Email to GenScript

AMN amnion associated transmembrane protein [Homo sapiens (human)]

Gene Symbol AMN
Entrez Gene ID 81693
Full Name amnion associated transmembrane protein
Synonyms PRO1028, amnionless
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Megaloblastic anemia-1, Norwegian type, 261100 (3)

The following AMN gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the AMN gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu72975 XM_011537202 PREDICTED: Homo sapiens amnion associated transmembrane protein (AMN), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu72975 XM_011537203 PREDICTED: Homo sapiens amnion associated transmembrane protein (AMN), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu18098 NM_030943 Homo sapiens amnion associated transmembrane protein (AMN), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu72975
Accession Version XM_011537202.1
Sequence Information ORF Nucleotide Sequence (Length: 1200bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein amnionless isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)323..1504(+)
Position Chain Variation Link
3 3 c, g, t dbSNP:567970311
17 17 a, g dbSNP:191851181
55 55 c, g dbSNP:59793431
68 68 c, t dbSNP:57687948
70 70 c, g dbSNP:538734434
76 76 a, g dbSNP:112794792
97 97 c, t dbSNP:114710627
102 102 a, g dbSNP:780798513
103 103 a, g dbSNP:745544144
106 106 -, aa dbSNP:746143548
107 107 a, c, t dbSNP:769523726
108 108 a, c dbSNP:749162280
109 109 a, g dbSNP:768328215
113 113 -, c dbSNP:772396092
115 115 a, c, g, t dbSNP:2295828
116 116 g, t dbSNP:776734357
118 118 c, t dbSNP:759591055
119 119 c, g, t dbSNP:2295829
123 123 -, tgc dbSNP:775709395
132 132 c, t dbSNP:758794765
134 134 a, g dbSNP:764306556
136 136 a, g dbSNP:376932320
137 137 a, g dbSNP:752133468
138 138 a, c, t dbSNP:757797348
147 147 c, t dbSNP:745417738
153 153 -, g dbSNP:746999720
155 155 a, g dbSNP:755562339
155 155 -, g dbSNP:386834168
157 157 c, g dbSNP:561570970
159 159 c, g, t dbSNP:200460988
162 162 a, c, t dbSNP:768522233
176 176 -, a dbSNP:769770182
183 183 c, t dbSNP:747910380
185 185 g, t dbSNP:386834172
190 190 c, g dbSNP:772049847
191 191 c, t dbSNP:369434844
193 193 a, g dbSNP:761472053
195 195 a, g dbSNP:765164769
197 197 c, t dbSNP:764845014
204 204 c, t dbSNP:367718843
205 205 a, c dbSNP:753339887
207 207 a, t dbSNP:754501107
217 217 g, t dbSNP:145328398
218 218 a, g dbSNP:372629049
222 222 c, t dbSNP:202122792
223 223 c, t dbSNP:150802428
234 234 c, t dbSNP:777496622
235 235 a, c, t dbSNP:746997257
239 239 a, c dbSNP:781165782
241 241 c, g, t dbSNP:554401493
251 251 a, g dbSNP:774714587
252 252 a, g dbSNP:762065641
253 253 c, t dbSNP:772599857
256 256 c, t dbSNP:773494418
268 268 c, g dbSNP:199835580
270 270 a, g dbSNP:200648108
277 277 c, t dbSNP:777192314
279 279 a, c, g dbSNP:759053400
282 282 c, t dbSNP:119478058
283 283 c, g dbSNP:758005290
289 289 c, t dbSNP:763705322
290 290 a, g dbSNP:138106067
292 292 -, cgg dbSNP:759251270
293 293 a, g dbSNP:757059886
296 296 a, g dbSNP:540101140
300 300 c, t dbSNP:373815557
301 301 a, c, t dbSNP:755118412
302 302 a, g dbSNP:748210579
309 309 g, t dbSNP:772475317
310 310 c, g dbSNP:773472640
312 312 c, t dbSNP:747402473
313 313 a, c, g dbSNP:771262042
316 316 a, g dbSNP:759987455
325 325 a, g dbSNP:61731158
334 334 c, g dbSNP:749734745
335 335 c, t dbSNP:199629027
340 340 c, g dbSNP:773867275
350 350 c, t dbSNP:144729558
352 352 c, t dbSNP:771819877
356 356 a, g dbSNP:772996972
357 357 c, t dbSNP:371713937
365 365 a, g dbSNP:766219642
366 366 c, t dbSNP:375774640
367 367 a, g dbSNP:759479529
370 370 c, t dbSNP:750661806
375 375 c, t dbSNP:756286731
379 379 a, g dbSNP:568797057
380 380 a, g dbSNP:766554192
389 389 c, t dbSNP:534527113
392 392 a, c, g dbSNP:754290581
406 406 a, g dbSNP:779483487
409 409 c, g dbSNP:748549145
410 410 a, g dbSNP:758005644
423 423 c, t dbSNP:777378282
424 424 a, g dbSNP:746489250
427 427 -, c dbSNP:754351074
435 435 c, t dbSNP:144707331
436 436 a, g dbSNP:774609969
441 441 c, t dbSNP:576779161
442 442 a, g dbSNP:148513667
450 450 a, g dbSNP:769407881
451 451 a, c, t dbSNP:775510849
454 454 a, g, t dbSNP:767611074
455 455 -, g dbSNP:386834171
457 457 a, c dbSNP:552595670
459 459 -, a dbSNP:747140475
461 461 c, t dbSNP:780518726
464 464 a, g dbSNP:372620819
465 465 a, c dbSNP:755757921
466 466 a, c, g dbSNP:779731533
467 467 a, g dbSNP:768376089
472 472 a, c dbSNP:778838482
481 481 c, t dbSNP:563004567
483 483 a, c dbSNP:771078036
484 484 c, t dbSNP:7140429
492 492 c, t dbSNP:375355075
494 494 a, t dbSNP:769969461
496 496 c, g dbSNP:775778646
500 500 a, g dbSNP:763413999
501 501 a, g dbSNP:764493431
502 502 a, c dbSNP:752135124
503 503 c, t dbSNP:762369943
504 504 a, c dbSNP:548672909
505 505 a, g dbSNP:749947054
511 511 c, g dbSNP:151031511
516 516 c, g, t dbSNP:533436439
523 523 a, g dbSNP:141455061
527 527 a, g dbSNP:778644293
530 530 a, g dbSNP:1134469
539 539 c, t dbSNP:747908131
555 555 c, t dbSNP:778640033
560 560 c, t dbSNP:758317090
563 563 a, c, g dbSNP:777755176
572 572 c, t dbSNP:769843598
573 573 c, g dbSNP:568801729
586 586 -, ttctttccg dbSNP:768565737
588 588 g, t dbSNP:775867545
596 596 a, c, t dbSNP:749472402
607 607 c, t dbSNP:199873929
612 612 a, c, g dbSNP:774892250
614 614 a, c, g, t dbSNP:201055900
615 615 c, t dbSNP:765866977
616 616 a, g dbSNP:753523412
622 622 c, t dbSNP:754669033
623 623 c, g dbSNP:764848388
624 624 a, g dbSNP:752547578
628 628 -, t dbSNP:386834173
629 629 a, g dbSNP:758209255
632 632 a, g dbSNP:548069465
641 641 g, t dbSNP:746904737
645 645 a, g dbSNP:756169550
647 647 c, g dbSNP:780240403
651 651 a, g dbSNP:749347768
655 655 c, t dbSNP:769044434
660 660 c, t dbSNP:774698023
663 663 a, c dbSNP:748524663
666 666 a, t dbSNP:772412589
667 667 a, g, t dbSNP:771099283
667 667 -, g dbSNP:776668853
670 670 a, c dbSNP:766844588
673 673 a, g dbSNP:776168503
676 676 a, g dbSNP:779099559
686 686 a, g dbSNP:555727641
692 692 a, g dbSNP:575761625
694 694 c, t dbSNP:11544132
717 717 a, c, g dbSNP:777844806
718 718 c, t dbSNP:771220137
721 721 a, g dbSNP:368104020
726 726 a, g dbSNP:746322796
732 732 a, g, t dbSNP:769322959
748 748 c, t dbSNP:762347221
751 751 g, t dbSNP:768409429
757 757 c, t dbSNP:773866783
758 758 a, g dbSNP:761701830
763 763 a, c dbSNP:535197788
775 775 c, g dbSNP:773316260
778 778 c, g dbSNP:760738336
793 793 c, t dbSNP:766208696
794 794 g, t dbSNP:752884400
800 800 c, g dbSNP:758403487
805 805 c, g dbSNP:764383277
823 823 a, g dbSNP:386834174
843 843 -, agcccctgggcggccgctgcccccaggccgcctgccacagcgccctcc dbSNP:386834175
851 851 a, g dbSNP:746199829
861 861 g, t dbSNP:386834176
865 865 c, g dbSNP:577843988
872 872 a, g dbSNP:756662668
883 883 c, g dbSNP:780412383
895 895 c, t dbSNP:546245909
902 902 c, t dbSNP:386834177
921 921 a, g dbSNP:386834178
933 933 c, t dbSNP:190222721
935 935 c, g dbSNP:200393580
940 940 a, c, t dbSNP:763110632
941 941 c, t dbSNP:76832951
943 943 c, t dbSNP:368430211
957 957 a, g dbSNP:757507992
958 958 c, t dbSNP:767700967
960 960 a, t dbSNP:372304599
964 964 a, g dbSNP:756429503
965 965 c, t dbSNP:200712130
971 971 c, t dbSNP:765147150
974 974 a, g dbSNP:571160852
988 988 c, t dbSNP:778609113
989 989 a, g dbSNP:146499374
995 995 c, t dbSNP:371426960
998 998 a, g dbSNP:374692212
1001 1001 c, t dbSNP:569327877
1002 1002 c, t dbSNP:746808374
1015 1015 c, g dbSNP:369865835
1042 1042 a, g dbSNP:777586051
1045 1045 a, g dbSNP:746596986
1050 1050 c, t dbSNP:770793845
1055 1055 c, t dbSNP:779650808
1058 1058 c, g dbSNP:745651516
1062 1062 a, g dbSNP:769673963
1064 1064 a, g dbSNP:775398085
1069 1069 c, t dbSNP:373382273
1070 1070 a, g dbSNP:772080788
1075 1075 a, g dbSNP:773444418
1078 1078 a, g dbSNP:760766577
1088 1088 a, g dbSNP:201788173
1103 1103 g, t dbSNP:754215413
1127 1127 c, t dbSNP:759940999
1136 1136 c, g dbSNP:576506616
1137 1137 -, cccg dbSNP:386834179
1149 1149 a, c dbSNP:542237999
1150 1150 c, g dbSNP:753202286
1174 1174 -, cctcggcg dbSNP:386834163
1179 1179 a, g dbSNP:779979824
1180 1180 c, t dbSNP:564548604
1202 1202 a, g dbSNP:749174906
1207 1207 g, t dbSNP:772168700
1216 1216 a, c, g dbSNP:773203683
1225 1225 c, t dbSNP:771126714
1245 1245 a, c dbSNP:776846832
1283 1283 a, g dbSNP:759831593
1297 1297 g, t dbSNP:533317064
1308 1308 c, t dbSNP:776174468
1312 1312 c, t dbSNP:763597496
1315 1315 c, t dbSNP:550072039
1330 1330 a, g dbSNP:565796359
1343 1343 a, g dbSNP:534440441
1399 1399 a, g dbSNP:374163665
1413 1413 -, a dbSNP:386834165
1415 1415 c, t dbSNP:779783437
1419 1419 c, g dbSNP:755801781
1423 1423 a, g dbSNP:765992885
1428 1428 a, g dbSNP:753700673
1429 1429 a, g dbSNP:754703477
1430 1430 c, g dbSNP:778728963
1431 1431 a, g dbSNP:748069971
1432 1432 g, t dbSNP:757315069
1438 1438 c, t dbSNP:781375346
1441 1441 c, g dbSNP:745924078
1444 1444 c, t dbSNP:770195778
1446 1446 c, t dbSNP:780417907
1452 1452 c, t dbSNP:571475027
1458 1458 a, c, t dbSNP:749671617
1461 1461 a, g dbSNP:774742356
1466 1466 a, c dbSNP:199821177
1468 1468 c, t dbSNP:772425937
1472 1472 -, ca dbSNP:767203418
1474 1474 -, ca dbSNP:386834167
1476 1476 g, t dbSNP:772756330
1484 1484 a, g dbSNP:760175392
1485 1485 a, t dbSNP:766026073
1491 1491 c, t dbSNP:753431313
1493 1493 c, g dbSNP:537194008
1498 1498 -, gccggg dbSNP:36040113
1498 1498 c, t dbSNP:765044933
1501 1501 -, gg dbSNP:760255866
1502 1502 a, c, g dbSNP:752407777
1503 1503 a, g dbSNP:777560818
1506 1506 c, t dbSNP:750595450
1508 1508 -, gggccg dbSNP:58093397
1509 1509 a, g dbSNP:370794142
1513 1513 c, g dbSNP:780432490
1520 1520 -, t dbSNP:757909786
1523 1523 -, gc dbSNP:765829662
1524 1524 c, t dbSNP:749468532
1526 1526 -, c dbSNP:750818482
1526 1526 a, g dbSNP:374540627
1527 1527 c, t dbSNP:779374303
1530 1530 c, t dbSNP:573971026
1533 1533 a, g dbSNP:772692254
1536 1536 a, c dbSNP:773644598
1537 1537 a, g dbSNP:376784377
1540 1540 c, g dbSNP:770379932
1544 1544 c, t dbSNP:776298245
1545 1545 c, t dbSNP:759277005
1550 1550 a, c dbSNP:764779782
1552 1552 c, g dbSNP:752598337
1555 1555 c, t dbSNP:762648972
1556 1556 a, g dbSNP:374225790
1560 1560 a, c, g, t dbSNP:1190233
1563 1563 a, c dbSNP:753937288
1566 1566 a, g dbSNP:755274556
1567 1567 c, t dbSNP:778988357
1569 1569 c, t dbSNP:748552065
1574 1574 c, t dbSNP:758633827
1614 1614 c, t dbSNP:555457770
1618 1618 c, t dbSNP:143445979
1622 1622 c, t dbSNP:754508920
1625 1625 c, t dbSNP:34124488
1627 1627 -, c dbSNP:531032661
1637 1637 c, t dbSNP:34293882
1655 1655 c, t dbSNP:7153925
1669 1669 a, g dbSNP:753296465
1679 1679 c, g dbSNP:543606080
1680 1680 c, g dbSNP:563679178

Target ORF information:

RefSeq Version XM_011537202
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens amnion associated transmembrane protein (AMN), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu72975
Accession Version XM_011537203.1
Sequence Information ORF Nucleotide Sequence (Length: 1200bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein amnionless isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_026437.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)697..1878(+)
Position Chain Variation Link
3 3 c, t dbSNP:538102706
10 10 a, g dbSNP:756319589
18 18 -, ggaga dbSNP:753478163
29 29 a, g dbSNP:555185838
36 36 c, g dbSNP:116464826
37 37 c, t dbSNP:540951191
45 45 c, t dbSNP:554473083
54 54 g, t dbSNP:181448681
65 65 c, t dbSNP:545740577
68 68 c, g dbSNP:562492639
86 86 g, t dbSNP:531423591
89 89 c, t dbSNP:777888037
96 96 c, t dbSNP:533063234
114 114 c, t dbSNP:772035824
137 137 a, g dbSNP:561522398
157 157 c, g dbSNP:527453559
182 182 a, c dbSNP:746917213
189 189 a, g dbSNP:568833269
198 198 a, g dbSNP:547303166
278 278 a, c dbSNP:570371519
302 302 a, c, g dbSNP:532404784
322 322 c, t dbSNP:552539421
331 331 c, t dbSNP:75380401
333 333 c, t dbSNP:538315477
346 346 -, taccggg dbSNP:749890948
380 380 c, g dbSNP:555073348
390 390 c, t dbSNP:776421620
399 399 a, g dbSNP:551323999
409 409 c, t dbSNP:568687195
416 416 a, c dbSNP:761439819
434 434 a, g dbSNP:534351595
442 442 c, t dbSNP:566521762
456 456 a, g dbSNP:769560080
475 475 c, t dbSNP:554510158
524 524 c, t dbSNP:577466165
532 532 c, t dbSNP:545524516
559 559 a, g dbSNP:186749942
563 563 a, g dbSNP:373726815
578 578 c, t dbSNP:367718843
579 579 a, c dbSNP:753339887
581 581 a, t dbSNP:754501107
591 591 g, t dbSNP:145328398
592 592 a, g dbSNP:372629049
596 596 c, t dbSNP:202122792
597 597 c, t dbSNP:150802428
608 608 c, t dbSNP:777496622
609 609 a, c, t dbSNP:746997257
613 613 a, c dbSNP:781165782
615 615 c, g, t dbSNP:554401493
625 625 a, g dbSNP:774714587
626 626 a, g dbSNP:762065641
627 627 c, t dbSNP:772599857
630 630 c, t dbSNP:773494418
642 642 c, g dbSNP:199835580
644 644 a, g dbSNP:200648108
651 651 c, t dbSNP:777192314
653 653 a, c, g dbSNP:759053400
656 656 c, t dbSNP:119478058
657 657 c, g dbSNP:758005290
663 663 c, t dbSNP:763705322
664 664 a, g dbSNP:138106067
666 666 -, cgg dbSNP:759251270
667 667 a, g dbSNP:757059886
670 670 a, g dbSNP:540101140
674 674 c, t dbSNP:373815557
675 675 a, c, t dbSNP:755118412
676 676 a, g dbSNP:748210579
683 683 g, t dbSNP:772475317
684 684 c, g dbSNP:773472640
686 686 c, t dbSNP:747402473
687 687 a, c, g dbSNP:771262042
690 690 a, g dbSNP:759987455
699 699 a, g dbSNP:61731158
708 708 c, g dbSNP:749734745
709 709 c, t dbSNP:199629027
714 714 c, g dbSNP:773867275
724 724 c, t dbSNP:144729558
726 726 c, t dbSNP:771819877
730 730 a, g dbSNP:772996972
731 731 c, t dbSNP:371713937
739 739 a, g dbSNP:766219642
740 740 c, t dbSNP:375774640
741 741 a, g dbSNP:759479529
744 744 c, t dbSNP:750661806
749 749 c, t dbSNP:756286731
753 753 a, g dbSNP:568797057
754 754 a, g dbSNP:766554192
763 763 c, t dbSNP:534527113
766 766 a, c, g dbSNP:754290581
780 780 a, g dbSNP:779483487
783 783 c, g dbSNP:748549145
784 784 a, g dbSNP:758005644
797 797 c, t dbSNP:777378282
798 798 a, g dbSNP:746489250
801 801 -, c dbSNP:754351074
809 809 c, t dbSNP:144707331
810 810 a, g dbSNP:774609969
815 815 c, t dbSNP:576779161
816 816 a, g dbSNP:148513667
824 824 a, g dbSNP:769407881
825 825 a, c, t dbSNP:775510849
828 828 a, g, t dbSNP:767611074
829 829 -, g dbSNP:386834171
831 831 a, c dbSNP:552595670
833 833 -, a dbSNP:747140475
835 835 c, t dbSNP:780518726
838 838 a, g dbSNP:372620819
839 839 a, c dbSNP:755757921
840 840 a, c, g dbSNP:779731533
841 841 a, g dbSNP:768376089
846 846 a, c dbSNP:778838482
855 855 c, t dbSNP:563004567
857 857 a, c dbSNP:771078036
858 858 c, t dbSNP:7140429
866 866 c, t dbSNP:375355075
868 868 a, t dbSNP:769969461
870 870 c, g dbSNP:775778646
874 874 a, g dbSNP:763413999
875 875 a, g dbSNP:764493431
876 876 a, c dbSNP:752135124
877 877 c, t dbSNP:762369943
878 878 a, c dbSNP:548672909
879 879 a, g dbSNP:749947054
885 885 c, g dbSNP:151031511
890 890 c, g, t dbSNP:533436439
897 897 a, g dbSNP:141455061
901 901 a, g dbSNP:778644293
904 904 a, g dbSNP:1134469
913 913 c, t dbSNP:747908131
929 929 c, t dbSNP:778640033
934 934 c, t dbSNP:758317090
937 937 a, c, g dbSNP:777755176
946 946 c, t dbSNP:769843598
947 947 c, g dbSNP:568801729
960 960 -, ttctttccg dbSNP:768565737
962 962 g, t dbSNP:775867545
970 970 a, c, t dbSNP:749472402
981 981 c, t dbSNP:199873929
986 986 a, c, g dbSNP:774892250
988 988 a, c, g, t dbSNP:201055900
989 989 c, t dbSNP:765866977
990 990 a, g dbSNP:753523412
996 996 c, t dbSNP:754669033
997 997 c, g dbSNP:764848388
998 998 a, g dbSNP:752547578
1002 1002 -, t dbSNP:386834173
1003 1003 a, g dbSNP:758209255
1006 1006 a, g dbSNP:548069465
1015 1015 g, t dbSNP:746904737
1019 1019 a, g dbSNP:756169550
1021 1021 c, g dbSNP:780240403
1025 1025 a, g dbSNP:749347768
1029 1029 c, t dbSNP:769044434
1034 1034 c, t dbSNP:774698023
1037 1037 a, c dbSNP:748524663
1040 1040 a, t dbSNP:772412589
1041 1041 a, g, t dbSNP:771099283
1041 1041 -, g dbSNP:776668853
1044 1044 a, c dbSNP:766844588
1047 1047 a, g dbSNP:776168503
1050 1050 a, g dbSNP:779099559
1060 1060 a, g dbSNP:555727641
1066 1066 a, g dbSNP:575761625
1068 1068 c, t dbSNP:11544132
1091 1091 a, c, g dbSNP:777844806
1092 1092 c, t dbSNP:771220137
1095 1095 a, g dbSNP:368104020
1100 1100 a, g dbSNP:746322796
1106 1106 a, g, t dbSNP:769322959
1122 1122 c, t dbSNP:762347221
1125 1125 g, t dbSNP:768409429
1131 1131 c, t dbSNP:773866783
1132 1132 a, g dbSNP:761701830
1137 1137 a, c dbSNP:535197788
1149 1149 c, g dbSNP:773316260
1152 1152 c, g dbSNP:760738336
1167 1167 c, t dbSNP:766208696
1168 1168 g, t dbSNP:752884400
1174 1174 c, g dbSNP:758403487
1179 1179 c, g dbSNP:764383277
1197 1197 a, g dbSNP:386834174
1217 1217 -, agcccctgggcggccgctgcccccaggccgcctgccacagcgccctcc dbSNP:386834175
1225 1225 a, g dbSNP:746199829
1235 1235 g, t dbSNP:386834176
1239 1239 c, g dbSNP:577843988
1246 1246 a, g dbSNP:756662668
1257 1257 c, g dbSNP:780412383
1269 1269 c, t dbSNP:546245909
1276 1276 c, t dbSNP:386834177
1295 1295 a, g dbSNP:386834178
1307 1307 c, t dbSNP:190222721
1309 1309 c, g dbSNP:200393580
1314 1314 a, c, t dbSNP:763110632
1315 1315 c, t dbSNP:76832951
1317 1317 c, t dbSNP:368430211
1331 1331 a, g dbSNP:757507992
1332 1332 c, t dbSNP:767700967
1334 1334 a, t dbSNP:372304599
1338 1338 a, g dbSNP:756429503
1339 1339 c, t dbSNP:200712130
1345 1345 c, t dbSNP:765147150
1348 1348 a, g dbSNP:571160852
1362 1362 c, t dbSNP:778609113
1363 1363 a, g dbSNP:146499374
1369 1369 c, t dbSNP:371426960
1372 1372 a, g dbSNP:374692212
1375 1375 c, t dbSNP:569327877
1376 1376 c, t dbSNP:746808374
1389 1389 c, g dbSNP:369865835
1416 1416 a, g dbSNP:777586051
1419 1419 a, g dbSNP:746596986
1424 1424 c, t dbSNP:770793845
1429 1429 c, t dbSNP:779650808
1432 1432 c, g dbSNP:745651516
1436 1436 a, g dbSNP:769673963
1438 1438 a, g dbSNP:775398085
1443 1443 c, t dbSNP:373382273
1444 1444 a, g dbSNP:772080788
1449 1449 a, g dbSNP:773444418
1452 1452 a, g dbSNP:760766577
1462 1462 a, g dbSNP:201788173
1477 1477 g, t dbSNP:754215413
1501 1501 c, t dbSNP:759940999
1510 1510 c, g dbSNP:576506616
1511 1511 -, cccg dbSNP:386834179
1523 1523 a, c dbSNP:542237999
1524 1524 c, g dbSNP:753202286
1548 1548 -, cctcggcg dbSNP:386834163
1553 1553 a, g dbSNP:779979824
1554 1554 c, t dbSNP:564548604
1576 1576 a, g dbSNP:749174906
1581 1581 g, t dbSNP:772168700
1590 1590 a, c, g dbSNP:773203683
1599 1599 c, t dbSNP:771126714
1619 1619 a, c dbSNP:776846832
1657 1657 a, g dbSNP:759831593
1671 1671 g, t dbSNP:533317064
1682 1682 c, t dbSNP:776174468
1686 1686 c, t dbSNP:763597496
1689 1689 c, t dbSNP:550072039
1704 1704 a, g dbSNP:565796359
1717 1717 a, g dbSNP:534440441
1773 1773 a, g dbSNP:374163665
1787 1787 -, a dbSNP:386834165
1789 1789 c, t dbSNP:779783437
1793 1793 c, g dbSNP:755801781
1797 1797 a, g dbSNP:765992885
1802 1802 a, g dbSNP:753700673
1803 1803 a, g dbSNP:754703477
1804 1804 c, g dbSNP:778728963
1805 1805 a, g dbSNP:748069971
1806 1806 g, t dbSNP:757315069
1812 1812 c, t dbSNP:781375346
1815 1815 c, g dbSNP:745924078
1818 1818 c, t dbSNP:770195778
1820 1820 c, t dbSNP:780417907
1826 1826 c, t dbSNP:571475027
1832 1832 a, c, t dbSNP:749671617
1835 1835 a, g dbSNP:774742356
1840 1840 a, c dbSNP:199821177
1842 1842 c, t dbSNP:772425937
1846 1846 -, ca dbSNP:767203418
1848 1848 -, ca dbSNP:386834167
1850 1850 g, t dbSNP:772756330
1858 1858 a, g dbSNP:760175392
1859 1859 a, t dbSNP:766026073
1865 1865 c, t dbSNP:753431313
1867 1867 c, g dbSNP:537194008
1872 1872 -, gccggg dbSNP:36040113
1872 1872 c, t dbSNP:765044933
1875 1875 -, gg dbSNP:760255866
1876 1876 a, c, g dbSNP:752407777
1877 1877 a, g dbSNP:777560818
1880 1880 c, t dbSNP:750595450
1882 1882 -, gggccg dbSNP:58093397
1883 1883 a, g dbSNP:370794142
1887 1887 c, g dbSNP:780432490
1894 1894 -, t dbSNP:757909786
1897 1897 -, gc dbSNP:765829662
1898 1898 c, t dbSNP:749468532
1900 1900 -, c dbSNP:750818482
1900 1900 a, g dbSNP:374540627
1901 1901 c, t dbSNP:779374303
1904 1904 c, t dbSNP:573971026
1907 1907 a, g dbSNP:772692254
1910 1910 a, c dbSNP:773644598
1911 1911 a, g dbSNP:376784377
1914 1914 c, g dbSNP:770379932
1918 1918 c, t dbSNP:776298245
1919 1919 c, t dbSNP:759277005
1924 1924 a, c dbSNP:764779782
1926 1926 c, g dbSNP:752598337
1929 1929 c, t dbSNP:762648972
1930 1930 a, g dbSNP:374225790
1934 1934 a, c, g, t dbSNP:1190233
1937 1937 a, c dbSNP:753937288
1940 1940 a, g dbSNP:755274556
1941 1941 c, t dbSNP:778988357
1943 1943 c, t dbSNP:748552065
1948 1948 c, t dbSNP:758633827
1988 1988 c, t dbSNP:555457770
1992 1992 c, t dbSNP:143445979
1996 1996 c, t dbSNP:754508920
1999 1999 c, t dbSNP:34124488
2001 2001 -, c dbSNP:531032661
2011 2011 c, t dbSNP:34293882
2029 2029 c, t dbSNP:7153925
2043 2043 a, g dbSNP:753296465
2053 2053 c, g dbSNP:543606080
2054 2054 c, g dbSNP:563679178

Target ORF information:

RefSeq Version XM_011537203
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens amnion associated transmembrane protein (AMN), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18098
Accession Version NM_030943.3
Sequence Information ORF Nucleotide Sequence (Length: 1362bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein amnionless precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC029948.1, AF328788.1, AL117209.7 and CB306421.1. This sequence is a reference standard in the RefSeqGene project. On May 28, 2008 this sequence version replaced gi:110611171. Summary: The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF328788.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1970526 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)97..1377(+)
Misc Feature(2)1105..1167(+)
Exon (1)1..76
Gene Synonym:
Exon (2)77..195
Gene Synonym:
Exon (3)196..240
Gene Synonym:
Exon (4)241..328
Gene Synonym:
Exon (5)329..546
Gene Synonym:
Exon (6)547..684
Gene Synonym:
Exon (7)685..793
Gene Synonym:
Exon (8)794..876
Gene Synonym:
Exon (9)877..1039
Gene Synonym:
Exon (10)1040..1202
Gene Synonym:
Exon (11)1203..1290
Gene Synonym:
Exon (12)1291..1557
Gene Synonym:
Position Chain Variation Link
1 1 a, g dbSNP:768328215
5 5 -, c dbSNP:772396092
7 7 a, c, g, t dbSNP:2295828
8 8 g, t dbSNP:776734357
10 10 c, t dbSNP:759591055
11 11 c, g, t dbSNP:2295829
15 15 -, tgc dbSNP:775709395
24 24 c, t dbSNP:758794765
26 26 a, g dbSNP:764306556
28 28 a, g dbSNP:376932320
29 29 a, g dbSNP:752133468
30 30 a, c, t dbSNP:757797348
39 39 c, t dbSNP:745417738
45 45 -, g dbSNP:746999720
47 47 a, g dbSNP:755562339
47 47 -, g dbSNP:386834168
49 49 c, g dbSNP:561570970
51 51 c, g, t dbSNP:200460988
54 54 a, c, t dbSNP:768522233
68 68 -, a dbSNP:769770182
75 75 c, t dbSNP:747910380
77 77 c, t dbSNP:367718843
78 78 a, c dbSNP:753339887
80 80 a, t dbSNP:754501107
90 90 g, t dbSNP:145328398
91 91 a, g dbSNP:372629049
95 95 c, t dbSNP:202122792
96 96 c, t dbSNP:150802428
107 107 c, t dbSNP:777496622
108 108 a, c, t dbSNP:746997257
112 112 a, c dbSNP:781165782
114 114 c, g, t dbSNP:554401493
124 124 a, g dbSNP:774714587
125 125 a, g dbSNP:762065641
126 126 c, t dbSNP:772599857
129 129 c, t dbSNP:773494418
141 141 c, g dbSNP:199835580
143 143 a, g dbSNP:200648108
150 150 c, t dbSNP:777192314
152 152 a, c, g dbSNP:759053400
155 155 c, t dbSNP:119478058
156 156 c, g dbSNP:758005290
162 162 c, t dbSNP:763705322
163 163 a, g dbSNP:138106067
165 165 -, cgg dbSNP:759251270
166 166 a, g dbSNP:757059886
169 169 a, g dbSNP:540101140
173 173 c, t dbSNP:373815557
174 174 a, c, t dbSNP:755118412
175 175 a, g dbSNP:748210579
182 182 g, t dbSNP:772475317
183 183 c, g dbSNP:773472640
185 185 c, t dbSNP:747402473
186 186 a, c, g dbSNP:771262042
189 189 a, g dbSNP:759987455
198 198 a, g dbSNP:61731158
207 207 c, g dbSNP:749734745
208 208 c, t dbSNP:199629027
213 213 c, g dbSNP:773867275
223 223 c, t dbSNP:144729558
225 225 c, t dbSNP:771819877
229 229 a, g dbSNP:772996972
230 230 c, t dbSNP:371713937
238 238 a, g dbSNP:766219642
239 239 c, t dbSNP:375774640
240 240 a, g dbSNP:759479529
243 243 c, t dbSNP:750661806
248 248 c, t dbSNP:756286731
252 252 a, g dbSNP:568797057
253 253 a, g dbSNP:766554192
262 262 c, t dbSNP:534527113
265 265 a, c, g dbSNP:754290581
279 279 a, g dbSNP:779483487
282 282 c, g dbSNP:748549145
283 283 a, g dbSNP:758005644
296 296 c, t dbSNP:777378282
297 297 a, g dbSNP:746489250
300 300 -, c dbSNP:754351074
308 308 c, t dbSNP:144707331
309 309 a, g dbSNP:774609969
314 314 c, t dbSNP:576779161
315 315 a, g dbSNP:148513667
323 323 a, g dbSNP:769407881
324 324 a, c, t dbSNP:775510849
327 327 a, g, t dbSNP:767611074
328 328 -, g dbSNP:386834171
330 330 a, c dbSNP:552595670
332 332 -, a dbSNP:747140475
334 334 c, t dbSNP:780518726
337 337 a, g dbSNP:372620819
338 338 a, c dbSNP:755757921
339 339 a, c, g dbSNP:779731533
340 340 a, g dbSNP:768376089
345 345 a, c dbSNP:778838482
354 354 c, t dbSNP:563004567
356 356 a, c dbSNP:771078036
357 357 c, t dbSNP:7140429
365 365 c, t dbSNP:375355075
367 367 a, t dbSNP:769969461
369 369 c, g dbSNP:775778646
373 373 a, g dbSNP:763413999
374 374 a, g dbSNP:764493431
375 375 a, c dbSNP:752135124
376 376 c, t dbSNP:762369943
377 377 a, c dbSNP:548672909
378 378 a, g dbSNP:749947054
384 384 c, g dbSNP:151031511
389 389 c, g, t dbSNP:533436439
396 396 a, g dbSNP:141455061
400 400 a, g dbSNP:778644293
403 403 a, g dbSNP:1134469
412 412 c, t dbSNP:747908131
428 428 c, t dbSNP:778640033
433 433 c, t dbSNP:758317090
436 436 a, c, g dbSNP:777755176
445 445 c, t dbSNP:769843598
446 446 c, g dbSNP:568801729
459 459 -, ttctttccg dbSNP:768565737
461 461 g, t dbSNP:775867545
469 469 a, c, t dbSNP:749472402
480 480 c, t dbSNP:199873929
485 485 a, c, g dbSNP:774892250
487 487 a, c, g, t dbSNP:201055900
488 488 c, t dbSNP:765866977
489 489 a, g dbSNP:753523412
495 495 c, t dbSNP:754669033
496 496 c, g dbSNP:764848388
497 497 a, g dbSNP:752547578
501 501 -, t dbSNP:386834173
502 502 a, g dbSNP:758209255
505 505 a, g dbSNP:548069465
514 514 g, t dbSNP:746904737
518 518 a, g dbSNP:756169550
520 520 c, g dbSNP:780240403
524 524 a, g dbSNP:749347768
528 528 c, t dbSNP:769044434
533 533 c, t dbSNP:774698023
536 536 a, c dbSNP:748524663
539 539 a, t dbSNP:772412589
540 540 a, g, t dbSNP:771099283
540 540 -, g dbSNP:776668853
543 543 a, c dbSNP:766844588
546 546 a, g dbSNP:776168503
549 549 a, g dbSNP:779099559
559 559 a, g dbSNP:555727641
565 565 a, g dbSNP:575761625
567 567 c, t dbSNP:11544132
590 590 a, c, g dbSNP:777844806
591 591 c, t dbSNP:771220137
594 594 a, g dbSNP:368104020
599 599 a, g dbSNP:746322796
605 605 a, g, t dbSNP:769322959
621 621 c, t dbSNP:762347221
624 624 g, t dbSNP:768409429
630 630 c, t dbSNP:773866783
631 631 a, g dbSNP:761701830
636 636 a, c dbSNP:535197788
648 648 c, g dbSNP:773316260
651 651 c, g dbSNP:760738336
666 666 c, t dbSNP:766208696
667 667 g, t dbSNP:752884400
673 673 c, g dbSNP:758403487
678 678 c, g dbSNP:764383277
696 696 a, g dbSNP:386834174
716 716 -, agcccctgggcggccgctgcccccaggccgcctgccacagcgccctcc dbSNP:386834175
724 724 a, g dbSNP:746199829
734 734 g, t dbSNP:386834176
738 738 c, g dbSNP:577843988
745 745 a, g dbSNP:756662668
756 756 c, g dbSNP:780412383
768 768 c, t dbSNP:546245909
775 775 c, t dbSNP:386834177
794 794 a, g dbSNP:386834178
806 806 c, t dbSNP:190222721
808 808 c, g dbSNP:200393580
813 813 a, c, t dbSNP:763110632
814 814 c, t dbSNP:76832951
816 816 c, t dbSNP:368430211
830 830 a, g dbSNP:757507992
831 831 c, t dbSNP:767700967
833 833 a, t dbSNP:372304599
837 837 a, g dbSNP:756429503
838 838 c, t dbSNP:200712130
844 844 c, t dbSNP:765147150
847 847 a, g dbSNP:571160852
861 861 c, t dbSNP:778609113
862 862 a, g dbSNP:146499374
868 868 c, t dbSNP:371426960
871 871 a, g dbSNP:374692212
874 874 c, t dbSNP:569327877
875 875 c, t dbSNP:746808374
888 888 c, g dbSNP:369865835
915 915 a, g dbSNP:777586051
918 918 a, g dbSNP:746596986
923 923 c, t dbSNP:770793845
928 928 c, t dbSNP:779650808
931 931 c, g dbSNP:745651516
935 935 a, g dbSNP:769673963
937 937 a, g dbSNP:775398085
942 942 c, t dbSNP:373382273
943 943 a, g dbSNP:772080788
948 948 a, g dbSNP:773444418
951 951 a, g dbSNP:760766577
961 961 a, g dbSNP:201788173
976 976 g, t dbSNP:754215413
1000 1000 c, t dbSNP:759940999
1009 1009 c, g dbSNP:576506616
1010 1010 -, cccg dbSNP:386834179
1022 1022 a, c dbSNP:542237999
1023 1023 c, g dbSNP:753202286
1047 1047 -, cctcggcg dbSNP:386834163
1052 1052 a, g dbSNP:779979824
1053 1053 c, t dbSNP:564548604
1075 1075 a, g dbSNP:749174906
1080 1080 g, t dbSNP:772168700
1089 1089 a, c, g dbSNP:773203683
1098 1098 c, t dbSNP:771126714
1118 1118 a, c dbSNP:776846832
1156 1156 a, g dbSNP:759831593
1170 1170 g, t dbSNP:533317064
1181 1181 c, t dbSNP:776174468
1185 1185 c, t dbSNP:763597496
1188 1188 c, t dbSNP:550072039
1203 1203 a, g dbSNP:565796359
1216 1216 a, g dbSNP:534440441
1272 1272 a, g dbSNP:374163665
1286 1286 -, a dbSNP:386834165
1288 1288 c, t dbSNP:779783437
1292 1292 c, g dbSNP:755801781
1296 1296 a, g dbSNP:765992885
1301 1301 a, g dbSNP:753700673
1302 1302 a, g dbSNP:754703477
1303 1303 c, g dbSNP:778728963
1304 1304 a, g dbSNP:748069971
1305 1305 g, t dbSNP:757315069
1311 1311 c, t dbSNP:781375346
1314 1314 c, g dbSNP:745924078
1317 1317 c, t dbSNP:770195778
1319 1319 c, t dbSNP:780417907
1325 1325 c, t dbSNP:571475027
1331 1331 a, c, t dbSNP:749671617
1334 1334 a, g dbSNP:774742356
1339 1339 a, c dbSNP:199821177
1341 1341 c, t dbSNP:772425937
1345 1345 -, ca dbSNP:767203418
1347 1347 -, ca dbSNP:386834167
1349 1349 g, t dbSNP:772756330
1357 1357 a, g dbSNP:760175392
1358 1358 a, t dbSNP:766026073
1364 1364 c, t dbSNP:753431313
1366 1366 c, g dbSNP:537194008
1371 1371 -, gccggg dbSNP:36040113
1371 1371 c, t dbSNP:765044933
1374 1374 -, gg dbSNP:760255866
1375 1375 a, c, g dbSNP:752407777
1376 1376 a, g dbSNP:777560818
1379 1379 c, t dbSNP:750595450
1381 1381 -, gggccg dbSNP:58093397
1382 1382 a, g dbSNP:370794142
1386 1386 c, g dbSNP:780432490
1393 1393 -, t dbSNP:757909786
1396 1396 -, gc dbSNP:765829662
1397 1397 c, t dbSNP:749468532
1399 1399 -, c dbSNP:750818482
1399 1399 a, g dbSNP:374540627
1400 1400 c, t dbSNP:779374303
1403 1403 c, t dbSNP:573971026
1406 1406 a, g dbSNP:772692254
1409 1409 a, c dbSNP:773644598
1410 1410 a, g dbSNP:376784377
1413 1413 c, g dbSNP:770379932
1417 1417 c, t dbSNP:776298245
1418 1418 c, t dbSNP:759277005
1423 1423 a, c dbSNP:764779782
1425 1425 c, g dbSNP:752598337
1428 1428 c, t dbSNP:762648972
1429 1429 a, g dbSNP:374225790
1433 1433 a, c, g, t dbSNP:1190233
1436 1436 a, c dbSNP:753937288
1439 1439 a, g dbSNP:755274556
1440 1440 c, t dbSNP:778988357
1442 1442 c, t dbSNP:748552065
1447 1447 c, t dbSNP:758633827
1487 1487 c, t dbSNP:555457770
1491 1491 c, t dbSNP:143445979
1495 1495 c, t dbSNP:754508920
1498 1498 c, t dbSNP:34124488
1500 1500 -, c dbSNP:531032661
1510 1510 c, t dbSNP:34293882
1528 1528 c, t dbSNP:7153925
1542 1542 a, g dbSNP:753296465
1552 1552 c, g dbSNP:543606080
1553 1553 c, g dbSNP:563679178

Target ORF information:

RefSeq Version NM_030943
Organism Homo sapiens (human)
Definition Homo sapiens amnion associated transmembrane protein (AMN), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.