
MADCAM1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MADCAM1
Entrez Gene ID 8174
Full Name mucosal vascular addressin cell adhesion molecule 1
Synonyms MACAM1
General protein information
Preferred Names
mucosal addressin cell adhesion molecule 1
mucosal addressin cell adhesion molecule 1
mucosal addressin cell adhesion molecule-1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_130762 NP_570118 mucosal addressin cell adhesion molecule 1 isoform b precursor
NM_130760 NP_570116 mucosal addressin cell adhesion molecule 1 isoform a precursor

hsa04514 Cell adhesion molecules (CAMs)
hsa04672 Intestinal immune network for IgA production
R-HSA-1280218 Adaptive Immune System
R-HSA-168256 Immune System
R-HSA-198933 Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
R-HSA-1474244 Extracellular matrix organization
R-HSA-216083 Integrin cell surface interactions
Pathway Interaction Database
a4b1_paxindep_pathway Paxillin-independent events mediated by a4b1 and a4b7


ID Name Evidence
GO:0005624 membrane fraction TAS
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane TAS
GO:0016021 integral to membrane IEA


ID Name Evidence
GO:0002687 positive regulation of leukocyte migration IEA
GO:0006955 immune response TAS
GO:0007155 cell adhesion IEA
GO:0007165 signal transduction TAS
GO:0007568 aging IEA
GO:0009790 embryo development IEA
GO:0030216 keratinocyte differentiation IEA
GO:0050776 regulation of immune response TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following MADCAM1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MADCAM1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu13360 NM_130762 Homo sapiens mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $309.00
OHu13301 NM_130760 Homo sapiens mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu13360
Accession Version NM_130762.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 888bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mucosal addressin cell adhesion molecule 1 isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U82483.1 and AY732484.1. On Jun 23, 2006 this sequence version replaced gi:18780284. Summary: The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b) that lacks an internal segment, compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC137506.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2146236, SAMEA2152568 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)92..337(+)
Misc Feature(2)107..343(+)
Misc Feature(3)347..676(+)
Exon (1)1..62
Gene Synonym:
Exon (2)63..347
Gene Synonym:
Exon (3)348..677
Gene Synonym:
Exon (4)678..1276
Gene Synonym:
Position Chain Variation Link
1 1 a, g dbSNP:759620163
7 7 a, g dbSNP:199659954
8 8 a, t dbSNP:752632106
14 14 a, c, g dbSNP:372974358
22 22 a, g dbSNP:764132233
23 23 a, c dbSNP:751309255
27 27 c, g dbSNP:757135454
38 38 a, g dbSNP:767023684
39 39 c, t dbSNP:377335633
40 40 a, g dbSNP:755585246
41 41 a, g dbSNP:201757601
43 43 a, g dbSNP:78668504
44 44 c, t dbSNP:758823933
49 49 a, g dbSNP:547485879
52 52 c, g dbSNP:747277662
59 59 c, g dbSNP:771329651
61 61 c, t dbSNP:776952557
137 137 c, t dbSNP:754527343
152 152 c, t dbSNP:778072743
165 165 a, c dbSNP:747581207
171 171 a, g dbSNP:757513312
183 183 c, t dbSNP:551345933
232 232 a, g dbSNP:563094555
245 245 a, c dbSNP:371474343
269 269 g, t dbSNP:530532155
283 283 c, g dbSNP:775914533
296 296 a, g dbSNP:549386086
328 328 c, t dbSNP:768787949
347 347 c, g dbSNP:758291598
356 356 -, gaccagct dbSNP:779900606
356 356 a, g dbSNP:764825328
358 358 c, g dbSNP:752197327
361 361 c, g dbSNP:757807645
364 364 c, g dbSNP:141044612
367 367 c, t dbSNP:750806172
372 372 c, t dbSNP:756563113
373 373 c, t dbSNP:780359017
376 376 a, c, g dbSNP:2302217
378 378 a, c dbSNP:779031918
399 399 c, t dbSNP:748238656
400 400 a, g dbSNP:771980595
408 408 c, t dbSNP:559623813
414 414 c, t dbSNP:760393977
415 415 a, g dbSNP:770741923
422 422 a, c dbSNP:776097995
423 423 a, g dbSNP:759203602
428 428 a, g dbSNP:764837360
430 430 c, g dbSNP:752248540
434 434 a, c, g dbSNP:762610866
437 437 c, g dbSNP:750971521
445 445 c, t dbSNP:147512432
448 448 a, g dbSNP:780492786
451 451 a, c dbSNP:369752923
454 454 -, ctt dbSNP:749060577
455 455 -, t dbSNP:768448687
466 466 c, t dbSNP:766903194
467 467 a, g dbSNP:755200816
470 470 a, g dbSNP:779058035
479 479 g, t dbSNP:199633806
491 491 a, g, t dbSNP:376416942
499 499 c, t dbSNP:777645903
500 500 a, c dbSNP:746970003
507 507 a, c dbSNP:770903296
516 516 -, agg dbSNP:774030325
518 518 c, g dbSNP:756671531
521 521 a, g dbSNP:776454553
530 530 a, g dbSNP:745716714
540 540 a, g dbSNP:202046094
548 548 a, g dbSNP:775020396
569 569 c, g dbSNP:762488496
570 570 a, c dbSNP:535573500
573 573 -, gct dbSNP:761745513
573 573 a, g dbSNP:773809049
581 581 c, t dbSNP:112593523
590 590 c, t dbSNP:761245758
599 599 c, t dbSNP:764642481
602 602 c, g dbSNP:754213054
606 606 c, t dbSNP:754263027
607 607 a, c, g dbSNP:765430520
634 634 a, g dbSNP:200570068
673 673 c, t dbSNP:2302218
677 677 a, g dbSNP:551406626
678 678 c, t dbSNP:199507986
679 679 a, g dbSNP:140417103
688 688 c, t dbSNP:780204137
690 690 c, t dbSNP:145604202
691 691 a, g dbSNP:755021998
693 693 a, g dbSNP:778769332
706 706 c, g, t dbSNP:748049978
707 707 a, g dbSNP:138020018
708 708 a, c, t dbSNP:374689202
709 709 a, g, t dbSNP:770550961
720 720 a, c dbSNP:754764277
721 721 c, g dbSNP:759037630
723 723 a, g dbSNP:372736157
727 727 c, t dbSNP:775180241
729 729 c, t dbSNP:149092655
730 730 a, g dbSNP:138718378
732 732 a, t dbSNP:750794834
746 746 c, t dbSNP:756437236
749 749 c, t dbSNP:766563350
755 755 g, t dbSNP:754025424
756 756 c, t dbSNP:755007127
757 757 a, g dbSNP:778945114
758 758 a, c dbSNP:748289153
762 762 -, g dbSNP:758064459
763 763 a, c, g, t dbSNP:7246543
780 780 a, g dbSNP:373464736
782 782 c, t dbSNP:776308081
785 785 c, t dbSNP:745478436
786 786 a, g, t dbSNP:141825568
790 790 c, g, t dbSNP:199656590
795 795 c, t dbSNP:149388006
796 796 c, t dbSNP:773603021
802 802 c, g, t dbSNP:147245939
803 803 a, g dbSNP:139304491
813 813 c, t dbSNP:201733673
822 822 c, t dbSNP:759745925
840 840 a, g dbSNP:765512380
842 842 a, c, g dbSNP:752710973
844 844 a, g, t dbSNP:777718695
846 846 c, t dbSNP:757260089
847 847 a, g dbSNP:143314648
853 853 c, g dbSNP:147543851
854 854 a, g, t dbSNP:565184057
857 857 a, g dbSNP:371476209
858 858 a, g dbSNP:768298980
862 862 a, g dbSNP:773726132
871 871 c, t dbSNP:139350636
872 872 a, g dbSNP:532346585
876 876 a, g dbSNP:776857920
878 878 a, g dbSNP:550472975
880 880 c, t dbSNP:765389123
881 881 a, g dbSNP:150040042
894 894 c, g dbSNP:762979960
895 895 c, t dbSNP:374750697
900 900 a, t dbSNP:751707863
901 901 a, g dbSNP:368846611
907 907 c, g, t dbSNP:529852754
912 912 c, t dbSNP:547863186
913 913 c, t dbSNP:779800333
917 917 g, t dbSNP:748977050
927 927 a, c dbSNP:768393049
930 930 c, g, t dbSNP:778276933
943 943 c, t dbSNP:771280019
948 948 g, t dbSNP:371067068
949 949 g, t dbSNP:777139660
957 957 a, t dbSNP:576214537
963 963 a, g dbSNP:192760680
997 997 c, t dbSNP:558308475
1004 1004 c, t dbSNP:1140823
1013 1013 a, g dbSNP:538493090
1043 1043 c, g dbSNP:184776902
1085 1085 a, c dbSNP:771428543
1087 1087 -, a dbSNP:746951141
1122 1122 a, c dbSNP:575052938
1143 1143 a, g dbSNP:774796539
1195 1195 a, g dbSNP:11543148
1220 1220 g, t dbSNP:542477240
1221 1221 c, g dbSNP:554217450
1230 1230 a, c dbSNP:572497165
1233 1233 c, t dbSNP:80251772
1254 1254 c, t dbSNP:746257311
1274 1274 a, g dbSNP:772464119

Target ORF information:

RefSeq Version NM_130762
Organism Homo sapiens (human)
Definition Homo sapiens mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu13301
Accession Version NM_130760.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1149bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mucosal addressin cell adhesion molecule 1 isoform a precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U82483.1, U43628.1 and DB323303.1. On or before Jun 23, 2006 this sequence version replaced gi:18780280, gi:18780276. Summary: The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) is the longer, predominant transcript and encodes the longer isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U82483.1, AY819760.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA2142348 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)86..337(+)
Misc Feature(2)107..343(+)
Misc Feature(3)347..682(+)
Misc Feature(4)704..823(+)
Misc Feature(5)962..1024(+)
Exon (1)1..62
Gene Synonym:
Exon (2)63..347
Gene Synonym:
Exon (3)348..677
Gene Synonym:
Exon (4)678..938
Gene Synonym:
Exon (5)939..1537
Gene Synonym:
Position Chain Variation Link
1 1 a, g dbSNP:759620163
7 7 a, g dbSNP:199659954
8 8 a, t dbSNP:752632106
14 14 a, c, g dbSNP:372974358
22 22 a, g dbSNP:764132233
23 23 a, c dbSNP:751309255
27 27 c, g dbSNP:757135454
38 38 a, g dbSNP:767023684
39 39 c, t dbSNP:377335633
40 40 a, g dbSNP:755585246
41 41 a, g dbSNP:201757601
43 43 a, g dbSNP:78668504
44 44 c, t dbSNP:758823933
49 49 a, g dbSNP:547485879
52 52 c, g dbSNP:747277662
59 59 c, g dbSNP:771329651
61 61 c, t dbSNP:776952557
137 137 c, t dbSNP:754527343
152 152 c, t dbSNP:778072743
165 165 a, c dbSNP:747581207
171 171 a, g dbSNP:757513312
183 183 c, t dbSNP:551345933
232 232 a, g dbSNP:563094555
245 245 a, c dbSNP:371474343
269 269 g, t dbSNP:530532155
283 283 c, g dbSNP:775914533
296 296 a, g dbSNP:549386086
328 328 c, t dbSNP:768787949
347 347 c, g dbSNP:758291598
356 356 -, gaccagct dbSNP:779900606
356 356 a, g dbSNP:764825328
358 358 c, g dbSNP:752197327
361 361 c, g dbSNP:757807645
364 364 c, g dbSNP:141044612
367 367 c, t dbSNP:750806172
372 372 c, t dbSNP:756563113
373 373 c, t dbSNP:780359017
376 376 a, c, g dbSNP:2302217
378 378 a, c dbSNP:779031918
399 399 c, t dbSNP:748238656
400 400 a, g dbSNP:771980595
408 408 c, t dbSNP:559623813
414 414 c, t dbSNP:760393977
415 415 a, g dbSNP:770741923
422 422 a, c dbSNP:776097995
423 423 a, g dbSNP:759203602
428 428 a, g dbSNP:764837360
430 430 c, g dbSNP:752248540
434 434 a, c, g dbSNP:762610866
437 437 c, g dbSNP:750971521
445 445 c, t dbSNP:147512432
448 448 a, g dbSNP:780492786
451 451 a, c dbSNP:369752923
454 454 -, ctt dbSNP:749060577
455 455 -, t dbSNP:768448687
466 466 c, t dbSNP:766903194
467 467 a, g dbSNP:755200816
470 470 a, g dbSNP:779058035
479 479 g, t dbSNP:199633806
491 491 a, g, t dbSNP:376416942
499 499 c, t dbSNP:777645903
500 500 a, c dbSNP:746970003
507 507 a, c dbSNP:770903296
516 516 -, agg dbSNP:774030325
518 518 c, g dbSNP:756671531
521 521 a, g dbSNP:776454553
530 530 a, g dbSNP:745716714
540 540 a, g dbSNP:202046094
548 548 a, g dbSNP:775020396
569 569 c, g dbSNP:762488496
570 570 a, c dbSNP:535573500
573 573 -, gct dbSNP:761745513
573 573 a, g dbSNP:773809049
581 581 c, t dbSNP:112593523
590 590 c, t dbSNP:761245758
599 599 c, t dbSNP:764642481
602 602 c, g dbSNP:754213054
606 606 c, t dbSNP:754263027
607 607 a, c, g dbSNP:765430520
634 634 a, g dbSNP:200570068
673 673 c, t dbSNP:2302218
677 677 a, g dbSNP:551406626
679 679 c, t dbSNP:750554202
691 691 a, g dbSNP:201083474
694 694 c, g, t dbSNP:572649173
699 699 c, t dbSNP:371304710
700 700 a, g, t dbSNP:375245858
704 704 c, t dbSNP:77685069
707 707 c, t dbSNP:771799498
709 709 a, c, t dbSNP:777127573
710 710 -, acaccacctccccggagcctccca dbSNP:768810399
710 710 a, g dbSNP:72970252
715 715 c, t dbSNP:746382893
723 723 -, cgg dbSNP:748891033
723 723 a, c, t dbSNP:78071082
724 724 a, g dbSNP:367965950
725 725 a, g dbSNP:769030372
727 727 -, cctcccaacaccacctccccggag dbSNP:71171990
728 728 c, t dbSNP:62130832
728 728 -, t dbSNP:772020567
729 729 c, t dbSNP:372191773
731 731 c, g dbSNP:767826664
733 733 a, c, t dbSNP:750453429
734 734 a, c, g dbSNP:62130833
738 738 a, c dbSNP:754782494
740 740 a, c dbSNP:778821968
742 742 a, c dbSNP:752588213
743 743 a, g, t dbSNP:757975587
745 745 a, c dbSNP:746437843
746 746 -, aggag dbSNP:760633258
746 746 a, c dbSNP:756772810
747 747 a, c dbSNP:1063736
748 748 -, gagtctcccgacaccacctcccaggagcctcccgacaccacctcccag dbSNP:71171991
748 748 a, g dbSNP:780489287
751 751 -, gtctcccg dbSNP:765447685
751 751 -, cc dbSNP:753094852
751 751 c, g dbSNP:140671566
752 752 c, t dbSNP:1140822
757 757 c, t dbSNP:149672992
758 758 a, g dbSNP:201782118
760 760 c, t dbSNP:748601216
763 763 a, c dbSNP:772175466
771 771 a, c dbSNP:200007467
772 772 -, ggagcctcccg dbSNP:779638444
776 776 c, t dbSNP:78245161
781 781 c, t dbSNP:760793486
782 782 a, g, t dbSNP:200749749
794 794 -, aggag dbSNP:747940969
795 795 -, cgg dbSNP:778477184
795 795 a, c dbSNP:77264553
796 796 a, g dbSNP:765325096
798 798 a, g dbSNP:752430378
799 799 a, g dbSNP:758217356
800 800 c, t dbSNP:201080795
804 804 -, ccgacaaga dbSNP:776691296
805 805 c, t dbSNP:751245330
806 806 a, g dbSNP:201886804
809 809 -, aag dbSNP:745996068
810 810 a, c dbSNP:76476234
811 811 c, g dbSNP:75905809
814 814 c, t dbSNP:755461075
819 819 a, c dbSNP:79868176
820 820 a, g dbSNP:748389843
823 823 -, cct, tct dbSNP:775615890
825 825 -, ccg dbSNP:764505389
825 825 -, t dbSNP:774859591
825 825 c, t dbSNP:187800291
826 826 -, cg dbSNP:762404714
826 826 c, t dbSNP:772512658
827 827 a, c, g dbSNP:773269857
828 828 a, c, t dbSNP:771330137
829 829 c, t dbSNP:759757971
830 830 a, c, t dbSNP:765017858
831 831 -, gaca dbSNP:754483501
832 832 -, ga dbSNP:764831428
833 833 c, g dbSNP:762606364
834 834 a, c dbSNP:763979858
835 835 a, g dbSNP:751393887
843 843 c, t dbSNP:756879109
851 851 -, c dbSNP:752238230
852 852 a, c, t dbSNP:113534319
854 854 c, g dbSNP:755621756
859 859 c, g dbSNP:779226163
862 862 a, c dbSNP:753282801
874 874 a, c dbSNP:369284078
881 881 c, t dbSNP:543789033
882 882 a, g dbSNP:747439523
884 884 c, g, t dbSNP:544727278
885 885 a, g dbSNP:200332335
886 886 a, c dbSNP:769939396
900 900 a, c, g dbSNP:775251362
907 907 a, g dbSNP:768524396
909 909 a, c dbSNP:3745925
910 910 c, t dbSNP:370047276
912 912 c, t dbSNP:200220692
913 913 a, g dbSNP:202078848
918 918 a, g dbSNP:377336483
923 923 a, g dbSNP:765885536
939 939 c, t dbSNP:199507986
940 940 a, g dbSNP:140417103
949 949 c, t dbSNP:780204137
951 951 c, t dbSNP:145604202
952 952 a, g dbSNP:755021998
954 954 a, g dbSNP:778769332
967 967 c, g, t dbSNP:748049978
968 968 a, g dbSNP:138020018
969 969 a, c, t dbSNP:374689202
970 970 a, g, t dbSNP:770550961
981 981 a, c dbSNP:754764277
982 982 c, g dbSNP:759037630
984 984 a, g dbSNP:372736157
988 988 c, t dbSNP:775180241
990 990 c, t dbSNP:149092655
991 991 a, g dbSNP:138718378
993 993 a, t dbSNP:750794834
1007 1007 c, t dbSNP:756437236
1010 1010 c, t dbSNP:766563350
1016 1016 g, t dbSNP:754025424
1017 1017 c, t dbSNP:755007127
1018 1018 a, g dbSNP:778945114
1019 1019 a, c dbSNP:748289153
1023 1023 -, g dbSNP:758064459
1024 1024 a, c, g, t dbSNP:7246543
1041 1041 a, g dbSNP:373464736
1043 1043 c, t dbSNP:776308081
1046 1046 c, t dbSNP:745478436
1047 1047 a, g, t dbSNP:141825568
1051 1051 c, g, t dbSNP:199656590
1056 1056 c, t dbSNP:149388006
1057 1057 c, t dbSNP:773603021
1063 1063 c, g, t dbSNP:147245939
1064 1064 a, g dbSNP:139304491
1074 1074 c, t dbSNP:201733673
1083 1083 c, t dbSNP:759745925
1101 1101 a, g dbSNP:765512380
1103 1103 a, c, g dbSNP:752710973
1105 1105 a, g, t dbSNP:777718695
1107 1107 c, t dbSNP:757260089
1108 1108 a, g dbSNP:143314648
1114 1114 c, g dbSNP:147543851
1115 1115 a, g, t dbSNP:565184057
1118 1118 a, g dbSNP:371476209
1119 1119 a, g dbSNP:768298980
1123 1123 a, g dbSNP:773726132
1132 1132 c, t dbSNP:139350636
1133 1133 a, g dbSNP:532346585
1137 1137 a, g dbSNP:776857920
1139 1139 a, g dbSNP:550472975
1141 1141 c, t dbSNP:765389123
1142 1142 a, g dbSNP:150040042
1155 1155 c, g dbSNP:762979960
1156 1156 c, t dbSNP:374750697
1161 1161 a, t dbSNP:751707863
1162 1162 a, g dbSNP:368846611
1168 1168 c, g, t dbSNP:529852754
1173 1173 c, t dbSNP:547863186
1174 1174 c, t dbSNP:779800333
1178 1178 g, t dbSNP:748977050
1188 1188 a, c dbSNP:768393049
1191 1191 c, g, t dbSNP:778276933
1204 1204 c, t dbSNP:771280019
1209 1209 g, t dbSNP:371067068
1210 1210 g, t dbSNP:777139660
1218 1218 a, t dbSNP:576214537
1224 1224 a, g dbSNP:192760680
1258 1258 c, t dbSNP:558308475
1265 1265 c, t dbSNP:1140823
1274 1274 a, g dbSNP:538493090
1304 1304 c, g dbSNP:184776902
1346 1346 a, c dbSNP:771428543
1348 1348 -, a dbSNP:746951141
1383 1383 a, c dbSNP:575052938
1404 1404 a, g dbSNP:774796539
1456 1456 a, g dbSNP:11543148
1481 1481 g, t dbSNP:542477240
1482 1482 c, g dbSNP:554217450
1491 1491 a, c dbSNP:572497165
1494 1494 c, t dbSNP:80251772
1515 1515 c, t dbSNP:746257311
1535 1535 a, g dbSNP:772464119

Target ORF information:

RefSeq Version NM_130760
Organism Homo sapiens (human)
Definition Homo sapiens mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Mucosal addressin cell adhesion molecule (MAdCAM-1) expression is upregulated in the cirrhotic liver and immunolocalises to the peribiliary plexus and lymphoid aggregates
Dig. Dis. Sci. 58 (9), 2528-2541 (2013)
Ala A, Brown D, Khan K, Standish R, Odin JA, Fiel MI, Schiano TD, Hillan KJ, Rahman SA, Hodgson HJ and Dhillon AP.


Domain 1 of mucosal addressin cell adhesion molecule has an I1-set fold and a flexible integrin-binding loop
J. Biol. Chem. 288 (9), 6284-6294 (2013)
Yu Y, Zhu J, Huang PS, Wang JH, Pullen N and Springer TA.


The CC' and DE loops in Ig domains 1 and 2 of MAdCAM-1 play different roles in MAdCAM-1 binding to low- and high-affinity integrin alpha4beta7
J. Biol. Chem. 286 (14), 12086-12092 (2011)
Sun H, Wu Y, Qi J, Pan Y, Ge G and Chen J.


Possible impact of MADCAM1 gene single nucleotide polymorphisms to the outcome of allogeneic hematopoietic stem cell transplantation
Hum. Immunol. 70 (6), 457-460 (2009)
Ambruzova Z, Mrazek F, Raida L, Stahelova A, Faber E, Indrak K and Petrek M.


Increased expression of mucosal addressin cell adhesion molecule 1 in the duodenum of patients with active celiac disease is associated with depletion of integrin alpha4beta7-positive T cells in blood
Hum. Pathol. 40 (5), 699-704 (2009)
Di Sabatino A, Rovedatti L, Rosado MM, Carsetti R, Corazza GR and MacDonald TT.


Genomic organization, chromosomal mapping, and analysis of the 5' promoter region of the human MAdCAM-1 gene
Immunogenetics 46 (2), 111-119 (1997)
Leung E, Berg RW, Langley R, Greene J, Raymond LA, Augustus M, Ni J, Carter KC, Spurr N, Choo KH and Krissansen GW.


Cloning of the mucosal addressin MAdCAM-1 from human brain: identification of novel alternatively spliced transcripts
Immunol. Cell Biol. 74 (6), 490-496 (1996)
Leung E, Greene J, Ni J, Raymond LG, Lehnert K, Langley R and Krissansen GW.


Human mucosal addressin cell adhesion molecule-1 (MAdCAM-1) demonstrates structural and functional similarities to the alpha 4 beta 7-integrin binding domains of murine MAdCAM-1, but extreme divergence of mucin-like sequences
J. Immunol. 156 (8), 2851-2857 (1996)
Shyjan AM, Bertagnolli M, Kenney CJ and Briskin MJ.


MAdCAM-1 has homology to immunoglobulin and mucin-like adhesion receptors and to IgA1
Nature 363 (6428), 461-464 (1993)
Briskin MJ, McEvoy LM and Butcher EC.


Monoclonal antibodies to human lymphocyte homing receptors define a novel class of adhesion molecules on diverse cell types
J. Cell Biol. 109 (2), 927-937 (1989)
Picker LJ, Nakache M and Butcher EC.
