Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 [Homo sapiens (human)]

Gene Symbol DNAJC5
Entrez Gene ID 80331
Full Name DnaJ (Hsp40) homolog, subfamily C, member 5
Synonyms CLN4, CLN4B, CSP, DNAJC5A, NCL, mir-941-2, mir-941-3, mir-941-4, mir-941-5
General protein information
Preferred Names
dnaJ homolog subfamily C member 5
dnaJ homolog subfamily C member 5
cysteine string protein alpha
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu26667 NM_025219 Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu26667 XM_011529048 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu26667 XM_011529049 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu26667 XM_011529050 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu26667D
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 26-JUL-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB452738.1, BC053642.1 and CR627461.1. This sequence is a reference standard in the RefSeqGene project. On Dec 1, 2010 this sequence version replaced gi:45504381. Summary: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC053642.1, AK289585.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)225..227(+)
Misc Feature(2)255..257(+)
Misc Feature(3)261..263(+)
Misc Feature(4)261..263(+)
Misc Feature(5)261..263(+)
Misc Feature(6)276..>485(+)
Misc Feature(7)276..278(+)
Misc Feature(8)282..440(+)
Misc Feature(9)360..419(+)
Misc Feature(10)399..401(+)
Exon (1)1..222
Gene Synonym:
Exon (2)223..340
Gene Synonym:
Exon (3)341..554
Gene Synonym:
Exon (4)555..726
Gene Synonym:
Exon (5)727..5293
Gene Synonym:
Position Chain Variation Link
23 23 g, t dbSNP:537670690
26 26 c, t dbSNP:557596205
46 46 -, ccgctg dbSNP:563818595
55 55 g, t dbSNP:577550567
66 66 c, t dbSNP:540212627
93 93 -, gcc dbSNP:531246320
125 125 a, g dbSNP:750302498
241 241 a, g dbSNP:755410138
250 250 a, g dbSNP:200104219
251 251 a, g dbSNP:148585496
272 272 a, g dbSNP:753100030
278 278 a, g dbSNP:144141585
279 279 c, t dbSNP:371819808
285 285 c, g dbSNP:780154907
287 287 a, c, t dbSNP:770638590
293 293 c, t dbSNP:745419250
297 297 g, t dbSNP:771878951
308 308 c, t dbSNP:189308547
309 309 g, t dbSNP:753722773
333 333 a, t dbSNP:768384234
341 341 c, g dbSNP:774703054
350 350 c, g dbSNP:147295643
355 355 a, g dbSNP:528096976
359 359 c, t dbSNP:775734607
365 365 c, t dbSNP:140948457
377 377 c, t dbSNP:113987077
378 378 a, g dbSNP:754228390
386 386 a, g, t dbSNP:151265913
390 390 a, g, t dbSNP:750037969
392 392 c, t dbSNP:779503067
393 393 a, g dbSNP:202015608
394 394 c, t dbSNP:754887788
395 395 a, g dbSNP:781164296
413 413 c, g dbSNP:747892660
419 419 c, t dbSNP:769566622
421 421 c, t dbSNP:139312819
422 422 a, g dbSNP:746052000
426 426 a, g, t dbSNP:772453351
429 429 a, g dbSNP:371863489
440 440 c, t dbSNP:760881795
441 441 a, g dbSNP:769269113
450 450 a, g dbSNP:777340985
455 455 c, t dbSNP:762228571
458 458 c, t dbSNP:376163421
461 461 c, t dbSNP:201495666
462 462 a, g dbSNP:762638579
464 464 c, t dbSNP:766072943
470 470 c, t dbSNP:149971662
476 476 a, c, g, t dbSNP:532410241
478 478 c, t dbSNP:752620792
482 482 g, t dbSNP:756026221
483 483 c, t dbSNP:777583663
488 488 c, t dbSNP:749077830
494 494 c, t dbSNP:772397861
497 497 a, g dbSNP:780477656
515 515 c, t dbSNP:113207069
524 524 c, g dbSNP:768786863
530 530 c, t dbSNP:776598152
531 531 a, g dbSNP:762344309
539 539 c, g dbSNP:770247745
557 557 c, g dbSNP:141103374
563 563 a, t dbSNP:370749414
569 569 c, t dbSNP:774665874
575 575 c, t dbSNP:746279787
577 577 g, t dbSNP:387907043
579 579 -, ctc dbSNP:587776892
583 583 c, t dbSNP:771742418
584 584 a, g, t dbSNP:775067598
595 595 a, g dbSNP:200240375
596 596 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
602 602 c, t dbSNP:763451897
603 603 g, t dbSNP:373850027
614 614 c, t dbSNP:199712884
622 622 a, g dbSNP:761814066
632 632 c, t dbSNP:377198126
633 633 a, g dbSNP:750233915
649 649 a, g dbSNP:758198396
652 652 c, t dbSNP:144915847
653 653 a, g, t dbSNP:568985915
654 654 c, g dbSNP:567056743
662 662 c, t dbSNP:753956759
669 669 a, t dbSNP:757737652
670 670 c, t dbSNP:779453928
671 671 a, g dbSNP:746222594
677 677 c, t dbSNP:772254851
680 680 c, t dbSNP:780478210
681 681 g, t dbSNP:146719477
689 689 c, t dbSNP:140326040
705 705 a, c dbSNP:776262497
715 715 c, g dbSNP:761471108
719 719 c, t dbSNP:145468246
720 720 c, g dbSNP:773217530
724 724 a, c, g dbSNP:762961919
730 730 c, t dbSNP:747758089
734 734 a, g dbSNP:587780922
736 736 a, g dbSNP:755865198
739 739 c, t dbSNP:777119527
740 740 a, g dbSNP:748875387
742 742 c, t dbSNP:770758533
743 743 a, g, t dbSNP:369508682
746 746 c, t dbSNP:745794091
747 747 a, g dbSNP:771796509
751 751 c, t dbSNP:775285560
757 757 c, t dbSNP:761982169
758 758 a, g dbSNP:373237152
760 760 c, t dbSNP:199540600
761 761 a, g dbSNP:773154613
764 764 c, t dbSNP:376694698
765 765 a, g dbSNP:766374425
770 770 c, t dbSNP:752046563
791 791 c, t dbSNP:755569080
794 794 c, t dbSNP:776807695
796 796 c, t dbSNP:753155376
798 798 c, t dbSNP:377119075
818 818 c, t dbSNP:777536850
819 819 a, g dbSNP:748741035
820 820 a, g dbSNP:756715630
826 826 a, g, t dbSNP:778299599
829 829 a, g dbSNP:745755215
840 840 g, t dbSNP:772027430
841 841 a, t dbSNP:775232180
843 843 c, g dbSNP:370517092
852 852 c, g dbSNP:770001201
857 857 a, g dbSNP:773417550
862 862 c, t dbSNP:763097815
863 863 a, g dbSNP:770998287
874 874 a, g dbSNP:774328739
875 875 c, t dbSNP:569455237
876 876 a, g dbSNP:759852870
878 878 a, c dbSNP:531888878
912 912 a, g dbSNP:552086243
947 947 g, t dbSNP:570103284
953 953 c, t dbSNP:765183029
966 966 a, g dbSNP:572104922
972 972 c, t dbSNP:539094544
988 988 a, t dbSNP:41278210
993 993 c, t dbSNP:566191883
1000 1000 c, t dbSNP:535553583
1009 1009 c, t dbSNP:555245819
1024 1024 g, t dbSNP:575426180
1025 1025 a, g dbSNP:180676568
1104 1104 -, c dbSNP:35725001
1104 1104 c, t dbSNP:762734761
1106 1106 c, t dbSNP:764108980
1151 1151 c, t dbSNP:751612521
1152 1152 a, g dbSNP:143646564
1186 1186 a, g dbSNP:111986990
1197 1197 c, t dbSNP:767468477
1203 1203 a, g dbSNP:188304560
1211 1211 a, g dbSNP:560493837
1227 1227 c, g dbSNP:755818517
1277 1277 c, g dbSNP:758406047
1278 1278 a, t dbSNP:779361142
1287 1287 c, t dbSNP:574019244
1289 1289 c, g dbSNP:543134692
1290 1290 a, g dbSNP:562923666
1298 1298 c, g dbSNP:181187018
1305 1305 c, t dbSNP:551783395
1306 1306 c, t dbSNP:565192822
1314 1314 a, c dbSNP:148120785
1326 1326 g, t dbSNP:546156109
1329 1329 a, c dbSNP:566153307
1348 1348 c, g dbSNP:535180536
1363 1363 c, t dbSNP:779821892
1370 1370 a, g dbSNP:530195733
1371 1371 c, t dbSNP:549098751
1375 1375 c, g dbSNP:373789837
1383 1383 a, g dbSNP:141876407
1421 1421 a, g dbSNP:754507844
1521 1521 g, t dbSNP:185583381
1529 1529 a, g dbSNP:550344216
1537 1537 c, t dbSNP:570221664
1538 1538 a, g dbSNP:190430622
1540 1540 a, g dbSNP:373517080
1549 1549 c, t dbSNP:534100165
1557 1557 a, c, g dbSNP:75130625
1558 1558 a, g dbSNP:150670642
1562 1562 c, t dbSNP:747559300
1563 1563 a, g dbSNP:370655221
1565 1565 c, t dbSNP:563045593
1566 1566 a, g dbSNP:552739074
1573 1573 c, t dbSNP:576463953
1580 1580 g, t dbSNP:140106848
1586 1586 g, t dbSNP:374071727
1591 1591 c, t dbSNP:182038156
1592 1592 a, g dbSNP:565154557
1597 1597 c, t dbSNP:200797893
1606 1606 c, t dbSNP:527952182
1609 1609 c, t dbSNP:547713871
1647 1647 c, t dbSNP:114525694
1664 1664 c, t dbSNP:528926444
1683 1683 a, c, g, t dbSNP:6011230
1697 1697 a, g dbSNP:142246799
1710 1710 c, t dbSNP:537557158
1717 1717 c, t dbSNP:551572805
1725 1725 c, g dbSNP:1064345
1739 1739 g, t dbSNP:114038171
1740 1740 c, t dbSNP:554148166
1762 1762 a, g dbSNP:3764726
1774 1774 a, t dbSNP:774407862
1783 1783 a, g dbSNP:761863277
1789 1789 -, ca dbSNP:761715605
1825 1825 c, t dbSNP:534697865
1839 1839 a, g dbSNP:745906826
1842 1842 a, g dbSNP:111530162
1843 1843 g, t dbSNP:374724029
1846 1846 c, g dbSNP:536602351
1860 1860 c, t dbSNP:556293043
1881 1881 c, t dbSNP:576448324
1882 1882 c, t dbSNP:41278212
1896 1896 c, t dbSNP:558705497
1909 1909 c, t dbSNP:370539010
1913 1913 c, t dbSNP:541319164
1914 1914 a, g dbSNP:772665889
1936 1936 g, t dbSNP:11554629
1947 1947 c, g dbSNP:530334605
1954 1954 a, g dbSNP:542572143
1975 1975 g, t dbSNP:761133645
1988 1988 a, t dbSNP:766037792
2012 2012 c, t dbSNP:753503517
2013 2013 g, t dbSNP:562364964
2027 2027 a, g dbSNP:187083695
2035 2035 c, t dbSNP:551534511
2050 2050 a, g dbSNP:73136582
2065 2065 c, t dbSNP:149675982
2080 2080 a, g dbSNP:547616976
2090 2090 c, t dbSNP:567511920
2110 2110 -, t dbSNP:570640728
2133 2133 c, t dbSNP:41278214
2135 2135 g, t dbSNP:41278216
2171 2171 a, c dbSNP:576882539
2172 2172 a, g dbSNP:41278218
2185 2185 c, t dbSNP:569979955
2194 2194 c, t dbSNP:61735744
2203 2203 c, t dbSNP:777130136
2219 2219 a, c dbSNP:558669385
2220 2220 c, t dbSNP:780290336
2243 2243 c, t dbSNP:375806163
2248 2248 a, g dbSNP:572304793
2263 2263 a, g dbSNP:41278220
2269 2269 c, t dbSNP:192310826
2272 2272 a, g dbSNP:61744085
2304 2304 a, g dbSNP:145450467
2348 2348 a, g dbSNP:543786216
2356 2356 a, c dbSNP:182388077
2386 2386 a, g dbSNP:58526294
2387 2387 g, t dbSNP:542172964
2388 2388 a, g dbSNP:772147376
2403 2403 g, t dbSNP:773078929
2426 2426 a, g dbSNP:61740713
2434 2434 c, t dbSNP:554749952
2460 2460 c, t dbSNP:527390994
2473 2473 c, t dbSNP:142546412
2478 2478 c, t dbSNP:41278222
2479 2479 a, g dbSNP:186759404
2486 2486 c, t dbSNP:549842283
2502 2502 c, t dbSNP:190043990
2515 2515 c, t dbSNP:776328647
2516 2516 a, g dbSNP:759212642
2529 2529 a, t dbSNP:538696522
2548 2548 a, c dbSNP:532451538
2592 2592 c, t dbSNP:764688339
2645 2645 a, g dbSNP:552159535
2650 2650 a, c dbSNP:182604967
2656 2656 a, g dbSNP:751434970
2666 2666 c, t dbSNP:752208413
2698 2698 a, t dbSNP:530157117
2710 2710 c, t dbSNP:757706518
2716 2716 g, t dbSNP:11554632
2720 2720 c, t dbSNP:368351354
2739 2739 c, t dbSNP:534811442
2757 2757 a, g dbSNP:187307345
2761 2761 a, g dbSNP:13048
2764 2764 g, t dbSNP:768056284
2766 2766 c, t dbSNP:574966040
2778 2778 c, t dbSNP:750932518
2785 2785 a, g dbSNP:192839202
2811 2811 c, g dbSNP:543845505
2848 2848 c, t dbSNP:569120771
2869 2869 c, t dbSNP:79245733
2884 2884 a, g dbSNP:577615375
2888 2888 c, t dbSNP:376946085
2894 2894 a, g dbSNP:564889567
2940 2940 a, g dbSNP:572143327
2953 2953 a, t dbSNP:369294707
2967 2967 a, g dbSNP:368218060
2982 2982 a, g dbSNP:561123246
2990 2990 a, g dbSNP:531764324
3001 3001 a, g dbSNP:185288496
3021 3021 c, g dbSNP:550048168
3032 3032 a, g dbSNP:563198999
3036 3036 a, g dbSNP:532286219
3038 3038 c, t dbSNP:11554631
3044 3044 a, c dbSNP:565762270
3048 3048 a, g dbSNP:142121195
3117 3117 c, t dbSNP:548433050
3144 3144 c, t dbSNP:755253233
3172 3172 g, t dbSNP:7360045
3209 3209 a, g dbSNP:6062590
3213 3213 a, g dbSNP:568634990
3249 3249 c, g dbSNP:537200922
3320 3320 c, t dbSNP:557540230
3375 3375 c, g dbSNP:577579444
3393 3393 a, c dbSNP:188604040
3399 3399 g, t dbSNP:11224
3405 3405 a, t dbSNP:762079204
3407 3407 c, t dbSNP:757512075
3431 3431 c, t dbSNP:112103063
3447 3447 a, g dbSNP:6122217
3453 3453 -, a dbSNP:35892428
3463 3463 a, g dbSNP:533825911
3482 3482 c, t dbSNP:772341856
3488 3488 g, t dbSNP:572106837
3508 3508 a, g dbSNP:541113088
3531 3531 c, t dbSNP:3206771
3541 3541 a, g dbSNP:76291580
3546 3546 -, cctgt dbSNP:747355306
3547 3547 c, g dbSNP:543214810
3553 3553 a, g dbSNP:76769576
3555 3555 a, g dbSNP:11554628
3569 3569 a, g dbSNP:6122218
3580 3580 a, g dbSNP:552085775
3591 3591 -, tgcttt dbSNP:111755454
3592 3592 c, g dbSNP:762727386
3595 3595 -, tttgct dbSNP:375427318
3612 3612 c, t dbSNP:559310134
3620 3620 c, t dbSNP:55665472
3632 3632 c, g dbSNP:556265433
3634 3634 c, t dbSNP:568420557
3668 3668 a, c dbSNP:531050018
3671 3671 a, g dbSNP:769271047
3685 3685 c, t dbSNP:551166849
3692 3692 c, t dbSNP:576307094
3693 3693 a, g dbSNP:764885154
3708 3708 c, t dbSNP:749724
3729 3729 a, g dbSNP:62218071
3742 3742 c, t dbSNP:749723
3743 3743 a, g dbSNP:539536316
3746 3746 c, t dbSNP:553744243
3753 3753 c, g dbSNP:552870087
3764 3764 a, g dbSNP:565668761
3784 3784 a, g dbSNP:534278396
3826 3826 a, g dbSNP:573120224
3842 3842 c, t dbSNP:193241753
3890 3890 g, t dbSNP:762417962
3953 3953 -, tgt dbSNP:758069157
3963 3963 a, g dbSNP:535738516
4009 4009 c, t dbSNP:555659295
4014 4014 a, g dbSNP:185738914
4034 4034 c, t dbSNP:140377993
4035 4035 a, g dbSNP:188065663
4046 4046 a, g dbSNP:543421330
4067 4067 g, t dbSNP:576665202
4081 4081 c, t dbSNP:766696156
4082 4082 a, g dbSNP:545688443
4084 4084 c, t dbSNP:559174835
4087 4087 c, t dbSNP:754263293
4099 4099 c, g dbSNP:528394634
4103 4103 c, t dbSNP:755449552
4130 4130 g, t dbSNP:541823867
4194 4194 c, t dbSNP:779269651
4243 4243 a, g dbSNP:150408300
4250 4250 a, g dbSNP:530888343
4258 4258 a, g dbSNP:563716010
4262 4262 a, g dbSNP:1051821
4310 4310 c, g dbSNP:577249426
4314 4314 c, t dbSNP:571049038
4332 4332 c, g dbSNP:746929103
4376 4376 c, g dbSNP:770779154
4380 4380 c, t dbSNP:546308193
4388 4388 c, t dbSNP:745650916
4393 4393 c, t dbSNP:138122310
4412 4412 a, g dbSNP:769644868
4431 4431 a, g dbSNP:547220250
4459 4459 a, g dbSNP:73136585
4482 4482 a, g dbSNP:536165125
4500 4500 a, g dbSNP:77107548
4501 4501 -, tgc dbSNP:549826139
4532 4532 a, g dbSNP:762613624
4575 4575 a, g dbSNP:768172464
4610 4610 c, t dbSNP:773737847
4644 4644 c, g dbSNP:568079996
4669 4669 a, g dbSNP:145028189
4687 4687 a, c dbSNP:556682543
4737 4737 c, t dbSNP:576531330
4745 4745 a, c dbSNP:766779440
4760 4760 a, g dbSNP:754459457
4801 4801 c, t dbSNP:369634697
4825 4825 a, g dbSNP:115323539
4829 4829 a, g dbSNP:528703267
4836 4836 c, t dbSNP:138866062
4837 4837 c, g dbSNP:77777268
4865 4865 c, t dbSNP:542135679
4866 4866 a, g dbSNP:758582743
4895 4895 a, g dbSNP:373099874
4900 4900 c, g dbSNP:3810500
4901 4901 a, g dbSNP:767414680
4947 4947 c, t dbSNP:11554630
4948 4948 a, g dbSNP:564527134
4959 4959 c, g dbSNP:191412647
4961 4961 c, t dbSNP:146360147
4976 4976 a, g dbSNP:1051865
5012 5012 a, c dbSNP:560762968
5027 5027 a, g dbSNP:529542196
5054 5054 g, t dbSNP:549689208
5071 5071 c, t dbSNP:751604011
5077 5077 c, t dbSNP:567957712
5094 5094 c, t dbSNP:757415732
5115 5115 a, g dbSNP:781104665
5127 5127 a, g dbSNP:745853097
5130 5130 c, t dbSNP:41278224
5131 5131 a, g dbSNP:540648110
5159 5159 c, t dbSNP:370513858
5171 5171 g, t dbSNP:574236342
5174 5174 c, t dbSNP:369210127
5206 5206 c, t dbSNP:183854692
5215 5215 a, t dbSNP:77335831
5217 5217 c, g dbSNP:550273913
5220 5220 c, t dbSNP:368872154
5221 5221 a, g dbSNP:539125829
5241 5241 a, g dbSNP:552913413
5285 5285 c, t dbSNP:74554553

Target ORF information:

RefSeq Version NM_025219
Organism Homo sapiens (human)
Definition Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu26667D
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)671..>880(+)
Misc Feature(2)677..835(+)
Misc Feature(3)755..814(+)
Position Chain Variation Link
4 4 a, g dbSNP:554095742
27 27 g, t dbSNP:546636341
29 29 c, t dbSNP:560493805
31 31 a, g dbSNP:529375235
91 91 a, g dbSNP:549523456
108 108 c, t dbSNP:757329562
137 137 a, c dbSNP:569457907
149 149 a, c dbSNP:531851167
168 168 c, t dbSNP:781179515
175 175 -, gaa dbSNP:201216377
185 185 g, t dbSNP:745778281
202 202 a, t dbSNP:769727908
206 206 c, t dbSNP:182952311
213 213 c, t dbSNP:571799801
261 261 c, t dbSNP:187541208
281 281 a, g dbSNP:552517783
347 347 c, t dbSNP:775205604
360 360 a, t dbSNP:749067875
381 381 c, t dbSNP:113317610
382 382 a, g dbSNP:138227881
404 404 a, g dbSNP:112154274
412 412 c, t dbSNP:575389457
436 436 c, t dbSNP:544127839
447 447 g, t dbSNP:557936482
474 474 a, g dbSNP:761417166
481 481 c, t dbSNP:767000758
498 498 a, g dbSNP:7272419
503 503 a, g dbSNP:562447488
543 543 c, t dbSNP:765856003
544 544 c, g dbSNP:138998858
547 547 a, g dbSNP:369184553
548 548 a, c, t dbSNP:192523484
552 552 c, t dbSNP:563017834
587 587 c, t dbSNP:12481368
636 636 a, g dbSNP:755410138
645 645 a, g dbSNP:200104219
646 646 a, g dbSNP:148585496
667 667 a, g dbSNP:753100030
673 673 a, g dbSNP:144141585
674 674 c, t dbSNP:371819808
680 680 c, g dbSNP:780154907
682 682 a, c, t dbSNP:770638590
688 688 c, t dbSNP:745419250
692 692 g, t dbSNP:771878951
703 703 c, t dbSNP:189308547
704 704 g, t dbSNP:753722773
728 728 a, t dbSNP:768384234
736 736 c, g dbSNP:774703054
745 745 c, g dbSNP:147295643
750 750 a, g dbSNP:528096976
754 754 c, t dbSNP:775734607
760 760 c, t dbSNP:140948457
772 772 c, t dbSNP:113987077
773 773 a, g dbSNP:754228390
781 781 a, g, t dbSNP:151265913
785 785 a, g, t dbSNP:750037969
787 787 c, t dbSNP:779503067
788 788 a, g dbSNP:202015608
789 789 c, t dbSNP:754887788
790 790 a, g dbSNP:781164296
808 808 c, g dbSNP:747892660
814 814 c, t dbSNP:769566622
816 816 c, t dbSNP:139312819
817 817 a, g dbSNP:746052000
821 821 a, g, t dbSNP:772453351
824 824 a, g dbSNP:371863489
835 835 c, t dbSNP:760881795
836 836 a, g dbSNP:769269113
845 845 a, g dbSNP:777340985
850 850 c, t dbSNP:762228571
853 853 c, t dbSNP:376163421
856 856 c, t dbSNP:201495666
857 857 a, g dbSNP:762638579
859 859 c, t dbSNP:766072943
865 865 c, t dbSNP:149971662
871 871 a, c, g, t dbSNP:532410241
873 873 c, t dbSNP:752620792
877 877 g, t dbSNP:756026221
878 878 c, t dbSNP:777583663
883 883 c, t dbSNP:749077830
889 889 c, t dbSNP:772397861
892 892 a, g dbSNP:780477656
910 910 c, t dbSNP:113207069
919 919 c, g dbSNP:768786863
925 925 c, t dbSNP:776598152
926 926 a, g dbSNP:762344309
934 934 c, g dbSNP:770247745
952 952 c, g dbSNP:141103374
958 958 a, t dbSNP:370749414
964 964 c, t dbSNP:774665874
970 970 c, t dbSNP:746279787
972 972 g, t dbSNP:387907043
974 974 -, ctc dbSNP:587776892
978 978 c, t dbSNP:771742418
979 979 a, g, t dbSNP:775067598
990 990 a, g dbSNP:200240375
991 991 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
997 997 c, t dbSNP:763451897
998 998 g, t dbSNP:373850027
1009 1009 c, t dbSNP:199712884
1017 1017 a, g dbSNP:761814066
1027 1027 c, t dbSNP:377198126
1028 1028 a, g dbSNP:750233915
1044 1044 a, g dbSNP:758198396
1047 1047 c, t dbSNP:144915847
1048 1048 a, g, t dbSNP:568985915
1049 1049 c, g dbSNP:567056743
1057 1057 c, t dbSNP:753956759
1064 1064 a, t dbSNP:757737652
1065 1065 c, t dbSNP:779453928
1066 1066 a, g dbSNP:746222594
1072 1072 c, t dbSNP:772254851
1075 1075 c, t dbSNP:780478210
1076 1076 g, t dbSNP:146719477
1084 1084 c, t dbSNP:140326040
1100 1100 a, c dbSNP:776262497
1110 1110 c, g dbSNP:761471108
1114 1114 c, t dbSNP:145468246
1115 1115 c, g dbSNP:773217530
1119 1119 a, c, g dbSNP:762961919
1125 1125 c, t dbSNP:747758089
1129 1129 a, g dbSNP:587780922
1131 1131 a, g dbSNP:755865198
1134 1134 c, t dbSNP:777119527
1135 1135 a, g dbSNP:748875387
1137 1137 c, t dbSNP:770758533
1138 1138 a, g, t dbSNP:369508682
1141 1141 c, t dbSNP:745794091
1142 1142 a, g dbSNP:771796509
1146 1146 c, t dbSNP:775285560
1152 1152 c, t dbSNP:761982169
1153 1153 a, g dbSNP:373237152
1155 1155 c, t dbSNP:199540600
1156 1156 a, g dbSNP:773154613
1159 1159 c, t dbSNP:376694698
1160 1160 a, g dbSNP:766374425
1165 1165 c, t dbSNP:752046563
1186 1186 c, t dbSNP:755569080
1189 1189 c, t dbSNP:776807695
1191 1191 c, t dbSNP:753155376
1193 1193 c, t dbSNP:377119075
1213 1213 c, t dbSNP:777536850
1214 1214 a, g dbSNP:748741035
1215 1215 a, g dbSNP:756715630
1221 1221 a, g, t dbSNP:778299599
1224 1224 a, g dbSNP:745755215
1235 1235 g, t dbSNP:772027430
1236 1236 a, t dbSNP:775232180
1238 1238 c, g dbSNP:370517092
1247 1247 c, g dbSNP:770001201
1252 1252 a, g dbSNP:773417550
1257 1257 c, t dbSNP:763097815
1258 1258 a, g dbSNP:770998287
1269 1269 a, g dbSNP:774328739
1270 1270 c, t dbSNP:569455237
1271 1271 a, g dbSNP:759852870
1273 1273 a, c dbSNP:531888878
1307 1307 a, g dbSNP:552086243
1342 1342 g, t dbSNP:570103284
1348 1348 c, t dbSNP:765183029
1361 1361 a, g dbSNP:572104922
1367 1367 c, t dbSNP:539094544
1383 1383 a, t dbSNP:41278210
1388 1388 c, t dbSNP:566191883
1395 1395 c, t dbSNP:535553583
1404 1404 c, t dbSNP:555245819
1419 1419 g, t dbSNP:575426180
1420 1420 a, g dbSNP:180676568
1499 1499 -, c dbSNP:35725001
1499 1499 c, t dbSNP:762734761
1501 1501 c, t dbSNP:764108980
1546 1546 c, t dbSNP:751612521
1547 1547 a, g dbSNP:143646564
1581 1581 a, g dbSNP:111986990
1592 1592 c, t dbSNP:767468477
1598 1598 a, g dbSNP:188304560
1606 1606 a, g dbSNP:560493837
1622 1622 c, g dbSNP:755818517
1672 1672 c, g dbSNP:758406047
1673 1673 a, t dbSNP:779361142
1682 1682 c, t dbSNP:574019244
1684 1684 c, g dbSNP:543134692
1685 1685 a, g dbSNP:562923666
1693 1693 c, g dbSNP:181187018
1700 1700 c, t dbSNP:551783395
1701 1701 c, t dbSNP:565192822
1709 1709 a, c dbSNP:148120785
1721 1721 g, t dbSNP:546156109
1724 1724 a, c dbSNP:566153307
1743 1743 c, g dbSNP:535180536
1758 1758 c, t dbSNP:779821892
1765 1765 a, g dbSNP:530195733
1766 1766 c, t dbSNP:549098751
1770 1770 c, g dbSNP:373789837
1778 1778 a, g dbSNP:141876407
1816 1816 a, g dbSNP:754507844
1916 1916 g, t dbSNP:185583381
1924 1924 a, g dbSNP:550344216
1932 1932 c, t dbSNP:570221664
1933 1933 a, g dbSNP:190430622
1935 1935 a, g dbSNP:373517080
1944 1944 c, t dbSNP:534100165
1952 1952 a, c, g dbSNP:75130625
1953 1953 a, g dbSNP:150670642
1957 1957 c, t dbSNP:747559300
1958 1958 a, g dbSNP:370655221
1960 1960 c, t dbSNP:563045593
1961 1961 a, g dbSNP:552739074
1968 1968 c, t dbSNP:576463953
1975 1975 g, t dbSNP:140106848
1981 1981 g, t dbSNP:374071727
1986 1986 c, t dbSNP:182038156
1987 1987 a, g dbSNP:565154557
1992 1992 c, t dbSNP:200797893
2001 2001 c, t dbSNP:527952182
2004 2004 c, t dbSNP:547713871
2042 2042 c, t dbSNP:114525694
2059 2059 c, t dbSNP:528926444
2078 2078 a, c, g, t dbSNP:6011230
2092 2092 a, g dbSNP:142246799
2105 2105 c, t dbSNP:537557158
2112 2112 c, t dbSNP:551572805
2120 2120 c, g dbSNP:1064345
2134 2134 g, t dbSNP:114038171
2135 2135 c, t dbSNP:554148166
2157 2157 a, g dbSNP:3764726
2169 2169 a, t dbSNP:774407862
2178 2178 a, g dbSNP:761863277
2184 2184 -, ca dbSNP:761715605
2220 2220 c, t dbSNP:534697865
2234 2234 a, g dbSNP:745906826
2237 2237 a, g dbSNP:111530162
2238 2238 g, t dbSNP:374724029
2241 2241 c, g dbSNP:536602351
2255 2255 c, t dbSNP:556293043
2276 2276 c, t dbSNP:576448324
2277 2277 c, t dbSNP:41278212
2291 2291 c, t dbSNP:558705497
2304 2304 c, t dbSNP:370539010
2308 2308 c, t dbSNP:541319164
2309 2309 a, g dbSNP:772665889
2331 2331 g, t dbSNP:11554629
2342 2342 c, g dbSNP:530334605
2349 2349 a, g dbSNP:542572143
2370 2370 g, t dbSNP:761133645
2383 2383 a, t dbSNP:766037792
2407 2407 c, t dbSNP:753503517
2408 2408 g, t dbSNP:562364964
2422 2422 a, g dbSNP:187083695
2430 2430 c, t dbSNP:551534511
2445 2445 a, g dbSNP:73136582
2460 2460 c, t dbSNP:149675982
2475 2475 a, g dbSNP:547616976
2485 2485 c, t dbSNP:567511920
2505 2505 -, t dbSNP:570640728
2528 2528 c, t dbSNP:41278214
2530 2530 g, t dbSNP:41278216
2566 2566 a, c dbSNP:576882539
2567 2567 a, g dbSNP:41278218
2580 2580 c, t dbSNP:569979955
2589 2589 c, t dbSNP:61735744
2598 2598 c, t dbSNP:777130136
2614 2614 a, c dbSNP:558669385
2615 2615 c, t dbSNP:780290336
2638 2638 c, t dbSNP:375806163
2643 2643 a, g dbSNP:572304793
2658 2658 a, g dbSNP:41278220
2664 2664 c, t dbSNP:192310826
2667 2667 a, g dbSNP:61744085
2699 2699 a, g dbSNP:145450467
2743 2743 a, g dbSNP:543786216
2751 2751 a, c dbSNP:182388077
2781 2781 a, g dbSNP:58526294
2782 2782 g, t dbSNP:542172964
2783 2783 a, g dbSNP:772147376
2798 2798 g, t dbSNP:773078929
2821 2821 a, g dbSNP:61740713
2829 2829 c, t dbSNP:554749952
2855 2855 c, t dbSNP:527390994
2868 2868 c, t dbSNP:142546412
2873 2873 c, t dbSNP:41278222
2874 2874 a, g dbSNP:186759404
2881 2881 c, t dbSNP:549842283
2897 2897 c, t dbSNP:190043990
2910 2910 c, t dbSNP:776328647
2911 2911 a, g dbSNP:759212642
2924 2924 a, t dbSNP:538696522
2943 2943 a, c dbSNP:532451538
2987 2987 c, t dbSNP:764688339
3040 3040 a, g dbSNP:552159535
3045 3045 a, c dbSNP:182604967
3051 3051 a, g dbSNP:751434970
3061 3061 c, t dbSNP:752208413
3093 3093 a, t dbSNP:530157117
3105 3105 c, t dbSNP:757706518
3111 3111 g, t dbSNP:11554632
3115 3115 c, t dbSNP:368351354
3134 3134 c, t dbSNP:534811442
3152 3152 a, g dbSNP:187307345
3156 3156 a, g dbSNP:13048
3159 3159 g, t dbSNP:768056284
3161 3161 c, t dbSNP:574966040
3173 3173 c, t dbSNP:750932518
3180 3180 a, g dbSNP:192839202
3206 3206 c, g dbSNP:543845505
3243 3243 c, t dbSNP:569120771
3264 3264 c, t dbSNP:79245733
3279 3279 a, g dbSNP:577615375
3283 3283 c, t dbSNP:376946085
3289 3289 a, g dbSNP:564889567
3335 3335 a, g dbSNP:572143327
3348 3348 a, t dbSNP:369294707
3362 3362 a, g dbSNP:368218060
3377 3377 a, g dbSNP:561123246
3385 3385 a, g dbSNP:531764324
3396 3396 a, g dbSNP:185288496
3416 3416 c, g dbSNP:550048168
3427 3427 a, g dbSNP:563198999
3431 3431 a, g dbSNP:532286219
3433 3433 c, t dbSNP:11554631
3439 3439 a, c dbSNP:565762270
3443 3443 a, g dbSNP:142121195
3512 3512 c, t dbSNP:548433050
3539 3539 c, t dbSNP:755253233
3567 3567 g, t dbSNP:7360045
3604 3604 a, g dbSNP:6062590
3608 3608 a, g dbSNP:568634990
3644 3644 c, g dbSNP:537200922
3715 3715 c, t dbSNP:557540230
3770 3770 c, g dbSNP:577579444
3788 3788 a, c dbSNP:188604040
3794 3794 g, t dbSNP:11224
3800 3800 a, t dbSNP:762079204
3802 3802 c, t dbSNP:757512075
3826 3826 c, t dbSNP:112103063
3842 3842 a, g dbSNP:6122217
3848 3848 -, a dbSNP:35892428
3858 3858 a, g dbSNP:533825911
3877 3877 c, t dbSNP:772341856
3883 3883 g, t dbSNP:572106837
3903 3903 a, g dbSNP:541113088
3926 3926 c, t dbSNP:3206771
3936 3936 a, g dbSNP:76291580
3941 3941 -, cctgt dbSNP:747355306
3942 3942 c, g dbSNP:543214810
3948 3948 a, g dbSNP:76769576
3950 3950 a, g dbSNP:11554628
3964 3964 a, g dbSNP:6122218
3975 3975 a, g dbSNP:552085775
3986 3986 -, tgcttt dbSNP:111755454
3987 3987 c, g dbSNP:762727386
3990 3990 -, tttgct dbSNP:375427318
4007 4007 c, t dbSNP:559310134
4015 4015 c, t dbSNP:55665472
4027 4027 c, g dbSNP:556265433
4029 4029 c, t dbSNP:568420557
4063 4063 a, c dbSNP:531050018
4066 4066 a, g dbSNP:769271047
4080 4080 c, t dbSNP:551166849
4087 4087 c, t dbSNP:576307094
4088 4088 a, g dbSNP:764885154
4103 4103 c, t dbSNP:749724
4124 4124 a, g dbSNP:62218071
4137 4137 c, t dbSNP:749723
4138 4138 a, g dbSNP:539536316
4141 4141 c, t dbSNP:553744243
4148 4148 c, g dbSNP:552870087
4159 4159 a, g dbSNP:565668761
4179 4179 a, g dbSNP:534278396
4221 4221 a, g dbSNP:573120224
4237 4237 c, t dbSNP:193241753
4285 4285 g, t dbSNP:762417962
4348 4348 -, tgt dbSNP:758069157
4358 4358 a, g dbSNP:535738516
4404 4404 c, t dbSNP:555659295
4409 4409 a, g dbSNP:185738914
4429 4429 c, t dbSNP:140377993
4430 4430 a, g dbSNP:188065663
4441 4441 a, g dbSNP:543421330
4462 4462 g, t dbSNP:576665202
4476 4476 c, t dbSNP:766696156
4477 4477 a, g dbSNP:545688443
4479 4479 c, t dbSNP:559174835
4482 4482 c, t dbSNP:754263293
4494 4494 c, g dbSNP:528394634
4498 4498 c, t dbSNP:755449552
4525 4525 g, t dbSNP:541823867
4589 4589 c, t dbSNP:779269651
4638 4638 a, g dbSNP:150408300
4645 4645 a, g dbSNP:530888343
4653 4653 a, g dbSNP:563716010
4657 4657 a, g dbSNP:1051821
4705 4705 c, g dbSNP:577249426
4709 4709 c, t dbSNP:571049038
4727 4727 c, g dbSNP:746929103
4771 4771 c, g dbSNP:770779154
4775 4775 c, t dbSNP:546308193
4783 4783 c, t dbSNP:745650916
4788 4788 c, t dbSNP:138122310
4807 4807 a, g dbSNP:769644868
4826 4826 a, g dbSNP:547220250
4854 4854 a, g dbSNP:73136585
4877 4877 a, g dbSNP:536165125
4895 4895 a, g dbSNP:77107548
4896 4896 -, tgc dbSNP:549826139
4927 4927 a, g dbSNP:762613624
4970 4970 a, g dbSNP:768172464
5005 5005 c, t dbSNP:773737847
5039 5039 c, g dbSNP:568079996
5064 5064 a, g dbSNP:145028189
5082 5082 a, c dbSNP:556682543
5132 5132 c, t dbSNP:576531330
5140 5140 a, c dbSNP:766779440
5155 5155 a, g dbSNP:754459457
5196 5196 c, t dbSNP:369634697
5220 5220 a, g dbSNP:115323539
5224 5224 a, g dbSNP:528703267
5231 5231 c, t dbSNP:138866062
5232 5232 c, g dbSNP:77777268
5260 5260 c, t dbSNP:542135679
5261 5261 a, g dbSNP:758582743
5290 5290 a, g dbSNP:373099874
5295 5295 c, g dbSNP:3810500
5296 5296 a, g dbSNP:767414680
5342 5342 c, t dbSNP:11554630
5343 5343 a, g dbSNP:564527134
5354 5354 c, g dbSNP:191412647
5356 5356 c, t dbSNP:146360147
5371 5371 a, g dbSNP:1051865
5407 5407 a, c dbSNP:560762968
5422 5422 a, g dbSNP:529542196
5449 5449 g, t dbSNP:549689208
5466 5466 c, t dbSNP:751604011
5472 5472 c, t dbSNP:567957712
5489 5489 c, t dbSNP:757415732
5510 5510 a, g dbSNP:781104665
5522 5522 a, g dbSNP:745853097
5525 5525 c, t dbSNP:41278224
5526 5526 a, g dbSNP:540648110
5554 5554 c, t dbSNP:370513858
5566 5566 g, t dbSNP:574236342
5569 5569 c, t dbSNP:369210127
5601 5601 c, t dbSNP:183854692
5610 5610 a, t dbSNP:77335831
5612 5612 c, g dbSNP:550273913
5615 5615 c, t dbSNP:368872154
5616 5616 a, g dbSNP:539125829
5636 5636 a, g dbSNP:552913413
5680 5680 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529048
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu26667D
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)933..>1142(+)
Misc Feature(2)939..1097(+)
Misc Feature(3)1017..1076(+)
Position Chain Variation Link
1 1 a, g dbSNP:367669837
2 2 c, t dbSNP:776173043
8 8 c, t dbSNP:761290631
13 13 c, t dbSNP:765265938
15 15 -, a dbSNP:763109334
15 15 c, t dbSNP:750321817
16 16 a, g dbSNP:2427556
23 23 c, t dbSNP:758425179
24 24 a, g dbSNP:766229694
26 26 c, t dbSNP:751432022
28 28 c, t dbSNP:756328807
29 29 a, g dbSNP:777904690
37 37 -, acgcacccggctgtgtgc dbSNP:764476807
38 38 c, t dbSNP:749373452
39 39 g, t dbSNP:757345661
44 44 c, t dbSNP:778967346
46 46 c, g dbSNP:113283070
49 49 c, g dbSNP:746312685
51 51 a, g dbSNP:111479365
54 54 c, g dbSNP:113698386
61 61 g, t dbSNP:772586794
62 62 c, t dbSNP:775788403
63 63 a, c dbSNP:112027130
72 72 a, g dbSNP:6089780
82 82 c, t dbSNP:6090019
85 85 a, g dbSNP:776217336
107 107 a, g dbSNP:113309089
110 110 c, g dbSNP:113946605
128 128 a, g dbSNP:113343621
141 141 a, g dbSNP:554875272
157 157 a, g dbSNP:574724312
163 163 a, g dbSNP:112466552
184 184 a, g dbSNP:111974421
196 196 c, t dbSNP:111549668
207 207 a, g dbSNP:112651993
212 212 c, t dbSNP:201085219
219 219 a, g dbSNP:2427557
222 222 c, g dbSNP:2427558
223 223 a, g dbSNP:772871954
228 228 a, t dbSNP:370749264
240 240 a, g dbSNP:111246522
262 262 c, t dbSNP:762946431
263 263 a, g dbSNP:545905782
274 274 c, t dbSNP:751347511
275 275 a, g dbSNP:559658009
289 289 c, t dbSNP:371545349
290 290 a, g dbSNP:753940797
295 295 c, t dbSNP:757483414
296 296 a, g dbSNP:778912055
300 300 a, g dbSNP:745974588
302 302 a, g dbSNP:113587130
305 305 c, g dbSNP:113258585
308 308 a, t dbSNP:542137436
309 309 g, t dbSNP:747398053
320 320 c, t dbSNP:768839190
322 322 c, t dbSNP:376672499
323 323 a, g dbSNP:747710372
330 330 c, t dbSNP:769602656
331 331 a, g dbSNP:772820428
349 349 c, t dbSNP:762602672
352 352 a, g dbSNP:113672516
358 358 a, g dbSNP:111993072
361 361 c, g dbSNP:34604519
391 391 c, t dbSNP:7360929
408 408 a, g dbSNP:76606291
414 414 a, g dbSNP:111696059
417 417 c, g dbSNP:12625445
420 420 -, at dbSNP:774681750
429 429 a, g dbSNP:770978307
433 433 -, ccgggacagcgccacggaagaggacgcacccgg dbSNP:760595490
434 434 c, t dbSNP:558127488
435 435 a, g dbSNP:759522333
442 442 c, t dbSNP:767158762
447 447 c, t dbSNP:112205797
448 448 a, g dbSNP:752555564
451 451 a, g dbSNP:761978432
457 457 c, t dbSNP:549849337
458 458 a, g dbSNP:765481515
464 464 a, g dbSNP:35544770
468 468 -, gtgtgcacatgtgcccagggccc dbSNP:766108698
470 470 a, g dbSNP:111586745
473 473 c, g dbSNP:12625454
490 490 c, t dbSNP:202033298
511 511 g, t dbSNP:780190059
513 513 c, t dbSNP:12624786
519 519 c, t dbSNP:751957826
520 520 a, g dbSNP:755535025
526 526 a, g dbSNP:371847120
529 529 a, g, t dbSNP:748563877
531 531 c, t dbSNP:777627197
532 532 a, c dbSNP:748801114
533 533 g, t dbSNP:770496241
541 541 a, g dbSNP:773924491
547 547 a, g dbSNP:532211416
573 573 c, t dbSNP:56202554
576 576 a, g dbSNP:113257637
607 607 c, t dbSNP:552270228
631 631 c, t dbSNP:565714646
641 641 c, g dbSNP:534851231
666 666 c, t dbSNP:548176739
681 681 c, t dbSNP:568057329
682 682 a, g dbSNP:148498083
693 693 c, t dbSNP:556898949
715 715 a, g dbSNP:576845383
726 726 a, c dbSNP:539521695
768 768 a, g dbSNP:553462142
802 802 a, g dbSNP:573342809
803 803 g, t dbSNP:542451465
824 824 c, t dbSNP:748257111
837 837 c, t dbSNP:112708386
853 853 c, g dbSNP:575967628
871 871 c, t dbSNP:187305839
898 898 a, g dbSNP:755410138
907 907 a, g dbSNP:200104219
908 908 a, g dbSNP:148585496
929 929 a, g dbSNP:753100030
935 935 a, g dbSNP:144141585
936 936 c, t dbSNP:371819808
942 942 c, g dbSNP:780154907
944 944 a, c, t dbSNP:770638590
950 950 c, t dbSNP:745419250
954 954 g, t dbSNP:771878951
965 965 c, t dbSNP:189308547
966 966 g, t dbSNP:753722773
990 990 a, t dbSNP:768384234
998 998 c, g dbSNP:774703054
1007 1007 c, g dbSNP:147295643
1012 1012 a, g dbSNP:528096976
1016 1016 c, t dbSNP:775734607
1022 1022 c, t dbSNP:140948457
1034 1034 c, t dbSNP:113987077
1035 1035 a, g dbSNP:754228390
1043 1043 a, g, t dbSNP:151265913
1047 1047 a, g, t dbSNP:750037969
1049 1049 c, t dbSNP:779503067
1050 1050 a, g dbSNP:202015608
1051 1051 c, t dbSNP:754887788
1052 1052 a, g dbSNP:781164296
1070 1070 c, g dbSNP:747892660
1076 1076 c, t dbSNP:769566622
1078 1078 c, t dbSNP:139312819
1079 1079 a, g dbSNP:746052000
1083 1083 a, g, t dbSNP:772453351
1086 1086 a, g dbSNP:371863489
1097 1097 c, t dbSNP:760881795
1098 1098 a, g dbSNP:769269113
1107 1107 a, g dbSNP:777340985
1112 1112 c, t dbSNP:762228571
1115 1115 c, t dbSNP:376163421
1118 1118 c, t dbSNP:201495666
1119 1119 a, g dbSNP:762638579
1121 1121 c, t dbSNP:766072943
1127 1127 c, t dbSNP:149971662
1133 1133 a, c, g, t dbSNP:532410241
1135 1135 c, t dbSNP:752620792
1139 1139 g, t dbSNP:756026221
1140 1140 c, t dbSNP:777583663
1145 1145 c, t dbSNP:749077830
1151 1151 c, t dbSNP:772397861
1154 1154 a, g dbSNP:780477656
1172 1172 c, t dbSNP:113207069
1181 1181 c, g dbSNP:768786863
1187 1187 c, t dbSNP:776598152
1188 1188 a, g dbSNP:762344309
1196 1196 c, g dbSNP:770247745
1214 1214 c, g dbSNP:141103374
1220 1220 a, t dbSNP:370749414
1226 1226 c, t dbSNP:774665874
1232 1232 c, t dbSNP:746279787
1234 1234 g, t dbSNP:387907043
1236 1236 -, ctc dbSNP:587776892
1240 1240 c, t dbSNP:771742418
1241 1241 a, g, t dbSNP:775067598
1252 1252 a, g dbSNP:200240375
1253 1253 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
1259 1259 c, t dbSNP:763451897
1260 1260 g, t dbSNP:373850027
1271 1271 c, t dbSNP:199712884
1279 1279 a, g dbSNP:761814066
1289 1289 c, t dbSNP:377198126
1290 1290 a, g dbSNP:750233915
1306 1306 a, g dbSNP:758198396
1309 1309 c, t dbSNP:144915847
1310 1310 a, g, t dbSNP:568985915
1311 1311 c, g dbSNP:567056743
1319 1319 c, t dbSNP:753956759
1326 1326 a, t dbSNP:757737652
1327 1327 c, t dbSNP:779453928
1328 1328 a, g dbSNP:746222594
1334 1334 c, t dbSNP:772254851
1337 1337 c, t dbSNP:780478210
1338 1338 g, t dbSNP:146719477
1346 1346 c, t dbSNP:140326040
1362 1362 a, c dbSNP:776262497
1372 1372 c, g dbSNP:761471108
1376 1376 c, t dbSNP:145468246
1377 1377 c, g dbSNP:773217530
1381 1381 a, c, g dbSNP:762961919
1387 1387 c, t dbSNP:747758089
1391 1391 a, g dbSNP:587780922
1393 1393 a, g dbSNP:755865198
1396 1396 c, t dbSNP:777119527
1397 1397 a, g dbSNP:748875387
1399 1399 c, t dbSNP:770758533
1400 1400 a, g, t dbSNP:369508682
1403 1403 c, t dbSNP:745794091
1404 1404 a, g dbSNP:771796509
1408 1408 c, t dbSNP:775285560
1414 1414 c, t dbSNP:761982169
1415 1415 a, g dbSNP:373237152
1417 1417 c, t dbSNP:199540600
1418 1418 a, g dbSNP:773154613
1421 1421 c, t dbSNP:376694698
1422 1422 a, g dbSNP:766374425
1427 1427 c, t dbSNP:752046563
1448 1448 c, t dbSNP:755569080
1451 1451 c, t dbSNP:776807695
1453 1453 c, t dbSNP:753155376
1455 1455 c, t dbSNP:377119075
1475 1475 c, t dbSNP:777536850
1476 1476 a, g dbSNP:748741035
1477 1477 a, g dbSNP:756715630
1483 1483 a, g, t dbSNP:778299599
1486 1486 a, g dbSNP:745755215
1497 1497 g, t dbSNP:772027430
1498 1498 a, t dbSNP:775232180
1500 1500 c, g dbSNP:370517092
1509 1509 c, g dbSNP:770001201
1514 1514 a, g dbSNP:773417550
1519 1519 c, t dbSNP:763097815
1520 1520 a, g dbSNP:770998287
1531 1531 a, g dbSNP:774328739
1532 1532 c, t dbSNP:569455237
1533 1533 a, g dbSNP:759852870
1535 1535 a, c dbSNP:531888878
1569 1569 a, g dbSNP:552086243
1604 1604 g, t dbSNP:570103284
1610 1610 c, t dbSNP:765183029
1623 1623 a, g dbSNP:572104922
1629 1629 c, t dbSNP:539094544
1645 1645 a, t dbSNP:41278210
1650 1650 c, t dbSNP:566191883
1657 1657 c, t dbSNP:535553583
1666 1666 c, t dbSNP:555245819
1681 1681 g, t dbSNP:575426180
1682 1682 a, g dbSNP:180676568
1761 1761 -, c dbSNP:35725001
1761 1761 c, t dbSNP:762734761
1763 1763 c, t dbSNP:764108980
1808 1808 c, t dbSNP:751612521
1809 1809 a, g dbSNP:143646564
1843 1843 a, g dbSNP:111986990
1854 1854 c, t dbSNP:767468477
1860 1860 a, g dbSNP:188304560
1868 1868 a, g dbSNP:560493837
1884 1884 c, g dbSNP:755818517
1934 1934 c, g dbSNP:758406047
1935 1935 a, t dbSNP:779361142
1944 1944 c, t dbSNP:574019244
1946 1946 c, g dbSNP:543134692
1947 1947 a, g dbSNP:562923666
1955 1955 c, g dbSNP:181187018
1962 1962 c, t dbSNP:551783395
1963 1963 c, t dbSNP:565192822
1971 1971 a, c dbSNP:148120785
1983 1983 g, t dbSNP:546156109
1986 1986 a, c dbSNP:566153307
2005 2005 c, g dbSNP:535180536
2020 2020 c, t dbSNP:779821892
2027 2027 a, g dbSNP:530195733
2028 2028 c, t dbSNP:549098751
2032 2032 c, g dbSNP:373789837
2040 2040 a, g dbSNP:141876407
2078 2078 a, g dbSNP:754507844
2178 2178 g, t dbSNP:185583381
2186 2186 a, g dbSNP:550344216
2194 2194 c, t dbSNP:570221664
2195 2195 a, g dbSNP:190430622
2197 2197 a, g dbSNP:373517080
2206 2206 c, t dbSNP:534100165
2214 2214 a, c, g dbSNP:75130625
2215 2215 a, g dbSNP:150670642
2219 2219 c, t dbSNP:747559300
2220 2220 a, g dbSNP:370655221
2222 2222 c, t dbSNP:563045593
2223 2223 a, g dbSNP:552739074
2230 2230 c, t dbSNP:576463953
2237 2237 g, t dbSNP:140106848
2243 2243 g, t dbSNP:374071727
2248 2248 c, t dbSNP:182038156
2249 2249 a, g dbSNP:565154557
2254 2254 c, t dbSNP:200797893
2263 2263 c, t dbSNP:527952182
2266 2266 c, t dbSNP:547713871
2304 2304 c, t dbSNP:114525694
2321 2321 c, t dbSNP:528926444
2340 2340 a, c, g, t dbSNP:6011230
2354 2354 a, g dbSNP:142246799
2367 2367 c, t dbSNP:537557158
2374 2374 c, t dbSNP:551572805
2382 2382 c, g dbSNP:1064345
2396 2396 g, t dbSNP:114038171
2397 2397 c, t dbSNP:554148166
2419 2419 a, g dbSNP:3764726
2431 2431 a, t dbSNP:774407862
2440 2440 a, g dbSNP:761863277
2446 2446 -, ca dbSNP:761715605
2482 2482 c, t dbSNP:534697865
2496 2496 a, g dbSNP:745906826
2499 2499 a, g dbSNP:111530162
2500 2500 g, t dbSNP:374724029
2503 2503 c, g dbSNP:536602351
2517 2517 c, t dbSNP:556293043
2538 2538 c, t dbSNP:576448324
2539 2539 c, t dbSNP:41278212
2553 2553 c, t dbSNP:558705497
2566 2566 c, t dbSNP:370539010
2570 2570 c, t dbSNP:541319164
2571 2571 a, g dbSNP:772665889
2593 2593 g, t dbSNP:11554629
2604 2604 c, g dbSNP:530334605
2611 2611 a, g dbSNP:542572143
2632 2632 g, t dbSNP:761133645
2645 2645 a, t dbSNP:766037792
2669 2669 c, t dbSNP:753503517
2670 2670 g, t dbSNP:562364964
2684 2684 a, g dbSNP:187083695
2692 2692 c, t dbSNP:551534511
2707 2707 a, g dbSNP:73136582
2722 2722 c, t dbSNP:149675982
2737 2737 a, g dbSNP:547616976
2747 2747 c, t dbSNP:567511920
2767 2767 -, t dbSNP:570640728
2790 2790 c, t dbSNP:41278214
2792 2792 g, t dbSNP:41278216
2828 2828 a, c dbSNP:576882539
2829 2829 a, g dbSNP:41278218
2842 2842 c, t dbSNP:569979955
2851 2851 c, t dbSNP:61735744
2860 2860 c, t dbSNP:777130136
2876 2876 a, c dbSNP:558669385
2877 2877 c, t dbSNP:780290336
2900 2900 c, t dbSNP:375806163
2905 2905 a, g dbSNP:572304793
2920 2920 a, g dbSNP:41278220
2926 2926 c, t dbSNP:192310826
2929 2929 a, g dbSNP:61744085
2961 2961 a, g dbSNP:145450467
3005 3005 a, g dbSNP:543786216
3013 3013 a, c dbSNP:182388077
3043 3043 a, g dbSNP:58526294
3044 3044 g, t dbSNP:542172964
3045 3045 a, g dbSNP:772147376
3060 3060 g, t dbSNP:773078929
3083 3083 a, g dbSNP:61740713
3091 3091 c, t dbSNP:554749952
3117 3117 c, t dbSNP:527390994
3130 3130 c, t dbSNP:142546412
3135 3135 c, t dbSNP:41278222
3136 3136 a, g dbSNP:186759404
3143 3143 c, t dbSNP:549842283
3159 3159 c, t dbSNP:190043990
3172 3172 c, t dbSNP:776328647
3173 3173 a, g dbSNP:759212642
3186 3186 a, t dbSNP:538696522
3205 3205 a, c dbSNP:532451538
3249 3249 c, t dbSNP:764688339
3302 3302 a, g dbSNP:552159535
3307 3307 a, c dbSNP:182604967
3313 3313 a, g dbSNP:751434970
3323 3323 c, t dbSNP:752208413
3355 3355 a, t dbSNP:530157117
3367 3367 c, t dbSNP:757706518
3373 3373 g, t dbSNP:11554632
3377 3377 c, t dbSNP:368351354
3396 3396 c, t dbSNP:534811442
3414 3414 a, g dbSNP:187307345
3418 3418 a, g dbSNP:13048
3421 3421 g, t dbSNP:768056284
3423 3423 c, t dbSNP:574966040
3435 3435 c, t dbSNP:750932518
3442 3442 a, g dbSNP:192839202
3468 3468 c, g dbSNP:543845505
3505 3505 c, t dbSNP:569120771
3526 3526 c, t dbSNP:79245733
3541 3541 a, g dbSNP:577615375
3545 3545 c, t dbSNP:376946085
3551 3551 a, g dbSNP:564889567
3597 3597 a, g dbSNP:572143327
3610 3610 a, t dbSNP:369294707
3624 3624 a, g dbSNP:368218060
3639 3639 a, g dbSNP:561123246
3647 3647 a, g dbSNP:531764324
3658 3658 a, g dbSNP:185288496
3678 3678 c, g dbSNP:550048168
3689 3689 a, g dbSNP:563198999
3693 3693 a, g dbSNP:532286219
3695 3695 c, t dbSNP:11554631
3701 3701 a, c dbSNP:565762270
3705 3705 a, g dbSNP:142121195
3774 3774 c, t dbSNP:548433050
3801 3801 c, t dbSNP:755253233
3829 3829 g, t dbSNP:7360045
3866 3866 a, g dbSNP:6062590
3870 3870 a, g dbSNP:568634990
3906 3906 c, g dbSNP:537200922
3977 3977 c, t dbSNP:557540230
4032 4032 c, g dbSNP:577579444
4050 4050 a, c dbSNP:188604040
4056 4056 g, t dbSNP:11224
4062 4062 a, t dbSNP:762079204
4064 4064 c, t dbSNP:757512075
4088 4088 c, t dbSNP:112103063
4104 4104 a, g dbSNP:6122217
4110 4110 -, a dbSNP:35892428
4120 4120 a, g dbSNP:533825911
4139 4139 c, t dbSNP:772341856
4145 4145 g, t dbSNP:572106837
4165 4165 a, g dbSNP:541113088
4188 4188 c, t dbSNP:3206771
4198 4198 a, g dbSNP:76291580
4203 4203 -, cctgt dbSNP:747355306
4204 4204 c, g dbSNP:543214810
4210 4210 a, g dbSNP:76769576
4212 4212 a, g dbSNP:11554628
4226 4226 a, g dbSNP:6122218
4237 4237 a, g dbSNP:552085775
4248 4248 -, tgcttt dbSNP:111755454
4249 4249 c, g dbSNP:762727386
4252 4252 -, tttgct dbSNP:375427318
4269 4269 c, t dbSNP:559310134
4277 4277 c, t dbSNP:55665472
4289 4289 c, g dbSNP:556265433
4291 4291 c, t dbSNP:568420557
4325 4325 a, c dbSNP:531050018
4328 4328 a, g dbSNP:769271047
4342 4342 c, t dbSNP:551166849
4349 4349 c, t dbSNP:576307094
4350 4350 a, g dbSNP:764885154
4365 4365 c, t dbSNP:749724
4386 4386 a, g dbSNP:62218071
4399 4399 c, t dbSNP:749723
4400 4400 a, g dbSNP:539536316
4403 4403 c, t dbSNP:553744243
4410 4410 c, g dbSNP:552870087
4421 4421 a, g dbSNP:565668761
4441 4441 a, g dbSNP:534278396
4483 4483 a, g dbSNP:573120224
4499 4499 c, t dbSNP:193241753
4547 4547 g, t dbSNP:762417962
4610 4610 -, tgt dbSNP:758069157
4620 4620 a, g dbSNP:535738516
4666 4666 c, t dbSNP:555659295
4671 4671 a, g dbSNP:185738914
4691 4691 c, t dbSNP:140377993
4692 4692 a, g dbSNP:188065663
4703 4703 a, g dbSNP:543421330
4724 4724 g, t dbSNP:576665202
4738 4738 c, t dbSNP:766696156
4739 4739 a, g dbSNP:545688443
4741 4741 c, t dbSNP:559174835
4744 4744 c, t dbSNP:754263293
4756 4756 c, g dbSNP:528394634
4760 4760 c, t dbSNP:755449552
4787 4787 g, t dbSNP:541823867
4851 4851 c, t dbSNP:779269651
4900 4900 a, g dbSNP:150408300
4907 4907 a, g dbSNP:530888343
4915 4915 a, g dbSNP:563716010
4919 4919 a, g dbSNP:1051821
4967 4967 c, g dbSNP:577249426
4971 4971 c, t dbSNP:571049038
4989 4989 c, g dbSNP:746929103
5033 5033 c, g dbSNP:770779154
5037 5037 c, t dbSNP:546308193
5045 5045 c, t dbSNP:745650916
5050 5050 c, t dbSNP:138122310
5069 5069 a, g dbSNP:769644868
5088 5088 a, g dbSNP:547220250
5116 5116 a, g dbSNP:73136585
5139 5139 a, g dbSNP:536165125
5157 5157 a, g dbSNP:77107548
5158 5158 -, tgc dbSNP:549826139
5189 5189 a, g dbSNP:762613624
5232 5232 a, g dbSNP:768172464
5267 5267 c, t dbSNP:773737847
5301 5301 c, g dbSNP:568079996
5326 5326 a, g dbSNP:145028189
5344 5344 a, c dbSNP:556682543
5394 5394 c, t dbSNP:576531330
5402 5402 a, c dbSNP:766779440
5417 5417 a, g dbSNP:754459457
5458 5458 c, t dbSNP:369634697
5482 5482 a, g dbSNP:115323539
5486 5486 a, g dbSNP:528703267
5493 5493 c, t dbSNP:138866062
5494 5494 c, g dbSNP:77777268
5522 5522 c, t dbSNP:542135679
5523 5523 a, g dbSNP:758582743
5552 5552 a, g dbSNP:373099874
5557 5557 c, g dbSNP:3810500
5558 5558 a, g dbSNP:767414680
5604 5604 c, t dbSNP:11554630
5605 5605 a, g dbSNP:564527134
5616 5616 c, g dbSNP:191412647
5618 5618 c, t dbSNP:146360147
5633 5633 a, g dbSNP:1051865
5669 5669 a, c dbSNP:560762968
5684 5684 a, g dbSNP:529542196
5711 5711 g, t dbSNP:549689208
5728 5728 c, t dbSNP:751604011
5734 5734 c, t dbSNP:567957712
5751 5751 c, t dbSNP:757415732
5772 5772 a, g dbSNP:781104665
5784 5784 a, g dbSNP:745853097
5787 5787 c, t dbSNP:41278224
5788 5788 a, g dbSNP:540648110
5816 5816 c, t dbSNP:370513858
5828 5828 g, t dbSNP:574236342
5831 5831 c, t dbSNP:369210127
5863 5863 c, t dbSNP:183854692
5872 5872 a, t dbSNP:77335831
5874 5874 c, g dbSNP:550273913
5877 5877 c, t dbSNP:368872154
5878 5878 a, g dbSNP:539125829
5898 5898 a, g dbSNP:552913413
5942 5942 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529049
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu26667D
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)70..>279(+)
Misc Feature(2)76..234(+)
Misc Feature(3)154..213(+)
Position Chain Variation Link
6 6 c, t dbSNP:751956545
35 35 a, g dbSNP:755410138
44 44 a, g dbSNP:200104219
45 45 a, g dbSNP:148585496
66 66 a, g dbSNP:753100030
72 72 a, g dbSNP:144141585
73 73 c, t dbSNP:371819808
79 79 c, g dbSNP:780154907
81 81 a, c, t dbSNP:770638590
87 87 c, t dbSNP:745419250
91 91 g, t dbSNP:771878951
102 102 c, t dbSNP:189308547
103 103 g, t dbSNP:753722773
127 127 a, t dbSNP:768384234
135 135 c, g dbSNP:774703054
144 144 c, g dbSNP:147295643
149 149 a, g dbSNP:528096976
153 153 c, t dbSNP:775734607
159 159 c, t dbSNP:140948457
171 171 c, t dbSNP:113987077
172 172 a, g dbSNP:754228390
180 180 a, g, t dbSNP:151265913
184 184 a, g, t dbSNP:750037969
186 186 c, t dbSNP:779503067
187 187 a, g dbSNP:202015608
188 188 c, t dbSNP:754887788
189 189 a, g dbSNP:781164296
207 207 c, g dbSNP:747892660
213 213 c, t dbSNP:769566622
215 215 c, t dbSNP:139312819
216 216 a, g dbSNP:746052000
220 220 a, g, t dbSNP:772453351
223 223 a, g dbSNP:371863489
234 234 c, t dbSNP:760881795
235 235 a, g dbSNP:769269113
244 244 a, g dbSNP:777340985
249 249 c, t dbSNP:762228571
252 252 c, t dbSNP:376163421
255 255 c, t dbSNP:201495666
256 256 a, g dbSNP:762638579
258 258 c, t dbSNP:766072943
264 264 c, t dbSNP:149971662
270 270 a, c, g, t dbSNP:532410241
272 272 c, t dbSNP:752620792
276 276 g, t dbSNP:756026221
277 277 c, t dbSNP:777583663
282 282 c, t dbSNP:749077830
288 288 c, t dbSNP:772397861
291 291 a, g dbSNP:780477656
309 309 c, t dbSNP:113207069
318 318 c, g dbSNP:768786863
324 324 c, t dbSNP:776598152
325 325 a, g dbSNP:762344309
333 333 c, g dbSNP:770247745
351 351 c, g dbSNP:141103374
357 357 a, t dbSNP:370749414
363 363 c, t dbSNP:774665874
369 369 c, t dbSNP:746279787
371 371 g, t dbSNP:387907043
373 373 -, ctc dbSNP:587776892
377 377 c, t dbSNP:771742418
378 378 a, g, t dbSNP:775067598
389 389 a, g dbSNP:200240375
390 390 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
396 396 c, t dbSNP:763451897
397 397 g, t dbSNP:373850027
408 408 c, t dbSNP:199712884
416 416 a, g dbSNP:761814066
426 426 c, t dbSNP:377198126
427 427 a, g dbSNP:750233915
443 443 a, g dbSNP:758198396
446 446 c, t dbSNP:144915847
447 447 a, g, t dbSNP:568985915
448 448 c, g dbSNP:567056743
456 456 c, t dbSNP:753956759
463 463 a, t dbSNP:757737652
464 464 c, t dbSNP:779453928
465 465 a, g dbSNP:746222594
471 471 c, t dbSNP:772254851
474 474 c, t dbSNP:780478210
475 475 g, t dbSNP:146719477
483 483 c, t dbSNP:140326040
499 499 a, c dbSNP:776262497
509 509 c, g dbSNP:761471108
513 513 c, t dbSNP:145468246
514 514 c, g dbSNP:773217530
518 518 a, c, g dbSNP:762961919
524 524 c, t dbSNP:747758089
528 528 a, g dbSNP:587780922
530 530 a, g dbSNP:755865198
533 533 c, t dbSNP:777119527
534 534 a, g dbSNP:748875387
536 536 c, t dbSNP:770758533
537 537 a, g, t dbSNP:369508682
540 540 c, t dbSNP:745794091
541 541 a, g dbSNP:771796509
545 545 c, t dbSNP:775285560
551 551 c, t dbSNP:761982169
552 552 a, g dbSNP:373237152
554 554 c, t dbSNP:199540600
555 555 a, g dbSNP:773154613
558 558 c, t dbSNP:376694698
559 559 a, g dbSNP:766374425
564 564 c, t dbSNP:752046563
585 585 c, t dbSNP:755569080
588 588 c, t dbSNP:776807695
590 590 c, t dbSNP:753155376
592 592 c, t dbSNP:377119075
612 612 c, t dbSNP:777536850
613 613 a, g dbSNP:748741035
614 614 a, g dbSNP:756715630
620 620 a, g, t dbSNP:778299599
623 623 a, g dbSNP:745755215
634 634 g, t dbSNP:772027430
635 635 a, t dbSNP:775232180
637 637 c, g dbSNP:370517092
646 646 c, g dbSNP:770001201
651 651 a, g dbSNP:773417550
656 656 c, t dbSNP:763097815
657 657 a, g dbSNP:770998287
668 668 a, g dbSNP:774328739
669 669 c, t dbSNP:569455237
670 670 a, g dbSNP:759852870
672 672 a, c dbSNP:531888878
706 706 a, g dbSNP:552086243
741 741 g, t dbSNP:570103284
747 747 c, t dbSNP:765183029
760 760 a, g dbSNP:572104922
766 766 c, t dbSNP:539094544
782 782 a, t dbSNP:41278210
787 787 c, t dbSNP:566191883
794 794 c, t dbSNP:535553583
803 803 c, t dbSNP:555245819
818 818 g, t dbSNP:575426180
819 819 a, g dbSNP:180676568
898 898 -, c dbSNP:35725001
898 898 c, t dbSNP:762734761
900 900 c, t dbSNP:764108980
945 945 c, t dbSNP:751612521
946 946 a, g dbSNP:143646564
980 980 a, g dbSNP:111986990
991 991 c, t dbSNP:767468477
997 997 a, g dbSNP:188304560
1005 1005 a, g dbSNP:560493837
1021 1021 c, g dbSNP:755818517
1071 1071 c, g dbSNP:758406047
1072 1072 a, t dbSNP:779361142
1081 1081 c, t dbSNP:574019244
1083 1083 c, g dbSNP:543134692
1084 1084 a, g dbSNP:562923666
1092 1092 c, g dbSNP:181187018
1099 1099 c, t dbSNP:551783395
1100 1100 c, t dbSNP:565192822
1108 1108 a, c dbSNP:148120785
1120 1120 g, t dbSNP:546156109
1123 1123 a, c dbSNP:566153307
1142 1142 c, g dbSNP:535180536
1157 1157 c, t dbSNP:779821892
1164 1164 a, g dbSNP:530195733
1165 1165 c, t dbSNP:549098751
1169 1169 c, g dbSNP:373789837
1177 1177 a, g dbSNP:141876407
1215 1215 a, g dbSNP:754507844
1315 1315 g, t dbSNP:185583381
1323 1323 a, g dbSNP:550344216
1331 1331 c, t dbSNP:570221664
1332 1332 a, g dbSNP:190430622
1334 1334 a, g dbSNP:373517080
1343 1343 c, t dbSNP:534100165
1351 1351 a, c, g dbSNP:75130625
1352 1352 a, g dbSNP:150670642
1356 1356 c, t dbSNP:747559300
1357 1357 a, g dbSNP:370655221
1359 1359 c, t dbSNP:563045593
1360 1360 a, g dbSNP:552739074
1367 1367 c, t dbSNP:576463953
1374 1374 g, t dbSNP:140106848
1380 1380 g, t dbSNP:374071727
1385 1385 c, t dbSNP:182038156
1386 1386 a, g dbSNP:565154557
1391 1391 c, t dbSNP:200797893
1400 1400 c, t dbSNP:527952182
1403 1403 c, t dbSNP:547713871
1441 1441 c, t dbSNP:114525694
1458 1458 c, t dbSNP:528926444
1477 1477 a, c, g, t dbSNP:6011230
1491 1491 a, g dbSNP:142246799
1504 1504 c, t dbSNP:537557158
1511 1511 c, t dbSNP:551572805
1519 1519 c, g dbSNP:1064345
1533 1533 g, t dbSNP:114038171
1534 1534 c, t dbSNP:554148166
1556 1556 a, g dbSNP:3764726
1568 1568 a, t dbSNP:774407862
1577 1577 a, g dbSNP:761863277
1583 1583 -, ca dbSNP:761715605
1619 1619 c, t dbSNP:534697865
1633 1633 a, g dbSNP:745906826
1636 1636 a, g dbSNP:111530162
1637 1637 g, t dbSNP:374724029
1640 1640 c, g dbSNP:536602351
1654 1654 c, t dbSNP:556293043
1675 1675 c, t dbSNP:576448324
1676 1676 c, t dbSNP:41278212
1690 1690 c, t dbSNP:558705497
1703 1703 c, t dbSNP:370539010
1707 1707 c, t dbSNP:541319164
1708 1708 a, g dbSNP:772665889
1730 1730 g, t dbSNP:11554629
1741 1741 c, g dbSNP:530334605
1748 1748 a, g dbSNP:542572143
1769 1769 g, t dbSNP:761133645
1782 1782 a, t dbSNP:766037792
1806 1806 c, t dbSNP:753503517
1807 1807 g, t dbSNP:562364964
1821 1821 a, g dbSNP:187083695
1829 1829 c, t dbSNP:551534511
1844 1844 a, g dbSNP:73136582
1859 1859 c, t dbSNP:149675982
1874 1874 a, g dbSNP:547616976
1884 1884 c, t dbSNP:567511920
1904 1904 -, t dbSNP:570640728
1927 1927 c, t dbSNP:41278214
1929 1929 g, t dbSNP:41278216
1965 1965 a, c dbSNP:576882539
1966 1966 a, g dbSNP:41278218
1979 1979 c, t dbSNP:569979955
1988 1988 c, t dbSNP:61735744
1997 1997 c, t dbSNP:777130136
2013 2013 a, c dbSNP:558669385
2014 2014 c, t dbSNP:780290336
2037 2037 c, t dbSNP:375806163
2042 2042 a, g dbSNP:572304793
2057 2057 a, g dbSNP:41278220
2063 2063 c, t dbSNP:192310826
2066 2066 a, g dbSNP:61744085
2098 2098 a, g dbSNP:145450467
2142 2142 a, g dbSNP:543786216
2150 2150 a, c dbSNP:182388077
2180 2180 a, g dbSNP:58526294
2181 2181 g, t dbSNP:542172964
2182 2182 a, g dbSNP:772147376
2197 2197 g, t dbSNP:773078929
2220 2220 a, g dbSNP:61740713
2228 2228 c, t dbSNP:554749952
2254 2254 c, t dbSNP:527390994
2267 2267 c, t dbSNP:142546412
2272 2272 c, t dbSNP:41278222
2273 2273 a, g dbSNP:186759404
2280 2280 c, t dbSNP:549842283
2296 2296 c, t dbSNP:190043990
2309 2309 c, t dbSNP:776328647
2310 2310 a, g dbSNP:759212642
2323 2323 a, t dbSNP:538696522
2342 2342 a, c dbSNP:532451538
2386 2386 c, t dbSNP:764688339
2439 2439 a, g dbSNP:552159535
2444 2444 a, c dbSNP:182604967
2450 2450 a, g dbSNP:751434970
2460 2460 c, t dbSNP:752208413
2492 2492 a, t dbSNP:530157117
2504 2504 c, t dbSNP:757706518
2510 2510 g, t dbSNP:11554632
2514 2514 c, t dbSNP:368351354
2533 2533 c, t dbSNP:534811442
2551 2551 a, g dbSNP:187307345
2555 2555 a, g dbSNP:13048
2558 2558 g, t dbSNP:768056284
2560 2560 c, t dbSNP:574966040
2572 2572 c, t dbSNP:750932518
2579 2579 a, g dbSNP:192839202
2605 2605 c, g dbSNP:543845505
2642 2642 c, t dbSNP:569120771
2663 2663 c, t dbSNP:79245733
2678 2678 a, g dbSNP:577615375
2682 2682 c, t dbSNP:376946085
2688 2688 a, g dbSNP:564889567
2734 2734 a, g dbSNP:572143327
2747 2747 a, t dbSNP:369294707
2761 2761 a, g dbSNP:368218060
2776 2776 a, g dbSNP:561123246
2784 2784 a, g dbSNP:531764324
2795 2795 a, g dbSNP:185288496
2815 2815 c, g dbSNP:550048168
2826 2826 a, g dbSNP:563198999
2830 2830 a, g dbSNP:532286219
2832 2832 c, t dbSNP:11554631
2838 2838 a, c dbSNP:565762270
2842 2842 a, g dbSNP:142121195
2911 2911 c, t dbSNP:548433050
2938 2938 c, t dbSNP:755253233
2966 2966 g, t dbSNP:7360045
3003 3003 a, g dbSNP:6062590
3007 3007 a, g dbSNP:568634990
3043 3043 c, g dbSNP:537200922
3114 3114 c, t dbSNP:557540230
3169 3169 c, g dbSNP:577579444
3187 3187 a, c dbSNP:188604040
3193 3193 g, t dbSNP:11224
3199 3199 a, t dbSNP:762079204
3201 3201 c, t dbSNP:757512075
3225 3225 c, t dbSNP:112103063
3241 3241 a, g dbSNP:6122217
3247 3247 -, a dbSNP:35892428
3257 3257 a, g dbSNP:533825911
3276 3276 c, t dbSNP:772341856
3282 3282 g, t dbSNP:572106837
3302 3302 a, g dbSNP:541113088
3325 3325 c, t dbSNP:3206771
3335 3335 a, g dbSNP:76291580
3340 3340 -, cctgt dbSNP:747355306
3341 3341 c, g dbSNP:543214810
3347 3347 a, g dbSNP:76769576
3349 3349 a, g dbSNP:11554628
3363 3363 a, g dbSNP:6122218
3374 3374 a, g dbSNP:552085775
3385 3385 -, tgcttt dbSNP:111755454
3386 3386 c, g dbSNP:762727386
3389 3389 -, tttgct dbSNP:375427318
3406 3406 c, t dbSNP:559310134
3414 3414 c, t dbSNP:55665472
3426 3426 c, g dbSNP:556265433
3428 3428 c, t dbSNP:568420557
3462 3462 a, c dbSNP:531050018
3465 3465 a, g dbSNP:769271047
3479 3479 c, t dbSNP:551166849
3486 3486 c, t dbSNP:576307094
3487 3487 a, g dbSNP:764885154
3502 3502 c, t dbSNP:749724
3523 3523 a, g dbSNP:62218071
3536 3536 c, t dbSNP:749723
3537 3537 a, g dbSNP:539536316
3540 3540 c, t dbSNP:553744243
3547 3547 c, g dbSNP:552870087
3558 3558 a, g dbSNP:565668761
3578 3578 a, g dbSNP:534278396
3620 3620 a, g dbSNP:573120224
3636 3636 c, t dbSNP:193241753
3684 3684 g, t dbSNP:762417962
3747 3747 -, tgt dbSNP:758069157
3757 3757 a, g dbSNP:535738516
3803 3803 c, t dbSNP:555659295
3808 3808 a, g dbSNP:185738914
3828 3828 c, t dbSNP:140377993
3829 3829 a, g dbSNP:188065663
3840 3840 a, g dbSNP:543421330
3861 3861 g, t dbSNP:576665202
3875 3875 c, t dbSNP:766696156
3876 3876 a, g dbSNP:545688443
3878 3878 c, t dbSNP:559174835
3881 3881 c, t dbSNP:754263293
3893 3893 c, g dbSNP:528394634
3897 3897 c, t dbSNP:755449552
3924 3924 g, t dbSNP:541823867
3988 3988 c, t dbSNP:779269651
4037 4037 a, g dbSNP:150408300
4044 4044 a, g dbSNP:530888343
4052 4052 a, g dbSNP:563716010
4056 4056 a, g dbSNP:1051821
4104 4104 c, g dbSNP:577249426
4108 4108 c, t dbSNP:571049038
4126 4126 c, g dbSNP:746929103
4170 4170 c, g dbSNP:770779154
4174 4174 c, t dbSNP:546308193
4182 4182 c, t dbSNP:745650916
4187 4187 c, t dbSNP:138122310
4206 4206 a, g dbSNP:769644868
4225 4225 a, g dbSNP:547220250
4253 4253 a, g dbSNP:73136585
4276 4276 a, g dbSNP:536165125
4294 4294 a, g dbSNP:77107548
4295 4295 -, tgc dbSNP:549826139
4326 4326 a, g dbSNP:762613624
4369 4369 a, g dbSNP:768172464
4404 4404 c, t dbSNP:773737847
4438 4438 c, g dbSNP:568079996
4463 4463 a, g dbSNP:145028189
4481 4481 a, c dbSNP:556682543
4531 4531 c, t dbSNP:576531330
4539 4539 a, c dbSNP:766779440
4554 4554 a, g dbSNP:754459457
4595 4595 c, t dbSNP:369634697
4619 4619 a, g dbSNP:115323539
4623 4623 a, g dbSNP:528703267
4630 4630 c, t dbSNP:138866062
4631 4631 c, g dbSNP:77777268
4659 4659 c, t dbSNP:542135679
4660 4660 a, g dbSNP:758582743
4689 4689 a, g dbSNP:373099874
4694 4694 c, g dbSNP:3810500
4695 4695 a, g dbSNP:767414680
4741 4741 c, t dbSNP:11554630
4742 4742 a, g dbSNP:564527134
4753 4753 c, g dbSNP:191412647
4755 4755 c, t dbSNP:146360147
4770 4770 a, g dbSNP:1051865
4806 4806 a, c dbSNP:560762968
4821 4821 a, g dbSNP:529542196
4848 4848 g, t dbSNP:549689208
4865 4865 c, t dbSNP:751604011
4871 4871 c, t dbSNP:567957712
4888 4888 c, t dbSNP:757415732
4909 4909 a, g dbSNP:781104665
4921 4921 a, g dbSNP:745853097
4924 4924 c, t dbSNP:41278224
4925 4925 a, g dbSNP:540648110
4953 4953 c, t dbSNP:370513858
4965 4965 g, t dbSNP:574236342
4968 4968 c, t dbSNP:369210127
5000 5000 c, t dbSNP:183854692
5009 5009 a, t dbSNP:77335831
5011 5011 c, g dbSNP:550273913
5014 5014 c, t dbSNP:368872154
5015 5015 a, g dbSNP:539125829
5035 5035 a, g dbSNP:552913413
5079 5079 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529050
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.