 c, g dbSNP:777779663
739 739 a, t dbSNP:758061550
744 744 a, g dbSNP:752482489
745 745 c, t dbSNP:377685108
746 746 a, g dbSNP:754599485
747 747 c, g dbSNP:753527159
751 751 c, t dbSNP:765763000
753 753 c, t dbSNP:755669319
754 754 a, g dbSNP:750840706
770 770 c, g dbSNP:200124946
774 774 c, t dbSNP:752153707
775 775 a, g dbSNP:146507354
786 786 c, t dbSNP:200567298
788 788 c, t dbSNP:201561134
789 789 a, g dbSNP:765492334
795 795 c, t dbSNP:374168537
796 796 a, g dbSNP:149963487
804 804 a, g, t dbSNP:138987760
811 811 c, t dbSNP:150729160
817 817 c, t dbSNP:141201371
825 825 c, t dbSNP:749117148
827 827 c, t dbSNP:779783228
839 839 c, t dbSNP:199681385
840 840 a, g dbSNP:755779950
841 841 c, t dbSNP:56347206
842 842 a, g dbSNP:546280840
845 845 c, t dbSNP:369021228
847 847 c, t dbSNP:752063855
848 848 a, g dbSNP:778439328
851 851 c, g, t dbSNP:376618856
855 855 c, t dbSNP:28903079
856 856 a, g dbSNP:143171186
865 865 a, g dbSNP:529784964
868 868 c, t dbSNP:759771337
869 869 c, t dbSNP:754035692
870 870 a, g dbSNP:766394376
883 883 c, t dbSNP:56288529
884 884 a, c, g dbSNP:768580716
889 889 c, g dbSNP:762860382
897 897 c, g dbSNP:775335436
901 901 -, ttc dbSNP:774682377
906 906 c, t dbSNP:373040437
907 907 a, g dbSNP:745494547
908 908 a, g dbSNP:781016854
911 911 a, c dbSNP:770508342
912 912 c, t dbSNP:746523890
913 913 a, g dbSNP:777483755
918 918 c, t dbSNP:200230392
919 919 a, g dbSNP:753182555
921 921 c, t dbSNP:544357486
926 926 a, c dbSNP:761343521
930 930 a, c dbSNP:751261262
939 939 a, g dbSNP:146875659
943 943 a, g dbSNP:762464936
949 949 a, t dbSNP:775909166
959 959 c, t dbSNP:372108006
960 960 c, t dbSNP:200213277
961 961 a, g dbSNP:531332562
964 964 c, t dbSNP:761781412
965 965 c, t dbSNP:747150871
967 967 c, t dbSNP:778069090
969 969 -, gt dbSNP:765025885
969 969 a, c, g dbSNP:748230682
973 973 c, t dbSNP:779189770
974 974 a, g dbSNP:756095186
977 977 a, g dbSNP:750418294
978 978 a, c dbSNP:780813014
980 980 g, t dbSNP:776568196
991 991 a, g dbSNP:751118907
995 995 c, t dbSNP:763742114
999 999 c, t dbSNP:41285494
1000 1000 a, g dbSNP:149642280
1003 1003 g, t dbSNP:764778351
1004 1004 c, t dbSNP:759919423
1005 1005 a, g dbSNP:200948313
1009 1009 a, g dbSNP:771142980
1012 1012 a, g dbSNP:761101817
1021 1021 c, t dbSNP:545840795
1022 1022 a, g dbSNP:772408011
1025 1025 a, g dbSNP:201886982
1027 1027 a, g, t dbSNP:768891111
1029 1029 a, t dbSNP:368831796
1039 1039 c, g dbSNP:373720646
1041 1041 a, g dbSNP:376831498
1043 1043 a, c dbSNP:781206798
1045 1045 -, tccgcc dbSNP:761813245
1046 1046 c, t dbSNP:756935758
1047 1047 c, t dbSNP:746816769
1048 1048 a, g dbSNP:777604903
1051 1051 c, t dbSNP:758025766
1066 1066 c, t dbSNP:757719690
1074 1074 c, t dbSNP:138142727
1076 1076 c, t dbSNP:754529357
1080 1080 a, g dbSNP:188768970
1082 1082 a, c dbSNP:766900735
1084 1084 a, c, g dbSNP:773686312
1085 1085 c, t dbSNP:861539
1086 1086 a, g, t dbSNP:79874791
1088 1088 c, t dbSNP:768565346
1090 1090 c, t dbSNP:749394060
1091 1091 a, g dbSNP:77381814
1093 1093 a, g dbSNP:770889808
1094 1094 a, g dbSNP:575587037
1098 1098 a, g dbSNP:566710190
1105 1105 a, g dbSNP:777515106
1113 1113 -, cacagc dbSNP:752714158
1119 1119 c, t dbSNP:200657624
1125 1125 a, c, g dbSNP:778540307
1128 1128 -, gc dbSNP:767691806
1128 1128 c, t dbSNP:373638417
1134 1134 c, t dbSNP:754653129
1146 1146 a, g dbSNP:764416609
1150 1150 a, g dbSNP:145063633
1153 1153 a, g dbSNP:752896177
1164 1164 c, t dbSNP:765302014
1173 1173 c, t dbSNP:759615397
1174 1174 a, g dbSNP:28903080
1177 1177 c, t dbSNP:771984433
1179 1179 a, g dbSNP:761784037
1190 1190 a, g dbSNP:140979846
1194 1194 c, t dbSNP:547969139
1195 1195 a, g dbSNP:548084133
1196 1196 a, g dbSNP:775425367
1198 1198 c, t dbSNP:536822410
1199 1199 a, g dbSNP:745564626
1205 1205 c, t dbSNP:776250580
1209 1209 a, g dbSNP:370905714
1215 1215 c, t dbSNP:747503600
1219 1219 a, g dbSNP:368289157
1222 1222 a, g dbSNP:759008998
1224 1224 c, t dbSNP:748447059
1232 1232 a, g dbSNP:538113920
1233 1233 c, g, t dbSNP:757288071
1261 1261 a, c dbSNP:754089796
1262 1262 a, g, t dbSNP:187038000
1267 1267 c, t dbSNP:751449355
1268 1268 a, g, t dbSNP:28903081
1269 1269 c, t dbSNP:370391238
1270 1270 a, g dbSNP:765167812
1276 1276 a, g dbSNP:267603888
1287 1287 c, t dbSNP:759227523
1288 1288 a, g dbSNP:532124840
1290 1290 a, c dbSNP:770496162
1299 1299 c, t dbSNP:746493086
1300 1300 c, t dbSNP:560239798
1301 1301 a, g dbSNP:546709768
1305 1305 c, t dbSNP:748729904
1309 1309 c, t dbSNP:529825639
1310 1310 a, g dbSNP:561421246
1324 1324 c, g, t dbSNP:780262052
1325 1325 c, g dbSNP:756426742
1327 1327 c, t dbSNP:750457573
1328 1328 -, acctgcccccc dbSNP:748760447
1338 1338 -, c dbSNP:770137120
1341 1341 -, c dbSNP:780557423
1355 1355 a, c, g, t dbSNP:200382220
1356 1356 a, g dbSNP:765078097
1366 1366 a, g dbSNP:759419858
1372 1372 -, g dbSNP:34183054
1373 1373 -, t dbSNP:745775675
1375 1375 c, t dbSNP:753750563
1376 1376 a, g dbSNP:766114040
1391 1391 c, t dbSNP:377185194
1396 1396 a, t dbSNP:760421139
1407 1407 c, t dbSNP:772562364
1408 1408 a, g dbSNP:760585240
1409 1409 a, g dbSNP:762177393
1413 1413 c, t dbSNP:774851674
1414 1414 a, g dbSNP:768944628
1424 1424 c, t dbSNP:575828884
1427 1427 c, t dbSNP:372513712
1428 1428 a, c dbSNP:769885082
1431 1431 c, g dbSNP:746146387
1432 1432 -, cctg dbSNP:768250263
1443 1443 a, c dbSNP:781095418
1444 1444 c, t dbSNP:565417023
1445 1445 a, g dbSNP:370272845
1448 1448 a, t dbSNP:752626065
1451 1451 a, c, t dbSNP:376407692
1472 1472 a, g dbSNP:748375579
1487 1487 a, g dbSNP:767258270
1492 1492 a, c dbSNP:545728746
1528 1528 a, g dbSNP:55748757
1533 1533 c, t dbSNP:552955847
1534 1534 a, g dbSNP:759052213
1549 1549 c, t dbSNP:3212116
1551 1551 c, t dbSNP:773918094
1552 1552 a, g dbSNP:781687008
1652 1652 c, g dbSNP:770390236
1677 1677 a, c, g dbSNP:189909594
1718 1718 c, t dbSNP:554712025
1724 1724 a, g dbSNP:755396661
1729 1729 a, g dbSNP:537630445
1770 1770 a, g dbSNP:569064462
1788 1788 a, g dbSNP:558573491
1797 1797 c, t dbSNP:773761112
1811 1811 a, c dbSNP:538978021
1831 1831 g, t dbSNP:566436220
1852 1852 a, c, t dbSNP:3212117
1863 1863 c, t dbSNP:748617408
1866 1866 c, t dbSNP:34023186
1905 1905 c, t dbSNP:3212118
1906 1906 a, g dbSNP:144660634
1924 1924 -, g dbSNP:34231836
1936 1936 a, g dbSNP:3212119
1937 1937 c, t dbSNP:532243901
1942 1942 a, g dbSNP:565514723
1943 1943 a, g dbSNP:77103957
1956 1956 g, t dbSNP:528762137
1958 1958 c, t dbSNP:559291946
1969 1969 a, c dbSNP:140813869
1989 1989 a, g dbSNP:3212120
1993 1993 a, g dbSNP:557155704
2005 2005 a, g dbSNP:118143436
2007 2007 a, g dbSNP:575338872
2017 2017 a, g dbSNP:3212121
2043 2043 g, t dbSNP:538889498
2058 2058 a, g dbSNP:566795325
2083 2083 c, g dbSNP:536177608
2086 2086 a, g dbSNP:552970909
2096 2096 c, t dbSNP:536232000
2102 2102 c, t dbSNP:567300930
2103 2103 a, g dbSNP:574806963
2121 2121 a, g dbSNP:530638739
2148 2148 a, g dbSNP:571700552
2158 2158 c, t dbSNP:11546527
2187 2187 c, t dbSNP:3212122
2192 2192 c, t dbSNP:3212123
2211 2211 c, t dbSNP:3212124
2212 2212 a, g dbSNP:117875015
2213 2213 g, t dbSNP:542944317
2225 2225 c, t dbSNP:529271454
2239 2239 c, t dbSNP:752549180
2259 2259 c, t dbSNP:11546528
2262 2262 c, g dbSNP:563744794
2272 2272 g, t dbSNP:3212125
2286 2286 c, t dbSNP:578052355
2311 2311 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2316 2316 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2316 2316 -, g dbSNP:528769172
2359 2359 c, g dbSNP:186232444
2362 2362 -, tg dbSNP:559884792
2389 2389 a, g dbSNP:545239247
2396 2396 c, t dbSNP:759264703
2453 2453 c, t dbSNP:751125257
2454 2454 a, g dbSNP:78863423
2457 2457 g, t dbSNP:553300152
2464 2464 -, c dbSNP:34975865
2498 2498 a, g dbSNP:3212126
2508 2508 c, t dbSNP:573515775
2518 2518 c, g dbSNP:75104408
2519 2519 a, c dbSNP:536717537
2521 2521 a, t dbSNP:45625536
2523 2523 -, ag dbSNP:540271138
2548 2548 a, g dbSNP:571332532
2589 2589 a, c dbSNP:762493634

Target ORF information:

RefSeq Version XM_011537138
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25309
Accession Version XM_005268046.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)421..1428(+)
Misc Feature(2)661..1431(+)
Misc Feature(3)736..759(+)
Misc Feature(4)742..1056(+)
Misc Feature(5)829..1164(+)
Misc Feature(6)1042..1056(+)
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
80 80 a, g dbSNP:760925000
95 95 c, t dbSNP:563666739
96 96 a, c, g dbSNP:55653926
109 109 a, g dbSNP:759662161
112 112 c, g dbSNP:530785814
151 151 c, t dbSNP:549945919
153 153 c, t dbSNP:775350941
180 180 a, g dbSNP:769776166
233 233 c, g dbSNP:571569002
234 234 a, g dbSNP:551369420
235 235 c, t dbSNP:564381445
236 236 a, g dbSNP:528107761
237 237 a, g dbSNP:774462522
252 252 c, t dbSNP:199632866
288 288 c, t dbSNP:577867073
322 322 c, t dbSNP:564460234
323 323 a, c dbSNP:776306927
372 372 a, t dbSNP:373800330
373 373 c, t dbSNP:778350647
379 379 c, t dbSNP:755493221
382 382 c, g dbSNP:370388004
393 393 a, t dbSNP:56018633
397 397 g, t dbSNP:756505421
411 411 c, t dbSNP:750598578
412 412 a, g dbSNP:376582164
432 432 a, g dbSNP:56377012
436 436 a, g dbSNP:751635577
438 438 c, t dbSNP:764138700
444 444 a, t dbSNP:759485767
459 459 a, t dbSNP:776463599
468 468 c, g dbSNP:770709968
485 485 -, c dbSNP:769719777
485 485 c, t dbSNP:748765569
486 486 a, g dbSNP:776001514
492 492 a, g dbSNP:770282151
494 494 -, agg dbSNP:780945006
500 500 -, t dbSNP:766346302
502 502 c, t dbSNP:546983534
508 508 c, t dbSNP:781514761
519 519 a, c dbSNP:757649541
525 525 a, g dbSNP:747203916
527 527 c, g dbSNP:777869466
530 530 c, t dbSNP:758434542
537 537 c, t dbSNP:752712328
540 540 c, g dbSNP:765461939
542 542 a, c dbSNP:569323871
543 543 c, t dbSNP:756095012
549 549 c, t dbSNP:3212045
550 550 a, g dbSNP:767384633
555 555 c, g dbSNP:530093752
558 558 a, g dbSNP:774000795
567 567 a, g dbSNP:763661308
568 568 a, g dbSNP:766540487
569 569 a, g dbSNP:762734728
571 571 -, gtcc dbSNP:762959042
572 572 c, t dbSNP:117761689
573 573 -, ag dbSNP:773320257
573 573 a, g dbSNP:548048987
578 578 -, cct dbSNP:765292788
583 583 a, c, t dbSNP:372985882
584 584 a, g dbSNP:369879767
589 589 c, t dbSNP:143410843
590 590 a, g dbSNP:139963722
596 596 a, g dbSNP:758533921
608 608 c, t dbSNP:748448131
609 609 a, c dbSNP:779101792
634 634 a, g dbSNP:761300047
638 638 a, g dbSNP:372383657
648 648 a, g dbSNP:772522836
649 649 c, g dbSNP:757118786
660 660 c, t dbSNP:574258303
663 663 a, g dbSNP:370617343
676 676 c, t dbSNP:768803063
677 677 c, t dbSNP:749386482
678 678 a, g dbSNP:374354789
698 698 a, g dbSNP:3212057
699 699 c, t dbSNP:751566300
712 712 c, t dbSNP:777400049
717 717 c, t dbSNP:758245729
718 718 a, g dbSNP:752288087
723 723 c, t dbSNP:777169987
735 735 c, g, t dbSNP:368062647
736 736 a, g dbSNP:753331169
738 738 a, g dbSNP:374120119
746 746 c, t dbSNP:577087507
751 751 g, t dbSNP:773795652
756 756 a, g dbSNP:772271531
759 759 c, g dbSNP:762286112
768 768 a, g dbSNP:371455247
769 769 a, c dbSNP:768997440
770 770 c, t dbSNP:749582836
777 777 c, t dbSNP:779977119
779 779 c, g dbSNP:769958215
780 780 c, t dbSNP:746881409
784 784 c, g dbSNP:777779663
793 793 a, t dbSNP:758061550
798 798 a, g dbSNP:752482489
799 799 c, t dbSNP:377685108
800 800 a, g dbSNP:754599485
801 801 c, g dbSNP:753527159
805 805 c, t dbSNP:765763000
807 807 c, t dbSNP:755669319
808 808 a, g dbSNP:750840706
824 824 c, g dbSNP:200124946
828 828 c, t dbSNP:752153707
829 829 a, g dbSNP:146507354
840 840 c, t dbSNP:200567298
842 842 c, t dbSNP:201561134
843 843 a, g dbSNP:765492334
849 849 c, t dbSNP:374168537
850 850 a, g dbSNP:149963487
858 858 a, g, t dbSNP:138987760
865 865 c, t dbSNP:150729160
871 871 c, t dbSNP:141201371
879 879 c, t dbSNP:749117148
881 881 c, t dbSNP:779783228
893 893 c, t dbSNP:199681385
894 894 a, g dbSNP:755779950
895 895 c, t dbSNP:56347206
896 896 a, g dbSNP:546280840
899 899 c, t dbSNP:369021228
901 901 c, t dbSNP:752063855
902 902 a, g dbSNP:778439328
905 905 c, g, t dbSNP:376618856
909 909 c, t dbSNP:28903079
910 910 a, g dbSNP:143171186
919 919 a, g dbSNP:529784964
922 922 c, t dbSNP:759771337
923 923 c, t dbSNP:754035692
924 924 a, g dbSNP:766394376
937 937 c, t dbSNP:56288529
938 938 a, c, g dbSNP:768580716
943 943 c, g dbSNP:762860382
951 951 c, g dbSNP:775335436
955 955 -, ttc dbSNP:774682377
960 960 c, t dbSNP:373040437
961 961 a, g dbSNP:745494547
962 962 a, g dbSNP:781016854
965 965 a, c dbSNP:770508342
966 966 c, t dbSNP:746523890
967 967 a, g dbSNP:777483755
972 972 c, t dbSNP:200230392
973 973 a, g dbSNP:753182555
975 975 c, t dbSNP:544357486
980 980 a, c dbSNP:761343521
984 984 a, c dbSNP:751261262
993 993 a, g dbSNP:146875659
997 997 a, g dbSNP:762464936
1003 1003 a, t dbSNP:775909166
1013 1013 c, t dbSNP:372108006
1014 1014 c, t dbSNP:200213277
1015 1015 a, g dbSNP:531332562
1018 1018 c, t dbSNP:761781412
1019 1019 c, t dbSNP:747150871
1021 1021 c, t dbSNP:778069090
1023 1023 -, gt dbSNP:765025885
1023 1023 a, c, g dbSNP:748230682
1027 1027 c, t dbSNP:779189770
1028 1028 a, g dbSNP:756095186
1031 1031 a, g dbSNP:750418294
1032 1032 a, c dbSNP:780813014
1034 1034 g, t dbSNP:776568196
1045 1045 a, g dbSNP:751118907
1049 1049 c, t dbSNP:763742114
1053 1053 c, t dbSNP:41285494
1054 1054 a, g dbSNP:149642280
1057 1057 g, t dbSNP:764778351
1058 1058 c, t dbSNP:759919423
1059 1059 a, g dbSNP:200948313
1063 1063 a, g dbSNP:771142980
1066 1066 a, g dbSNP:761101817
1075 1075 c, t dbSNP:545840795
1076 1076 a, g dbSNP:772408011
1079 1079 a, g dbSNP:201886982
1081 1081 a, g, t dbSNP:768891111
1083 1083 a, t dbSNP:368831796
1093 1093 c, g dbSNP:373720646
1095 1095 a, g dbSNP:376831498
1097 1097 a, c dbSNP:781206798
1099 1099 -, tccgcc dbSNP:761813245
1100 1100 c, t dbSNP:756935758
1101 1101 c, t dbSNP:746816769
1102 1102 a, g dbSNP:777604903
1105 1105 c, t dbSNP:758025766
1120 1120 c, t dbSNP:757719690
1128 1128 c, t dbSNP:138142727
1130 1130 c, t dbSNP:754529357
1134 1134 a, g dbSNP:188768970
1136 1136 a, c dbSNP:766900735
1138 1138 a, c, g dbSNP:773686312
1139 1139 c, t dbSNP:861539
1140 1140 a, g, t dbSNP:79874791
1142 1142 c, t dbSNP:768565346
1144 1144 c, t dbSNP:749394060
1145 1145 a, g dbSNP:77381814
1147 1147 a, g dbSNP:770889808
1148 1148 a, g dbSNP:575587037
1152 1152 a, g dbSNP:566710190
1159 1159 a, g dbSNP:777515106
1167 1167 -, cacagc dbSNP:752714158
1173 1173 c, t dbSNP:200657624
1179 1179 a, c, g dbSNP:778540307
1182 1182 -, gc dbSNP:767691806
1182 1182 c, t dbSNP:373638417
1188 1188 c, t dbSNP:754653129
1200 1200 a, g dbSNP:764416609
1204 1204 a, g dbSNP:145063633
1207 1207 a, g dbSNP:752896177
1218 1218 c, t dbSNP:765302014
1227 1227 c, t dbSNP:759615397
1228 1228 a, g dbSNP:28903080
1231 1231 c, t dbSNP:771984433
1233 1233 a, g dbSNP:761784037
1244 1244 a, g dbSNP:140979846
1248 1248 c, t dbSNP:547969139
1249 1249 a, g dbSNP:548084133
1250 1250 a, g dbSNP:775425367
1252 1252 c, t dbSNP:536822410
1253 1253 a, g dbSNP:745564626
1259 1259 c, t dbSNP:776250580
1263 1263 a, g dbSNP:370905714
1269 1269 c, t dbSNP:747503600
1273 1273 a, g dbSNP:368289157
1276 1276 a, g dbSNP:759008998
1278 1278 c, t dbSNP:748447059
1286 1286 a, g dbSNP:538113920
1287 1287 c, g, t dbSNP:757288071
1315 1315 a, c dbSNP:754089796
1316 1316 a, g, t dbSNP:187038000
1321 1321 c, t dbSNP:751449355
1322 1322 a, g, t dbSNP:28903081
1323 1323 c, t dbSNP:370391238
1324 1324 a, g dbSNP:765167812
1330 1330 a, g dbSNP:267603888
1341 1341 c, t dbSNP:759227523
1342 1342 a, g dbSNP:532124840
1344 1344 a, c dbSNP:770496162
1353 1353 c, t dbSNP:746493086
1354 1354 c, t dbSNP:560239798
1355 1355 a, g dbSNP:546709768
1359 1359 c, t dbSNP:748729904
1363 1363 c, t dbSNP:529825639
1364 1364 a, g dbSNP:561421246
1378 1378 c, g, t dbSNP:780262052
1379 1379 c, g dbSNP:756426742
1381 1381 c, t dbSNP:750457573
1382 1382 -, acctgcccccc dbSNP:748760447
1392 1392 -, c dbSNP:770137120
1395 1395 -, c dbSNP:780557423
1409 1409 a, c, g, t dbSNP:200382220
1410 1410 a, g dbSNP:765078097
1420 1420 a, g dbSNP:759419858
1426 1426 -, g dbSNP:34183054
1427 1427 -, t dbSNP:745775675
1429 1429 c, t dbSNP:753750563
1430 1430 a, g dbSNP:766114040
1445 1445 c, t dbSNP:377185194
1450 1450 a, t dbSNP:760421139
1461 1461 c, t dbSNP:772562364
1462 1462 a, g dbSNP:760585240
1463 1463 a, g dbSNP:762177393
1467 1467 c, t dbSNP:774851674
1468 1468 a, g dbSNP:768944628
1478 1478 c, t dbSNP:575828884
1481 1481 c, t dbSNP:372513712
1482 1482 a, c dbSNP:769885082
1485 1485 c, g dbSNP:746146387
1486 1486 -, cctg dbSNP:768250263
1497 1497 a, c dbSNP:781095418
1498 1498 c, t dbSNP:565417023
1499 1499 a, g dbSNP:370272845
1502 1502 a, t dbSNP:752626065
1505 1505 a, c, t dbSNP:376407692
1526 1526 a, g dbSNP:748375579
1541 1541 a, g dbSNP:767258270
1546 1546 a, c dbSNP:545728746
1582 1582 a, g dbSNP:55748757
1587 1587 c, t dbSNP:552955847
1588 1588 a, g dbSNP:759052213
1603 1603 c, t dbSNP:3212116
1605 1605 c, t dbSNP:773918094
1606 1606 a, g dbSNP:781687008
1706 1706 c, g dbSNP:770390236
1731 1731 a, c, g dbSNP:189909594
1772 1772 c, t dbSNP:554712025
1778 1778 a, g dbSNP:755396661
1783 1783 a, g dbSNP:537630445
1824 1824 a, g dbSNP:569064462
1842 1842 a, g dbSNP:558573491
1851 1851 c, t dbSNP:773761112
1865 1865 a, c dbSNP:538978021
1885 1885 g, t dbSNP:566436220
1906 1906 a, c, t dbSNP:3212117
1917 1917 c, t dbSNP:748617408
1920 1920 c, t dbSNP:34023186
1959 1959 c, t dbSNP:3212118
1960 1960 a, g dbSNP:144660634
1978 1978 -, g dbSNP:34231836
1990 1990 a, g dbSNP:3212119
1991 1991 c, t dbSNP:532243901
1996 1996 a, g dbSNP:565514723
1997 1997 a, g dbSNP:77103957
2010 2010 g, t dbSNP:528762137
2012 2012 c, t dbSNP:559291946
2023 2023 a, c dbSNP:140813869
2043 2043 a, g dbSNP:3212120
2047 2047 a, g dbSNP:557155704
2059 2059 a, g dbSNP:118143436
2061 2061 a, g dbSNP:575338872
2071 2071 a, g dbSNP:3212121
2097 2097 g, t dbSNP:538889498
2112 2112 a, g dbSNP:566795325
2137 2137 c, g dbSNP:536177608
2140 2140 a, g dbSNP:552970909
2150 2150 c, t dbSNP:536232000
2156 2156 c, t dbSNP:567300930
2157 2157 a, g dbSNP:574806963
2175 2175 a, g dbSNP:530638739
2202 2202 a, g dbSNP:571700552
2212 2212 c, t dbSNP:11546527
2241 2241 c, t dbSNP:3212122
2246 2246 c, t dbSNP:3212123
2265 2265 c, t dbSNP:3212124
2266 2266 a, g dbSNP:117875015
2267 2267 g, t dbSNP:542944317
2279 2279 c, t dbSNP:529271454
2293 2293 c, t dbSNP:752549180
2313 2313 c, t dbSNP:11546528
2316 2316 c, g dbSNP:563744794
2326 2326 g, t dbSNP:3212125
2340 2340 c, t dbSNP:578052355
2365 2365 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2370 2370 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2370 2370 -, g dbSNP:528769172
2413 2413 c, g dbSNP:186232444
2416 2416 -, tg dbSNP:559884792
2443 2443 a, g dbSNP:545239247
2450 2450 c, t dbSNP:759264703
2507 2507 c, t dbSNP:751125257
2508 2508 a, g dbSNP:78863423
2511 2511 g, t dbSNP:553300152
2518 2518 -, c dbSNP:34975865
2552 2552 a, g dbSNP:3212126
2562 2562 c, t dbSNP:573515775
2572 2572 c, g dbSNP:75104408
2573 2573 a, c dbSNP:536717537
2575 2575 a, t dbSNP:45625536
2577 2577 -, ag dbSNP:540271138
2602 2602 a, g dbSNP:571332532
2643 2643 a, c dbSNP:762493634

Target ORF information:

RefSeq Version XM_005268046
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25309
Accession Version NM_005432.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, AK023646.1, BX161398.1 and BC002949.1. On Jul 26, 2007 this sequence version replaced gi:12408644. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks a segment in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC001036.1, AK023646.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)297..299(+)
Misc Feature(2)381..383(+)
Misc Feature(3)384..1391(+)
Misc Feature(4)624..1394(+)
Misc Feature(5)699..722(+)
Misc Feature(6)705..1019(+)
Misc Feature(7)792..1127(+)
Misc Feature(8)1005..1019(+)
Misc Feature(9)1053..1055(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..120
Gene Synonym:
Exon (3)121..222
Gene Synonym:
Exon (4)223..435
Gene Synonym:
Exon (5)436..573
Gene Synonym:
Exon (6)574..786
Gene Synonym:
Exon (7)787..941
Gene Synonym:
Exon (8)942..1154
Gene Synonym:
Exon (9)1155..1201
Gene Synonym:
Exon (10)1202..2602
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
65 65 a, g dbSNP:1799794
67 67 a, g dbSNP:537473935
84 84 a, g dbSNP:571372232
100 100 c, t dbSNP:45603942
120 120 a, g dbSNP:373604874
143 143 a, g dbSNP:769776166
196 196 c, g dbSNP:571569002
197 197 a, g dbSNP:551369420
198 198 c, t dbSNP:564381445
199 199 a, g dbSNP:528107761
200 200 a, g dbSNP:774462522
215 215 c, t dbSNP:199632866
251 251 c, t dbSNP:577867073
285 285 c, t dbSNP:564460234
286 286 a, c dbSNP:776306927
335 335 a, t dbSNP:373800330
336 336 c, t dbSNP:778350647
342 342 c, t dbSNP:755493221
345 345 c, g dbSNP:370388004
356 356 a, t dbSNP:56018633
360 360 g, t dbSNP:756505421
374 374 c, t dbSNP:750598578
375 375 a, g dbSNP:376582164
395 395 a, g dbSNP:56377012
399 399 a, g dbSNP:751635577
401 401 c, t dbSNP:764138700
407 407 a, t dbSNP:759485767
422 422 a, t dbSNP:776463599
431 431 c, g dbSNP:770709968
448 448 -, c dbSNP:769719777
448 448 c, t dbSNP:748765569
449 449 a, g dbSNP:776001514
455 455 a, g dbSNP:770282151
457 457 -, agg dbSNP:780945006
463 463 -, t dbSNP:766346302
465 465 c, t dbSNP:546983534
471 471 c, t dbSNP:781514761
482 482 a, c dbSNP:757649541
488 488 a, g dbSNP:747203916
490 490 c, g dbSNP:777869466
493 493 c, t dbSNP:758434542
500 500 c, t dbSNP:752712328
503 503 c, g dbSNP:765461939
505 505 a, c dbSNP:569323871
506 506 c, t dbSNP:756095012
512 512 c, t dbSNP:3212045
513 513 a, g dbSNP:767384633
518 518 c, g dbSNP:530093752
521 521 a, g dbSNP:774000795
530 530 a, g dbSNP:763661308
531 531 a, g dbSNP:766540487
532 532 a, g dbSNP:762734728
534 534 -, gtcc dbSNP:762959042
535 535 c, t dbSNP:117761689
536 536 -, ag dbSNP:773320257
536 536 a, g dbSNP:548048987
541 541 -, cct dbSNP:765292788
546 546 a, c, t dbSNP:372985882
547 547 a, g dbSNP:369879767
552 552 c, t dbSNP:143410843
553 553 a, g dbSNP:139963722
559 559 a, g dbSNP:758533921
571 571 c, t dbSNP:748448131
572 572 a, c dbSNP:779101792
597 597 a, g dbSNP:761300047
601 601 a, g dbSNP:372383657
611 611 a, g dbSNP:772522836
612 612 c, g dbSNP:757118786
623 623 c, t dbSNP:574258303
626 626 a, g dbSNP:370617343
639 639 c, t dbSNP:768803063
640 640 c, t dbSNP:749386482
641 641 a, g dbSNP:374354789
661 661 a, g dbSNP:3212057
662 662 c, t dbSNP:751566300
675 675 c, t dbSNP:777400049
680 680 c, t dbSNP:758245729
681 681 a, g dbSNP:752288087
686 686 c, t dbSNP:777169987
698 698 c, g, t dbSNP:368062647
699 699 a, g dbSNP:753331169
701 701 a, g dbSNP:374120119
709 709 c, t dbSNP:577087507
714 714 g, t dbSNP:773795652
719 719 a, g dbSNP:772271531
722 722 c, g dbSNP:762286112
731 731 a, g dbSNP:371455247
732 732 a, c dbSNP:768997440
733 733 c, t dbSNP:749582836
740 740 c, t dbSNP:779977119
742 742 c, g dbSNP:769958215
743 743 c, t dbSNP:746881409
747 747 c, g dbSNP:777779663
756 756 a, t dbSNP:758061550
761 761 a, g dbSNP:752482489
762 762 c, t dbSNP:377685108
763 763 a, g dbSNP:754599485
764 764 c, g dbSNP:753527159
768 768 c, t dbSNP:765763000
770 770 c, t dbSNP:755669319
771 771 a, g dbSNP:750840706
787 787 c, g dbSNP:200124946
791 791 c, t dbSNP:752153707
792 792 a, g dbSNP:146507354
803 803 c, t dbSNP:200567298
805 805 c, t dbSNP:201561134
806 806 a, g dbSNP:765492334
812 812 c, t dbSNP:374168537
813 813 a, g dbSNP:149963487
821 821 a, g, t dbSNP:138987760
828 828 c, t dbSNP:150729160
834 834 c, t dbSNP:141201371
842 842 c, t dbSNP:749117148
844 844 c, t dbSNP:779783228
856 856 c, t dbSNP:199681385
857 857 a, g dbSNP:755779950
858 858 c, t dbSNP:56347206
859 859 a, g dbSNP:546280840
862 862 c, t dbSNP:369021228
864 864 c, t dbSNP:752063855
865 865 a, g dbSNP:778439328
868 868 c, g, t dbSNP:376618856
872 872 c, t dbSNP:28903079
873 873 a, g dbSNP:143171186
882 882 a, g dbSNP:529784964
885 885 c, t dbSNP:759771337
886 886 c, t dbSNP:754035692
887 887 a, g dbSNP:766394376
900 900 c, t dbSNP:56288529
901 901 a, c, g dbSNP:768580716
906 906 c, g dbSNP:762860382
914 914 c, g dbSNP:775335436
918 918 -, ttc dbSNP:774682377
923 923 c, t dbSNP:373040437
924 924 a, g dbSNP:745494547
925 925 a, g dbSNP:781016854
928 928 a, c dbSNP:770508342
929 929 c, t dbSNP:746523890
930 930 a, g dbSNP:777483755
935 935 c, t dbSNP:200230392
936 936 a, g dbSNP:753182555
938 938 c, t dbSNP:544357486
943 943 a, c dbSNP:761343521
947 947 a, c dbSNP:751261262
956 956 a, g dbSNP:146875659
960 960 a, g dbSNP:762464936
966 966 a, t dbSNP:775909166
976 976 c, t dbSNP:372108006
977 977 c, t dbSNP:200213277
978 978 a, g dbSNP:531332562
981 981 c, t dbSNP:761781412
982 982 c, t dbSNP:747150871
984 984 c, t dbSNP:778069090
986 986 -, gt dbSNP:765025885
986 986 a, c, g dbSNP:748230682
990 990 c, t dbSNP:779189770
991 991 a, g dbSNP:756095186
994 994 a, g dbSNP:750418294
995 995 a, c dbSNP:780813014
997 997 g, t dbSNP:776568196
1008 1008 a, g dbSNP:751118907
1012 1012 c, t dbSNP:763742114
1016 1016 c, t dbSNP:41285494
1017 1017 a, g dbSNP:149642280
1020 1020 g, t dbSNP:764778351
1021 1021 c, t dbSNP:759919423
1022 1022 a, g dbSNP:200948313
1026 1026 a, g dbSNP:771142980
1029 1029 a, g dbSNP:761101817
1038 1038 c, t dbSNP:545840795
1039 1039 a, g dbSNP:772408011
1042 1042 a, g dbSNP:201886982
1044 1044 a, g, t dbSNP:768891111
1046 1046 a, t dbSNP:368831796
1056 1056 c, g dbSNP:373720646
1058 1058 a, g dbSNP:376831498
1060 1060 a, c dbSNP:781206798
1062 1062 -, tccgcc dbSNP:761813245
1063 1063 c, t dbSNP:756935758
1064 1064 c, t dbSNP:746816769
1065 1065 a, g dbSNP:777604903
1068 1068 c, t dbSNP:758025766
1083 1083 c, t dbSNP:757719690
1091 1091 c, t dbSNP:138142727
1093 1093 c, t dbSNP:754529357
1097 1097 a, g dbSNP:188768970
1099 1099 a, c dbSNP:766900735
1101 1101 a, c, g dbSNP:773686312
1102 1102 c, t dbSNP:861539
1103 1103 a, g, t dbSNP:79874791
1105 1105 c, t dbSNP:768565346
1107 1107 c, t dbSNP:749394060
1108 1108 a, g dbSNP:77381814
1110 1110 a, g dbSNP:770889808
1111 1111 a, g dbSNP:575587037
1115 1115 a, g dbSNP:566710190
1122 1122 a, g dbSNP:777515106
1130 1130 -, cacagc dbSNP:752714158
1136 1136 c, t dbSNP:200657624
1142 1142 a, c, g dbSNP:778540307
1145 1145 -, gc dbSNP:767691806
1145 1145 c, t dbSNP:373638417
1151 1151 c, t dbSNP:754653129
1163 1163 a, g dbSNP:764416609
1167 1167 a, g dbSNP:145063633
1170 1170 a, g dbSNP:752896177
1181 1181 c, t dbSNP:765302014
1190 1190 c, t dbSNP:759615397
1191 1191 a, g dbSNP:28903080
1194 1194 c, t dbSNP:771984433
1196 1196 a, g dbSNP:761784037
1207 1207 a, g dbSNP:140979846
1211 1211 c, t dbSNP:547969139
1212 1212 a, g dbSNP:548084133
1213 1213 a, g dbSNP:775425367
1215 1215 c, t dbSNP:536822410
1216 1216 a, g dbSNP:745564626
1222 1222 c, t dbSNP:776250580
1226 1226 a, g dbSNP:370905714
1232 1232 c, t dbSNP:747503600
1236 1236 a, g dbSNP:368289157
1239 1239 a, g dbSNP:759008998
1241 1241 c, t dbSNP:748447059
1249 1249 a, g dbSNP:538113920
1250 1250 c, g, t dbSNP:757288071
1278 1278 a, c dbSNP:754089796
1279 1279 a, g, t dbSNP:187038000
1284 1284 c, t dbSNP:751449355
1285 1285 a, g, t dbSNP:28903081
1286 1286 c, t dbSNP:370391238
1287 1287 a, g dbSNP:765167812
1293 1293 a, g dbSNP:267603888
1304 1304 c, t dbSNP:759227523
1305 1305 a, g dbSNP:532124840
1307 1307 a, c dbSNP:770496162
1316 1316 c, t dbSNP:746493086
1317 1317 c, t dbSNP:560239798
1318 1318 a, g dbSNP:546709768
1322 1322 c, t dbSNP:748729904
1326 1326 c, t dbSNP:529825639
1327 1327 a, g dbSNP:561421246
1341 1341 c, g, t dbSNP:780262052
1342 1342 c, g dbSNP:756426742
1344 1344 c, t dbSNP:750457573
1345 1345 -, acctgcccccc dbSNP:748760447
1355 1355 -, c dbSNP:770137120
1358 1358 -, c dbSNP:780557423
1372 1372 a, c, g, t dbSNP:200382220
1373 1373 a, g dbSNP:765078097
1383 1383 a, g dbSNP:759419858
1389 1389 -, g dbSNP:34183054
1390 1390 -, t dbSNP:745775675
1392 1392 c, t dbSNP:753750563
1393 1393 a, g dbSNP:766114040
1408 1408 c, t dbSNP:377185194
1413 1413 a, t dbSNP:760421139
1424 1424 c, t dbSNP:772562364
1425 1425 a, g dbSNP:760585240
1426 1426 a, g dbSNP:762177393
1430 1430 c, t dbSNP:774851674
1431 1431 a, g dbSNP:768944628
1441 1441 c, t dbSNP:575828884
1444 1444 c, t dbSNP:372513712
1445 1445 a, c dbSNP:769885082
1448 1448 c, g dbSNP:746146387
1449 1449 -, cctg dbSNP:768250263
1460 1460 a, c dbSNP:781095418
1461 1461 c, t dbSNP:565417023
1462 1462 a, g dbSNP:370272845
1465 1465 a, t dbSNP:752626065
1468 1468 a, c, t dbSNP:376407692
1489 1489 a, g dbSNP:748375579
1504 1504 a, g dbSNP:767258270
1509 1509 a, c dbSNP:545728746
1545 1545 a, g dbSNP:55748757
1550 1550 c, t dbSNP:552955847
1551 1551 a, g dbSNP:759052213
1566 1566 c, t dbSNP:3212116
1568 1568 c, t dbSNP:773918094
1569 1569 a, g dbSNP:781687008
1669 1669 c, g dbSNP:770390236
1694 1694 a, c, g dbSNP:189909594
1735 1735 c, t dbSNP:554712025
1741 1741 a, g dbSNP:755396661
1746 1746 a, g dbSNP:537630445
1787 1787 a, g dbSNP:569064462
1805 1805 a, g dbSNP:558573491
1814 1814 c, t dbSNP:773761112
1828 1828 a, c dbSNP:538978021
1848 1848 g, t dbSNP:566436220
1869 1869 a, c, t dbSNP:3212117
1880 1880 c, t dbSNP:748617408
1883 1883 c, t dbSNP:34023186
1922 1922 c, t dbSNP:3212118
1923 1923 a, g dbSNP:144660634
1941 1941 -, g dbSNP:34231836
1953 1953 a, g dbSNP:3212119
1954 1954 c, t dbSNP:532243901
1959 1959 a, g dbSNP:565514723
1960 1960 a, g dbSNP:77103957
1973 1973 g, t dbSNP:528762137
1975 1975 c, t dbSNP:559291946
1986 1986 a, c dbSNP:140813869
2006 2006 a, g dbSNP:3212120
2010 2010 a, g dbSNP:557155704
2022 2022 a, g dbSNP:118143436
2024 2024 a, g dbSNP:575338872
2034 2034 a, g dbSNP:3212121
2060 2060 g, t dbSNP:538889498
2075 2075 a, g dbSNP:566795325
2100 2100 c, g dbSNP:536177608
2103 2103 a, g dbSNP:552970909
2113 2113 c, t dbSNP:536232000
2119 2119 c, t dbSNP:567300930
2120 2120 a, g dbSNP:574806963
2138 2138 a, g dbSNP:530638739
2165 2165 a, g dbSNP:571700552
2175 2175 c, t dbSNP:11546527
2204 2204 c, t dbSNP:3212122
2209 2209 c, t dbSNP:3212123
2228 2228 c, t dbSNP:3212124
2229 2229 a, g dbSNP:117875015
2230 2230 g, t dbSNP:542944317
2242 2242 c, t dbSNP:529271454
2256 2256 c, t dbSNP:752549180
2276 2276 c, t dbSNP:11546528
2279 2279 c, g dbSNP:563744794
2289 2289 g, t dbSNP:3212125
2303 2303 c, t dbSNP:578052355
2328 2328 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2333 2333 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2333 2333 -, g dbSNP:528769172
2376 2376 c, g dbSNP:186232444
2379 2379 -, tg dbSNP:559884792
2406 2406 a, g dbSNP:545239247
2413 2413 c, t dbSNP:759264703
2470 2470 c, t dbSNP:751125257
2471 2471 a, g dbSNP:78863423
2474 2474 g, t dbSNP:553300152
2481 2481 -, c dbSNP:34975865
2515 2515 a, g dbSNP:3212126
2525 2525 c, t dbSNP:573515775
2535 2535 c, g dbSNP:75104408
2536 2536 a, c dbSNP:536717537
2538 2538 a, t dbSNP:45625536
2540 2540 -, ag dbSNP:540271138
2565 2565 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_005432
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25309
Accession Version NM_001100118.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, BX161398.1 and BC002949.1. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) lacks a segment in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC011725.2, BX161398.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)240..242(+)
Misc Feature(2)324..326(+)
Misc Feature(3)327..1334(+)
Misc Feature(4)567..1337(+)
Misc Feature(5)642..665(+)
Misc Feature(6)648..962(+)
Misc Feature(7)735..1070(+)
Misc Feature(8)948..962(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..165
Gene Synonym:
Exon (3)166..378
Gene Synonym:
Exon (4)379..516
Gene Synonym:
Exon (5)517..729
Gene Synonym:
Exon (6)730..884
Gene Synonym:
Exon (7)885..1097
Gene Synonym:
Exon (8)1098..1144
Gene Synonym:
Exon (9)1145..2545
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
86 86 a, g dbSNP:769776166
139 139 c, g dbSNP:571569002
140 140 a, g dbSNP:551369420
141 141 c, t dbSNP:564381445
142 142 a, g dbSNP:528107761
143 143 a, g dbSNP:774462522
158 158 c, t dbSNP:199632866
194 194 c, t dbSNP:577867073
228 228 c, t dbSNP:564460234
229 229 a, c dbSNP:776306927
278 278 a, t dbSNP:373800330
279 279 c, t dbSNP:778350647
285 285 c, t dbSNP:755493221
288 288 c, g dbSNP:370388004
299 299 a, t dbSNP:56018633
303 303 g, t dbSNP:756505421
317 317 c, t dbSNP:750598578
318 318 a, g dbSNP:376582164
338 338 a, g dbSNP:56377012
342 342 a, g dbSNP:751635577
344 344 c, t dbSNP:764138700
350 350 a, t dbSNP:759485767
365 365 a, t dbSNP:776463599
374 374 c, g dbSNP:770709968
391 391 -, c dbSNP:769719777
391 391 c, t dbSNP:748765569
392 392 a, g dbSNP:776001514
398 398 a, g dbSNP:770282151
400 400 -, agg dbSNP:780945006
406 406 -, t dbSNP:766346302
408 408 c, t dbSNP:546983534
414 414 c, t dbSNP:781514761
425 425 a, c dbSNP:757649541
431 431 a, g dbSNP:747203916
433 433 c, g dbSNP:777869466
436 436 c, t dbSNP:758434542
443 443 c, t dbSNP:752712328
446 446 c, g dbSNP:765461939
448 448 a, c dbSNP:569323871
449 449 c, t dbSNP:756095012
455 455 c, t dbSNP:3212045
456 456 a, g dbSNP:767384633
461 461 c, g dbSNP:530093752
464 464 a, g dbSNP:774000795
473 473 a, g dbSNP:763661308
474 474 a, g dbSNP:766540487
475 475 a, g dbSNP:762734728
477 477 -, gtcc dbSNP:762959042
478 478 c, t dbSNP:117761689
479 479 -, ag dbSNP:773320257
479 479 a, g dbSNP:548048987
484 484 -, cct dbSNP:765292788
489 489 a, c, t dbSNP:372985882
490 490 a, g dbSNP:369879767
495 495 c, t dbSNP:143410843
496 496 a, g dbSNP:139963722
502 502 a, g dbSNP:758533921
514 514 c, t dbSNP:748448131
515 515 a, c dbSNP:779101792
540 540 a, g dbSNP:761300047
544 544 a, g dbSNP:372383657
554 554 a, g dbSNP:772522836
555 555 c, g dbSNP:757118786
566 566 c, t dbSNP:574258303
569 569 a, g dbSNP:370617343
582 582 c, t dbSNP:768803063
583 583 c, t dbSNP:749386482
584 584 a, g dbSNP:374354789
604 604 a, g dbSNP:3212057
605 605 c, t dbSNP:751566300
618 618 c, t dbSNP:777400049
623 623 c, t dbSNP:758245729
624 624 a, g dbSNP:752288087
629 629 c, t dbSNP:777169987
641 641 c, g, t dbSNP:368062647
642 642 a, g dbSNP:753331169
644 644 a, g dbSNP:374120119
652 652 c, t dbSNP:577087507
657 657 g, t dbSNP:773795652
662 662 a, g dbSNP:772271531
665 665 c, g dbSNP:762286112
674 674 a, g dbSNP:371455247
675 675 a, c dbSNP:768997440
676 676 c, t dbSNP:749582836
683 683 c, t dbSNP:779977119
685 685 c, g dbSNP:769958215
686 686 c, t dbSNP:746881409
690 690 c, g dbSNP:777779663
699 699 a, t dbSNP:758061550
704 704 a, g dbSNP:752482489
705 705 c, t dbSNP:377685108
706 706 a, g dbSNP:754599485
707 707 c, g dbSNP:753527159
711 711 c, t dbSNP:765763000
713 713 c, t dbSNP:755669319
714 714 a, g dbSNP:750840706
730 730 c, g dbSNP:200124946
734 734 c, t dbSNP:752153707
735 735 a, g dbSNP:146507354
746 746 c, t dbSNP:200567298
748 748 c, t dbSNP:201561134
749 749 a, g dbSNP:765492334
755 755 c, t dbSNP:374168537
756 756 a, g dbSNP:149963487
764 764 a, g, t dbSNP:138987760
771 771 c, t dbSNP:150729160
777 777 c, t dbSNP:141201371
785 785 c, t dbSNP:749117148
787 787 c, t dbSNP:779783228
799 799 c, t dbSNP:199681385
800 800 a, g dbSNP:755779950
801 801 c, t dbSNP:56347206
802 802 a, g dbSNP:546280840
805 805 c, t dbSNP:369021228
807 807 c, t dbSNP:752063855
808 808 a, g dbSNP:778439328
811 811 c, g, t dbSNP:376618856
815 815 c, t dbSNP:28903079
816 816 a, g dbSNP:143171186
825 825 a, g dbSNP:529784964
828 828 c, t dbSNP:759771337
829 829 c, t dbSNP:754035692
830 830 a, g dbSNP:766394376
843 843 c, t dbSNP:56288529
844 844 a, c, g dbSNP:768580716
849 849 c, g dbSNP:762860382
857 857 c, g dbSNP:775335436
861 861 -, ttc dbSNP:774682377
866 866 c, t dbSNP:373040437
867 867 a, g dbSNP:745494547
868 868 a, g dbSNP:781016854
871 871 a, c dbSNP:770508342
872 872 c, t dbSNP:746523890
873 873 a, g dbSNP:777483755
878 878 c, t dbSNP:200230392
879 879 a, g dbSNP:753182555
881 881 c, t dbSNP:544357486
886 886 a, c dbSNP:761343521
890 890 a, c dbSNP:751261262
899 899 a, g dbSNP:146875659
903 903 a, g dbSNP:762464936
909 909 a, t dbSNP:775909166
919 919 c, t dbSNP:372108006
920 920 c, t dbSNP:200213277
921 921 a, g dbSNP:531332562
924 924 c, t dbSNP:761781412
925 925 c, t dbSNP:747150871
927 927 c, t dbSNP:778069090
929 929 -, gt dbSNP:765025885
929 929 a, c, g dbSNP:748230682
933 933 c, t dbSNP:779189770
934 934 a, g dbSNP:756095186
937 937 a, g dbSNP:750418294
938 938 a, c dbSNP:780813014
940 940 g, t dbSNP:776568196
951 951 a, g dbSNP:751118907
955 955 c, t dbSNP:763742114
959 959 c, t dbSNP:41285494
960 960 a, g dbSNP:149642280
963 963 g, t dbSNP:764778351
964 964 c, t dbSNP:759919423
965 965 a, g dbSNP:200948313
969 969 a, g dbSNP:771142980
972 972 a, g dbSNP:761101817
981 981 c, t dbSNP:545840795
982 982 a, g dbSNP:772408011
985 985 a, g dbSNP:201886982
987 987 a, g, t dbSNP:768891111
989 989 a, t dbSNP:368831796
999 999 c, g dbSNP:373720646
1001 1001 a, g dbSNP:376831498
1003 1003 a, c dbSNP:781206798
1005 1005 -, tccgcc dbSNP:761813245
1006 1006 c, t dbSNP:756935758
1007 1007 c, t dbSNP:746816769
1008 1008 a, g dbSNP:777604903
1011 1011 c, t dbSNP:758025766
1026 1026 c, t dbSNP:757719690
1034 1034 c, t dbSNP:138142727
1036 1036 c, t dbSNP:754529357
1040 1040 a, g dbSNP:188768970
1042 1042 a, c dbSNP:766900735
1044 1044 a, c, g dbSNP:773686312
1045 1045 c, t dbSNP:861539
1046 1046 a, g, t dbSNP:79874791
1048 1048 c, t dbSNP:768565346
1050 1050 c, t dbSNP:749394060
1051 1051 a, g dbSNP:77381814
1053 1053 a, g dbSNP:770889808
1054 1054 a, g dbSNP:575587037
1058 1058 a, g dbSNP:566710190
1065 1065 a, g dbSNP:777515106
1073 1073 -, cacagc dbSNP:752714158
1079 1079 c, t dbSNP:200657624
1085 1085 a, c, g dbSNP:778540307
1088 1088 -, gc dbSNP:767691806
1088 1088 c, t dbSNP:373638417
1094 1094 c, t dbSNP:754653129
1106 1106 a, g dbSNP:764416609
1110 1110 a, g dbSNP:145063633
1113 1113 a, g dbSNP:752896177
1124 1124 c, t dbSNP:765302014
1133 1133 c, t dbSNP:759615397
1134 1134 a, g dbSNP:28903080
1137 1137 c, t dbSNP:771984433
1139 1139 a, g dbSNP:761784037
1150 1150 a, g dbSNP:140979846
1154 1154 c, t dbSNP:547969139
1155 1155 a, g dbSNP:548084133
1156 1156 a, g dbSNP:775425367
1158 1158 c, t dbSNP:536822410
1159 1159 a, g dbSNP:745564626
1165 1165 c, t dbSNP:776250580
1169 1169 a, g dbSNP:370905714
1175 1175 c, t dbSNP:747503600
1179 1179 a, g dbSNP:368289157
1182 1182 a, g dbSNP:759008998
1184 1184 c, t dbSNP:748447059
1192 1192 a, g dbSNP:538113920
1193 1193 c, g, t dbSNP:757288071
1221 1221 a, c dbSNP:754089796
1222 1222 a, g, t dbSNP:187038000
1227 1227 c, t dbSNP:751449355
1228 1228 a, g, t dbSNP:28903081
1229 1229 c, t dbSNP:370391238
1230 1230 a, g dbSNP:765167812
1236 1236 a, g dbSNP:267603888
1247 1247 c, t dbSNP:759227523
1248 1248 a, g dbSNP:532124840
1250 1250 a, c dbSNP:770496162
1259 1259 c, t dbSNP:746493086
1260 1260 c, t dbSNP:560239798
1261 1261 a, g dbSNP:546709768
1265 1265 c, t dbSNP:748729904
1269 1269 c, t dbSNP:529825639
1270 1270 a, g dbSNP:561421246
1284 1284 c, g, t dbSNP:780262052
1285 1285 c, g dbSNP:756426742
1287 1287 c, t dbSNP:750457573
1288 1288 -, acctgcccccc dbSNP:748760447
1298 1298 -, c dbSNP:770137120
1301 1301 -, c dbSNP:780557423
1315 1315 a, c, g, t dbSNP:200382220
1316 1316 a, g dbSNP:765078097
1326 1326 a, g dbSNP:759419858
1332 1332 -, g dbSNP:34183054
1333 1333 -, t dbSNP:745775675
1335 1335 c, t dbSNP:753750563
1336 1336 a, g dbSNP:766114040
1351 1351 c, t dbSNP:377185194
1356 1356 a, t dbSNP:760421139
1367 1367 c, t dbSNP:772562364
1368 1368 a, g dbSNP:760585240
1369 1369 a, g dbSNP:762177393
1373 1373 c, t dbSNP:774851674
1374 1374 a, g dbSNP:768944628
1384 1384 c, t dbSNP:575828884
1387 1387 c, t dbSNP:372513712
1388 1388 a, c dbSNP:769885082
1391 1391 c, g dbSNP:746146387
1392 1392 -, cctg dbSNP:768250263
1403 1403 a, c dbSNP:781095418
1404 1404 c, t dbSNP:565417023
1405 1405 a, g dbSNP:370272845
1408 1408 a, t dbSNP:752626065
1411 1411 a, c, t dbSNP:376407692
1432 1432 a, g dbSNP:748375579
1447 1447 a, g dbSNP:767258270
1452 1452 a, c dbSNP:545728746
1488 1488 a, g dbSNP:55748757
1493 1493 c, t dbSNP:552955847
1494 1494 a, g dbSNP:759052213
1509 1509 c, t dbSNP:3212116
1511 1511 c, t dbSNP:773918094
1512 1512 a, g dbSNP:781687008
1612 1612 c, g dbSNP:770390236
1637 1637 a, c, g dbSNP:189909594
1678 1678 c, t dbSNP:554712025
1684 1684 a, g dbSNP:755396661
1689 1689 a, g dbSNP:537630445
1730 1730 a, g dbSNP:569064462
1748 1748 a, g dbSNP:558573491
1757 1757 c, t dbSNP:773761112
1771 1771 a, c dbSNP:538978021
1791 1791 g, t dbSNP:566436220
1812 1812 a, c, t dbSNP:3212117
1823 1823 c, t dbSNP:748617408
1826 1826 c, t dbSNP:34023186
1865 1865 c, t dbSNP:3212118
1866 1866 a, g dbSNP:144660634
1884 1884 -, g dbSNP:34231836
1896 1896 a, g dbSNP:3212119
1897 1897 c, t dbSNP:532243901
1902 1902 a, g dbSNP:565514723
1903 1903 a, g dbSNP:77103957
1916 1916 g, t dbSNP:528762137
1918 1918 c, t dbSNP:559291946
1929 1929 a, c dbSNP:140813869
1949 1949 a, g dbSNP:3212120
1953 1953 a, g dbSNP:557155704
1965 1965 a, g dbSNP:118143436
1967 1967 a, g dbSNP:575338872
1977 1977 a, g dbSNP:3212121
2003 2003 g, t dbSNP:538889498
2018 2018 a, g dbSNP:566795325
2043 2043 c, g dbSNP:536177608
2046 2046 a, g dbSNP:552970909
2056 2056 c, t dbSNP:536232000
2062 2062 c, t dbSNP:567300930
2063 2063 a, g dbSNP:574806963
2081 2081 a, g dbSNP:530638739
2108 2108 a, g dbSNP:571700552
2118 2118 c, t dbSNP:11546527
2147 2147 c, t dbSNP:3212122
2152 2152 c, t dbSNP:3212123
2171 2171 c, t dbSNP:3212124
2172 2172 a, g dbSNP:117875015
2173 2173 g, t dbSNP:542944317
2185 2185 c, t dbSNP:529271454
2199 2199 c, t dbSNP:752549180
2219 2219 c, t dbSNP:11546528
2222 2222 c, g dbSNP:563744794
2232 2232 g, t dbSNP:3212125
2246 2246 c, t dbSNP:578052355
2271 2271 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2276 2276 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2276 2276 -, g dbSNP:528769172
2319 2319 c, g dbSNP:186232444
2322 2322 -, tg dbSNP:559884792
2349 2349 a, g dbSNP:545239247
2356 2356 c, t dbSNP:759264703
2413 2413 c, t dbSNP:751125257
2414 2414 a, g dbSNP:78863423
2417 2417 g, t dbSNP:553300152
2424 2424 -, c dbSNP:34975865
2458 2458 a, g dbSNP:3212126
2468 2468 c, t dbSNP:573515775
2478 2478 c, g dbSNP:75104408
2479 2479 a, c dbSNP:536717537
2481 2481 a, t dbSNP:45625536
2483 2483 -, ag dbSNP:540271138
2508 2508 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_001100118
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25309
Accession Version NM_001100119.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product DNA repair protein XRCC3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB041321.1, AK022829.1, BX161398.1 and BC002949.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC001036.1, AK022829.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)334..336(+)
Misc Feature(2)418..420(+)
Misc Feature(3)421..1428(+)
Misc Feature(4)661..1431(+)
Misc Feature(5)736..759(+)
Misc Feature(6)742..1056(+)
Misc Feature(7)829..1164(+)
Misc Feature(8)1042..1056(+)
Exon (1)1..63
Gene Synonym:
Exon (2)64..157
Gene Synonym:
Exon (3)158..259
Gene Synonym:
Exon (4)260..472
Gene Synonym:
Exon (5)473..610
Gene Synonym:
Exon (6)611..823
Gene Synonym:
Exon (7)824..978
Gene Synonym:
Exon (8)979..1191
Gene Synonym:
Exon (9)1192..1238
Gene Synonym:
Exon (10)1239..2639
Gene Synonym:
Position Chain Variation Link
35 35 a, c dbSNP:527896479
41 41 a, g dbSNP:561980080
72 72 c, t dbSNP:750918816
76 76 a, g dbSNP:567960399
102 102 a, g dbSNP:1799794
104 104 a, g dbSNP:537473935
121 121 a, g dbSNP:571372232
137 137 c, t dbSNP:45603942
157 157 a, g dbSNP:373604874
180 180 a, g dbSNP:769776166
233 233 c, g dbSNP:571569002
234 234 a, g dbSNP:551369420
235 235 c, t dbSNP:564381445
236 236 a, g dbSNP:528107761
237 237 a, g dbSNP:774462522
252 252 c, t dbSNP:199632866
288 288 c, t dbSNP:577867073
322 322 c, t dbSNP:564460234
323 323 a, c dbSNP:776306927
372 372 a, t dbSNP:373800330
373 373 c, t dbSNP:778350647
379 379 c, t dbSNP:755493221
382 382 c, g dbSNP:370388004
393 393 a, t dbSNP:56018633
397 397 g, t dbSNP:756505421
411 411 c, t dbSNP:750598578
412 412 a, g dbSNP:376582164
432 432 a, g dbSNP:56377012
436 436 a, g dbSNP:751635577
438 438 c, t dbSNP:764138700
444 444 a, t dbSNP:759485767
459 459 a, t dbSNP:776463599
468 468 c, g dbSNP:770709968
485 485 -, c dbSNP:769719777
485 485 c, t dbSNP:748765569
486 486 a, g dbSNP:776001514
492 492 a, g dbSNP:770282151
494 494 -, agg dbSNP:780945006
500 500 -, t dbSNP:766346302
502 502 c, t dbSNP:546983534
508 508 c, t dbSNP:781514761
519 519 a, c dbSNP:757649541
525 525 a, g dbSNP:747203916
527 527 c, g dbSNP:777869466
530 530 c, t dbSNP:758434542
537 537 c, t dbSNP:752712328
540 540 c, g dbSNP:765461939
542 542 a, c dbSNP:569323871
543 543 c, t dbSNP:756095012
549 549 c, t dbSNP:3212045
550 550 a, g dbSNP:767384633
555 555 c, g dbSNP:530093752
558 558 a, g dbSNP:774000795
567 567 a, g dbSNP:763661308
568 568 a, g dbSNP:766540487
569 569 a, g dbSNP:762734728
571 571 -, gtcc dbSNP:762959042
572 572 c, t dbSNP:117761689
573 573 -, ag dbSNP:773320257
573 573 a, g dbSNP:548048987
578 578 -, cct dbSNP:765292788
583 583 a, c, t dbSNP:372985882
584 584 a, g dbSNP:369879767
589 589 c, t dbSNP:143410843
590 590 a, g dbSNP:139963722
596 596 a, g dbSNP:758533921
608 608 c, t dbSNP:748448131
609 609 a, c dbSNP:779101792
634 634 a, g dbSNP:761300047
638 638 a, g dbSNP:372383657
648 648 a, g dbSNP:772522836
649 649 c, g dbSNP:757118786
660 660 c, t dbSNP:574258303
663 663 a, g dbSNP:370617343
676 676 c, t dbSNP:768803063
677 677 c, t dbSNP:749386482
678 678 a, g dbSNP:374354789
698 698 a, g dbSNP:3212057
699 699 c, t dbSNP:751566300
712 712 c, t dbSNP:777400049
717 717 c, t dbSNP:758245729
718 718 a, g dbSNP:752288087
723 723 c, t dbSNP:777169987
735 735 c, g, t dbSNP:368062647
736 736 a, g dbSNP:753331169
738 738 a, g dbSNP:374120119
746 746 c, t dbSNP:577087507
751 751 g, t dbSNP:773795652
756 756 a, g dbSNP:772271531
759 759 c, g dbSNP:762286112
768 768 a, g dbSNP:371455247
769 769 a, c dbSNP:768997440
770 770 c, t dbSNP:749582836
777 777 c, t dbSNP:779977119
779 779 c, g dbSNP:769958215
780 780 c, t dbSNP:746881409
784 784 c, g dbSNP:777779663
793 793 a, t dbSNP:758061550
798 798 a, g dbSNP:752482489
799 799 c, t dbSNP:377685108
800 800 a, g dbSNP:754599485
801 801 c, g dbSNP:753527159
805 805 c, t dbSNP:765763000
807 807 c, t dbSNP:755669319
808 808 a, g dbSNP:750840706
824 824 c, g dbSNP:200124946
828 828 c, t dbSNP:752153707
829 829 a, g dbSNP:146507354
840 840 c, t dbSNP:200567298
842 842 c, t dbSNP:201561134
843 843 a, g dbSNP:765492334
849 849 c, t dbSNP:374168537
850 850 a, g dbSNP:149963487
858 858 a, g, t dbSNP:138987760
865 865 c, t dbSNP:150729160
871 871 c, t dbSNP:141201371
879 879 c, t dbSNP:749117148
881 881 c, t dbSNP:779783228
893 893 c, t dbSNP:199681385
894 894 a, g dbSNP:755779950
895 895 c, t dbSNP:56347206
896 896 a, g dbSNP:546280840
899 899 c, t dbSNP:369021228
901 901 c, t dbSNP:752063855
902 902 a, g dbSNP:778439328
905 905 c, g, t dbSNP:376618856
909 909 c, t dbSNP:28903079
910 910 a, g dbSNP:143171186
919 919 a, g dbSNP:529784964
922 922 c, t dbSNP:759771337
923 923 c, t dbSNP:754035692
924 924 a, g dbSNP:766394376
937 937 c, t dbSNP:56288529
938 938 a, c, g dbSNP:768580716
943 943 c, g dbSNP:762860382
951 951 c, g dbSNP:775335436
955 955 -, ttc dbSNP:774682377
960 960 c, t dbSNP:373040437
961 961 a, g dbSNP:745494547
962 962 a, g dbSNP:781016854
965 965 a, c dbSNP:770508342
966 966 c, t dbSNP:746523890
967 967 a, g dbSNP:777483755
972 972 c, t dbSNP:200230392
973 973 a, g dbSNP:753182555
975 975 c, t dbSNP:544357486
980 980 a, c dbSNP:761343521
984 984 a, c dbSNP:751261262
993 993 a, g dbSNP:146875659
997 997 a, g dbSNP:762464936
1003 1003 a, t dbSNP:775909166
1013 1013 c, t dbSNP:372108006
1014 1014 c, t dbSNP:200213277
1015 1015 a, g dbSNP:531332562
1018 1018 c, t dbSNP:761781412
1019 1019 c, t dbSNP:747150871
1021 1021 c, t dbSNP:778069090
1023 1023 -, gt dbSNP:765025885
1023 1023 a, c, g dbSNP:748230682
1027 1027 c, t dbSNP:779189770
1028 1028 a, g dbSNP:756095186
1031 1031 a, g dbSNP:750418294
1032 1032 a, c dbSNP:780813014
1034 1034 g, t dbSNP:776568196
1045 1045 a, g dbSNP:751118907
1049 1049 c, t dbSNP:763742114
1053 1053 c, t dbSNP:41285494
1054 1054 a, g dbSNP:149642280
1057 1057 g, t dbSNP:764778351
1058 1058 c, t dbSNP:759919423
1059 1059 a, g dbSNP:200948313
1063 1063 a, g dbSNP:771142980
1066 1066 a, g dbSNP:761101817
1075 1075 c, t dbSNP:545840795
1076 1076 a, g dbSNP:772408011
1079 1079 a, g dbSNP:201886982
1081 1081 a, g, t dbSNP:768891111
1083 1083 a, t dbSNP:368831796
1093 1093 c, g dbSNP:373720646
1095 1095 a, g dbSNP:376831498
1097 1097 a, c dbSNP:781206798
1099 1099 -, tccgcc dbSNP:761813245
1100 1100 c, t dbSNP:756935758
1101 1101 c, t dbSNP:746816769
1102 1102 a, g dbSNP:777604903
1105 1105 c, t dbSNP:758025766
1120 1120 c, t dbSNP:757719690
1128 1128 c, t dbSNP:138142727
1130 1130 c, t dbSNP:754529357
1134 1134 a, g dbSNP:188768970
1136 1136 a, c dbSNP:766900735
1138 1138 a, c, g dbSNP:773686312
1139 1139 c, t dbSNP:861539
1140 1140 a, g, t dbSNP:79874791
1142 1142 c, t dbSNP:768565346
1144 1144 c, t dbSNP:749394060
1145 1145 a, g dbSNP:77381814
1147 1147 a, g dbSNP:770889808
1148 1148 a, g dbSNP:575587037
1152 1152 a, g dbSNP:566710190
1159 1159 a, g dbSNP:777515106
1167 1167 -, cacagc dbSNP:752714158
1173 1173 c, t dbSNP:200657624
1179 1179 a, c, g dbSNP:778540307
1182 1182 -, gc dbSNP:767691806
1182 1182 c, t dbSNP:373638417
1188 1188 c, t dbSNP:754653129
1200 1200 a, g dbSNP:764416609
1204 1204 a, g dbSNP:145063633
1207 1207 a, g dbSNP:752896177
1218 1218 c, t dbSNP:765302014
1227 1227 c, t dbSNP:759615397
1228 1228 a, g dbSNP:28903080
1231 1231 c, t dbSNP:771984433
1233 1233 a, g dbSNP:761784037
1244 1244 a, g dbSNP:140979846
1248 1248 c, t dbSNP:547969139
1249 1249 a, g dbSNP:548084133
1250 1250 a, g dbSNP:775425367
1252 1252 c, t dbSNP:536822410
1253 1253 a, g dbSNP:745564626
1259 1259 c, t dbSNP:776250580
1263 1263 a, g dbSNP:370905714
1269 1269 c, t dbSNP:747503600
1273 1273 a, g dbSNP:368289157
1276 1276 a, g dbSNP:759008998
1278 1278 c, t dbSNP:748447059
1286 1286 a, g dbSNP:538113920
1287 1287 c, g, t dbSNP:757288071
1315 1315 a, c dbSNP:754089796
1316 1316 a, g, t dbSNP:187038000
1321 1321 c, t dbSNP:751449355
1322 1322 a, g, t dbSNP:28903081
1323 1323 c, t dbSNP:370391238
1324 1324 a, g dbSNP:765167812
1330 1330 a, g dbSNP:267603888
1341 1341 c, t dbSNP:759227523
1342 1342 a, g dbSNP:532124840
1344 1344 a, c dbSNP:770496162
1353 1353 c, t dbSNP:746493086
1354 1354 c, t dbSNP:560239798
1355 1355 a, g dbSNP:546709768
1359 1359 c, t dbSNP:748729904
1363 1363 c, t dbSNP:529825639
1364 1364 a, g dbSNP:561421246
1378 1378 c, g, t dbSNP:780262052
1379 1379 c, g dbSNP:756426742
1381 1381 c, t dbSNP:750457573
1382 1382 -, acctgcccccc dbSNP:748760447
1392 1392 -, c dbSNP:770137120
1395 1395 -, c dbSNP:780557423
1409 1409 a, c, g, t dbSNP:200382220
1410 1410 a, g dbSNP:765078097
1420 1420 a, g dbSNP:759419858
1426 1426 -, g dbSNP:34183054
1427 1427 -, t dbSNP:745775675
1429 1429 c, t dbSNP:753750563
1430 1430 a, g dbSNP:766114040
1445 1445 c, t dbSNP:377185194
1450 1450 a, t dbSNP:760421139
1461 1461 c, t dbSNP:772562364
1462 1462 a, g dbSNP:760585240
1463 1463 a, g dbSNP:762177393
1467 1467 c, t dbSNP:774851674
1468 1468 a, g dbSNP:768944628
1478 1478 c, t dbSNP:575828884
1481 1481 c, t dbSNP:372513712
1482 1482 a, c dbSNP:769885082
1485 1485 c, g dbSNP:746146387
1486 1486 -, cctg dbSNP:768250263
1497 1497 a, c dbSNP:781095418
1498 1498 c, t dbSNP:565417023
1499 1499 a, g dbSNP:370272845
1502 1502 a, t dbSNP:752626065
1505 1505 a, c, t dbSNP:376407692
1526 1526 a, g dbSNP:748375579
1541 1541 a, g dbSNP:767258270
1546 1546 a, c dbSNP:545728746
1582 1582 a, g dbSNP:55748757
1587 1587 c, t dbSNP:552955847
1588 1588 a, g dbSNP:759052213
1603 1603 c, t dbSNP:3212116
1605 1605 c, t dbSNP:773918094
1606 1606 a, g dbSNP:781687008
1706 1706 c, g dbSNP:770390236
1731 1731 a, c, g dbSNP:189909594
1772 1772 c, t dbSNP:554712025
1778 1778 a, g dbSNP:755396661
1783 1783 a, g dbSNP:537630445
1824 1824 a, g dbSNP:569064462
1842 1842 a, g dbSNP:558573491
1851 1851 c, t dbSNP:773761112
1865 1865 a, c dbSNP:538978021
1885 1885 g, t dbSNP:566436220
1906 1906 a, c, t dbSNP:3212117
1917 1917 c, t dbSNP:748617408
1920 1920 c, t dbSNP:34023186
1959 1959 c, t dbSNP:3212118
1960 1960 a, g dbSNP:144660634
1978 1978 -, g dbSNP:34231836
1990 1990 a, g dbSNP:3212119
1991 1991 c, t dbSNP:532243901
1996 1996 a, g dbSNP:565514723
1997 1997 a, g dbSNP:77103957
2010 2010 g, t dbSNP:528762137
2012 2012 c, t dbSNP:559291946
2023 2023 a, c dbSNP:140813869
2043 2043 a, g dbSNP:3212120
2047 2047 a, g dbSNP:557155704
2059 2059 a, g dbSNP:118143436
2061 2061 a, g dbSNP:575338872
2071 2071 a, g dbSNP:3212121
2097 2097 g, t dbSNP:538889498
2112 2112 a, g dbSNP:566795325
2137 2137 c, g dbSNP:536177608
2140 2140 a, g dbSNP:552970909
2150 2150 c, t dbSNP:536232000
2156 2156 c, t dbSNP:567300930
2157 2157 a, g dbSNP:574806963
2175 2175 a, g dbSNP:530638739
2202 2202 a, g dbSNP:571700552
2212 2212 c, t dbSNP:11546527
2241 2241 c, t dbSNP:3212122
2246 2246 c, t dbSNP:3212123
2265 2265 c, t dbSNP:3212124
2266 2266 a, g dbSNP:117875015
2267 2267 g, t dbSNP:542944317
2279 2279 c, t dbSNP:529271454
2293 2293 c, t dbSNP:752549180
2313 2313 c, t dbSNP:11546528
2316 2316 c, g dbSNP:563744794
2326 2326 g, t dbSNP:3212125
2340 2340 c, t dbSNP:578052355
2365 2365 -, tgcaggaccctgtcctgcagtcccacactg dbSNP:377198655
2370 2370 -, gaccctgtcctgcagtcccacactgtgcag dbSNP:150768508
2370 2370 -, g dbSNP:528769172
2413 2413 c, g dbSNP:186232444
2416 2416 -, tg dbSNP:559884792
2443 2443 a, g dbSNP:545239247
2450 2450 c, t dbSNP:759264703
2507 2507 c, t dbSNP:751125257
2508 2508 a, g dbSNP:78863423
2511 2511 g, t dbSNP:553300152
2518 2518 -, c dbSNP:34975865
2552 2552 a, g dbSNP:3212126
2562 2562 c, t dbSNP:573515775
2572 2572 c, g dbSNP:75104408
2573 2573 a, c dbSNP:536717537
2575 2575 a, t dbSNP:45625536
2577 2577 -, ag dbSNP:540271138
2602 2602 a, g dbSNP:571332532

Target ORF information:

RefSeq Version NM_001100119
Organism Homo sapiens (human)
Definition Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
