Email to GenScript

DNAJC5 DnaJ (Hsp40) homolog, subfamily C, member 5 [Homo sapiens (human)]

Gene Symbol DNAJC5
Entrez Gene ID 80331
Full Name DnaJ (Hsp40) homolog, subfamily C, member 5
Synonyms CLN4, CLN4B, CSP, DNAJC5A, NCL, mir-941-2, mir-941-3, mir-941-4, mir-941-5
General protein information
Preferred Names
dnaJ homolog subfamily C member 5
dnaJ homolog subfamily C member 5
cysteine string protein alpha
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]. lac of sum
Disorder MIM:


Disorder Html:

The following DNAJC5 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the DNAJC5 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26667 NM_025219 Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu26667 XM_011529048 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu26667 XM_011529049 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu26667 XM_011529050 PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26667
Accession Version NM_025219.2
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 26-JUL-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB452738.1, BC053642.1 and CR627461.1. This sequence is a reference standard in the RefSeqGene project. On Dec 1, 2010 this sequence version replaced gi:45504381. Summary: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC053642.1, AK289585.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)225..227(+)
Misc Feature(2)255..257(+)
Misc Feature(3)261..263(+)
Misc Feature(4)261..263(+)
Misc Feature(5)261..263(+)
Misc Feature(6)276..>485(+)
Misc Feature(7)276..278(+)
Misc Feature(8)282..440(+)
Misc Feature(9)360..419(+)
Misc Feature(10)399..401(+)
Exon (1)1..222
Gene Synonym:
Exon (2)223..340
Gene Synonym:
Exon (3)341..554
Gene Synonym:
Exon (4)555..726
Gene Synonym:
Exon (5)727..5293
Gene Synonym:
Position Chain Variation Link
23 23 g, t dbSNP:537670690
26 26 c, t dbSNP:557596205
46 46 -, ccgctg dbSNP:563818595
55 55 g, t dbSNP:577550567
66 66 c, t dbSNP:540212627
93 93 -, gcc dbSNP:531246320
125 125 a, g dbSNP:750302498
241 241 a, g dbSNP:755410138
250 250 a, g dbSNP:200104219
251 251 a, g dbSNP:148585496
272 272 a, g dbSNP:753100030
278 278 a, g dbSNP:144141585
279 279 c, t dbSNP:371819808
285 285 c, g dbSNP:780154907
287 287 a, c, t dbSNP:770638590
293 293 c, t dbSNP:745419250
297 297 g, t dbSNP:771878951
308 308 c, t dbSNP:189308547
309 309 g, t dbSNP:753722773
333 333 a, t dbSNP:768384234
341 341 c, g dbSNP:774703054
350 350 c, g dbSNP:147295643
355 355 a, g dbSNP:528096976
359 359 c, t dbSNP:775734607
365 365 c, t dbSNP:140948457
377 377 c, t dbSNP:113987077
378 378 a, g dbSNP:754228390
386 386 a, g, t dbSNP:151265913
390 390 a, g, t dbSNP:750037969
392 392 c, t dbSNP:779503067
393 393 a, g dbSNP:202015608
394 394 c, t dbSNP:754887788
395 395 a, g dbSNP:781164296
413 413 c, g dbSNP:747892660
419 419 c, t dbSNP:769566622
421 421 c, t dbSNP:139312819
422 422 a, g dbSNP:746052000
426 426 a, g, t dbSNP:772453351
429 429 a, g dbSNP:371863489
440 440 c, t dbSNP:760881795
441 441 a, g dbSNP:769269113
450 450 a, g dbSNP:777340985
455 455 c, t dbSNP:762228571
458 458 c, t dbSNP:376163421
461 461 c, t dbSNP:201495666
462 462 a, g dbSNP:762638579
464 464 c, t dbSNP:766072943
470 470 c, t dbSNP:149971662
476 476 a, c, g, t dbSNP:532410241
478 478 c, t dbSNP:752620792
482 482 g, t dbSNP:756026221
483 483 c, t dbSNP:777583663
488 488 c, t dbSNP:749077830
494 494 c, t dbSNP:772397861
497 497 a, g dbSNP:780477656
515 515 c, t dbSNP:113207069
524 524 c, g dbSNP:768786863
530 530 c, t dbSNP:776598152
531 531 a, g dbSNP:762344309
539 539 c, g dbSNP:770247745
557 557 c, g dbSNP:141103374
563 563 a, t dbSNP:370749414
569 569 c, t dbSNP:774665874
575 575 c, t dbSNP:746279787
577 577 g, t dbSNP:387907043
579 579 -, ctc dbSNP:587776892
583 583 c, t dbSNP:771742418
584 584 a, g, t dbSNP:775067598
595 595 a, g dbSNP:200240375
596 596 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
602 602 c, t dbSNP:763451897
603 603 g, t dbSNP:373850027
614 614 c, t dbSNP:199712884
622 622 a, g dbSNP:761814066
632 632 c, t dbSNP:377198126
633 633 a, g dbSNP:750233915
649 649 a, g dbSNP:758198396
652 652 c, t dbSNP:144915847
653 653 a, g, t dbSNP:568985915
654 654 c, g dbSNP:567056743
662 662 c, t dbSNP:753956759
669 669 a, t dbSNP:757737652
670 670 c, t dbSNP:779453928
671 671 a, g dbSNP:746222594
677 677 c, t dbSNP:772254851
680 680 c, t dbSNP:780478210
681 681 g, t dbSNP:146719477
689 689 c, t dbSNP:140326040
705 705 a, c dbSNP:776262497
715 715 c, g dbSNP:761471108
719 719 c, t dbSNP:145468246
720 720 c, g dbSNP:773217530
724 724 a, c, g dbSNP:762961919
730 730 c, t dbSNP:747758089
734 734 a, g dbSNP:587780922
736 736 a, g dbSNP:755865198
739 739 c, t dbSNP:777119527
740 740 a, g dbSNP:748875387
742 742 c, t dbSNP:770758533
743 743 a, g, t dbSNP:369508682
746 746 c, t dbSNP:745794091
747 747 a, g dbSNP:771796509
751 751 c, t dbSNP:775285560
757 757 c, t dbSNP:761982169
758 758 a, g dbSNP:373237152
760 760 c, t dbSNP:199540600
761 761 a, g dbSNP:773154613
764 764 c, t dbSNP:376694698
765 765 a, g dbSNP:766374425
770 770 c, t dbSNP:752046563
791 791 c, t dbSNP:755569080
794 794 c, t dbSNP:776807695
796 796 c, t dbSNP:753155376
798 798 c, t dbSNP:377119075
818 818 c, t dbSNP:777536850
819 819 a, g dbSNP:748741035
820 820 a, g dbSNP:756715630
826 826 a, g, t dbSNP:778299599
829 829 a, g dbSNP:745755215
840 840 g, t dbSNP:772027430
841 841 a, t dbSNP:775232180
843 843 c, g dbSNP:370517092
852 852 c, g dbSNP:770001201
857 857 a, g dbSNP:773417550
862 862 c, t dbSNP:763097815
863 863 a, g dbSNP:770998287
874 874 a, g dbSNP:774328739
875 875 c, t dbSNP:569455237
876 876 a, g dbSNP:759852870
878 878 a, c dbSNP:531888878
912 912 a, g dbSNP:552086243
947 947 g, t dbSNP:570103284
953 953 c, t dbSNP:765183029
966 966 a, g dbSNP:572104922
972 972 c, t dbSNP:539094544
988 988 a, t dbSNP:41278210
993 993 c, t dbSNP:566191883
1000 1000 c, t dbSNP:535553583
1009 1009 c, t dbSNP:555245819
1024 1024 g, t dbSNP:575426180
1025 1025 a, g dbSNP:180676568
1104 1104 -, c dbSNP:35725001
1104 1104 c, t dbSNP:762734761
1106 1106 c, t dbSNP:764108980
1151 1151 c, t dbSNP:751612521
1152 1152 a, g dbSNP:143646564
1186 1186 a, g dbSNP:111986990
1197 1197 c, t dbSNP:767468477
1203 1203 a, g dbSNP:188304560
1211 1211 a, g dbSNP:560493837
1227 1227 c, g dbSNP:755818517
1277 1277 c, g dbSNP:758406047
1278 1278 a, t dbSNP:779361142
1287 1287 c, t dbSNP:574019244
1289 1289 c, g dbSNP:543134692
1290 1290 a, g dbSNP:562923666
1298 1298 c, g dbSNP:181187018
1305 1305 c, t dbSNP:551783395
1306 1306 c, t dbSNP:565192822
1314 1314 a, c dbSNP:148120785
1326 1326 g, t dbSNP:546156109
1329 1329 a, c dbSNP:566153307
1348 1348 c, g dbSNP:535180536
1363 1363 c, t dbSNP:779821892
1370 1370 a, g dbSNP:530195733
1371 1371 c, t dbSNP:549098751
1375 1375 c, g dbSNP:373789837
1383 1383 a, g dbSNP:141876407
1421 1421 a, g dbSNP:754507844
1521 1521 g, t dbSNP:185583381
1529 1529 a, g dbSNP:550344216
1537 1537 c, t dbSNP:570221664
1538 1538 a, g dbSNP:190430622
1540 1540 a, g dbSNP:373517080
1549 1549 c, t dbSNP:534100165
1557 1557 a, c, g dbSNP:75130625
1558 1558 a, g dbSNP:150670642
1562 1562 c, t dbSNP:747559300
1563 1563 a, g dbSNP:370655221
1565 1565 c, t dbSNP:563045593
1566 1566 a, g dbSNP:552739074
1573 1573 c, t dbSNP:576463953
1580 1580 g, t dbSNP:140106848
1586 1586 g, t dbSNP:374071727
1591 1591 c, t dbSNP:182038156
1592 1592 a, g dbSNP:565154557
1597 1597 c, t dbSNP:200797893
1606 1606 c, t dbSNP:527952182
1609 1609 c, t dbSNP:547713871
1647 1647 c, t dbSNP:114525694
1664 1664 c, t dbSNP:528926444
1683 1683 a, c, g, t dbSNP:6011230
1697 1697 a, g dbSNP:142246799
1710 1710 c, t dbSNP:537557158
1717 1717 c, t dbSNP:551572805
1725 1725 c, g dbSNP:1064345
1739 1739 g, t dbSNP:114038171
1740 1740 c, t dbSNP:554148166
1762 1762 a, g dbSNP:3764726
1774 1774 a, t dbSNP:774407862
1783 1783 a, g dbSNP:761863277
1789 1789 -, ca dbSNP:761715605
1825 1825 c, t dbSNP:534697865
1839 1839 a, g dbSNP:745906826
1842 1842 a, g dbSNP:111530162
1843 1843 g, t dbSNP:374724029
1846 1846 c, g dbSNP:536602351
1860 1860 c, t dbSNP:556293043
1881 1881 c, t dbSNP:576448324
1882 1882 c, t dbSNP:41278212
1896 1896 c, t dbSNP:558705497
1909 1909 c, t dbSNP:370539010
1913 1913 c, t dbSNP:541319164
1914 1914 a, g dbSNP:772665889
1936 1936 g, t dbSNP:11554629
1947 1947 c, g dbSNP:530334605
1954 1954 a, g dbSNP:542572143
1975 1975 g, t dbSNP:761133645
1988 1988 a, t dbSNP:766037792
2012 2012 c, t dbSNP:753503517
2013 2013 g, t dbSNP:562364964
2027 2027 a, g dbSNP:187083695
2035 2035 c, t dbSNP:551534511
2050 2050 a, g dbSNP:73136582
2065 2065 c, t dbSNP:149675982
2080 2080 a, g dbSNP:547616976
2090 2090 c, t dbSNP:567511920
2110 2110 -, t dbSNP:570640728
2133 2133 c, t dbSNP:41278214
2135 2135 g, t dbSNP:41278216
2171 2171 a, c dbSNP:576882539
2172 2172 a, g dbSNP:41278218
2185 2185 c, t dbSNP:569979955
2194 2194 c, t dbSNP:61735744
2203 2203 c, t dbSNP:777130136
2219 2219 a, c dbSNP:558669385
2220 2220 c, t dbSNP:780290336
2243 2243 c, t dbSNP:375806163
2248 2248 a, g dbSNP:572304793
2263 2263 a, g dbSNP:41278220
2269 2269 c, t dbSNP:192310826
2272 2272 a, g dbSNP:61744085
2304 2304 a, g dbSNP:145450467
2348 2348 a, g dbSNP:543786216
2356 2356 a, c dbSNP:182388077
2386 2386 a, g dbSNP:58526294
2387 2387 g, t dbSNP:542172964
2388 2388 a, g dbSNP:772147376
2403 2403 g, t dbSNP:773078929
2426 2426 a, g dbSNP:61740713
2434 2434 c, t dbSNP:554749952
2460 2460 c, t dbSNP:527390994
2473 2473 c, t dbSNP:142546412
2478 2478 c, t dbSNP:41278222
2479 2479 a, g dbSNP:186759404
2486 2486 c, t dbSNP:549842283
2502 2502 c, t dbSNP:190043990
2515 2515 c, t dbSNP:776328647
2516 2516 a, g dbSNP:759212642
2529 2529 a, t dbSNP:538696522
2548 2548 a, c dbSNP:532451538
2592 2592 c, t dbSNP:764688339
2645 2645 a, g dbSNP:552159535
2650 2650 a, c dbSNP:182604967
2656 2656 a, g dbSNP:751434970
2666 2666 c, t dbSNP:752208413
2698 2698 a, t dbSNP:530157117
2710 2710 c, t dbSNP:757706518
2716 2716 g, t dbSNP:11554632
2720 2720 c, t dbSNP:368351354
2739 2739 c, t dbSNP:534811442
2757 2757 a, g dbSNP:187307345
2761 2761 a, g dbSNP:13048
2764 2764 g, t dbSNP:768056284
2766 2766 c, t dbSNP:574966040
2778 2778 c, t dbSNP:750932518
2785 2785 a, g dbSNP:192839202
2811 2811 c, g dbSNP:543845505
2848 2848 c, t dbSNP:569120771
2869 2869 c, t dbSNP:79245733
2884 2884 a, g dbSNP:577615375
2888 2888 c, t dbSNP:376946085
2894 2894 a, g dbSNP:564889567
2940 2940 a, g dbSNP:572143327
2953 2953 a, t dbSNP:369294707
2967 2967 a, g dbSNP:368218060
2982 2982 a, g dbSNP:561123246
2990 2990 a, g dbSNP:531764324
3001 3001 a, g dbSNP:185288496
3021 3021 c, g dbSNP:550048168
3032 3032 a, g dbSNP:563198999
3036 3036 a, g dbSNP:532286219
3038 3038 c, t dbSNP:11554631
3044 3044 a, c dbSNP:565762270
3048 3048 a, g dbSNP:142121195
3117 3117 c, t dbSNP:548433050
3144 3144 c, t dbSNP:755253233
3172 3172 g, t dbSNP:7360045
3209 3209 a, g dbSNP:6062590
3213 3213 a, g dbSNP:568634990
3249 3249 c, g dbSNP:537200922
3320 3320 c, t dbSNP:557540230
3375 3375 c, g dbSNP:577579444
3393 3393 a, c dbSNP:188604040
3399 3399 g, t dbSNP:11224
3405 3405 a, t dbSNP:762079204
3407 3407 c, t dbSNP:757512075
3431 3431 c, t dbSNP:112103063
3447 3447 a, g dbSNP:6122217
3453 3453 -, a dbSNP:35892428
3463 3463 a, g dbSNP:533825911
3482 3482 c, t dbSNP:772341856
3488 3488 g, t dbSNP:572106837
3508 3508 a, g dbSNP:541113088
3531 3531 c, t dbSNP:3206771
3541 3541 a, g dbSNP:76291580
3546 3546 -, cctgt dbSNP:747355306
3547 3547 c, g dbSNP:543214810
3553 3553 a, g dbSNP:76769576
3555 3555 a, g dbSNP:11554628
3569 3569 a, g dbSNP:6122218
3580 3580 a, g dbSNP:552085775
3591 3591 -, tgcttt dbSNP:111755454
3592 3592 c, g dbSNP:762727386
3595 3595 -, tttgct dbSNP:375427318
3612 3612 c, t dbSNP:559310134
3620 3620 c, t dbSNP:55665472
3632 3632 c, g dbSNP:556265433
3634 3634 c, t dbSNP:568420557
3668 3668 a, c dbSNP:531050018
3671 3671 a, g dbSNP:769271047
3685 3685 c, t dbSNP:551166849
3692 3692 c, t dbSNP:576307094
3693 3693 a, g dbSNP:764885154
3708 3708 c, t dbSNP:749724
3729 3729 a, g dbSNP:62218071
3742 3742 c, t dbSNP:749723
3743 3743 a, g dbSNP:539536316
3746 3746 c, t dbSNP:553744243
3753 3753 c, g dbSNP:552870087
3764 3764 a, g dbSNP:565668761
3784 3784 a, g dbSNP:534278396
3826 3826 a, g dbSNP:573120224
3842 3842 c, t dbSNP:193241753
3890 3890 g, t dbSNP:762417962
3953 3953 -, tgt dbSNP:758069157
3963 3963 a, g dbSNP:535738516
4009 4009 c, t dbSNP:555659295
4014 4014 a, g dbSNP:185738914
4034 4034 c, t dbSNP:140377993
4035 4035 a, g dbSNP:188065663
4046 4046 a, g dbSNP:543421330
4067 4067 g, t dbSNP:576665202
4081 4081 c, t dbSNP:766696156
4082 4082 a, g dbSNP:545688443
4084 4084 c, t dbSNP:559174835
4087 4087 c, t dbSNP:754263293
4099 4099 c, g dbSNP:528394634
4103 4103 c, t dbSNP:755449552
4130 4130 g, t dbSNP:541823867
4194 4194 c, t dbSNP:779269651
4243 4243 a, g dbSNP:150408300
4250 4250 a, g dbSNP:530888343
4258 4258 a, g dbSNP:563716010
4262 4262 a, g dbSNP:1051821
4310 4310 c, g dbSNP:577249426
4314 4314 c, t dbSNP:571049038
4332 4332 c, g dbSNP:746929103
4376 4376 c, g dbSNP:770779154
4380 4380 c, t dbSNP:546308193
4388 4388 c, t dbSNP:745650916
4393 4393 c, t dbSNP:138122310
4412 4412 a, g dbSNP:769644868
4431 4431 a, g dbSNP:547220250
4459 4459 a, g dbSNP:73136585
4482 4482 a, g dbSNP:536165125
4500 4500 a, g dbSNP:77107548
4501 4501 -, tgc dbSNP:549826139
4532 4532 a, g dbSNP:762613624
4575 4575 a, g dbSNP:768172464
4610 4610 c, t dbSNP:773737847
4644 4644 c, g dbSNP:568079996
4669 4669 a, g dbSNP:145028189
4687 4687 a, c dbSNP:556682543
4737 4737 c, t dbSNP:576531330
4745 4745 a, c dbSNP:766779440
4760 4760 a, g dbSNP:754459457
4801 4801 c, t dbSNP:369634697
4825 4825 a, g dbSNP:115323539
4829 4829 a, g dbSNP:528703267
4836 4836 c, t dbSNP:138866062
4837 4837 c, g dbSNP:77777268
4865 4865 c, t dbSNP:542135679
4866 4866 a, g dbSNP:758582743
4895 4895 a, g dbSNP:373099874
4900 4900 c, g dbSNP:3810500
4901 4901 a, g dbSNP:767414680
4947 4947 c, t dbSNP:11554630
4948 4948 a, g dbSNP:564527134
4959 4959 c, g dbSNP:191412647
4961 4961 c, t dbSNP:146360147
4976 4976 a, g dbSNP:1051865
5012 5012 a, c dbSNP:560762968
5027 5027 a, g dbSNP:529542196
5054 5054 g, t dbSNP:549689208
5071 5071 c, t dbSNP:751604011
5077 5077 c, t dbSNP:567957712
5094 5094 c, t dbSNP:757415732
5115 5115 a, g dbSNP:781104665
5127 5127 a, g dbSNP:745853097
5130 5130 c, t dbSNP:41278224
5131 5131 a, g dbSNP:540648110
5159 5159 c, t dbSNP:370513858
5171 5171 g, t dbSNP:574236342
5174 5174 c, t dbSNP:369210127
5206 5206 c, t dbSNP:183854692
5215 5215 a, t dbSNP:77335831
5217 5217 c, g dbSNP:550273913
5220 5220 c, t dbSNP:368872154
5221 5221 a, g dbSNP:539125829
5241 5241 a, g dbSNP:552913413
5285 5285 c, t dbSNP:74554553

Target ORF information:

RefSeq Version NM_025219
Organism Homo sapiens (human)
Definition Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26667
Accession Version XM_011529048.1
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)671..>880(+)
Misc Feature(2)677..835(+)
Misc Feature(3)755..814(+)
Position Chain Variation Link
4 4 a, g dbSNP:554095742
27 27 g, t dbSNP:546636341
29 29 c, t dbSNP:560493805
31 31 a, g dbSNP:529375235
91 91 a, g dbSNP:549523456
108 108 c, t dbSNP:757329562
137 137 a, c dbSNP:569457907
149 149 a, c dbSNP:531851167
168 168 c, t dbSNP:781179515
175 175 -, gaa dbSNP:201216377
185 185 g, t dbSNP:745778281
202 202 a, t dbSNP:769727908
206 206 c, t dbSNP:182952311
213 213 c, t dbSNP:571799801
261 261 c, t dbSNP:187541208
281 281 a, g dbSNP:552517783
347 347 c, t dbSNP:775205604
360 360 a, t dbSNP:749067875
381 381 c, t dbSNP:113317610
382 382 a, g dbSNP:138227881
404 404 a, g dbSNP:112154274
412 412 c, t dbSNP:575389457
436 436 c, t dbSNP:544127839
447 447 g, t dbSNP:557936482
474 474 a, g dbSNP:761417166
481 481 c, t dbSNP:767000758
498 498 a, g dbSNP:7272419
503 503 a, g dbSNP:562447488
543 543 c, t dbSNP:765856003
544 544 c, g dbSNP:138998858
547 547 a, g dbSNP:369184553
548 548 a, c, t dbSNP:192523484
552 552 c, t dbSNP:563017834
587 587 c, t dbSNP:12481368
636 636 a, g dbSNP:755410138
645 645 a, g dbSNP:200104219
646 646 a, g dbSNP:148585496
667 667 a, g dbSNP:753100030
673 673 a, g dbSNP:144141585
674 674 c, t dbSNP:371819808
680 680 c, g dbSNP:780154907
682 682 a, c, t dbSNP:770638590
688 688 c, t dbSNP:745419250
692 692 g, t dbSNP:771878951
703 703 c, t dbSNP:189308547
704 704 g, t dbSNP:753722773
728 728 a, t dbSNP:768384234
736 736 c, g dbSNP:774703054
745 745 c, g dbSNP:147295643
750 750 a, g dbSNP:528096976
754 754 c, t dbSNP:775734607
760 760 c, t dbSNP:140948457
772 772 c, t dbSNP:113987077
773 773 a, g dbSNP:754228390
781 781 a, g, t dbSNP:151265913
785 785 a, g, t dbSNP:750037969
787 787 c, t dbSNP:779503067
788 788 a, g dbSNP:202015608
789 789 c, t dbSNP:754887788
790 790 a, g dbSNP:781164296
808 808 c, g dbSNP:747892660
814 814 c, t dbSNP:769566622
816 816 c, t dbSNP:139312819
817 817 a, g dbSNP:746052000
821 821 a, g, t dbSNP:772453351
824 824 a, g dbSNP:371863489
835 835 c, t dbSNP:760881795
836 836 a, g dbSNP:769269113
845 845 a, g dbSNP:777340985
850 850 c, t dbSNP:762228571
853 853 c, t dbSNP:376163421
856 856 c, t dbSNP:201495666
857 857 a, g dbSNP:762638579
859 859 c, t dbSNP:766072943
865 865 c, t dbSNP:149971662
871 871 a, c, g, t dbSNP:532410241
873 873 c, t dbSNP:752620792
877 877 g, t dbSNP:756026221
878 878 c, t dbSNP:777583663
883 883 c, t dbSNP:749077830
889 889 c, t dbSNP:772397861
892 892 a, g dbSNP:780477656
910 910 c, t dbSNP:113207069
919 919 c, g dbSNP:768786863
925 925 c, t dbSNP:776598152
926 926 a, g dbSNP:762344309
934 934 c, g dbSNP:770247745
952 952 c, g dbSNP:141103374
958 958 a, t dbSNP:370749414
964 964 c, t dbSNP:774665874
970 970 c, t dbSNP:746279787
972 972 g, t dbSNP:387907043
974 974 -, ctc dbSNP:587776892
978 978 c, t dbSNP:771742418
979 979 a, g, t dbSNP:775067598
990 990 a, g dbSNP:200240375
991 991 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
997 997 c, t dbSNP:763451897
998 998 g, t dbSNP:373850027
1009 1009 c, t dbSNP:199712884
1017 1017 a, g dbSNP:761814066
1027 1027 c, t dbSNP:377198126
1028 1028 a, g dbSNP:750233915
1044 1044 a, g dbSNP:758198396
1047 1047 c, t dbSNP:144915847
1048 1048 a, g, t dbSNP:568985915
1049 1049 c, g dbSNP:567056743
1057 1057 c, t dbSNP:753956759
1064 1064 a, t dbSNP:757737652
1065 1065 c, t dbSNP:779453928
1066 1066 a, g dbSNP:746222594
1072 1072 c, t dbSNP:772254851
1075 1075 c, t dbSNP:780478210
1076 1076 g, t dbSNP:146719477
1084 1084 c, t dbSNP:140326040
1100 1100 a, c dbSNP:776262497
1110 1110 c, g dbSNP:761471108
1114 1114 c, t dbSNP:145468246
1115 1115 c, g dbSNP:773217530
1119 1119 a, c, g dbSNP:762961919
1125 1125 c, t dbSNP:747758089
1129 1129 a, g dbSNP:587780922
1131 1131 a, g dbSNP:755865198
1134 1134 c, t dbSNP:777119527
1135 1135 a, g dbSNP:748875387
1137 1137 c, t dbSNP:770758533
1138 1138 a, g, t dbSNP:369508682
1141 1141 c, t dbSNP:745794091
1142 1142 a, g dbSNP:771796509
1146 1146 c, t dbSNP:775285560
1152 1152 c, t dbSNP:761982169
1153 1153 a, g dbSNP:373237152
1155 1155 c, t dbSNP:199540600
1156 1156 a, g dbSNP:773154613
1159 1159 c, t dbSNP:376694698
1160 1160 a, g dbSNP:766374425
1165 1165 c, t dbSNP:752046563
1186 1186 c, t dbSNP:755569080
1189 1189 c, t dbSNP:776807695
1191 1191 c, t dbSNP:753155376
1193 1193 c, t dbSNP:377119075
1213 1213 c, t dbSNP:777536850
1214 1214 a, g dbSNP:748741035
1215 1215 a, g dbSNP:756715630
1221 1221 a, g, t dbSNP:778299599
1224 1224 a, g dbSNP:745755215
1235 1235 g, t dbSNP:772027430
1236 1236 a, t dbSNP:775232180
1238 1238 c, g dbSNP:370517092
1247 1247 c, g dbSNP:770001201
1252 1252 a, g dbSNP:773417550
1257 1257 c, t dbSNP:763097815
1258 1258 a, g dbSNP:770998287
1269 1269 a, g dbSNP:774328739
1270 1270 c, t dbSNP:569455237
1271 1271 a, g dbSNP:759852870
1273 1273 a, c dbSNP:531888878
1307 1307 a, g dbSNP:552086243
1342 1342 g, t dbSNP:570103284
1348 1348 c, t dbSNP:765183029
1361 1361 a, g dbSNP:572104922
1367 1367 c, t dbSNP:539094544
1383 1383 a, t dbSNP:41278210
1388 1388 c, t dbSNP:566191883
1395 1395 c, t dbSNP:535553583
1404 1404 c, t dbSNP:555245819
1419 1419 g, t dbSNP:575426180
1420 1420 a, g dbSNP:180676568
1499 1499 -, c dbSNP:35725001
1499 1499 c, t dbSNP:762734761
1501 1501 c, t dbSNP:764108980
1546 1546 c, t dbSNP:751612521
1547 1547 a, g dbSNP:143646564
1581 1581 a, g dbSNP:111986990
1592 1592 c, t dbSNP:767468477
1598 1598 a, g dbSNP:188304560
1606 1606 a, g dbSNP:560493837
1622 1622 c, g dbSNP:755818517
1672 1672 c, g dbSNP:758406047
1673 1673 a, t dbSNP:779361142
1682 1682 c, t dbSNP:574019244
1684 1684 c, g dbSNP:543134692
1685 1685 a, g dbSNP:562923666
1693 1693 c, g dbSNP:181187018
1700 1700 c, t dbSNP:551783395
1701 1701 c, t dbSNP:565192822
1709 1709 a, c dbSNP:148120785
1721 1721 g, t dbSNP:546156109
1724 1724 a, c dbSNP:566153307
1743 1743 c, g dbSNP:535180536
1758 1758 c, t dbSNP:779821892
1765 1765 a, g dbSNP:530195733
1766 1766 c, t dbSNP:549098751
1770 1770 c, g dbSNP:373789837
1778 1778 a, g dbSNP:141876407
1816 1816 a, g dbSNP:754507844
1916 1916 g, t dbSNP:185583381
1924 1924 a, g dbSNP:550344216
1932 1932 c, t dbSNP:570221664
1933 1933 a, g dbSNP:190430622
1935 1935 a, g dbSNP:373517080
1944 1944 c, t dbSNP:534100165
1952 1952 a, c, g dbSNP:75130625
1953 1953 a, g dbSNP:150670642
1957 1957 c, t dbSNP:747559300
1958 1958 a, g dbSNP:370655221
1960 1960 c, t dbSNP:563045593
1961 1961 a, g dbSNP:552739074
1968 1968 c, t dbSNP:576463953
1975 1975 g, t dbSNP:140106848
1981 1981 g, t dbSNP:374071727
1986 1986 c, t dbSNP:182038156
1987 1987 a, g dbSNP:565154557
1992 1992 c, t dbSNP:200797893
2001 2001 c, t dbSNP:527952182
2004 2004 c, t dbSNP:547713871
2042 2042 c, t dbSNP:114525694
2059 2059 c, t dbSNP:528926444
2078 2078 a, c, g, t dbSNP:6011230
2092 2092 a, g dbSNP:142246799
2105 2105 c, t dbSNP:537557158
2112 2112 c, t dbSNP:551572805
2120 2120 c, g dbSNP:1064345
2134 2134 g, t dbSNP:114038171
2135 2135 c, t dbSNP:554148166
2157 2157 a, g dbSNP:3764726
2169 2169 a, t dbSNP:774407862
2178 2178 a, g dbSNP:761863277
2184 2184 -, ca dbSNP:761715605
2220 2220 c, t dbSNP:534697865
2234 2234 a, g dbSNP:745906826
2237 2237 a, g dbSNP:111530162
2238 2238 g, t dbSNP:374724029
2241 2241 c, g dbSNP:536602351
2255 2255 c, t dbSNP:556293043
2276 2276 c, t dbSNP:576448324
2277 2277 c, t dbSNP:41278212
2291 2291 c, t dbSNP:558705497
2304 2304 c, t dbSNP:370539010
2308 2308 c, t dbSNP:541319164
2309 2309 a, g dbSNP:772665889
2331 2331 g, t dbSNP:11554629
2342 2342 c, g dbSNP:530334605
2349 2349 a, g dbSNP:542572143
2370 2370 g, t dbSNP:761133645
2383 2383 a, t dbSNP:766037792
2407 2407 c, t dbSNP:753503517
2408 2408 g, t dbSNP:562364964
2422 2422 a, g dbSNP:187083695
2430 2430 c, t dbSNP:551534511
2445 2445 a, g dbSNP:73136582
2460 2460 c, t dbSNP:149675982
2475 2475 a, g dbSNP:547616976
2485 2485 c, t dbSNP:567511920
2505 2505 -, t dbSNP:570640728
2528 2528 c, t dbSNP:41278214
2530 2530 g, t dbSNP:41278216
2566 2566 a, c dbSNP:576882539
2567 2567 a, g dbSNP:41278218
2580 2580 c, t dbSNP:569979955
2589 2589 c, t dbSNP:61735744
2598 2598 c, t dbSNP:777130136
2614 2614 a, c dbSNP:558669385
2615 2615 c, t dbSNP:780290336
2638 2638 c, t dbSNP:375806163
2643 2643 a, g dbSNP:572304793
2658 2658 a, g dbSNP:41278220
2664 2664 c, t dbSNP:192310826
2667 2667 a, g dbSNP:61744085
2699 2699 a, g dbSNP:145450467
2743 2743 a, g dbSNP:543786216
2751 2751 a, c dbSNP:182388077
2781 2781 a, g dbSNP:58526294
2782 2782 g, t dbSNP:542172964
2783 2783 a, g dbSNP:772147376
2798 2798 g, t dbSNP:773078929
2821 2821 a, g dbSNP:61740713
2829 2829 c, t dbSNP:554749952
2855 2855 c, t dbSNP:527390994
2868 2868 c, t dbSNP:142546412
2873 2873 c, t dbSNP:41278222
2874 2874 a, g dbSNP:186759404
2881 2881 c, t dbSNP:549842283
2897 2897 c, t dbSNP:190043990
2910 2910 c, t dbSNP:776328647
2911 2911 a, g dbSNP:759212642
2924 2924 a, t dbSNP:538696522
2943 2943 a, c dbSNP:532451538
2987 2987 c, t dbSNP:764688339
3040 3040 a, g dbSNP:552159535
3045 3045 a, c dbSNP:182604967
3051 3051 a, g dbSNP:751434970
3061 3061 c, t dbSNP:752208413
3093 3093 a, t dbSNP:530157117
3105 3105 c, t dbSNP:757706518
3111 3111 g, t dbSNP:11554632
3115 3115 c, t dbSNP:368351354
3134 3134 c, t dbSNP:534811442
3152 3152 a, g dbSNP:187307345
3156 3156 a, g dbSNP:13048
3159 3159 g, t dbSNP:768056284
3161 3161 c, t dbSNP:574966040
3173 3173 c, t dbSNP:750932518
3180 3180 a, g dbSNP:192839202
3206 3206 c, g dbSNP:543845505
3243 3243 c, t dbSNP:569120771
3264 3264 c, t dbSNP:79245733
3279 3279 a, g dbSNP:577615375
3283 3283 c, t dbSNP:376946085
3289 3289 a, g dbSNP:564889567
3335 3335 a, g dbSNP:572143327
3348 3348 a, t dbSNP:369294707
3362 3362 a, g dbSNP:368218060
3377 3377 a, g dbSNP:561123246
3385 3385 a, g dbSNP:531764324
3396 3396 a, g dbSNP:185288496
3416 3416 c, g dbSNP:550048168
3427 3427 a, g dbSNP:563198999
3431 3431 a, g dbSNP:532286219
3433 3433 c, t dbSNP:11554631
3439 3439 a, c dbSNP:565762270
3443 3443 a, g dbSNP:142121195
3512 3512 c, t dbSNP:548433050
3539 3539 c, t dbSNP:755253233
3567 3567 g, t dbSNP:7360045
3604 3604 a, g dbSNP:6062590
3608 3608 a, g dbSNP:568634990
3644 3644 c, g dbSNP:537200922
3715 3715 c, t dbSNP:557540230
3770 3770 c, g dbSNP:577579444
3788 3788 a, c dbSNP:188604040
3794 3794 g, t dbSNP:11224
3800 3800 a, t dbSNP:762079204
3802 3802 c, t dbSNP:757512075
3826 3826 c, t dbSNP:112103063
3842 3842 a, g dbSNP:6122217
3848 3848 -, a dbSNP:35892428
3858 3858 a, g dbSNP:533825911
3877 3877 c, t dbSNP:772341856
3883 3883 g, t dbSNP:572106837
3903 3903 a, g dbSNP:541113088
3926 3926 c, t dbSNP:3206771
3936 3936 a, g dbSNP:76291580
3941 3941 -, cctgt dbSNP:747355306
3942 3942 c, g dbSNP:543214810
3948 3948 a, g dbSNP:76769576
3950 3950 a, g dbSNP:11554628
3964 3964 a, g dbSNP:6122218
3975 3975 a, g dbSNP:552085775
3986 3986 -, tgcttt dbSNP:111755454
3987 3987 c, g dbSNP:762727386
3990 3990 -, tttgct dbSNP:375427318
4007 4007 c, t dbSNP:559310134
4015 4015 c, t dbSNP:55665472
4027 4027 c, g dbSNP:556265433
4029 4029 c, t dbSNP:568420557
4063 4063 a, c dbSNP:531050018
4066 4066 a, g dbSNP:769271047
4080 4080 c, t dbSNP:551166849
4087 4087 c, t dbSNP:576307094
4088 4088 a, g dbSNP:764885154
4103 4103 c, t dbSNP:749724
4124 4124 a, g dbSNP:62218071
4137 4137 c, t dbSNP:749723
4138 4138 a, g dbSNP:539536316
4141 4141 c, t dbSNP:553744243
4148 4148 c, g dbSNP:552870087
4159 4159 a, g dbSNP:565668761
4179 4179 a, g dbSNP:534278396
4221 4221 a, g dbSNP:573120224
4237 4237 c, t dbSNP:193241753
4285 4285 g, t dbSNP:762417962
4348 4348 -, tgt dbSNP:758069157
4358 4358 a, g dbSNP:535738516
4404 4404 c, t dbSNP:555659295
4409 4409 a, g dbSNP:185738914
4429 4429 c, t dbSNP:140377993
4430 4430 a, g dbSNP:188065663
4441 4441 a, g dbSNP:543421330
4462 4462 g, t dbSNP:576665202
4476 4476 c, t dbSNP:766696156
4477 4477 a, g dbSNP:545688443
4479 4479 c, t dbSNP:559174835
4482 4482 c, t dbSNP:754263293
4494 4494 c, g dbSNP:528394634
4498 4498 c, t dbSNP:755449552
4525 4525 g, t dbSNP:541823867
4589 4589 c, t dbSNP:779269651
4638 4638 a, g dbSNP:150408300
4645 4645 a, g dbSNP:530888343
4653 4653 a, g dbSNP:563716010
4657 4657 a, g dbSNP:1051821
4705 4705 c, g dbSNP:577249426
4709 4709 c, t dbSNP:571049038
4727 4727 c, g dbSNP:746929103
4771 4771 c, g dbSNP:770779154
4775 4775 c, t dbSNP:546308193
4783 4783 c, t dbSNP:745650916
4788 4788 c, t dbSNP:138122310
4807 4807 a, g dbSNP:769644868
4826 4826 a, g dbSNP:547220250
4854 4854 a, g dbSNP:73136585
4877 4877 a, g dbSNP:536165125
4895 4895 a, g dbSNP:77107548
4896 4896 -, tgc dbSNP:549826139
4927 4927 a, g dbSNP:762613624
4970 4970 a, g dbSNP:768172464
5005 5005 c, t dbSNP:773737847
5039 5039 c, g dbSNP:568079996
5064 5064 a, g dbSNP:145028189
5082 5082 a, c dbSNP:556682543
5132 5132 c, t dbSNP:576531330
5140 5140 a, c dbSNP:766779440
5155 5155 a, g dbSNP:754459457
5196 5196 c, t dbSNP:369634697
5220 5220 a, g dbSNP:115323539
5224 5224 a, g dbSNP:528703267
5231 5231 c, t dbSNP:138866062
5232 5232 c, g dbSNP:77777268
5260 5260 c, t dbSNP:542135679
5261 5261 a, g dbSNP:758582743
5290 5290 a, g dbSNP:373099874
5295 5295 c, g dbSNP:3810500
5296 5296 a, g dbSNP:767414680
5342 5342 c, t dbSNP:11554630
5343 5343 a, g dbSNP:564527134
5354 5354 c, g dbSNP:191412647
5356 5356 c, t dbSNP:146360147
5371 5371 a, g dbSNP:1051865
5407 5407 a, c dbSNP:560762968
5422 5422 a, g dbSNP:529542196
5449 5449 g, t dbSNP:549689208
5466 5466 c, t dbSNP:751604011
5472 5472 c, t dbSNP:567957712
5489 5489 c, t dbSNP:757415732
5510 5510 a, g dbSNP:781104665
5522 5522 a, g dbSNP:745853097
5525 5525 c, t dbSNP:41278224
5526 5526 a, g dbSNP:540648110
5554 5554 c, t dbSNP:370513858
5566 5566 g, t dbSNP:574236342
5569 5569 c, t dbSNP:369210127
5601 5601 c, t dbSNP:183854692
5610 5610 a, t dbSNP:77335831
5612 5612 c, g dbSNP:550273913
5615 5615 c, t dbSNP:368872154
5616 5616 a, g dbSNP:539125829
5636 5636 a, g dbSNP:552913413
5680 5680 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529048
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26667
Accession Version XM_011529049.1
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)933..>1142(+)
Misc Feature(2)939..1097(+)
Misc Feature(3)1017..1076(+)
Position Chain Variation Link
1 1 a, g dbSNP:367669837
2 2 c, t dbSNP:776173043
8 8 c, t dbSNP:761290631
13 13 c, t dbSNP:765265938
15 15 -, a dbSNP:763109334
15 15 c, t dbSNP:750321817
16 16 a, g dbSNP:2427556
23 23 c, t dbSNP:758425179
24 24 a, g dbSNP:766229694
26 26 c, t dbSNP:751432022
28 28 c, t dbSNP:756328807
29 29 a, g dbSNP:777904690
37 37 -, acgcacccggctgtgtgc dbSNP:764476807
38 38 c, t dbSNP:749373452
39 39 g, t dbSNP:757345661
44 44 c, t dbSNP:778967346
46 46 c, g dbSNP:113283070
49 49 c, g dbSNP:746312685
51 51 a, g dbSNP:111479365
54 54 c, g dbSNP:113698386
61 61 g, t dbSNP:772586794
62 62 c, t dbSNP:775788403
63 63 a, c dbSNP:112027130
72 72 a, g dbSNP:6089780
82 82 c, t dbSNP:6090019
85 85 a, g dbSNP:776217336
107 107 a, g dbSNP:113309089
110 110 c, g dbSNP:113946605
128 128 a, g dbSNP:113343621
141 141 a, g dbSNP:554875272
157 157 a, g dbSNP:574724312
163 163 a, g dbSNP:112466552
184 184 a, g dbSNP:111974421
196 196 c, t dbSNP:111549668
207 207 a, g dbSNP:112651993
212 212 c, t dbSNP:201085219
219 219 a, g dbSNP:2427557
222 222 c, g dbSNP:2427558
223 223 a, g dbSNP:772871954
228 228 a, t dbSNP:370749264
240 240 a, g dbSNP:111246522
262 262 c, t dbSNP:762946431
263 263 a, g dbSNP:545905782
274 274 c, t dbSNP:751347511
275 275 a, g dbSNP:559658009
289 289 c, t dbSNP:371545349
290 290 a, g dbSNP:753940797
295 295 c, t dbSNP:757483414
296 296 a, g dbSNP:778912055
300 300 a, g dbSNP:745974588
302 302 a, g dbSNP:113587130
305 305 c, g dbSNP:113258585
308 308 a, t dbSNP:542137436
309 309 g, t dbSNP:747398053
320 320 c, t dbSNP:768839190
322 322 c, t dbSNP:376672499
323 323 a, g dbSNP:747710372
330 330 c, t dbSNP:769602656
331 331 a, g dbSNP:772820428
349 349 c, t dbSNP:762602672
352 352 a, g dbSNP:113672516
358 358 a, g dbSNP:111993072
361 361 c, g dbSNP:34604519
391 391 c, t dbSNP:7360929
408 408 a, g dbSNP:76606291
414 414 a, g dbSNP:111696059
417 417 c, g dbSNP:12625445
420 420 -, at dbSNP:774681750
429 429 a, g dbSNP:770978307
433 433 -, ccgggacagcgccacggaagaggacgcacccgg dbSNP:760595490
434 434 c, t dbSNP:558127488
435 435 a, g dbSNP:759522333
442 442 c, t dbSNP:767158762
447 447 c, t dbSNP:112205797
448 448 a, g dbSNP:752555564
451 451 a, g dbSNP:761978432
457 457 c, t dbSNP:549849337
458 458 a, g dbSNP:765481515
464 464 a, g dbSNP:35544770
468 468 -, gtgtgcacatgtgcccagggccc dbSNP:766108698
470 470 a, g dbSNP:111586745
473 473 c, g dbSNP:12625454
490 490 c, t dbSNP:202033298
511 511 g, t dbSNP:780190059
513 513 c, t dbSNP:12624786
519 519 c, t dbSNP:751957826
520 520 a, g dbSNP:755535025
526 526 a, g dbSNP:371847120
529 529 a, g, t dbSNP:748563877
531 531 c, t dbSNP:777627197
532 532 a, c dbSNP:748801114
533 533 g, t dbSNP:770496241
541 541 a, g dbSNP:773924491
547 547 a, g dbSNP:532211416
573 573 c, t dbSNP:56202554
576 576 a, g dbSNP:113257637
607 607 c, t dbSNP:552270228
631 631 c, t dbSNP:565714646
641 641 c, g dbSNP:534851231
666 666 c, t dbSNP:548176739
681 681 c, t dbSNP:568057329
682 682 a, g dbSNP:148498083
693 693 c, t dbSNP:556898949
715 715 a, g dbSNP:576845383
726 726 a, c dbSNP:539521695
768 768 a, g dbSNP:553462142
802 802 a, g dbSNP:573342809
803 803 g, t dbSNP:542451465
824 824 c, t dbSNP:748257111
837 837 c, t dbSNP:112708386
853 853 c, g dbSNP:575967628
871 871 c, t dbSNP:187305839
898 898 a, g dbSNP:755410138
907 907 a, g dbSNP:200104219
908 908 a, g dbSNP:148585496
929 929 a, g dbSNP:753100030
935 935 a, g dbSNP:144141585
936 936 c, t dbSNP:371819808
942 942 c, g dbSNP:780154907
944 944 a, c, t dbSNP:770638590
950 950 c, t dbSNP:745419250
954 954 g, t dbSNP:771878951
965 965 c, t dbSNP:189308547
966 966 g, t dbSNP:753722773
990 990 a, t dbSNP:768384234
998 998 c, g dbSNP:774703054
1007 1007 c, g dbSNP:147295643
1012 1012 a, g dbSNP:528096976
1016 1016 c, t dbSNP:775734607
1022 1022 c, t dbSNP:140948457
1034 1034 c, t dbSNP:113987077
1035 1035 a, g dbSNP:754228390
1043 1043 a, g, t dbSNP:151265913
1047 1047 a, g, t dbSNP:750037969
1049 1049 c, t dbSNP:779503067
1050 1050 a, g dbSNP:202015608
1051 1051 c, t dbSNP:754887788
1052 1052 a, g dbSNP:781164296
1070 1070 c, g dbSNP:747892660
1076 1076 c, t dbSNP:769566622
1078 1078 c, t dbSNP:139312819
1079 1079 a, g dbSNP:746052000
1083 1083 a, g, t dbSNP:772453351
1086 1086 a, g dbSNP:371863489
1097 1097 c, t dbSNP:760881795
1098 1098 a, g dbSNP:769269113
1107 1107 a, g dbSNP:777340985
1112 1112 c, t dbSNP:762228571
1115 1115 c, t dbSNP:376163421
1118 1118 c, t dbSNP:201495666
1119 1119 a, g dbSNP:762638579
1121 1121 c, t dbSNP:766072943
1127 1127 c, t dbSNP:149971662
1133 1133 a, c, g, t dbSNP:532410241
1135 1135 c, t dbSNP:752620792
1139 1139 g, t dbSNP:756026221
1140 1140 c, t dbSNP:777583663
1145 1145 c, t dbSNP:749077830
1151 1151 c, t dbSNP:772397861
1154 1154 a, g dbSNP:780477656
1172 1172 c, t dbSNP:113207069
1181 1181 c, g dbSNP:768786863
1187 1187 c, t dbSNP:776598152
1188 1188 a, g dbSNP:762344309
1196 1196 c, g dbSNP:770247745
1214 1214 c, g dbSNP:141103374
1220 1220 a, t dbSNP:370749414
1226 1226 c, t dbSNP:774665874
1232 1232 c, t dbSNP:746279787
1234 1234 g, t dbSNP:387907043
1236 1236 -, ctc dbSNP:587776892
1240 1240 c, t dbSNP:771742418
1241 1241 a, g, t dbSNP:775067598
1252 1252 a, g dbSNP:200240375
1253 1253 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
1259 1259 c, t dbSNP:763451897
1260 1260 g, t dbSNP:373850027
1271 1271 c, t dbSNP:199712884
1279 1279 a, g dbSNP:761814066
1289 1289 c, t dbSNP:377198126
1290 1290 a, g dbSNP:750233915
1306 1306 a, g dbSNP:758198396
1309 1309 c, t dbSNP:144915847
1310 1310 a, g, t dbSNP:568985915
1311 1311 c, g dbSNP:567056743
1319 1319 c, t dbSNP:753956759
1326 1326 a, t dbSNP:757737652
1327 1327 c, t dbSNP:779453928
1328 1328 a, g dbSNP:746222594
1334 1334 c, t dbSNP:772254851
1337 1337 c, t dbSNP:780478210
1338 1338 g, t dbSNP:146719477
1346 1346 c, t dbSNP:140326040
1362 1362 a, c dbSNP:776262497
1372 1372 c, g dbSNP:761471108
1376 1376 c, t dbSNP:145468246
1377 1377 c, g dbSNP:773217530
1381 1381 a, c, g dbSNP:762961919
1387 1387 c, t dbSNP:747758089
1391 1391 a, g dbSNP:587780922
1393 1393 a, g dbSNP:755865198
1396 1396 c, t dbSNP:777119527
1397 1397 a, g dbSNP:748875387
1399 1399 c, t dbSNP:770758533
1400 1400 a, g, t dbSNP:369508682
1403 1403 c, t dbSNP:745794091
1404 1404 a, g dbSNP:771796509
1408 1408 c, t dbSNP:775285560
1414 1414 c, t dbSNP:761982169
1415 1415 a, g dbSNP:373237152
1417 1417 c, t dbSNP:199540600
1418 1418 a, g dbSNP:773154613
1421 1421 c, t dbSNP:376694698
1422 1422 a, g dbSNP:766374425
1427 1427 c, t dbSNP:752046563
1448 1448 c, t dbSNP:755569080
1451 1451 c, t dbSNP:776807695
1453 1453 c, t dbSNP:753155376
1455 1455 c, t dbSNP:377119075
1475 1475 c, t dbSNP:777536850
1476 1476 a, g dbSNP:748741035
1477 1477 a, g dbSNP:756715630
1483 1483 a, g, t dbSNP:778299599
1486 1486 a, g dbSNP:745755215
1497 1497 g, t dbSNP:772027430
1498 1498 a, t dbSNP:775232180
1500 1500 c, g dbSNP:370517092
1509 1509 c, g dbSNP:770001201
1514 1514 a, g dbSNP:773417550
1519 1519 c, t dbSNP:763097815
1520 1520 a, g dbSNP:770998287
1531 1531 a, g dbSNP:774328739
1532 1532 c, t dbSNP:569455237
1533 1533 a, g dbSNP:759852870
1535 1535 a, c dbSNP:531888878
1569 1569 a, g dbSNP:552086243
1604 1604 g, t dbSNP:570103284
1610 1610 c, t dbSNP:765183029
1623 1623 a, g dbSNP:572104922
1629 1629 c, t dbSNP:539094544
1645 1645 a, t dbSNP:41278210
1650 1650 c, t dbSNP:566191883
1657 1657 c, t dbSNP:535553583
1666 1666 c, t dbSNP:555245819
1681 1681 g, t dbSNP:575426180
1682 1682 a, g dbSNP:180676568
1761 1761 -, c dbSNP:35725001
1761 1761 c, t dbSNP:762734761
1763 1763 c, t dbSNP:764108980
1808 1808 c, t dbSNP:751612521
1809 1809 a, g dbSNP:143646564
1843 1843 a, g dbSNP:111986990
1854 1854 c, t dbSNP:767468477
1860 1860 a, g dbSNP:188304560
1868 1868 a, g dbSNP:560493837
1884 1884 c, g dbSNP:755818517
1934 1934 c, g dbSNP:758406047
1935 1935 a, t dbSNP:779361142
1944 1944 c, t dbSNP:574019244
1946 1946 c, g dbSNP:543134692
1947 1947 a, g dbSNP:562923666
1955 1955 c, g dbSNP:181187018
1962 1962 c, t dbSNP:551783395
1963 1963 c, t dbSNP:565192822
1971 1971 a, c dbSNP:148120785
1983 1983 g, t dbSNP:546156109
1986 1986 a, c dbSNP:566153307
2005 2005 c, g dbSNP:535180536
2020 2020 c, t dbSNP:779821892
2027 2027 a, g dbSNP:530195733
2028 2028 c, t dbSNP:549098751
2032 2032 c, g dbSNP:373789837
2040 2040 a, g dbSNP:141876407
2078 2078 a, g dbSNP:754507844
2178 2178 g, t dbSNP:185583381
2186 2186 a, g dbSNP:550344216
2194 2194 c, t dbSNP:570221664
2195 2195 a, g dbSNP:190430622
2197 2197 a, g dbSNP:373517080
2206 2206 c, t dbSNP:534100165
2214 2214 a, c, g dbSNP:75130625
2215 2215 a, g dbSNP:150670642
2219 2219 c, t dbSNP:747559300
2220 2220 a, g dbSNP:370655221
2222 2222 c, t dbSNP:563045593
2223 2223 a, g dbSNP:552739074
2230 2230 c, t dbSNP:576463953
2237 2237 g, t dbSNP:140106848
2243 2243 g, t dbSNP:374071727
2248 2248 c, t dbSNP:182038156
2249 2249 a, g dbSNP:565154557
2254 2254 c, t dbSNP:200797893
2263 2263 c, t dbSNP:527952182
2266 2266 c, t dbSNP:547713871
2304 2304 c, t dbSNP:114525694
2321 2321 c, t dbSNP:528926444
2340 2340 a, c, g, t dbSNP:6011230
2354 2354 a, g dbSNP:142246799
2367 2367 c, t dbSNP:537557158
2374 2374 c, t dbSNP:551572805
2382 2382 c, g dbSNP:1064345
2396 2396 g, t dbSNP:114038171
2397 2397 c, t dbSNP:554148166
2419 2419 a, g dbSNP:3764726
2431 2431 a, t dbSNP:774407862
2440 2440 a, g dbSNP:761863277
2446 2446 -, ca dbSNP:761715605
2482 2482 c, t dbSNP:534697865
2496 2496 a, g dbSNP:745906826
2499 2499 a, g dbSNP:111530162
2500 2500 g, t dbSNP:374724029
2503 2503 c, g dbSNP:536602351
2517 2517 c, t dbSNP:556293043
2538 2538 c, t dbSNP:576448324
2539 2539 c, t dbSNP:41278212
2553 2553 c, t dbSNP:558705497
2566 2566 c, t dbSNP:370539010
2570 2570 c, t dbSNP:541319164
2571 2571 a, g dbSNP:772665889
2593 2593 g, t dbSNP:11554629
2604 2604 c, g dbSNP:530334605
2611 2611 a, g dbSNP:542572143
2632 2632 g, t dbSNP:761133645
2645 2645 a, t dbSNP:766037792
2669 2669 c, t dbSNP:753503517
2670 2670 g, t dbSNP:562364964
2684 2684 a, g dbSNP:187083695
2692 2692 c, t dbSNP:551534511
2707 2707 a, g dbSNP:73136582
2722 2722 c, t dbSNP:149675982
2737 2737 a, g dbSNP:547616976
2747 2747 c, t dbSNP:567511920
2767 2767 -, t dbSNP:570640728
2790 2790 c, t dbSNP:41278214
2792 2792 g, t dbSNP:41278216
2828 2828 a, c dbSNP:576882539
2829 2829 a, g dbSNP:41278218
2842 2842 c, t dbSNP:569979955
2851 2851 c, t dbSNP:61735744
2860 2860 c, t dbSNP:777130136
2876 2876 a, c dbSNP:558669385
2877 2877 c, t dbSNP:780290336
2900 2900 c, t dbSNP:375806163
2905 2905 a, g dbSNP:572304793
2920 2920 a, g dbSNP:41278220
2926 2926 c, t dbSNP:192310826
2929 2929 a, g dbSNP:61744085
2961 2961 a, g dbSNP:145450467
3005 3005 a, g dbSNP:543786216
3013 3013 a, c dbSNP:182388077
3043 3043 a, g dbSNP:58526294
3044 3044 g, t dbSNP:542172964
3045 3045 a, g dbSNP:772147376
3060 3060 g, t dbSNP:773078929
3083 3083 a, g dbSNP:61740713
3091 3091 c, t dbSNP:554749952
3117 3117 c, t dbSNP:527390994
3130 3130 c, t dbSNP:142546412
3135 3135 c, t dbSNP:41278222
3136 3136 a, g dbSNP:186759404
3143 3143 c, t dbSNP:549842283
3159 3159 c, t dbSNP:190043990
3172 3172 c, t dbSNP:776328647
3173 3173 a, g dbSNP:759212642
3186 3186 a, t dbSNP:538696522
3205 3205 a, c dbSNP:532451538
3249 3249 c, t dbSNP:764688339
3302 3302 a, g dbSNP:552159535
3307 3307 a, c dbSNP:182604967
3313 3313 a, g dbSNP:751434970
3323 3323 c, t dbSNP:752208413
3355 3355 a, t dbSNP:530157117
3367 3367 c, t dbSNP:757706518
3373 3373 g, t dbSNP:11554632
3377 3377 c, t dbSNP:368351354
3396 3396 c, t dbSNP:534811442
3414 3414 a, g dbSNP:187307345
3418 3418 a, g dbSNP:13048
3421 3421 g, t dbSNP:768056284
3423 3423 c, t dbSNP:574966040
3435 3435 c, t dbSNP:750932518
3442 3442 a, g dbSNP:192839202
3468 3468 c, g dbSNP:543845505
3505 3505 c, t dbSNP:569120771
3526 3526 c, t dbSNP:79245733
3541 3541 a, g dbSNP:577615375
3545 3545 c, t dbSNP:376946085
3551 3551 a, g dbSNP:564889567
3597 3597 a, g dbSNP:572143327
3610 3610 a, t dbSNP:369294707
3624 3624 a, g dbSNP:368218060
3639 3639 a, g dbSNP:561123246
3647 3647 a, g dbSNP:531764324
3658 3658 a, g dbSNP:185288496
3678 3678 c, g dbSNP:550048168
3689 3689 a, g dbSNP:563198999
3693 3693 a, g dbSNP:532286219
3695 3695 c, t dbSNP:11554631
3701 3701 a, c dbSNP:565762270
3705 3705 a, g dbSNP:142121195
3774 3774 c, t dbSNP:548433050
3801 3801 c, t dbSNP:755253233
3829 3829 g, t dbSNP:7360045
3866 3866 a, g dbSNP:6062590
3870 3870 a, g dbSNP:568634990
3906 3906 c, g dbSNP:537200922
3977 3977 c, t dbSNP:557540230
4032 4032 c, g dbSNP:577579444
4050 4050 a, c dbSNP:188604040
4056 4056 g, t dbSNP:11224
4062 4062 a, t dbSNP:762079204
4064 4064 c, t dbSNP:757512075
4088 4088 c, t dbSNP:112103063
4104 4104 a, g dbSNP:6122217
4110 4110 -, a dbSNP:35892428
4120 4120 a, g dbSNP:533825911
4139 4139 c, t dbSNP:772341856
4145 4145 g, t dbSNP:572106837
4165 4165 a, g dbSNP:541113088
4188 4188 c, t dbSNP:3206771
4198 4198 a, g dbSNP:76291580
4203 4203 -, cctgt dbSNP:747355306
4204 4204 c, g dbSNP:543214810
4210 4210 a, g dbSNP:76769576
4212 4212 a, g dbSNP:11554628
4226 4226 a, g dbSNP:6122218
4237 4237 a, g dbSNP:552085775
4248 4248 -, tgcttt dbSNP:111755454
4249 4249 c, g dbSNP:762727386
4252 4252 -, tttgct dbSNP:375427318
4269 4269 c, t dbSNP:559310134
4277 4277 c, t dbSNP:55665472
4289 4289 c, g dbSNP:556265433
4291 4291 c, t dbSNP:568420557
4325 4325 a, c dbSNP:531050018
4328 4328 a, g dbSNP:769271047
4342 4342 c, t dbSNP:551166849
4349 4349 c, t dbSNP:576307094
4350 4350 a, g dbSNP:764885154
4365 4365 c, t dbSNP:749724
4386 4386 a, g dbSNP:62218071
4399 4399 c, t dbSNP:749723
4400 4400 a, g dbSNP:539536316
4403 4403 c, t dbSNP:553744243
4410 4410 c, g dbSNP:552870087
4421 4421 a, g dbSNP:565668761
4441 4441 a, g dbSNP:534278396
4483 4483 a, g dbSNP:573120224
4499 4499 c, t dbSNP:193241753
4547 4547 g, t dbSNP:762417962
4610 4610 -, tgt dbSNP:758069157
4620 4620 a, g dbSNP:535738516
4666 4666 c, t dbSNP:555659295
4671 4671 a, g dbSNP:185738914
4691 4691 c, t dbSNP:140377993
4692 4692 a, g dbSNP:188065663
4703 4703 a, g dbSNP:543421330
4724 4724 g, t dbSNP:576665202
4738 4738 c, t dbSNP:766696156
4739 4739 a, g dbSNP:545688443
4741 4741 c, t dbSNP:559174835
4744 4744 c, t dbSNP:754263293
4756 4756 c, g dbSNP:528394634
4760 4760 c, t dbSNP:755449552
4787 4787 g, t dbSNP:541823867
4851 4851 c, t dbSNP:779269651
4900 4900 a, g dbSNP:150408300
4907 4907 a, g dbSNP:530888343
4915 4915 a, g dbSNP:563716010
4919 4919 a, g dbSNP:1051821
4967 4967 c, g dbSNP:577249426
4971 4971 c, t dbSNP:571049038
4989 4989 c, g dbSNP:746929103
5033 5033 c, g dbSNP:770779154
5037 5037 c, t dbSNP:546308193
5045 5045 c, t dbSNP:745650916
5050 5050 c, t dbSNP:138122310
5069 5069 a, g dbSNP:769644868
5088 5088 a, g dbSNP:547220250
5116 5116 a, g dbSNP:73136585
5139 5139 a, g dbSNP:536165125
5157 5157 a, g dbSNP:77107548
5158 5158 -, tgc dbSNP:549826139
5189 5189 a, g dbSNP:762613624
5232 5232 a, g dbSNP:768172464
5267 5267 c, t dbSNP:773737847
5301 5301 c, g dbSNP:568079996
5326 5326 a, g dbSNP:145028189
5344 5344 a, c dbSNP:556682543
5394 5394 c, t dbSNP:576531330
5402 5402 a, c dbSNP:766779440
5417 5417 a, g dbSNP:754459457
5458 5458 c, t dbSNP:369634697
5482 5482 a, g dbSNP:115323539
5486 5486 a, g dbSNP:528703267
5493 5493 c, t dbSNP:138866062
5494 5494 c, g dbSNP:77777268
5522 5522 c, t dbSNP:542135679
5523 5523 a, g dbSNP:758582743
5552 5552 a, g dbSNP:373099874
5557 5557 c, g dbSNP:3810500
5558 5558 a, g dbSNP:767414680
5604 5604 c, t dbSNP:11554630
5605 5605 a, g dbSNP:564527134
5616 5616 c, g dbSNP:191412647
5618 5618 c, t dbSNP:146360147
5633 5633 a, g dbSNP:1051865
5669 5669 a, c dbSNP:560762968
5684 5684 a, g dbSNP:529542196
5711 5711 g, t dbSNP:549689208
5728 5728 c, t dbSNP:751604011
5734 5734 c, t dbSNP:567957712
5751 5751 c, t dbSNP:757415732
5772 5772 a, g dbSNP:781104665
5784 5784 a, g dbSNP:745853097
5787 5787 c, t dbSNP:41278224
5788 5788 a, g dbSNP:540648110
5816 5816 c, t dbSNP:370513858
5828 5828 g, t dbSNP:574236342
5831 5831 c, t dbSNP:369210127
5863 5863 c, t dbSNP:183854692
5872 5872 a, t dbSNP:77335831
5874 5874 c, g dbSNP:550273913
5877 5877 c, t dbSNP:368872154
5878 5878 a, g dbSNP:539125829
5898 5898 a, g dbSNP:552913413
5942 5942 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529049
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26667
Accession Version XM_011529050.1
Sequence Information ORF Nucleotide Sequence (Length: 597bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product dnaJ homolog subfamily C member 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011362.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)70..>279(+)
Misc Feature(2)76..234(+)
Misc Feature(3)154..213(+)
Position Chain Variation Link
6 6 c, t dbSNP:751956545
35 35 a, g dbSNP:755410138
44 44 a, g dbSNP:200104219
45 45 a, g dbSNP:148585496
66 66 a, g dbSNP:753100030
72 72 a, g dbSNP:144141585
73 73 c, t dbSNP:371819808
79 79 c, g dbSNP:780154907
81 81 a, c, t dbSNP:770638590
87 87 c, t dbSNP:745419250
91 91 g, t dbSNP:771878951
102 102 c, t dbSNP:189308547
103 103 g, t dbSNP:753722773
127 127 a, t dbSNP:768384234
135 135 c, g dbSNP:774703054
144 144 c, g dbSNP:147295643
149 149 a, g dbSNP:528096976
153 153 c, t dbSNP:775734607
159 159 c, t dbSNP:140948457
171 171 c, t dbSNP:113987077
172 172 a, g dbSNP:754228390
180 180 a, g, t dbSNP:151265913
184 184 a, g, t dbSNP:750037969
186 186 c, t dbSNP:779503067
187 187 a, g dbSNP:202015608
188 188 c, t dbSNP:754887788
189 189 a, g dbSNP:781164296
207 207 c, g dbSNP:747892660
213 213 c, t dbSNP:769566622
215 215 c, t dbSNP:139312819
216 216 a, g dbSNP:746052000
220 220 a, g, t dbSNP:772453351
223 223 a, g dbSNP:371863489
234 234 c, t dbSNP:760881795
235 235 a, g dbSNP:769269113
244 244 a, g dbSNP:777340985
249 249 c, t dbSNP:762228571
252 252 c, t dbSNP:376163421
255 255 c, t dbSNP:201495666
256 256 a, g dbSNP:762638579
258 258 c, t dbSNP:766072943
264 264 c, t dbSNP:149971662
270 270 a, c, g, t dbSNP:532410241
272 272 c, t dbSNP:752620792
276 276 g, t dbSNP:756026221
277 277 c, t dbSNP:777583663
282 282 c, t dbSNP:749077830
288 288 c, t dbSNP:772397861
291 291 a, g dbSNP:780477656
309 309 c, t dbSNP:113207069
318 318 c, g dbSNP:768786863
324 324 c, t dbSNP:776598152
325 325 a, g dbSNP:762344309
333 333 c, g dbSNP:770247745
351 351 c, g dbSNP:141103374
357 357 a, t dbSNP:370749414
363 363 c, t dbSNP:774665874
369 369 c, t dbSNP:746279787
371 371 g, t dbSNP:387907043
373 373 -, ctc dbSNP:587776892
377 377 c, t dbSNP:771742418
378 378 a, g, t dbSNP:775067598
389 389 a, g dbSNP:200240375
390 390 -, ctgctgctgtctgtgctgctgcttcaa dbSNP:777445507
396 396 c, t dbSNP:763451897
397 397 g, t dbSNP:373850027
408 408 c, t dbSNP:199712884
416 416 a, g dbSNP:761814066
426 426 c, t dbSNP:377198126
427 427 a, g dbSNP:750233915
443 443 a, g dbSNP:758198396
446 446 c, t dbSNP:144915847
447 447 a, g, t dbSNP:568985915
448 448 c, g dbSNP:567056743
456 456 c, t dbSNP:753956759
463 463 a, t dbSNP:757737652
464 464 c, t dbSNP:779453928
465 465 a, g dbSNP:746222594
471 471 c, t dbSNP:772254851
474 474 c, t dbSNP:780478210
475 475 g, t dbSNP:146719477
483 483 c, t dbSNP:140326040
499 499 a, c dbSNP:776262497
509 509 c, g dbSNP:761471108
513 513 c, t dbSNP:145468246
514 514 c, g dbSNP:773217530
518 518 a, c, g dbSNP:762961919
524 524 c, t dbSNP:747758089
528 528 a, g dbSNP:587780922
530 530 a, g dbSNP:755865198
533 533 c, t dbSNP:777119527
534 534 a, g dbSNP:748875387
536 536 c, t dbSNP:770758533
537 537 a, g, t dbSNP:369508682
540 540 c, t dbSNP:745794091
541 541 a, g dbSNP:771796509
545 545 c, t dbSNP:775285560
551 551 c, t dbSNP:761982169
552 552 a, g dbSNP:373237152
554 554 c, t dbSNP:199540600
555 555 a, g dbSNP:773154613
558 558 c, t dbSNP:376694698
559 559 a, g dbSNP:766374425
564 564 c, t dbSNP:752046563
585 585 c, t dbSNP:755569080
588 588 c, t dbSNP:776807695
590 590 c, t dbSNP:753155376
592 592 c, t dbSNP:377119075
612 612 c, t dbSNP:777536850
613 613 a, g dbSNP:748741035
614 614 a, g dbSNP:756715630
620 620 a, g, t dbSNP:778299599
623 623 a, g dbSNP:745755215
634 634 g, t dbSNP:772027430
635 635 a, t dbSNP:775232180
637 637 c, g dbSNP:370517092
646 646 c, g dbSNP:770001201
651 651 a, g dbSNP:773417550
656 656 c, t dbSNP:763097815
657 657 a, g dbSNP:770998287
668 668 a, g dbSNP:774328739
669 669 c, t dbSNP:569455237
670 670 a, g dbSNP:759852870
672 672 a, c dbSNP:531888878
706 706 a, g dbSNP:552086243
741 741 g, t dbSNP:570103284
747 747 c, t dbSNP:765183029
760 760 a, g dbSNP:572104922
766 766 c, t dbSNP:539094544
782 782 a, t dbSNP:41278210
787 787 c, t dbSNP:566191883
794 794 c, t dbSNP:535553583
803 803 c, t dbSNP:555245819
818 818 g, t dbSNP:575426180
819 819 a, g dbSNP:180676568
898 898 -, c dbSNP:35725001
898 898 c, t dbSNP:762734761
900 900 c, t dbSNP:764108980
945 945 c, t dbSNP:751612521
946 946 a, g dbSNP:143646564
980 980 a, g dbSNP:111986990
991 991 c, t dbSNP:767468477
997 997 a, g dbSNP:188304560
1005 1005 a, g dbSNP:560493837
1021 1021 c, g dbSNP:755818517
1071 1071 c, g dbSNP:758406047
1072 1072 a, t dbSNP:779361142
1081 1081 c, t dbSNP:574019244
1083 1083 c, g dbSNP:543134692
1084 1084 a, g dbSNP:562923666
1092 1092 c, g dbSNP:181187018
1099 1099 c, t dbSNP:551783395
1100 1100 c, t dbSNP:565192822
1108 1108 a, c dbSNP:148120785
1120 1120 g, t dbSNP:546156109
1123 1123 a, c dbSNP:566153307
1142 1142 c, g dbSNP:535180536
1157 1157 c, t dbSNP:779821892
1164 1164 a, g dbSNP:530195733
1165 1165 c, t dbSNP:549098751
1169 1169 c, g dbSNP:373789837
1177 1177 a, g dbSNP:141876407
1215 1215 a, g dbSNP:754507844
1315 1315 g, t dbSNP:185583381
1323 1323 a, g dbSNP:550344216
1331 1331 c, t dbSNP:570221664
1332 1332 a, g dbSNP:190430622
1334 1334 a, g dbSNP:373517080
1343 1343 c, t dbSNP:534100165
1351 1351 a, c, g dbSNP:75130625
1352 1352 a, g dbSNP:150670642
1356 1356 c, t dbSNP:747559300
1357 1357 a, g dbSNP:370655221
1359 1359 c, t dbSNP:563045593
1360 1360 a, g dbSNP:552739074
1367 1367 c, t dbSNP:576463953
1374 1374 g, t dbSNP:140106848
1380 1380 g, t dbSNP:374071727
1385 1385 c, t dbSNP:182038156
1386 1386 a, g dbSNP:565154557
1391 1391 c, t dbSNP:200797893
1400 1400 c, t dbSNP:527952182
1403 1403 c, t dbSNP:547713871
1441 1441 c, t dbSNP:114525694
1458 1458 c, t dbSNP:528926444
1477 1477 a, c, g, t dbSNP:6011230
1491 1491 a, g dbSNP:142246799
1504 1504 c, t dbSNP:537557158
1511 1511 c, t dbSNP:551572805
1519 1519 c, g dbSNP:1064345
1533 1533 g, t dbSNP:114038171
1534 1534 c, t dbSNP:554148166
1556 1556 a, g dbSNP:3764726
1568 1568 a, t dbSNP:774407862
1577 1577 a, g dbSNP:761863277
1583 1583 -, ca dbSNP:761715605
1619 1619 c, t dbSNP:534697865
1633 1633 a, g dbSNP:745906826
1636 1636 a, g dbSNP:111530162
1637 1637 g, t dbSNP:374724029
1640 1640 c, g dbSNP:536602351
1654 1654 c, t dbSNP:556293043
1675 1675 c, t dbSNP:576448324
1676 1676 c, t dbSNP:41278212
1690 1690 c, t dbSNP:558705497
1703 1703 c, t dbSNP:370539010
1707 1707 c, t dbSNP:541319164
1708 1708 a, g dbSNP:772665889
1730 1730 g, t dbSNP:11554629
1741 1741 c, g dbSNP:530334605
1748 1748 a, g dbSNP:542572143
1769 1769 g, t dbSNP:761133645
1782 1782 a, t dbSNP:766037792
1806 1806 c, t dbSNP:753503517
1807 1807 g, t dbSNP:562364964
1821 1821 a, g dbSNP:187083695
1829 1829 c, t dbSNP:551534511
1844 1844 a, g dbSNP:73136582
1859 1859 c, t dbSNP:149675982
1874 1874 a, g dbSNP:547616976
1884 1884 c, t dbSNP:567511920
1904 1904 -, t dbSNP:570640728
1927 1927 c, t dbSNP:41278214
1929 1929 g, t dbSNP:41278216
1965 1965 a, c dbSNP:576882539
1966 1966 a, g dbSNP:41278218
1979 1979 c, t dbSNP:569979955
1988 1988 c, t dbSNP:61735744
1997 1997 c, t dbSNP:777130136
2013 2013 a, c dbSNP:558669385
2014 2014 c, t dbSNP:780290336
2037 2037 c, t dbSNP:375806163
2042 2042 a, g dbSNP:572304793
2057 2057 a, g dbSNP:41278220
2063 2063 c, t dbSNP:192310826
2066 2066 a, g dbSNP:61744085
2098 2098 a, g dbSNP:145450467
2142 2142 a, g dbSNP:543786216
2150 2150 a, c dbSNP:182388077
2180 2180 a, g dbSNP:58526294
2181 2181 g, t dbSNP:542172964
2182 2182 a, g dbSNP:772147376
2197 2197 g, t dbSNP:773078929
2220 2220 a, g dbSNP:61740713
2228 2228 c, t dbSNP:554749952
2254 2254 c, t dbSNP:527390994
2267 2267 c, t dbSNP:142546412
2272 2272 c, t dbSNP:41278222
2273 2273 a, g dbSNP:186759404
2280 2280 c, t dbSNP:549842283
2296 2296 c, t dbSNP:190043990
2309 2309 c, t dbSNP:776328647
2310 2310 a, g dbSNP:759212642
2323 2323 a, t dbSNP:538696522
2342 2342 a, c dbSNP:532451538
2386 2386 c, t dbSNP:764688339
2439 2439 a, g dbSNP:552159535
2444 2444 a, c dbSNP:182604967
2450 2450 a, g dbSNP:751434970
2460 2460 c, t dbSNP:752208413
2492 2492 a, t dbSNP:530157117
2504 2504 c, t dbSNP:757706518
2510 2510 g, t dbSNP:11554632
2514 2514 c, t dbSNP:368351354
2533 2533 c, t dbSNP:534811442
2551 2551 a, g dbSNP:187307345
2555 2555 a, g dbSNP:13048
2558 2558 g, t dbSNP:768056284
2560 2560 c, t dbSNP:574966040
2572 2572 c, t dbSNP:750932518
2579 2579 a, g dbSNP:192839202
2605 2605 c, g dbSNP:543845505
2642 2642 c, t dbSNP:569120771
2663 2663 c, t dbSNP:79245733
2678 2678 a, g dbSNP:577615375
2682 2682 c, t dbSNP:376946085
2688 2688 a, g dbSNP:564889567
2734 2734 a, g dbSNP:572143327
2747 2747 a, t dbSNP:369294707
2761 2761 a, g dbSNP:368218060
2776 2776 a, g dbSNP:561123246
2784 2784 a, g dbSNP:531764324
2795 2795 a, g dbSNP:185288496
2815 2815 c, g dbSNP:550048168
2826 2826 a, g dbSNP:563198999
2830 2830 a, g dbSNP:532286219
2832 2832 c, t dbSNP:11554631
2838 2838 a, c dbSNP:565762270
2842 2842 a, g dbSNP:142121195
2911 2911 c, t dbSNP:548433050
2938 2938 c, t dbSNP:755253233
2966 2966 g, t dbSNP:7360045
3003 3003 a, g dbSNP:6062590
3007 3007 a, g dbSNP:568634990
3043 3043 c, g dbSNP:537200922
3114 3114 c, t dbSNP:557540230
3169 3169 c, g dbSNP:577579444
3187 3187 a, c dbSNP:188604040
3193 3193 g, t dbSNP:11224
3199 3199 a, t dbSNP:762079204
3201 3201 c, t dbSNP:757512075
3225 3225 c, t dbSNP:112103063
3241 3241 a, g dbSNP:6122217
3247 3247 -, a dbSNP:35892428
3257 3257 a, g dbSNP:533825911
3276 3276 c, t dbSNP:772341856
3282 3282 g, t dbSNP:572106837
3302 3302 a, g dbSNP:541113088
3325 3325 c, t dbSNP:3206771
3335 3335 a, g dbSNP:76291580
3340 3340 -, cctgt dbSNP:747355306
3341 3341 c, g dbSNP:543214810
3347 3347 a, g dbSNP:76769576
3349 3349 a, g dbSNP:11554628
3363 3363 a, g dbSNP:6122218
3374 3374 a, g dbSNP:552085775
3385 3385 -, tgcttt dbSNP:111755454
3386 3386 c, g dbSNP:762727386
3389 3389 -, tttgct dbSNP:375427318
3406 3406 c, t dbSNP:559310134
3414 3414 c, t dbSNP:55665472
3426 3426 c, g dbSNP:556265433
3428 3428 c, t dbSNP:568420557
3462 3462 a, c dbSNP:531050018
3465 3465 a, g dbSNP:769271047
3479 3479 c, t dbSNP:551166849
3486 3486 c, t dbSNP:576307094
3487 3487 a, g dbSNP:764885154
3502 3502 c, t dbSNP:749724
3523 3523 a, g dbSNP:62218071
3536 3536 c, t dbSNP:749723
3537 3537 a, g dbSNP:539536316
3540 3540 c, t dbSNP:553744243
3547 3547 c, g dbSNP:552870087
3558 3558 a, g dbSNP:565668761
3578 3578 a, g dbSNP:534278396
3620 3620 a, g dbSNP:573120224
3636 3636 c, t dbSNP:193241753
3684 3684 g, t dbSNP:762417962
3747 3747 -, tgt dbSNP:758069157
3757 3757 a, g dbSNP:535738516
3803 3803 c, t dbSNP:555659295
3808 3808 a, g dbSNP:185738914
3828 3828 c, t dbSNP:140377993
3829 3829 a, g dbSNP:188065663
3840 3840 a, g dbSNP:543421330
3861 3861 g, t dbSNP:576665202
3875 3875 c, t dbSNP:766696156
3876 3876 a, g dbSNP:545688443
3878 3878 c, t dbSNP:559174835
3881 3881 c, t dbSNP:754263293
3893 3893 c, g dbSNP:528394634
3897 3897 c, t dbSNP:755449552
3924 3924 g, t dbSNP:541823867
3988 3988 c, t dbSNP:779269651
4037 4037 a, g dbSNP:150408300
4044 4044 a, g dbSNP:530888343
4052 4052 a, g dbSNP:563716010
4056 4056 a, g dbSNP:1051821
4104 4104 c, g dbSNP:577249426
4108 4108 c, t dbSNP:571049038
4126 4126 c, g dbSNP:746929103
4170 4170 c, g dbSNP:770779154
4174 4174 c, t dbSNP:546308193
4182 4182 c, t dbSNP:745650916
4187 4187 c, t dbSNP:138122310
4206 4206 a, g dbSNP:769644868
4225 4225 a, g dbSNP:547220250
4253 4253 a, g dbSNP:73136585
4276 4276 a, g dbSNP:536165125
4294 4294 a, g dbSNP:77107548
4295 4295 -, tgc dbSNP:549826139
4326 4326 a, g dbSNP:762613624
4369 4369 a, g dbSNP:768172464
4404 4404 c, t dbSNP:773737847
4438 4438 c, g dbSNP:568079996
4463 4463 a, g dbSNP:145028189
4481 4481 a, c dbSNP:556682543
4531 4531 c, t dbSNP:576531330
4539 4539 a, c dbSNP:766779440
4554 4554 a, g dbSNP:754459457
4595 4595 c, t dbSNP:369634697
4619 4619 a, g dbSNP:115323539
4623 4623 a, g dbSNP:528703267
4630 4630 c, t dbSNP:138866062
4631 4631 c, g dbSNP:77777268
4659 4659 c, t dbSNP:542135679
4660 4660 a, g dbSNP:758582743
4689 4689 a, g dbSNP:373099874
4694 4694 c, g dbSNP:3810500
4695 4695 a, g dbSNP:767414680
4741 4741 c, t dbSNP:11554630
4742 4742 a, g dbSNP:564527134
4753 4753 c, g dbSNP:191412647
4755 4755 c, t dbSNP:146360147
4770 4770 a, g dbSNP:1051865
4806 4806 a, c dbSNP:560762968
4821 4821 a, g dbSNP:529542196
4848 4848 g, t dbSNP:549689208
4865 4865 c, t dbSNP:751604011
4871 4871 c, t dbSNP:567957712
4888 4888 c, t dbSNP:757415732
4909 4909 a, g dbSNP:781104665
4921 4921 a, g dbSNP:745853097
4924 4924 c, t dbSNP:41278224
4925 4925 a, g dbSNP:540648110
4953 4953 c, t dbSNP:370513858
4965 4965 g, t dbSNP:574236342
4968 4968 c, t dbSNP:369210127
5000 5000 c, t dbSNP:183854692
5009 5009 a, t dbSNP:77335831
5011 5011 c, g dbSNP:550273913
5014 5014 c, t dbSNP:368872154
5015 5015 a, g dbSNP:539125829
5035 5035 a, g dbSNP:552913413
5079 5079 c, t dbSNP:74554553

Target ORF information:

RefSeq Version XM_011529050
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.