Email to GenScript

BRIP1 BRCA1 interacting protein C-terminal helicase 1 [Homo sapiens (human)]

Gene Symbol BRIP1
Entrez Gene ID 83990
Full Name BRCA1 interacting protein C-terminal helicase 1
Synonyms BACH1, FANCJ, OF
General protein information
Preferred Names
Fanconi anemia group J protein
Fanconi anemia group J protein
ATP-dependent RNA helicase BRIP1
BRCA1/BRCA2-associated helicase 1
BRCA1-associated C-terminal helicase 1
BRCA1-binding helicase-like protein BACH1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Breast cancer, early-onset, 114480 (3); Fanconi anemia,

The following BRIP1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the BRIP1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu73257 XM_011525332 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73257 XM_011525333 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73257 XM_011525334 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73258 XM_011525335 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73259 XM_011525336 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73260 XM_011525337 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73261 XM_011525338 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu73262 XM_011525339 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu73263 XM_011525340 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu73264 XM_011525341 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu21213 NM_032043 Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu73257
Accession Version XM_011525332.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1417..3387(+)
Misc Feature(2)1426..1929(+)
Misc Feature(3)2782..3339(+)
Position Chain Variation Link
30 30 a, g dbSNP:7503488
43 43 a, t dbSNP:756872543
63 63 a, g dbSNP:76551053
78 78 -, gcttaaagat dbSNP:548678896
96 96 c, t dbSNP:755855605
108 108 c, g dbSNP:145073204
132 132 a, g dbSNP:764398336
141 141 a, g dbSNP:752502969
142 142 a, g dbSNP:560765726
184 184 -, tg dbSNP:544121197
207 207 a, g dbSNP:370923463
213 213 c, t dbSNP:141306575
215 215 c, g dbSNP:530468488
216 216 c, g dbSNP:565185322
262 262 c, t dbSNP:545287870
280 280 -, t dbSNP:3840867
281 281 -, t dbSNP:34753867
281 281 c, t dbSNP:759466028
281 281 -, t dbSNP:559771069
346 346 c, t dbSNP:376399814
355 355 c, t dbSNP:376981898
389 389 g, t dbSNP:572973022
426 426 c, t dbSNP:775977840
447 447 -, t dbSNP:112243287
471 471 c, g dbSNP:559475592
480 480 a, g dbSNP:2048718
488 488 a, c dbSNP:180948389
513 513 a, c dbSNP:554590681
550 550 c, g dbSNP:79220357
555 555 c, t dbSNP:4988339
558 558 c, t dbSNP:148498140
568 568 a, g dbSNP:761838059
622 622 c, t dbSNP:558845941
647 647 c, g, t dbSNP:371225829
663 663 a, c dbSNP:377620948
680 680 a, g dbSNP:754270436
685 685 a, g dbSNP:764585550
689 689 c, t dbSNP:751194347
694 694 a, g dbSNP:45512093
708 708 a, c, t dbSNP:752411477
713 713 c, t dbSNP:786203418
714 714 c, t dbSNP:767215118
717 717 c, t dbSNP:759187663
720 720 c, g, t dbSNP:45566938
731 731 a, g dbSNP:587781387
735 735 c, t dbSNP:762827371
753 753 a, g dbSNP:45458996
767 767 a, t dbSNP:786202674
771 771 a, g dbSNP:769585673
772 772 a, g dbSNP:747867580
778 778 a, t dbSNP:776386693
781 781 c, t dbSNP:772319724
785 785 c, g dbSNP:786201468
787 787 a, g dbSNP:373104267
792 792 a, c dbSNP:774586397
805 805 c, t dbSNP:770930270
810 810 c, t dbSNP:749323434
814 814 c, t dbSNP:758270108
817 817 a, g, t dbSNP:587781292
823 823 a, c, g dbSNP:28903098
825 825 -, c dbSNP:587782065
827 827 a, c dbSNP:755317452
842 842 gc, tt dbSNP:786202417
842 842 g, t dbSNP:751182362
843 843 c, t dbSNP:779686432
847 847 a, g dbSNP:757909937
857 857 a, g dbSNP:749920386
865 865 g, t dbSNP:765205377
868 868 g, t dbSNP:786202861
870 870 a, g dbSNP:764252214
877 877 c, t dbSNP:575595017
879 879 a, g dbSNP:141436143
885 885 c, t dbSNP:763819127
889 889 a, g dbSNP:372581879
896 896 c, t dbSNP:779629295
909 909 c, t dbSNP:186802750
910 910 a, g dbSNP:769573395
924 924 g, t dbSNP:745422385
928 928 a, g dbSNP:565078834
931 931 c, t dbSNP:756707967
933 933 -, attacc dbSNP:759174262
933 933 a, g dbSNP:45528833
938 938 c, t dbSNP:587781830
942 942 -, ttgttgtgcatg dbSNP:730881648
946 946 -, tgt dbSNP:587781388
951 951 a, g dbSNP:764027029
958 958 c, t dbSNP:755930156
960 960 a, g dbSNP:786202281
965 965 a, g dbSNP:529201896
974 974 -, acaa dbSNP:763009188
975 975 c, g dbSNP:766561078
977 977 a, g dbSNP:781121675
980 980 a, t dbSNP:773532701
981 981 c, t dbSNP:201617644
983 983 c, t dbSNP:587782427
991 991 a, g dbSNP:777068696
996 996 g, t dbSNP:769190318
1000 1000 c, t dbSNP:587780247
1001 1001 a, g dbSNP:143615668
1002 1002 a, t dbSNP:772283705
1010 1010 a, g dbSNP:587782734
1016 1016 a, c dbSNP:201790351
1022 1022 c, t dbSNP:778480809
1026 1026 a, g dbSNP:756764576
1031 1031 c, g dbSNP:748793974
1033 1033 g, t dbSNP:786203890
1041 1041 c, t dbSNP:786202477
1043 1043 a, g dbSNP:730881637
1046 1046 c, g dbSNP:777630298
1054 1054 a, c, g dbSNP:45617634
1070 1070 c, t dbSNP:587780831
1071 1071 c, t dbSNP:779324498
1078 1078 -, a dbSNP:587781416
1078 1078 a, t dbSNP:730881623
1079 1079 a, c dbSNP:753965650
1081 1081 a, t dbSNP:764256720
1096 1096 c, t dbSNP:786201292
1097 1097 c, t dbSNP:587780251
1099 1099 g, t dbSNP:202072866
1110 1110 a, g dbSNP:768008017
1114 1114 a, g dbSNP:116952709
1121 1121 c, t dbSNP:774677996
1122 1122 ata, ct dbSNP:786203429
1124 1124 -, a dbSNP:786203521
1130 1130 a, g dbSNP:770613242
1132 1132 a, g dbSNP:762701532
1141 1141 a, g dbSNP:772695469
1147 1147 c, t dbSNP:587781786
1157 1157 a, c dbSNP:769364081
1165 1165 a, g dbSNP:786203916
1168 1168 c, t dbSNP:747604569
1169 1169 a, g, t dbSNP:61757643
1173 1173 c, g dbSNP:746838904
1179 1179 a, c dbSNP:780024960
1184 1184 c, t dbSNP:758218234
1186 1186 c, t dbSNP:748211848
1201 1201 c, t dbSNP:4988345
1202 1202 a, g dbSNP:761432927
1204 1204 c, t dbSNP:776248182
1207 1207 a, t dbSNP:546727788
1210 1210 g, t dbSNP:746963627
1221 1221 a, g dbSNP:775509896
1234 1234 a, g, t dbSNP:201047375
1237 1237 a, g dbSNP:745645356
1239 1239 a, c dbSNP:778116059
1240 1240 a, g dbSNP:730881624
1245 1245 c, t dbSNP:786201596
1253 1253 a, g dbSNP:756269682
1256 1256 a, g dbSNP:748268716
1260 1260 c, t dbSNP:781282996
1261 1261 a, g dbSNP:4988346
1268 1268 c, t dbSNP:4988347
1271 1271 a, g dbSNP:550707862
1272 1272 c, t dbSNP:758851721
1273 1273 c, t dbSNP:530897769
1274 1274 c, t dbSNP:533184563
1279 1279 c, t dbSNP:144969738
1288 1288 a, g dbSNP:778275257
1294 1294 g, t dbSNP:761401027
1295 1295 c, t dbSNP:776372251
1296 1296 c, g dbSNP:587780832
1301 1301 c, t dbSNP:565458815
1302 1302 a, g, t dbSNP:367614726
1303 1303 c, t dbSNP:775636640
1305 1305 a, g dbSNP:771891225
1310 1310 a, g dbSNP:748912293
1312 1312 c, t dbSNP:150313156
1313 1313 a, c, t dbSNP:140097800
1316 1316 c, t dbSNP:780026145
1317 1317 -, t dbSNP:779466229
1321 1321 c, t dbSNP:772140734
1322 1322 a, g dbSNP:376760085
1325 1325 c, g dbSNP:779409059
1328 1328 a, c dbSNP:12947398
1332 1332 a, g dbSNP:202035881
1334 1334 g, t dbSNP:587782156
1337 1337 a, g dbSNP:754242563
1339 1339 c, t dbSNP:730881630
1340 1340 a, g dbSNP:587782238
1345 1345 a, g dbSNP:777618772
1346 1346 c, g dbSNP:373774920
1351 1351 c, t dbSNP:786201733
1352 1352 a, g dbSNP:786203708
1356 1356 a, g dbSNP:752356873
1358 1358 -, a dbSNP:757771711
1363 1363 c, g dbSNP:45459799
1373 1373 c, t dbSNP:759031349
1374 1374 a, g dbSNP:751460179
1375 1375 a, g dbSNP:766340391
1379 1379 c, g dbSNP:762781085
1380 1380 a, c dbSNP:772957320
1381 1381 a, g dbSNP:769535320
1385 1385 a, g dbSNP:587780834
1386 1386 a, g dbSNP:45512798
1392 1392 c, t dbSNP:775721645
1395 1395 c, t dbSNP:772048413
1397 1397 c, t dbSNP:745955726
1398 1398 a, g dbSNP:548018916
1405 1405 c, t dbSNP:771542690
1412 1412 c, t dbSNP:587781860
1416 1416 a, c dbSNP:786202300
1420 1420 a, g dbSNP:376893571
1424 1424 a, g dbSNP:756499865
1435 1435 c, t dbSNP:752309409
1436 1436 a, g dbSNP:780834054
1453 1453 g, t dbSNP:754515912
1462 1462 a, g dbSNP:138743097
1474 1474 c, t dbSNP:28997569
1475 1475 a, g dbSNP:758360637
1479 1479 a, g dbSNP:61754143
1481 1481 c, t dbSNP:550031006
1484 1484 c, t dbSNP:730881631
1488 1488 g, t dbSNP:587782514
1500 1500 a, g dbSNP:765027420
1501 1501 a, c dbSNP:587781797
1504 1504 a, g dbSNP:62620988
1507 1507 a, g dbSNP:587781425
1515 1515 c, g dbSNP:45549332
1521 1521 g, t dbSNP:759584091
1529 1529 c, g dbSNP:45624635
1532 1532 a, g dbSNP:771096783
1536 1536 c, t dbSNP:144940449
1538 1538 a, g dbSNP:141055990
1540 1540 c, t dbSNP:770289817
1548 1548 a, g dbSNP:748545827
1551 1551 c, t dbSNP:147739458
1552 1552 a, g dbSNP:145601931
1553 1553 a, g dbSNP:148556781
1562 1562 a, g dbSNP:746599076
1574 1574 -, a dbSNP:786202610
1574 1574 a, g dbSNP:28997570
1581 1581 a, g dbSNP:137852985
1586 1586 c, g, t dbSNP:750376292
1596 1596 a, g dbSNP:786201326
1605 1605 a, g dbSNP:786202337
1608 1608 a, g dbSNP:374974885
1616 1616 -, a dbSNP:587778138
1616 1616 a, g dbSNP:587782731
1625 1625 a, g dbSNP:112076926
1643 1643 a, g dbSNP:746681841
1648 1648 c, t dbSNP:587778139
1656 1656 a, t dbSNP:779627397
1659 1659 a, g dbSNP:771630777
1668 1668 c, t dbSNP:745379285
1670 1670 a, g dbSNP:778863018
1676 1676 g, t dbSNP:587782771
1677 1677 a, g dbSNP:587780252
1681 1681 a, g dbSNP:757196702
1684 1684 a, g, t dbSNP:535414791
1689 1689 a, g dbSNP:786201808
1696 1696 c, g dbSNP:777653224
1702 1702 c, t dbSNP:755796609
1715 1715 a, g dbSNP:751841684
1724 1724 c, t dbSNP:786201819
1729 1729 c, g dbSNP:149364097
1731 1731 c, t dbSNP:763189201
1737 1737 a, g dbSNP:544977115
1738 1738 c, t dbSNP:730881632
1739 1739 a, g dbSNP:762417690
1745 1745 c, t dbSNP:776939714
1750 1750 c, t dbSNP:730881633
1751 1751 -, g dbSNP:751209171
1753 1753 g, t dbSNP:769081927
1754 1754 -, ttac dbSNP:766110015
1755 1755 a, g dbSNP:761017296
1756 1756 -, agtcca dbSNP:762883121
1756 1756 a, c dbSNP:775191379
1758 1758 a, c dbSNP:771682192
1761 1761 a, g dbSNP:730881634
1766 1766 -, a dbSNP:587781639
1767 1767 c, t dbSNP:745432312
1773 1773 c, t dbSNP:139701369
1774 1774 a, t dbSNP:770306753
1777 1777 a, g dbSNP:749251680
1789 1789 c, t dbSNP:587781325
1790 1790 a, g dbSNP:786202218
1793 1793 a, g dbSNP:777511615
1798 1798 a, ct dbSNP:587783377
1798 1798 a, c dbSNP:786202637
1801 1801 c, t dbSNP:755992778
1808 1808 c, t dbSNP:786202192
1810 1810 -, ca dbSNP:587780224
1823 1823 a, g, t dbSNP:569696977
1837 1837 c, t dbSNP:748001678
1840 1840 a, t dbSNP:730881635
1849 1849 a, g dbSNP:587780825
1852 1852 a, g dbSNP:781168634
1854 1854 c, t dbSNP:754755989
1860 1860 a, g dbSNP:550092661
1868 1868 a, c dbSNP:778992385
1873 1873 a, c dbSNP:587782039
1876 1876 a, g dbSNP:786203967
1878 1878 c, t dbSNP:757427498
1879 1879 a, g dbSNP:587782816
1882 1882 g, t dbSNP:764711572
1885 1885 c, t dbSNP:756636362
1888 1888 -, tgtg dbSNP:730881647
1891 1891 c, t dbSNP:369631413
1892 1892 a, g dbSNP:786202780
1901 1901 c, t dbSNP:767872861
1904 1904 a, g dbSNP:759835916
1910 1910 g, t dbSNP:587782247
1914 1914 -, aacagaagttcagcttcggttt dbSNP:786202415
1922 1922 c, t dbSNP:45576134
1924 1924 c, t dbSNP:368796923
1930 1930 c, t dbSNP:587780225
1931 1931 a, g dbSNP:772570870
1939 1939 c, t dbSNP:150624408
1940 1940 a, g dbSNP:748105919
1941 1941 a, g dbSNP:148429663
1948 1948 a, c dbSNP:768633507
1952 1952 a, g dbSNP:746778889
1967 1967 a, c dbSNP:779237423
1970 1970 a, c dbSNP:587781463
1980 1980 a, g dbSNP:757400610
1988 1988 a, g dbSNP:730881636
1996 1996 a, c, t dbSNP:756119073
1999 1999 c, t dbSNP:587780226
2000 2000 a, g dbSNP:753214212
2016 2016 c, t dbSNP:200581792
2020 2020 a, c dbSNP:786203496
2027 2027 a, g dbSNP:775171520
2036 2036 c, t dbSNP:771861055
2040 2040 c, t dbSNP:730881640
2041 2041 a, g dbSNP:587780227
2045 2045 a, t dbSNP:769918040
2046 2046 a, c dbSNP:786202553
2047 2047 a, t dbSNP:587780826
2053 2053 c, g dbSNP:748221377
2056 2056 g, t dbSNP:587780228
2059 2059 a, c, g dbSNP:752052351
2061 2061 a, c dbSNP:780310294
2064 2064 c, t dbSNP:758735370
2067 2067 c, g, t dbSNP:587780875
2085 2085 a, g dbSNP:764979728
2109 2109 -, aactt dbSNP:768736851
2116 2116 c, t dbSNP:761452695
2117 2117 a, g dbSNP:45501097
2125 2125 g, t dbSNP:587780229
2126 2126 a, g, t dbSNP:200062099
2127 2127 c, t dbSNP:775431508
2128 2128 a, g dbSNP:142744352
2130 2130 c, t dbSNP:759360709
2139 2139 c, t dbSNP:773489367
2151 2151 g, t dbSNP:587780230
2168 2168 c, t dbSNP:536081549
2169 2169 g, t dbSNP:370658123
2183 2183 a, g dbSNP:746329838
2194 2194 -, a dbSNP:775735278
2195 2195 c, t dbSNP:755306832
2226 2226 a, g dbSNP:779454200
2234 2234 c, t dbSNP:786202169
2236 2236 a, g dbSNP:786201701
2243 2243 c, g dbSNP:757629526
2244 2244 a, t dbSNP:730881638
2255 2255 a, g dbSNP:587781726
2258 2258 -, t dbSNP:772248310
2266 2266 a, g dbSNP:748962730
2270 2270 a, g dbSNP:138784299
2275 2275 a, c dbSNP:4988350
2289 2289 c, g dbSNP:56024614
2300 2300 a, g, t dbSNP:199616792
2303 2303 a, t dbSNP:4988349
2307 2307 c, t dbSNP:786203897
2310 2310 c, t dbSNP:373709958
2325 2325 g, t dbSNP:754414731
2327 2327 a, g dbSNP:587782405
2328 2328 c, t dbSNP:372760869
2334 2334 g, t dbSNP:587782254
2335 2335 c, g dbSNP:766302517
2336 2336 c, t dbSNP:375246789
2337 2337 a, g dbSNP:750213758
2339 2339 c, t dbSNP:369340666
2344 2344 c, g dbSNP:777217004
2345 2345 -, a dbSNP:749762964
2350 2350 c, t dbSNP:752797989
2356 2356 c, t dbSNP:767648925
2368 2368 a, g dbSNP:45533636
2371 2371 -, gat dbSNP:780590493
2372 2372 a, g dbSNP:577768294
2375 2375 c, t dbSNP:755635967
2376 2376 c, t dbSNP:786202979
2379 2379 a, c dbSNP:142572387
2388 2388 g, t dbSNP:763458922
2390 2390 c, g dbSNP:373228183
2394 2394 a, g dbSNP:370087045
2395 2395 -, ttg dbSNP:754566378
2401 2401 c, g dbSNP:786202587
2405 2405 c, t dbSNP:377302300
2411 2411 -, a dbSNP:587778131
2411 2411 a, g dbSNP:587778132
2415 2415 a, g dbSNP:587780829
2418 2418 a, g dbSNP:786202592
2419 2419 c, t dbSNP:28997571
2420 2420 a, g dbSNP:768224857
2422 2422 g, t dbSNP:746494295
2425 2425 c, t dbSNP:780020495
2426 2426 a, g dbSNP:587778133
2429 2429 a, g dbSNP:750288231
2436 2436 c, t dbSNP:778774207
2438 2438 a, c dbSNP:756946068
2458 2458 g, t dbSNP:587780231
2460 2460 a, g dbSNP:753023295
2465 2465 c, t dbSNP:587781559
2468 2468 a, g dbSNP:759727507
2474 2474 c, t dbSNP:751667661
2481 2481 c, t dbSNP:771672834
2482 2482 c, t dbSNP:745367580
2484 2484 g, t dbSNP:375625993
2488 2488 g, t dbSNP:770750488
2493 2493 c, t dbSNP:370393808
2507 2507 a, g dbSNP:112505689
2509 2509 a, g dbSNP:189758577
2512 2512 a, g dbSNP:749200646
2515 2515 a, g dbSNP:777741543
2537 2537 -, g dbSNP:587781985
2555 2555 a, c, t dbSNP:587781321
2556 2556 a, g dbSNP:145504336
2572 2572 -, a dbSNP:763818712
2573 2573 a, c dbSNP:780407946
2574 2574 a, g dbSNP:145796331
2581 2581 a, c, g dbSNP:765314472
2582 2582 c, t dbSNP:587780232
2583 2583 c, g dbSNP:28997572
2587 2587 c, t dbSNP:754280136
2593 2593 g, t dbSNP:541203428
2598 2598 c, t dbSNP:764456240
2601 2601 c, t dbSNP:763534423
2624 2624 a, t dbSNP:554791910
2625 2625 a, g dbSNP:538015264
2685 2685 g, t dbSNP:786202760
2686 2686 a, g dbSNP:780475484
2690 2690 a, c, g dbSNP:746066323
2695 2695 a, g dbSNP:778867622
2696 2696 c, t dbSNP:757305097
2697 2697 c, t dbSNP:754400631
2700 2700 a, g dbSNP:778250103
2702 2702 c, t dbSNP:756511744
2706 2706 c, t dbSNP:786201877
2707 2707 c, t dbSNP:753036322
2708 2708 c, g dbSNP:767872111
2714 2714 -, g dbSNP:760782298
2716 2716 c, t dbSNP:786203170
2717 2717 a, g dbSNP:759142191
2728 2728 a, g dbSNP:571340013
2733 2733 a, c dbSNP:376628979
2737 2737 -, c dbSNP:34224865
2740 2740 a, g dbSNP:765816425
2754 2754 -, t dbSNP:775537066
2754 2754 a, t dbSNP:762535496
2756 2756 a, g dbSNP:587778135
2762 2762 a, g dbSNP:786203619
2772 2772 c, g dbSNP:786202395
2782 2782 c, t dbSNP:786203872
2783 2783 -, tt dbSNP:587778134
2791 2791 c, g dbSNP:773347072
2800 2800 a, g dbSNP:769820537
2805 2805 c, g dbSNP:112414873
2811 2811 a, g dbSNP:556955136
2815 2815 a, c dbSNP:587782356
2831 2831 c, t dbSNP:147755155
2832 2832 a, t dbSNP:768436074
2844 2844 a, g dbSNP:766047812
2851 2851 a, c dbSNP:762590242
2852 2852 -, cc dbSNP:760863397
2852 2852 a, t dbSNP:756412722
2852 2852 a, tcc dbSNP:786203384
2863 2863 c, t dbSNP:764803896
2864 2864 a, g, t dbSNP:200313471
2873 2873 c, t dbSNP:768393936
2875 2875 a, g dbSNP:760515227
2896 2896 c, g dbSNP:774478325
2899 2899 c, t dbSNP:771122056
2908 2908 -, acag dbSNP:778385829
2911 2911 a, g dbSNP:145616741
2913 2913 c, t dbSNP:749460936
2916 2916 c, t dbSNP:777860588
2917 2917 -, gtagaa dbSNP:770198861
2923 2923 c, t dbSNP:769797684
2933 2933 a, g dbSNP:748616469
2937 2937 a, g dbSNP:781712098
2954 2954 a, g dbSNP:755361298
2960 2960 c, t dbSNP:587780234
2961 2961 g, t dbSNP:747365105
2964 2964 c, g, t dbSNP:45589637
2972 2972 a, c, g dbSNP:750033391
2976 2976 c, t dbSNP:374362388
2977 2977 a, g dbSNP:587780235
2980 2980 a, g dbSNP:111536363
2981 2981 -, tcaa dbSNP:587782726
2991 2991 a, t dbSNP:587782556
2993 2993 g, t dbSNP:764061653
2995 2995 c, g dbSNP:760438320
2999 2999 -, aa dbSNP:730881649
3002 3002 a, g dbSNP:745578572
3017 3017 -, t dbSNP:587780236
3018 3018 a, g dbSNP:786201526
3028 3028 c, t dbSNP:587778136
3029 3029 a, g, t dbSNP:200960251
3030 3030 c, t dbSNP:61754141
3032 3032 a, g dbSNP:371484780
3039 3039 a, g dbSNP:752509701
3040 3040 a, g dbSNP:371227751
3045 3045 a, c, g dbSNP:369434185
3054 3054 c, t dbSNP:148752066
3057 3057 -, ctcagat dbSNP:758128094
3061 3061 a, g dbSNP:146091205
3068 3068 a, g dbSNP:571108955
3069 3069 g, t dbSNP:375146450
3072 3072 c, t dbSNP:786203725
3073 3073 c, g, t dbSNP:768555161
3074 3074 a, g dbSNP:747568830
3082 3082 a, c dbSNP:776131401
3087 3087 a, g dbSNP:772636536
3088 3088 a, g dbSNP:142806416
3089 3089 c, t dbSNP:778758437
3108 3108 a, t dbSNP:587783045
3114 3114 a, g dbSNP:372122365
3120 3120 a, g dbSNP:554514054
3121 3121 c, t dbSNP:587782574
3126 3126 g, t dbSNP:560088455
3134 3134 a, g dbSNP:730881622
3136 3136 c, t dbSNP:137852986
3137 3137 a, g dbSNP:375082407
3138 3138 a, t dbSNP:540236878
3144 3144 c, g, t dbSNP:574552037
3150 3150 a, c, t dbSNP:748981650
3153 3153 c, t dbSNP:762039913
3155 3155 a, g dbSNP:777277034
3159 3159 a, c dbSNP:769413097
3160 3160 a, g dbSNP:747622456
3163 3163 c, t dbSNP:786201708
3166 3166 a, g dbSNP:587780237
3167 3167 g, t dbSNP:781153382
3171 3171 c, t dbSNP:754927538
3172 3172 c, g dbSNP:587780238
3177 3177 a, t dbSNP:751455420
3178 3178 c, t dbSNP:779915262
3184 3184 c, t dbSNP:201869624
3185 3185 a, g dbSNP:45468199
3189 3189 a, g dbSNP:764195906
3191 3191 a, g dbSNP:786204250
3208 3208 c, t dbSNP:760887592
3209 3209 a, g dbSNP:587781572
3212 3212 g, t dbSNP:45479297
3213 3213 a, g, t dbSNP:587780239
3216 3216 c, t dbSNP:767666616
3221 3221 a, g dbSNP:760127237
3222 3222 c, t dbSNP:774939280
3223 3223 a, c dbSNP:786203898
3236 3236 a, g dbSNP:771382903
3238 3238 c, t dbSNP:768222842
3239 3239 a, g dbSNP:4988355
3241 3241 a, g dbSNP:199831248
3247 3247 c, g dbSNP:746492294
3249 3249 c, t dbSNP:775547651
3253 3253 a, c dbSNP:771929845
3268 3268 c, t dbSNP:786201802
3286 3286 a, c, t dbSNP:45572934
3287 3287 a, g dbSNP:374334794
3289 3289 c, t dbSNP:786202317
3297 3297 g, t dbSNP:587781793
3298 3298 a, g dbSNP:745782331
3307 3307 c, t dbSNP:146031731
3308 3308 a, g, t dbSNP:200894063
3311 3311 a, g dbSNP:781556845
3312 3312 c, t dbSNP:370175724
3313 3313 a, g dbSNP:28904918
3314 3314 c, t dbSNP:766432760
3323 3323 c, t dbSNP:587780242
3326 3326 c, g dbSNP:774415723
3330 3330 a, g dbSNP:745318756
3334 3334 a, g dbSNP:149529390
3337 3337 c, t dbSNP:578022079
3338 3338 a, g dbSNP:781609846
3339 3339 -, g dbSNP:587781974
3342 3342 a, g dbSNP:769021796
3343 3343 a, c dbSNP:182028200
3344 3344 a, g dbSNP:747213803
3355 3355 c, t dbSNP:786203288
3357 3357 c, t dbSNP:199721657
3359 3359 c, t dbSNP:587781964
3361 3361 a, g dbSNP:758444508
3371 3371 a, g dbSNP:750961319
3375 3375 a, g dbSNP:786201336
3381 3381 a, g dbSNP:4986765
3394 3394 a, t dbSNP:587780243
3406 3406 c, t dbSNP:757668121
3415 3415 a, g dbSNP:754224663
3428 3428 -, ccat dbSNP:760551339
3430 3430 a, g dbSNP:764406913
3433 3433 a, g dbSNP:587781644
3437 3437 a, t dbSNP:752340544
3450 3450 a, g dbSNP:587780244
3460 3460 a, g dbSNP:759080195
3465 3465 a, t dbSNP:774467171
3467 3467 c, t dbSNP:786201919
3469 3469 c, g dbSNP:587781853
3470 3470 c, t dbSNP:770966270
3474 3474 a, g dbSNP:570751937
3476 3476 -, t dbSNP:752780954
3479 3479 a, c dbSNP:571949350
3492 3492 c, t dbSNP:555200296
3495 3495 c, t dbSNP:150780318
3497 3497 a, c, t dbSNP:587781298
3499 3499 c, t dbSNP:4986764
3509 3509 g, t dbSNP:587782410
3516 3516 a, c dbSNP:730881625
3530 3530 g, t dbSNP:772087074
3535 3535 a, c dbSNP:745940032
3545 3545 c, t dbSNP:778916092
3548 3548 g, t dbSNP:4988356
3550 3550 a, g dbSNP:754280048
3555 3555 c, t dbSNP:374335608
3556 3556 a, g dbSNP:199643061
3560 3560 c, g dbSNP:756490117
3564 3564 a, g dbSNP:786201396
3567 3567 -, a dbSNP:767549540
3569 3569 a, g dbSNP:370330739
3572 3572 c, t dbSNP:786204143
3573 3573 c, g, t dbSNP:767164240
3574 3574 c, g, t dbSNP:140233356
3575 3575 a, c, g dbSNP:148232408
3579 3579 a, g dbSNP:786203633
3585 3585 a, g dbSNP:786201414
3591 3591 c, t dbSNP:45499991
3595 3595 a, g dbSNP:730881626
3598 3598 a, g dbSNP:200239986
3601 3601 a, c dbSNP:587780245
3602 3602 c, t dbSNP:201672040
3603 3603 a, c dbSNP:786201685
3607 3607 a, c dbSNP:587782244
3610 3610 c, t dbSNP:74824981
3611 3611 c, g dbSNP:761639530
3614 3614 c, t dbSNP:786203077
3615 3615 c, t dbSNP:786202095
3617 3617 a, t dbSNP:145859791
3627 3627 c, t dbSNP:367728797
3629 3629 c, t dbSNP:786201632
3637 3637 a, c, g dbSNP:113697814
3646 3646 a, g dbSNP:587782679
3658 3658 a, g dbSNP:786203224
3674 3674 c, t dbSNP:770352467
3677 3677 a, g dbSNP:587780246
3679 3679 a, g dbSNP:730881627
3681 3681 a, g dbSNP:75091137
3683 3683 c, t dbSNP:781622986
3691 3691 -, a dbSNP:774684620
3691 3691 a, t dbSNP:755337038
3692 3692 a, t dbSNP:587781417
3693 3693 g, t dbSNP:746715917
3701 3701 c, g dbSNP:182087528
3707 3707 c, t dbSNP:758032378
3734 3734 -, caaa dbSNP:771028677
3734 3734 c, t dbSNP:749978235
3735 3735 a, g dbSNP:45466996
3736 3736 -, aaga dbSNP:786203717
3738 3738 c, g dbSNP:757225144
3748 3748 -, tgacagct dbSNP:763443434
3749 3749 a, g dbSNP:753664225
3750 3750 c, g, t dbSNP:546083449
3753 3753 a, g dbSNP:751823379
3755 3755 a, g dbSNP:766562396
3769 3769 a, g, t dbSNP:587781328
3771 3771 a, g dbSNP:786201171
3786 3786 c, t dbSNP:188258913
3787 3787 a, g dbSNP:769692303
3794 3794 c, t dbSNP:747907706
3795 3795 a, g dbSNP:776990704
3808 3808 a, g dbSNP:587782808
3812 3812 c, t dbSNP:747345595
3813 3813 c, t dbSNP:61754142
3814 3814 a, g dbSNP:147119272
3815 3815 g, t dbSNP:587781744
3816 3816 a, g, t dbSNP:778500245
3820 3820 c, t dbSNP:756712872
3822 3822 a, g dbSNP:786201657
3823 3823 a, g dbSNP:371185409
3825 3825 a, g dbSNP:777660106
3830 3830 c, g dbSNP:755949409
3830 3830 -, g dbSNP:773433456
3833 3833 c, g, t dbSNP:767255426
3840 3840 g, t dbSNP:763162379
3843 3843 c, t dbSNP:202228407
3844 3844 a, c dbSNP:765416041
3847 3847 c, t dbSNP:45437094
3848 3848 a, g dbSNP:367816363
3861 3861 a, g dbSNP:769310105
3866 3866 c, t dbSNP:761225576
3868 3868 a, g dbSNP:776002434
3884 3884 c, t dbSNP:786203344
3889 3889 c, t dbSNP:772507914
3893 3893 a, c dbSNP:373040333
3922 3922 a, g dbSNP:149016505
3925 3925 a, c dbSNP:778430337
3929 3929 c, t dbSNP:770517912
3932 3932 c, t dbSNP:575998972
3939 3939 a, g dbSNP:45540240
3940 3940 -, t dbSNP:730881645
3952 3952 -, t dbSNP:748598593
3953 3953 c, t dbSNP:777213170
3958 3958 a, g dbSNP:756074244
3959 3959 a, c dbSNP:786204068
3967 3967 a, t dbSNP:368867532
3968 3968 c, t dbSNP:183928474
3976 3976 a, t dbSNP:786202927
3978 3978 a, g, t dbSNP:570238270
3980 3980 c, t dbSNP:150813402
3981 3981 g, t dbSNP:587781666
3982 3982 a, g dbSNP:786204230
3984 3984 -, t dbSNP:779741278
3987 3987 c, t dbSNP:754003636
4004 4004 -, a dbSNP:771654971
4004 4004 a, g dbSNP:786202024
4009 4009 g, t dbSNP:764205156
4010 4010 c, t dbSNP:761278503
4016 4016 a, g dbSNP:776129117
4018 4018 c, t dbSNP:768065626
4019 4019 c, t dbSNP:587780830
4020 4020 a, g dbSNP:375911315
4029 4029 c, t dbSNP:774105218
4033 4033 c, g dbSNP:770509300
4038 4038 c, t dbSNP:748928248
4040 4040 g, t dbSNP:772709195
4042 4042 a, g dbSNP:587781923
4049 4049 a, g dbSNP:748140041
4052 4052 c, t dbSNP:781102464
4060 4060 c, t dbSNP:111943191
4075 4075 c, g dbSNP:587780248
4080 4080 c, t dbSNP:369843642
4093 4093 g, t dbSNP:779860140
4098 4098 c, t dbSNP:757427210
4111 4111 a, g dbSNP:754056526
4118 4118 -, cag dbSNP:745344948
4122 4122 a, c dbSNP:145855459
4126 4126 a, g dbSNP:45552539
4132 4132 a, t dbSNP:786202549
4134 4134 -, ctat dbSNP:778664039
4145 4145 -, c dbSNP:756853672
4147 4147 a, g dbSNP:369340444
4155 4155 c, t dbSNP:4986763
4156 4156 a, g, t dbSNP:587780249
4175 4175 a, g dbSNP:774605759
4180 4180 a, g dbSNP:786202247
4184 4184 -, a dbSNP:753683450
4188 4188 a, c dbSNP:28997573
4192 4192 c, g dbSNP:757363615
4203 4203 c, t dbSNP:4987050
4204 4204 a, g dbSNP:769359514
4208 4208 a, g dbSNP:45603843
4212 4212 c, t dbSNP:747624574
4214 4214 c, g dbSNP:776599258
4219 4219 g, t dbSNP:368610199
4224 4224 c, t dbSNP:746898528
4233 4233 c, t dbSNP:144245485
4237 4237 a, c dbSNP:771889454
4247 4247 a, c dbSNP:749589266
4249 4249 g, t dbSNP:587782029
4251 4251 a, c dbSNP:375741316
4252 4252 c, g dbSNP:587782552
4265 4265 c, g dbSNP:786202662
4267 4267 a, g dbSNP:372799558
4269 4269 -, t dbSNP:777367075
4273 4273 a, c dbSNP:756313788
4275 4275 a, g dbSNP:181186298
4277 4277 a, t dbSNP:752850661
4279 4279 a, g dbSNP:781289228
4290 4290 c, t dbSNP:755440956
4299 4299 a, g dbSNP:752044406
4300 4300 a, g dbSNP:766709841
4301 4301 a, g dbSNP:763298204
4303 4303 a, g dbSNP:367610893
4306 4306 a, g dbSNP:786201962
4311 4311 c, t dbSNP:764848326
4315 4315 a, g dbSNP:761405340
4334 4334 a, g dbSNP:587781677
4343 4343 a, g dbSNP:730881628
4349 4349 a, g dbSNP:776010326
4351 4351 at, ga dbSNP:587782615
4359 4359 a, t dbSNP:768156067
4364 4364 a, t dbSNP:139539831
4366 4366 a, g dbSNP:760589795
4371 4371 a, t dbSNP:548674096
4373 4373 a, g dbSNP:112214651
4380 4380 c, t dbSNP:374392860
4388 4388 c, t dbSNP:771805501
4391 4391 -, c dbSNP:756079324
4395 4395 a, g, t dbSNP:542698396
4406 4406 g, t dbSNP:778805688
4408 4408 -, g dbSNP:752586524
4409 4409 a, g dbSNP:770175142
4411 4411 c, g dbSNP:748310432
4420 4420 a, c dbSNP:781140410
4424 4424 a, g dbSNP:755069935
4425 4425 c, t dbSNP:370581038
4436 4436 g, t dbSNP:780578438
4445 4445 g, t dbSNP:587778137
4454 4454 c, t dbSNP:587781819
4455 4455 c, t dbSNP:786203915
4459 4459 c, t dbSNP:587781886
4461 4461 c, t dbSNP:758809865
4471 4471 g, t dbSNP:587780250
4472 4472 g, t dbSNP:765545033
4474 4474 -, at dbSNP:730881646
4474 4474 a, c dbSNP:761468878
4476 4476 a, g dbSNP:753516000
4487 4487 g, t dbSNP:763579793
4508 4508 g, t dbSNP:760202569
4516 4516 -, a dbSNP:755091088
4526 4526 c, t dbSNP:754001752
4533 4533 a, g dbSNP:202123733
4535 4535 c, g dbSNP:772160050
4541 4541 a, g dbSNP:759511390
4571 4571 a, c dbSNP:4988358
4581 4581 g, t dbSNP:557749565
4583 4583 g, t dbSNP:539702731
4584 4584 a, g dbSNP:569535272
4610 4610 g, t dbSNP:562726845
4622 4622 a, g dbSNP:150444311
4626 4626 a, g dbSNP:143361598
4629 4629 a, g dbSNP:775842351
4638 4638 c, g dbSNP:767771825
4645 4645 g, t dbSNP:538867472
4646 4646 g, t dbSNP:540229694
4647 4647 c, g dbSNP:113345004
4649 4649 -, t dbSNP:376507309
4652 4652 c, t dbSNP:1978111
4653 4653 c, t dbSNP:554326644
4659 4659 -, t dbSNP:111519368
4666 4666 c, g dbSNP:111898257
4668 4668 a, g dbSNP:774889346
4676 4676 -, ctgt dbSNP:551479702
4729 4729 c, t dbSNP:764128633
4757 4757 c, t dbSNP:774821210
4774 4774 c, g dbSNP:189935192
4777 4777 -, a dbSNP:531656835
4874 4874 c, t dbSNP:556729826
4890 4890 -, ct dbSNP:546666211
4954 4954 c, g dbSNP:539677174
4977 4977 c, t dbSNP:7213430
4982 4982 c, t dbSNP:772711204
4994 4994 g, t dbSNP:377169249
5003 5003 c, t dbSNP:533893805
5018 5018 a, g dbSNP:371689236
5086 5086 a, t dbSNP:568447515
5097 5097 c, t dbSNP:368711371
5110 5110 a, g dbSNP:116292412
5153 5153 a, g dbSNP:769375960
5154 5154 c, g dbSNP:569287586
5208 5208 g, t dbSNP:552378907
5223 5223 c, t dbSNP:137967725
5255 5255 g, t dbSNP:560463291
5268 5268 a, g dbSNP:376898714
5273 5273 c, t dbSNP:185040281
5346 5346 g, t dbSNP:540541914
5369 5369 a, c dbSNP:193165407
5391 5391 a, g dbSNP:747741322
5396 5396 a, g dbSNP:571471772
5410 5410 a, g dbSNP:560959350
5472 5472 a, g dbSNP:367962443
5517 5517 a, g dbSNP:543935297
5542 5542 -, tat dbSNP:564290244
5594 5594 c, t dbSNP:575280579
5679 5679 -, ttct dbSNP:560881577
5696 5696 a, t dbSNP:113940104
5711 5711 c, t dbSNP:374389912
5727 5727 a, t dbSNP:372430235
5745 5745 c, t dbSNP:374318992
5757 5757 a, g dbSNP:73991940
5784 5784 c, t dbSNP:545980168
5792 5792 c, g dbSNP:746812029
5807 5807 a, t dbSNP:577034037
5811 5811 g, t dbSNP:368664791
5868 5868 c, t dbSNP:59115933
5882 5882 a, g dbSNP:554909015
5887 5887 g, t dbSNP:754698039
5891 5891 a, g dbSNP:568330176
5903 5903 a, t dbSNP:554933640
5996 5996 a, t dbSNP:537881525
6043 6043 a, g dbSNP:569331035
6050 6050 a, c dbSNP:552744287
6066 6066 -, aa dbSNP:772163923
6097 6097 a, g dbSNP:374453575
6140 6140 c, g dbSNP:145338121
6169 6169 a, g dbSNP:566674578
6248 6248 c, g dbSNP:546886816
6286 6286 a, g dbSNP:746869920
6287 6287 a, t dbSNP:190169023
6297 6297 c, t dbSNP:780101170
6314 6314 c, t dbSNP:114037902
6341 6341 a, g dbSNP:546189831
6354 6354 a, g dbSNP:758416895
6362 6362 g, t dbSNP:184666432
6425 6425 a, g dbSNP:778892658
6428 6428 c, t dbSNP:192638855
6430 6430 a, g dbSNP:754507753
6458 6458 c, t dbSNP:140267868
6501 6501 a, g dbSNP:564955157

Target ORF information:

RefSeq Version XM_011525332
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu73257
Accession Version XM_011525333.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1413..3383(+)
Misc Feature(2)1422..1925(+)
Misc Feature(3)2778..3335(+)
Position Chain Variation Link
30 30 a, g dbSNP:7503488
43 43 a, t dbSNP:756872543
63 63 a, g dbSNP:76551053
78 78 -, gcttaaagat dbSNP:548678896
96 96 c, t dbSNP:755855605
108 108 c, g dbSNP:145073204
132 132 a, g dbSNP:764398336
141 141 a, g dbSNP:752502969
142 142 a, g dbSNP:560765726
184 184 -, tg dbSNP:544121197
207 207 a, g dbSNP:370923463
213 213 c, t dbSNP:141306575
215 215 c, g dbSNP:530468488
216 216 c, g dbSNP:565185322
262 262 c, t dbSNP:545287870
280 280 -, t dbSNP:3840867
281 281 -, t dbSNP:34753867
281 281 c, t dbSNP:759466028
281 281 -, t dbSNP:559771069
346 346 c, t dbSNP:376399814
355 355 c, t dbSNP:376981898
389 389 g, t dbSNP:572973022
426 426 c, t dbSNP:775977840
447 447 -, t dbSNP:112243287
471 471 c, g dbSNP:559475592
480 480 a, g dbSNP:2048718
488 488 a, c dbSNP:180948389
513 513 a, c dbSNP:554590681
550 550 c, g dbSNP:79220357
555 555 c, t dbSNP:4988339
558 558 c, t dbSNP:148498140
568 568 a, g dbSNP:761838059
622 622 c, t dbSNP:558845941
647 647 c, g, t dbSNP:371225829
659 659 a, c dbSNP:377620948
676 676 a, g dbSNP:754270436
681 681 a, g dbSNP:764585550
685 685 c, t dbSNP:751194347
690 690 a, g dbSNP:45512093
704 704 a, c, t dbSNP:752411477
709 709 c, t dbSNP:786203418
710 710 c, t dbSNP:767215118
713 713 c, t dbSNP:759187663
716 716 c, g, t dbSNP:45566938
727 727 a, g dbSNP:587781387
731 731 c, t dbSNP:762827371
749 749 a, g dbSNP:45458996
763 763 a, t dbSNP:786202674
767 767 a, g dbSNP:769585673
768 768 a, g dbSNP:747867580
774 774 a, t dbSNP:776386693
777 777 c, t dbSNP:772319724
781 781 c, g dbSNP:786201468
783 783 a, g dbSNP:373104267
788 788 a, c dbSNP:774586397
801 801 c, t dbSNP:770930270
806 806 c, t dbSNP:749323434
810 810 c, t dbSNP:758270108
813 813 a, g, t dbSNP:587781292
819 819 a, c, g dbSNP:28903098
821 821 -, c dbSNP:587782065
823 823 a, c dbSNP:755317452
838 838 gc, tt dbSNP:786202417
838 838 g, t dbSNP:751182362
839 839 c, t dbSNP:779686432
843 843 a, g dbSNP:757909937
853 853 a, g dbSNP:749920386
861 861 g, t dbSNP:765205377
864 864 g, t dbSNP:786202861
866 866 a, g dbSNP:764252214
873 873 c, t dbSNP:575595017
875 875 a, g dbSNP:141436143
881 881 c, t dbSNP:763819127
885 885 a, g dbSNP:372581879
892 892 c, t dbSNP:779629295
905 905 c, t dbSNP:186802750
906 906 a, g dbSNP:769573395
920 920 g, t dbSNP:745422385
924 924 a, g dbSNP:565078834
927 927 c, t dbSNP:756707967
929 929 -, attacc dbSNP:759174262
929 929 a, g dbSNP:45528833
934 934 c, t dbSNP:587781830
938 938 -, ttgttgtgcatg dbSNP:730881648
942 942 -, tgt dbSNP:587781388
947 947 a, g dbSNP:764027029
954 954 c, t dbSNP:755930156
956 956 a, g dbSNP:786202281
961 961 a, g dbSNP:529201896
970 970 -, acaa dbSNP:763009188
971 971 c, g dbSNP:766561078
973 973 a, g dbSNP:781121675
976 976 a, t dbSNP:773532701
977 977 c, t dbSNP:201617644
979 979 c, t dbSNP:587782427
987 987 a, g dbSNP:777068696
992 992 g, t dbSNP:769190318
996 996 c, t dbSNP:587780247
997 997 a, g dbSNP:143615668
998 998 a, t dbSNP:772283705
1006 1006 a, g dbSNP:587782734
1012 1012 a, c dbSNP:201790351
1018 1018 c, t dbSNP:778480809
1022 1022 a, g dbSNP:756764576
1027 1027 c, g dbSNP:748793974
1029 1029 g, t dbSNP:786203890
1037 1037 c, t dbSNP:786202477
1039 1039 a, g dbSNP:730881637
1042 1042 c, g dbSNP:777630298
1050 1050 a, c, g dbSNP:45617634
1066 1066 c, t dbSNP:587780831
1067 1067 c, t dbSNP:779324498
1074 1074 -, a dbSNP:587781416
1074 1074 a, t dbSNP:730881623
1075 1075 a, c dbSNP:753965650
1077 1077 a, t dbSNP:764256720
1092 1092 c, t dbSNP:786201292
1093 1093 c, t dbSNP:587780251
1095 1095 g, t dbSNP:202072866
1106 1106 a, g dbSNP:768008017
1110 1110 a, g dbSNP:116952709
1117 1117 c, t dbSNP:774677996
1118 1118 ata, ct dbSNP:786203429
1120 1120 -, a dbSNP:786203521
1126 1126 a, g dbSNP:770613242
1128 1128 a, g dbSNP:762701532
1137 1137 a, g dbSNP:772695469
1143 1143 c, t dbSNP:587781786
1153 1153 a, c dbSNP:769364081
1161 1161 a, g dbSNP:786203916
1164 1164 c, t dbSNP:747604569
1165 1165 a, g, t dbSNP:61757643
1169 1169 c, g dbSNP:746838904
1175 1175 a, c dbSNP:780024960
1180 1180 c, t dbSNP:758218234
1182 1182 c, t dbSNP:748211848
1197 1197 c, t dbSNP:4988345
1198 1198 a, g dbSNP:761432927
1200 1200 c, t dbSNP:776248182
1203 1203 a, t dbSNP:546727788
1206 1206 g, t dbSNP:746963627
1217 1217 a, g dbSNP:775509896
1230 1230 a, g, t dbSNP:201047375
1233 1233 a, g dbSNP:745645356
1235 1235 a, c dbSNP:778116059
1236 1236 a, g dbSNP:730881624
1241 1241 c, t dbSNP:786201596
1249 1249 a, g dbSNP:756269682
1252 1252 a, g dbSNP:748268716
1256 1256 c, t dbSNP:781282996
1257 1257 a, g dbSNP:4988346
1264 1264 c, t dbSNP:4988347
1267 1267 a, g dbSNP:550707862
1268 1268 c, t dbSNP:758851721
1269 1269 c, t dbSNP:530897769
1270 1270 c, t dbSNP:533184563
1275 1275 c, t dbSNP:144969738
1284 1284 a, g dbSNP:778275257
1290 1290 g, t dbSNP:761401027
1291 1291 c, t dbSNP:776372251
1292 1292 c, g dbSNP:587780832
1297 1297 c, t dbSNP:565458815
1298 1298 a, g, t dbSNP:367614726
1299 1299 c, t dbSNP:775636640
1301 1301 a, g dbSNP:771891225
1306 1306 a, g dbSNP:748912293
1308 1308 c, t dbSNP:150313156
1309 1309 a, c, t dbSNP:140097800
1312 1312 c, t dbSNP:780026145
1313 1313 -, t dbSNP:779466229
1317 1317 c, t dbSNP:772140734
1318 1318 a, g dbSNP:376760085
1321 1321 c, g dbSNP:779409059
1324 1324 a, c dbSNP:12947398
1328 1328 a, g dbSNP:202035881
1330 1330 g, t dbSNP:587782156
1333 1333 a, g dbSNP:754242563
1335 1335 c, t dbSNP:730881630
1336 1336 a, g dbSNP:587782238
1341 1341 a, g dbSNP:777618772
1342 1342 c, g dbSNP:373774920
1347 1347 c, t dbSNP:786201733
1348 1348 a, g dbSNP:786203708
1352 1352 a, g dbSNP:752356873
1354 1354 -, a dbSNP:757771711
1359 1359 c, g dbSNP:45459799
1369 1369 c, t dbSNP:759031349
1370 1370 a, g dbSNP:751460179
1371 1371 a, g dbSNP:766340391
1375 1375 c, g dbSNP:762781085
1376 1376 a, c dbSNP:772957320
1377 1377 a, g dbSNP:769535320
1381 1381 a, g dbSNP:587780834
1382 1382 a, g dbSNP:45512798
1388 1388 c, t dbSNP:775721645
1391 1391 c, t dbSNP:772048413
1393 1393 c, t dbSNP:745955726
1394 1394 a, g dbSNP:548018916
1401 1401 c, t dbSNP:771542690
1408 1408 c, t dbSNP:587781860
1412 1412 a, c dbSNP:786202300
1416 1416 a, g dbSNP:376893571
1420 1420 a, g dbSNP:756499865
1431 1431 c, t dbSNP:752309409
1432 1432 a, g dbSNP:780834054
1449 1449 g, t dbSNP:754515912
1458 1458 a, g dbSNP:138743097
1470 1470 c, t dbSNP:28997569
1471 1471 a, g dbSNP:758360637
1475 1475 a, g dbSNP:61754143
1477 1477 c, t dbSNP:550031006
1480 1480 c, t dbSNP:730881631
1484 1484 g, t dbSNP:587782514
1496 1496 a, g dbSNP:765027420
1497 1497 a, c dbSNP:587781797
1500 1500 a, g dbSNP:62620988
1503 1503 a, g dbSNP:587781425
1511 1511 c, g dbSNP:45549332
1517 1517 g, t dbSNP:759584091
1525 1525 c, g dbSNP:45624635
1528 1528 a, g dbSNP:771096783
1532 1532 c, t dbSNP:144940449
1534 1534 a, g dbSNP:141055990
1536 1536 c, t dbSNP:770289817
1544 1544 a, g dbSNP:748545827
1547 1547 c, t dbSNP:147739458
1548 1548 a, g dbSNP:145601931
1549 1549 a, g dbSNP:148556781
1558 1558 a, g dbSNP:746599076
1570 1570 -, a dbSNP:786202610
1570 1570 a, g dbSNP:28997570
1577 1577 a, g dbSNP:137852985
1582 1582 c, g, t dbSNP:750376292
1592 1592 a, g dbSNP:786201326
1601 1601 a, g dbSNP:786202337
1604 1604 a, g dbSNP:374974885
1612 1612 -, a dbSNP:587778138
1612 1612 a, g dbSNP:587782731
1621 1621 a, g dbSNP:112076926
1639 1639 a, g dbSNP:746681841
1644 1644 c, t dbSNP:587778139
1652 1652 a, t dbSNP:779627397
1655 1655 a, g dbSNP:771630777
1664 1664 c, t dbSNP:745379285
1666 1666 a, g dbSNP:778863018
1672 1672 g, t dbSNP:587782771
1673 1673 a, g dbSNP:587780252
1677 1677 a, g dbSNP:757196702
1680 1680 a, g, t dbSNP:535414791
1685 1685 a, g dbSNP:786201808
1692 1692 c, g dbSNP:777653224
1698 1698 c, t dbSNP:755796609
1711 1711 a, g dbSNP:751841684
1720 1720 c, t dbSNP:786201819
1725 1725 c, g dbSNP:149364097
1727 1727 c, t dbSNP:763189201
1733 1733 a, g dbSNP:544977115
1734 1734 c, t dbSNP:730881632
1735 1735 a, g dbSNP:762417690
1741 1741 c, t dbSNP:776939714
1746 1746 c, t dbSNP:730881633
1747 1747 -, g dbSNP:751209171
1749 1749 g, t dbSNP:769081927
1750 1750 -, ttac dbSNP:766110015
1751 1751 a, g dbSNP:761017296
1752 1752 -, agtcca dbSNP:762883121
1752 1752 a, c dbSNP:775191379
1754 1754 a, c dbSNP:771682192
1757 1757 a, g dbSNP:730881634
1762 1762 -, a dbSNP:587781639
1763 1763 c, t dbSNP:745432312
1769 1769 c, t dbSNP:139701369
1770 1770 a, t dbSNP:770306753
1773 1773 a, g dbSNP:749251680
1785 1785 c, t dbSNP:587781325
1786 1786 a, g dbSNP:786202218
1789 1789 a, g dbSNP:777511615
1794 1794 a, ct dbSNP:587783377
1794 1794 a, c dbSNP:786202637
1797 1797 c, t dbSNP:755992778
1804 1804 c, t dbSNP:786202192
1806 1806 -, ca dbSNP:587780224
1819 1819 a, g, t dbSNP:569696977
1833 1833 c, t dbSNP:748001678
1836 1836 a, t dbSNP:730881635
1845 1845 a, g dbSNP:587780825
1848 1848 a, g dbSNP:781168634
1850 1850 c, t dbSNP:754755989
1856 1856 a, g dbSNP:550092661
1864 1864 a, c dbSNP:778992385
1869 1869 a, c dbSNP:587782039
1872 1872 a, g dbSNP:786203967
1874 1874 c, t dbSNP:757427498
1875 1875 a, g dbSNP:587782816
1878 1878 g, t dbSNP:764711572
1881 1881 c, t dbSNP:756636362
1884 1884 -, tgtg dbSNP:730881647
1887 1887 c, t dbSNP:369631413
1888 1888 a, g dbSNP:786202780
1897 1897 c, t dbSNP:767872861
1900 1900 a, g dbSNP:759835916
1906 1906 g, t dbSNP:587782247
1910 1910 -, aacagaagttcagcttcggttt dbSNP:786202415
1918 1918 c, t dbSNP:45576134
1920 1920 c, t dbSNP:368796923
1926 1926 c, t dbSNP:587780225
1927 1927 a, g dbSNP:772570870
1935 1935 c, t dbSNP:150624408
1936 1936 a, g dbSNP:748105919
1937 1937 a, g dbSNP:148429663
1944 1944 a, c dbSNP:768633507
1948 1948 a, g dbSNP:746778889
1963 1963 a, c dbSNP:779237423
1966 1966 a, c dbSNP:587781463
1976 1976 a, g dbSNP:757400610
1984 1984 a, g dbSNP:730881636
1992 1992 a, c, t dbSNP:756119073
1995 1995 c, t dbSNP:587780226
1996 1996 a, g dbSNP:753214212
2012 2012 c, t dbSNP:200581792
2016 2016 a, c dbSNP:786203496
2023 2023 a, g dbSNP:775171520
2032 2032 c, t dbSNP:771861055
2036 2036 c, t dbSNP:730881640
2037 2037 a, g dbSNP:587780227
2041 2041 a, t dbSNP:769918040
2042 2042 a, c dbSNP:786202553
2043 2043 a, t dbSNP:587780826
2049 2049 c, g dbSNP:748221377
2052 2052 g, t dbSNP:587780228
2055 2055 a, c, g dbSNP:752052351
2057 2057 a, c dbSNP:780310294
2060 2060 c, t dbSNP:758735370
2063 2063 c, g, t dbSNP:587780875
2081 2081 a, g dbSNP:764979728
2105 2105 -, aactt dbSNP:768736851
2112 2112 c, t dbSNP:761452695
2113 2113 a, g dbSNP:45501097
2121 2121 g, t dbSNP:587780229
2122 2122 a, g, t dbSNP:200062099
2123 2123 c, t dbSNP:775431508
2124 2124 a, g dbSNP:142744352
2126 2126 c, t dbSNP:759360709
2135 2135 c, t dbSNP:773489367
2147 2147 g, t dbSNP:587780230
2164 2164 c, t dbSNP:536081549
2165 2165 g, t dbSNP:370658123
2179 2179 a, g dbSNP:746329838
2190 2190 -, a dbSNP:775735278
2191 2191 c, t dbSNP:755306832
2222 2222 a, g dbSNP:779454200
2230 2230 c, t dbSNP:786202169
2232 2232 a, g dbSNP:786201701
2239 2239 c, g dbSNP:757629526
2240 2240 a, t dbSNP:730881638
2251 2251 a, g dbSNP:587781726
2254 2254 -, t dbSNP:772248310
2262 2262 a, g dbSNP:748962730
2266 2266 a, g dbSNP:138784299
2271 2271 a, c dbSNP:4988350
2285 2285 c, g dbSNP:56024614
2296 2296 a, g, t dbSNP:199616792
2299 2299 a, t dbSNP:4988349
2303 2303 c, t dbSNP:786203897
2306 2306 c, t dbSNP:373709958
2321 2321 g, t dbSNP:754414731
2323 2323 a, g dbSNP:587782405
2324 2324 c, t dbSNP:372760869
2330 2330 g, t dbSNP:587782254
2331 2331 c, g dbSNP:766302517
2332 2332 c, t dbSNP:375246789
2333 2333 a, g dbSNP:750213758
2335 2335 c, t dbSNP:369340666
2340 2340 c, g dbSNP:777217004
2341 2341 -, a dbSNP:749762964
2346 2346 c, t dbSNP:752797989
2352 2352 c, t dbSNP:767648925
2364 2364 a, g dbSNP:45533636
2367 2367 -, gat dbSNP:780590493
2368 2368 a, g dbSNP:577768294
2371 2371 c, t dbSNP:755635967
2372 2372 c, t dbSNP:786202979
2375 2375 a, c dbSNP:142572387
2384 2384 g, t dbSNP:763458922
2386 2386 c, g dbSNP:373228183
2390 2390 a, g dbSNP:370087045
2391 2391 -, ttg dbSNP:754566378
2397 2397 c, g dbSNP:786202587
2401 2401 c, t dbSNP:377302300
2407 2407 -, a dbSNP:587778131
2407 2407 a, g dbSNP:587778132
2411 2411 a, g dbSNP:587780829
2414 2414 a, g dbSNP:786202592
2415 2415 c, t dbSNP:28997571
2416 2416 a, g dbSNP:768224857
2418 2418 g, t dbSNP:746494295
2421 2421 c, t dbSNP:780020495
2422 2422 a, g dbSNP:587778133
2425 2425 a, g dbSNP:750288231
2432 2432 c, t dbSNP:778774207
2434 2434 a, c dbSNP:756946068
2454 2454 g, t dbSNP:587780231
2456 2456 a, g dbSNP:753023295
2461 2461 c, t dbSNP:587781559
2464 2464 a, g dbSNP:759727507
2470 2470 c, t dbSNP:751667661
2477 2477 c, t dbSNP:771672834
2478 2478 c, t dbSNP:745367580
2480 2480 g, t dbSNP:375625993
2484 2484 g, t dbSNP:770750488
2489 2489 c, t dbSNP:370393808
2503 2503 a, g dbSNP:112505689
2505 2505 a, g dbSNP:189758577
2508 2508 a, g dbSNP:749200646
2511 2511 a, g dbSNP:777741543
2533 2533 -, g dbSNP:587781985
2551 2551 a, c, t dbSNP:587781321
2552 2552 a, g dbSNP:145504336
2568 2568 -, a dbSNP:763818712
2569 2569 a, c dbSNP:780407946
2570 2570 a, g dbSNP:145796331
2577 2577 a, c, g dbSNP:765314472
2578 2578 c, t dbSNP:587780232
2579 2579 c, g dbSNP:28997572
2583 2583 c, t dbSNP:754280136
2589 2589 g, t dbSNP:541203428
2594 2594 c, t dbSNP:764456240
2597 2597 c, t dbSNP:763534423
2620 2620 a, t dbSNP:554791910
2621 2621 a, g dbSNP:538015264
2681 2681 g, t dbSNP:786202760
2682 2682 a, g dbSNP:780475484
2686 2686 a, c, g dbSNP:746066323
2691 2691 a, g dbSNP:778867622
2692 2692 c, t dbSNP:757305097
2693 2693 c, t dbSNP:754400631
2696 2696 a, g dbSNP:778250103
2698 2698 c, t dbSNP:756511744
2702 2702 c, t dbSNP:786201877
2703 2703 c, t dbSNP:753036322
2704 2704 c, g dbSNP:767872111
2710 2710 -, g dbSNP:760782298
2712 2712 c, t dbSNP:786203170
2713 2713 a, g dbSNP:759142191
2724 2724 a, g dbSNP:571340013
2729 2729 a, c dbSNP:376628979
2733 2733 -, c dbSNP:34224865
2736 2736 a, g dbSNP:765816425
2750 2750 -, t dbSNP:775537066
2750 2750 a, t dbSNP:762535496
2752 2752 a, g dbSNP:587778135
2758 2758 a, g dbSNP:786203619
2768 2768 c, g dbSNP:786202395
2778 2778 c, t dbSNP:786203872
2779 2779 -, tt dbSNP:587778134
2787 2787 c, g dbSNP:773347072
2796 2796 a, g dbSNP:769820537
2801 2801 c, g dbSNP:112414873
2807 2807 a, g dbSNP:556955136
2811 2811 a, c dbSNP:587782356
2827 2827 c, t dbSNP:147755155
2828 2828 a, t dbSNP:768436074
2840 2840 a, g dbSNP:766047812
2847 2847 a, c dbSNP:762590242
2848 2848 -, cc dbSNP:760863397
2848 2848 a, t dbSNP:756412722
2848 2848 a, tcc dbSNP:786203384
2859 2859 c, t dbSNP:764803896
2860 2860 a, g, t dbSNP:200313471
2869 2869 c, t dbSNP:768393936
2871 2871 a, g dbSNP:760515227
2892 2892 c, g dbSNP:774478325
2895 2895 c, t dbSNP:771122056
2904 2904 -, acag dbSNP:778385829
2907 2907 a, g dbSNP:145616741
2909 2909 c, t dbSNP:749460936
2912 2912 c, t dbSNP:777860588
2913 2913 -, gtagaa dbSNP:770198861
2919 2919 c, t dbSNP:769797684
2929 2929 a, g dbSNP:748616469
2933 2933 a, g dbSNP:781712098
2950 2950 a, g dbSNP:755361298
2956 2956 c, t dbSNP:587780234
2957 2957 g, t dbSNP:747365105
2960 2960 c, g, t dbSNP:45589637
2968 2968 a, c, g dbSNP:750033391
2972 2972 c, t dbSNP:374362388
2973 2973 a, g dbSNP:587780235
2976 2976 a, g dbSNP:111536363
2977 2977 -, tcaa dbSNP:587782726
2987 2987 a, t dbSNP:587782556
2989 2989 g, t dbSNP:764061653
2991 2991 c, g dbSNP:760438320
2995 2995 -, aa dbSNP:730881649
2998 2998 a, g dbSNP:745578572
3013 3013 -, t dbSNP:587780236
3014 3014 a, g dbSNP:786201526
3024 3024 c, t dbSNP:587778136
3025 3025 a, g, t dbSNP:200960251
3026 3026 c, t dbSNP:61754141
3028 3028 a, g dbSNP:371484780
3035 3035 a, g dbSNP:752509701
3036 3036 a, g dbSNP:371227751
3041 3041 a, c, g dbSNP:369434185
3050 3050 c, t dbSNP:148752066
3053 3053 -, ctcagat dbSNP:758128094
3057 3057 a, g dbSNP:146091205
3064 3064 a, g dbSNP:571108955
3065 3065 g, t dbSNP:375146450
3068 3068 c, t dbSNP:786203725
3069 3069 c, g, t dbSNP:768555161
3070 3070 a, g dbSNP:747568830
3078 3078 a, c dbSNP:776131401
3083 3083 a, g dbSNP:772636536
3084 3084 a, g dbSNP:142806416
3085 3085 c, t dbSNP:778758437
3104 3104 a, t dbSNP:587783045
3110 3110 a, g dbSNP:372122365
3116 3116 a, g dbSNP:554514054
3117 3117 c, t dbSNP:587782574
3122 3122 g, t dbSNP:560088455
3130 3130 a, g dbSNP:730881622
3132 3132 c, t dbSNP:137852986
3133 3133 a, g dbSNP:375082407
3134 3134 a, t dbSNP:540236878
3140 3140 c, g, t dbSNP:574552037
3146 3146 a, c, t dbSNP:748981650
3149 3149 c, t dbSNP:762039913
3151 3151 a, g dbSNP:777277034
3155 3155 a, c dbSNP:769413097
3156 3156 a, g dbSNP:747622456
3159 3159 c, t dbSNP:786201708
3162 3162 a, g dbSNP:587780237
3163 3163 g, t dbSNP:781153382
3167 3167 c, t dbSNP:754927538
3168 3168 c, g dbSNP:587780238
3173 3173 a, t dbSNP:751455420
3174 3174 c, t dbSNP:779915262
3180 3180 c, t dbSNP:201869624
3181 3181 a, g dbSNP:45468199
3185 3185 a, g dbSNP:764195906
3187 3187 a, g dbSNP:786204250
3204 3204 c, t dbSNP:760887592
3205 3205 a, g dbSNP:587781572
3208 3208 g, t dbSNP:45479297
3209 3209 a, g, t dbSNP:587780239
3212 3212 c, t dbSNP:767666616
3217 3217 a, g dbSNP:760127237
3218 3218 c, t dbSNP:774939280
3219 3219 a, c dbSNP:786203898
3232 3232 a, g dbSNP:771382903
3234 3234 c, t dbSNP:768222842
3235 3235 a, g dbSNP:4988355
3237 3237 a, g dbSNP:199831248
3243 3243 c, g dbSNP:746492294
3245 3245 c, t dbSNP:775547651
3249 3249 a, c dbSNP:771929845
3264 3264 c, t dbSNP:786201802
3282 3282 a, c, t dbSNP:45572934
3283 3283 a, g dbSNP:374334794
3285 3285 c, t dbSNP:786202317
3293 3293 g, t dbSNP:587781793
3294 3294 a, g dbSNP:745782331
3303 3303 c, t dbSNP:146031731
3304 3304 a, g, t dbSNP:200894063
3307 3307 a, g dbSNP:781556845
3308 3308 c, t dbSNP:370175724
3309 3309 a, g dbSNP:28904918
3310 3310 c, t dbSNP:766432760
3319 3319 c, t dbSNP:587780242
3322 3322 c, g dbSNP:774415723
3326 3326 a, g dbSNP:745318756
3330 3330 a, g dbSNP:149529390
3333 3333 c, t dbSNP:578022079
3334 3334 a, g dbSNP:781609846
3335 3335 -, g dbSNP:587781974
3338 3338 a, g dbSNP:769021796
3339 3339 a, c dbSNP:182028200
3340 3340 a, g dbSNP:747213803
3351 3351 c, t dbSNP:786203288
3353 3353 c, t dbSNP:199721657
3355 3355 c, t dbSNP:587781964
3357 3357 a, g dbSNP:758444508
3367 3367 a, g dbSNP:750961319
3371 3371 a, g dbSNP:786201336
3377 3377 a, g dbSNP:4986765
3390 3390 a, t dbSNP:587780243
3402 3402 c, t dbSNP:757668121
3411 3411 a, g dbSNP:754224663
3424 3424 -, ccat dbSNP:760551339
3426 3426 a, g dbSNP:764406913
3429 3429 a, g dbSNP:587781644
3433 3433 a, t dbSNP:752340544
3446 3446 a, g dbSNP:587780244
3456 3456 a, g dbSNP:759080195
3461 3461 a, t dbSNP:774467171
3463 3463 c, t dbSNP:786201919
3465 3465 c, g dbSNP:587781853
3466 3466 c, t dbSNP:770966270
3470 3470 a, g dbSNP:570751937
3472 3472 -, t dbSNP:752780954
3475 3475 a, c dbSNP:571949350
3488 3488 c, t dbSNP:555200296
3491 3491 c, t dbSNP:150780318
3493 3493 a, c, t dbSNP:587781298
3495 3495 c, t dbSNP:4986764
3505 3505 g, t dbSNP:587782410
3512 3512 a, c dbSNP:730881625
3526 3526 g, t dbSNP:772087074
3531 3531 a, c dbSNP:745940032
3541 3541 c, t dbSNP:778916092
3544 3544 g, t dbSNP:4988356
3546 3546 a, g dbSNP:754280048
3551 3551 c, t dbSNP:374335608
3552 3552 a, g dbSNP:199643061
3556 3556 c, g dbSNP:756490117
3560 3560 a, g dbSNP:786201396
3563 3563 -, a dbSNP:767549540
3565 3565 a, g dbSNP:370330739
3568 3568 c, t dbSNP:786204143
3569 3569 c, g, t dbSNP:767164240
3570 3570 c, g, t dbSNP:140233356
3571 3571 a, c, g dbSNP:148232408
3575 3575 a, g dbSNP:786203633
3581 3581 a, g dbSNP:786201414
3587 3587 c, t dbSNP:45499991
3591 3591 a, g dbSNP:730881626
3594 3594 a, g dbSNP:200239986
3597 3597 a, c dbSNP:587780245
3598 3598 c, t dbSNP:201672040
3599 3599 a, c dbSNP:786201685
3603 3603 a, c dbSNP:587782244
3606 3606 c, t dbSNP:74824981
3607 3607 c, g dbSNP:761639530
3610 3610 c, t dbSNP:786203077
3611 3611 c, t dbSNP:786202095
3613 3613 a, t dbSNP:145859791
3623 3623 c, t dbSNP:367728797
3625 3625 c, t dbSNP:786201632
3633 3633 a, c, g dbSNP:113697814
3642 3642 a, g dbSNP:587782679
3654 3654 a, g dbSNP:786203224
3670 3670 c, t dbSNP:770352467
3673 3673 a, g dbSNP:587780246
3675 3675 a, g dbSNP:730881627
3677 3677 a, g dbSNP:75091137
3679 3679 c, t dbSNP:781622986
3687 3687 -, a dbSNP:774684620
3687 3687 a, t dbSNP:755337038
3688 3688 a, t dbSNP:587781417
3689 3689 g, t dbSNP:746715917
3697 3697 c, g dbSNP:182087528
3703 3703 c, t dbSNP:758032378
3730 3730 -, caaa dbSNP:771028677
3730 3730 c, t dbSNP:749978235
3731 3731 a, g dbSNP:45466996
3732 3732 -, aaga dbSNP:786203717
3734 3734 c, g dbSNP:757225144
3744 3744 -, tgacagct dbSNP:763443434
3745 3745 a, g dbSNP:753664225
3746 3746 c, g, t dbSNP:546083449
3749 3749 a, g dbSNP:751823379
3751 3751 a, g dbSNP:766562396
3765 3765 a, g, t dbSNP:587781328
3767 3767 a, g dbSNP:786201171
3782 3782 c, t dbSNP:188258913
3783 3783 a, g dbSNP:769692303
3790 3790 c, t dbSNP:747907706
3791 3791 a, g dbSNP:776990704
3804 3804 a, g dbSNP:587782808
3808 3808 c, t dbSNP:747345595
3809 3809 c, t dbSNP:61754142
3810 3810 a, g dbSNP:147119272
3811 3811 g, t dbSNP:587781744
3812 3812 a, g, t dbSNP:778500245
3816 3816 c, t dbSNP:756712872
3818 3818 a, g dbSNP:786201657
3819 3819 a, g dbSNP:371185409
3821 3821 a, g dbSNP:777660106
3826 3826 c, g dbSNP:755949409
3826 3826 -, g dbSNP:773433456
3829 3829 c, g, t dbSNP:767255426
3836 3836 g, t dbSNP:763162379
3839 3839 c, t dbSNP:202228407
3840 3840 a, c dbSNP:765416041
3843 3843 c, t dbSNP:45437094
3844 3844 a, g dbSNP:367816363
3857 3857 a, g dbSNP:769310105
3862 3862 c, t dbSNP:761225576
3864 3864 a, g dbSNP:776002434
3880 3880 c, t dbSNP:786203344
3885 3885 c, t dbSNP:772507914
3889 3889 a, c dbSNP:373040333
3918 3918 a, g dbSNP:149016505
3921 3921 a, c dbSNP:778430337
3925 3925 c, t dbSNP:770517912
3928 3928 c, t dbSNP:575998972
3935 3935 a, g dbSNP:45540240
3936 3936 -, t dbSNP:730881645
3948 3948 -, t dbSNP:748598593
3949 3949 c, t dbSNP:777213170
3954 3954 a, g dbSNP:756074244
3955 3955 a, c dbSNP:786204068
3963 3963 a, t dbSNP:368867532
3964 3964 c, t dbSNP:183928474
3972 3972 a, t dbSNP:786202927
3974 3974 a, g, t dbSNP:570238270
3976 3976 c, t dbSNP:150813402
3977 3977 g, t dbSNP:587781666
3978 3978 a, g dbSNP:786204230
3980 3980 -, t dbSNP:779741278
3983 3983 c, t dbSNP:754003636
4000 4000 -, a dbSNP:771654971
4000 4000 a, g dbSNP:786202024
4005 4005 g, t dbSNP:764205156
4006 4006 c, t dbSNP:761278503
4012 4012 a, g dbSNP:776129117
4014 4014 c, t dbSNP:768065626
4015 4015 c, t dbSNP:587780830
4016 4016 a, g dbSNP:375911315
4025 4025 c, t dbSNP:774105218
4029 4029 c, g dbSNP:770509300
4034 4034 c, t dbSNP:748928248
4036 4036 g, t dbSNP:772709195
4038 4038 a, g dbSNP:587781923
4045 4045 a, g dbSNP:748140041
4048 4048 c, t dbSNP:781102464
4056 4056 c, t dbSNP:111943191
4071 4071 c, g dbSNP:587780248
4076 4076 c, t dbSNP:369843642
4089 4089 g, t dbSNP:779860140
4094 4094 c, t dbSNP:757427210
4107 4107 a, g dbSNP:754056526
4114 4114 -, cag dbSNP:745344948
4118 4118 a, c dbSNP:145855459
4122 4122 a, g dbSNP:45552539
4128 4128 a, t dbSNP:786202549
4130 4130 -, ctat dbSNP:778664039
4141 4141 -, c dbSNP:756853672
4143 4143 a, g dbSNP:369340444
4151 4151 c, t dbSNP:4986763
4152 4152 a, g, t dbSNP:587780249
4171 4171 a, g dbSNP:774605759
4176 4176 a, g dbSNP:786202247
4180 4180 -, a dbSNP:753683450
4184 4184 a, c dbSNP:28997573
4188 4188 c, g dbSNP:757363615
4199 4199 c, t dbSNP:4987050
4200 4200 a, g dbSNP:769359514
4204 4204 a, g dbSNP:45603843
4208 4208 c, t dbSNP:747624574
4210 4210 c, g dbSNP:776599258
4215 4215 g, t dbSNP:368610199
4220 4220 c, t dbSNP:746898528
4229 4229 c, t dbSNP:144245485
4233 4233 a, c dbSNP:771889454
4243 4243 a, c dbSNP:749589266
4245 4245 g, t dbSNP:587782029
4247 4247 a, c dbSNP:375741316
4248 4248 c, g dbSNP:587782552
4261 4261 c, g dbSNP:786202662
4263 4263 a, g dbSNP:372799558
4265 4265 -, t dbSNP:777367075
4269 4269 a, c dbSNP:756313788
4271 4271 a, g dbSNP:181186298
4273 4273 a, t dbSNP:752850661
4275 4275 a, g dbSNP:781289228
4286 4286 c, t dbSNP:755440956
4295 4295 a, g dbSNP:752044406
4296 4296 a, g dbSNP:766709841
4297 4297 a, g dbSNP:763298204
4299 4299 a, g dbSNP:367610893
4302 4302 a, g dbSNP:786201962
4307 4307 c, t dbSNP:764848326
4311 4311 a, g dbSNP:761405340
4330 4330 a, g dbSNP:587781677
4339 4339 a, g dbSNP:730881628
4345 4345 a, g dbSNP:776010326
4347 4347 at, ga dbSNP:587782615
4355 4355 a, t dbSNP:768156067
4360 4360 a, t dbSNP:139539831
4362 4362 a, g dbSNP:760589795
4367 4367 a, t dbSNP:548674096
4369 4369 a, g dbSNP:112214651
4376 4376 c, t dbSNP:374392860
4384 4384 c, t dbSNP:771805501
4387 4387 -, c dbSNP:756079324
4391 4391 a, g, t dbSNP:542698396
4402 4402 g, t dbSNP:778805688
4404 4404 -, g dbSNP:752586524
4405 4405 a, g dbSNP:770175142
4407 4407 c, g dbSNP:748310432
4416 4416 a, c dbSNP:781140410
4420 4420 a, g dbSNP:755069935
4421 4421 c, t dbSNP:370581038
4432 4432 g, t dbSNP:780578438
4441 4441 g, t dbSNP:587778137
4450 4450 c, t dbSNP:587781819
4451 4451 c, t dbSNP:786203915
4455 4455 c, t dbSNP:587781886
4457 4457 c, t dbSNP:758809865
4467 4467 g, t dbSNP:587780250
4468 4468 g, t dbSNP:765545033
4470 4470 -, at dbSNP:730881646
4470 4470 a, c dbSNP:761468878
4472 4472 a, g dbSNP:753516000
4483 4483 g, t dbSNP:763579793
4504 4504 g, t dbSNP:760202569
4512 4512 -, a dbSNP:755091088
4522 4522 c, t dbSNP:754001752
4529 4529 a, g dbSNP:202123733
4531 4531 c, g dbSNP:772160050
4537 4537 a, g dbSNP:759511390
4567 4567 a, c dbSNP:4988358
4577 4577 g, t dbSNP:557749565
4579 4579 g, t dbSNP:539702731
4580 4580 a, g dbSNP:569535272
4606 4606 g, t dbSNP:562726845
4618 4618 a, g dbSNP:150444311
4622 4622 a, g dbSNP:143361598
4625 4625 a, g dbSNP:775842351
4634 4634 c, g dbSNP:767771825
4641 4641 g, t dbSNP:538867472
4642 4642 g, t dbSNP:540229694
4643 4643 c, g dbSNP:113345004
4645 4645 -, t dbSNP:376507309
4648 4648 c, t dbSNP:1978111
4649 4649 c, t dbSNP:554326644
4655 4655 -, t dbSNP:111519368
4662 4662 c, g dbSNP:111898257
4664 4664 a, g dbSNP:774889346
4672 4672 -, ctgt dbSNP:551479702
4725 4725 c, t dbSNP:764128633
4753 4753 c, t dbSNP:774821210
4770 4770 c, g dbSNP:189935192
4773 4773 -, a dbSNP:531656835
4870 4870 c, t dbSNP:556729826
4886 4886 -, ct dbSNP:546666211
4950 4950 c, g dbSNP:539677174
4973 4973 c, t dbSNP:7213430
4978 4978 c, t dbSNP:772711204
4990 4990 g, t dbSNP:377169249
4999 4999 c, t dbSNP:533893805
5014 5014 a, g dbSNP:371689236
5082 5082 a, t dbSNP:568447515
5093 5093 c, t dbSNP:368711371
5106 5106 a, g dbSNP:116292412
5149 5149 a, g dbSNP:769375960
5150 5150 c, g dbSNP:569287586
5204 5204 g, t dbSNP:552378907
5219 5219 c, t dbSNP:137967725
5251 5251 g, t dbSNP:560463291
5264 5264 a, g dbSNP:376898714
5269 5269 c, t dbSNP:185040281
5342 5342 g, t dbSNP:540541914
5365 5365 a, c dbSNP:193165407
5387 5387 a, g dbSNP:747741322
5392 5392 a, g dbSNP:571471772
5406 5406 a, g dbSNP:560959350
5468 5468 a, g dbSNP:367962443
5513 5513 a, g dbSNP:543935297
5538 5538 -, tat dbSNP:564290244
5590 5590 c, t dbSNP:575280579
5675 5675 -, ttct dbSNP:560881577
5692 5692 a, t dbSNP:113940104
5707 5707 c, t dbSNP:374389912
5723 5723 a, t dbSNP:372430235
5741 5741 c, t dbSNP:374318992
5753 5753 a, g dbSNP:73991940
5780 5780 c, t dbSNP:545980168
5788 5788 c, g dbSNP:746812029
5803 5803 a, t dbSNP:577034037
5807 5807 g, t dbSNP:368664791
5864 5864 c, t dbSNP:59115933
5878 5878 a, g dbSNP:554909015
5883 5883 g, t dbSNP:754698039
5887 5887 a, g dbSNP:568330176
5899 5899 a, t dbSNP:554933640
5992 5992 a, t dbSNP:537881525
6039 6039 a, g dbSNP:569331035
6046 6046 a, c dbSNP:552744287
6062 6062 -, aa dbSNP:772163923
6093 6093 a, g dbSNP:374453575
6136 6136 c, g dbSNP:145338121
6165 6165 a, g dbSNP:566674578
6244 6244 c, g dbSNP:546886816
6282 6282 a, g dbSNP:746869920
6283 6283 a, t dbSNP:190169023
6293 6293 c, t dbSNP:780101170
6310 6310 c, t dbSNP:114037902
6337 6337 a, g dbSNP:546189831
6350 6350 a, g dbSNP:758416895
6358 6358 g, t dbSNP:184666432
6421 6421 a, g dbSNP:778892658
6424 6424 c, t dbSNP:192638855
6426 6426 a, g dbSNP:754507753
6454 6454 c, t dbSNP:140267868
6497 6497 a, g dbSNP:564955157

Target ORF information:

RefSeq Version XM_011525333
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu73257
Accession Version XM_011525334.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1322..3292(+)
Misc Feature(2)1331..1834(+)
Misc Feature(3)2687..3244(+)
Position Chain Variation Link
32 32 a, g dbSNP:7212884
41 41 c, t dbSNP:755769153
52 52 g, t dbSNP:752414798
133 133 c, t dbSNP:779818099
143 143 c, t dbSNP:567823137
148 148 a, g dbSNP:550715267
166 166 a, g dbSNP:377018932
231 231 -, a dbSNP:775139545
316 316 c, t dbSNP:537120108
341 341 c, t dbSNP:571297291
394 394 c, t dbSNP:372805424
467 467 c, t dbSNP:551265650
500 500 c, t dbSNP:528422757
508 508 c, t dbSNP:780953002
531 531 -, aact dbSNP:552602799
568 568 a, c dbSNP:377620948
585 585 a, g dbSNP:754270436
590 590 a, g dbSNP:764585550
594 594 c, t dbSNP:751194347
599 599 a, g dbSNP:45512093
613 613 a, c, t dbSNP:752411477
618 618 c, t dbSNP:786203418
619 619 c, t dbSNP:767215118
622 622 c, t dbSNP:759187663
625 625 c, g, t dbSNP:45566938
636 636 a, g dbSNP:587781387
640 640 c, t dbSNP:762827371
658 658 a, g dbSNP:45458996
672 672 a, t dbSNP:786202674
676 676 a, g dbSNP:769585673
677 677 a, g dbSNP:747867580
683 683 a, t dbSNP:776386693
686 686 c, t dbSNP:772319724
690 690 c, g dbSNP:786201468
692 692 a, g dbSNP:373104267
697 697 a, c dbSNP:774586397
710 710 c, t dbSNP:770930270
715 715 c, t dbSNP:749323434
719 719 c, t dbSNP:758270108
722 722 a, g, t dbSNP:587781292
728 728 a, c, g dbSNP:28903098
730 730 -, c dbSNP:587782065
732 732 a, c dbSNP:755317452
747 747 gc, tt dbSNP:786202417
747 747 g, t dbSNP:751182362
748 748 c, t dbSNP:779686432
752 752 a, g dbSNP:757909937
762 762 a, g dbSNP:749920386
770 770 g, t dbSNP:765205377
773 773 g, t dbSNP:786202861
775 775 a, g dbSNP:764252214
782 782 c, t dbSNP:575595017
784 784 a, g dbSNP:141436143
790 790 c, t dbSNP:763819127
794 794 a, g dbSNP:372581879
801 801 c, t dbSNP:779629295
814 814 c, t dbSNP:186802750
815 815 a, g dbSNP:769573395
829 829 g, t dbSNP:745422385
833 833 a, g dbSNP:565078834
836 836 c, t dbSNP:756707967
838 838 -, attacc dbSNP:759174262
838 838 a, g dbSNP:45528833
843 843 c, t dbSNP:587781830
847 847 -, ttgttgtgcatg dbSNP:730881648
851 851 -, tgt dbSNP:587781388
856 856 a, g dbSNP:764027029
863 863 c, t dbSNP:755930156
865 865 a, g dbSNP:786202281
870 870 a, g dbSNP:529201896
879 879 -, acaa dbSNP:763009188
880 880 c, g dbSNP:766561078
882 882 a, g dbSNP:781121675
885 885 a, t dbSNP:773532701
886 886 c, t dbSNP:201617644
888 888 c, t dbSNP:587782427
896 896 a, g dbSNP:777068696
901 901 g, t dbSNP:769190318
905 905 c, t dbSNP:587780247
906 906 a, g dbSNP:143615668
907 907 a, t dbSNP:772283705
915 915 a, g dbSNP:587782734
921 921 a, c dbSNP:201790351
927 927 c, t dbSNP:778480809
931 931 a, g dbSNP:756764576
936 936 c, g dbSNP:748793974
938 938 g, t dbSNP:786203890
946 946 c, t dbSNP:786202477
948 948 a, g dbSNP:730881637
951 951 c, g dbSNP:777630298
959 959 a, c, g dbSNP:45617634
975 975 c, t dbSNP:587780831
976 976 c, t dbSNP:779324498
983 983 -, a dbSNP:587781416
983 983 a, t dbSNP:730881623
984 984 a, c dbSNP:753965650
986 986 a, t dbSNP:764256720
1001 1001 c, t dbSNP:786201292
1002 1002 c, t dbSNP:587780251
1004 1004 g, t dbSNP:202072866
1015 1015 a, g dbSNP:768008017
1019 1019 a, g dbSNP:116952709
1026 1026 c, t dbSNP:774677996
1027 1027 ata, ct dbSNP:786203429
1029 1029 -, a dbSNP:786203521
1035 1035 a, g dbSNP:770613242
1037 1037 a, g dbSNP:762701532
1046 1046 a, g dbSNP:772695469
1052 1052 c, t dbSNP:587781786
1062 1062 a, c dbSNP:769364081
1070 1070 a, g dbSNP:786203916
1073 1073 c, t dbSNP:747604569
1074 1074 a, g, t dbSNP:61757643
1078 1078 c, g dbSNP:746838904
1084 1084 a, c dbSNP:780024960
1089 1089 c, t dbSNP:758218234
1091 1091 c, t dbSNP:748211848
1106 1106 c, t dbSNP:4988345
1107 1107 a, g dbSNP:761432927
1109 1109 c, t dbSNP:776248182
1112 1112 a, t dbSNP:546727788
1115 1115 g, t dbSNP:746963627
1126 1126 a, g dbSNP:775509896
1139 1139 a, g, t dbSNP:201047375
1142 1142 a, g dbSNP:745645356
1144 1144 a, c dbSNP:778116059
1145 1145 a, g dbSNP:730881624
1150 1150 c, t dbSNP:786201596
1158 1158 a, g dbSNP:756269682
1161 1161 a, g dbSNP:748268716
1165 1165 c, t dbSNP:781282996
1166 1166 a, g dbSNP:4988346
1173 1173 c, t dbSNP:4988347
1176 1176 a, g dbSNP:550707862
1177 1177 c, t dbSNP:758851721
1178 1178 c, t dbSNP:530897769
1179 1179 c, t dbSNP:533184563
1184 1184 c, t dbSNP:144969738
1193 1193 a, g dbSNP:778275257
1199 1199 g, t dbSNP:761401027
1200 1200 c, t dbSNP:776372251
1201 1201 c, g dbSNP:587780832
1206 1206 c, t dbSNP:565458815
1207 1207 a, g, t dbSNP:367614726
1208 1208 c, t dbSNP:775636640
1210 1210 a, g dbSNP:771891225
1215 1215 a, g dbSNP:748912293
1217 1217 c, t dbSNP:150313156
1218 1218 a, c, t dbSNP:140097800
1221 1221 c, t dbSNP:780026145
1222 1222 -, t dbSNP:779466229
1226 1226 c, t dbSNP:772140734
1227 1227 a, g dbSNP:376760085
1230 1230 c, g dbSNP:779409059
1233 1233 a, c dbSNP:12947398
1237 1237 a, g dbSNP:202035881
1239 1239 g, t dbSNP:587782156
1242 1242 a, g dbSNP:754242563
1244 1244 c, t dbSNP:730881630
1245 1245 a, g dbSNP:587782238
1250 1250 a, g dbSNP:777618772
1251 1251 c, g dbSNP:373774920
1256 1256 c, t dbSNP:786201733
1257 1257 a, g dbSNP:786203708
1261 1261 a, g dbSNP:752356873
1263 1263 -, a dbSNP:757771711
1268 1268 c, g dbSNP:45459799
1278 1278 c, t dbSNP:759031349
1279 1279 a, g dbSNP:751460179
1280 1280 a, g dbSNP:766340391
1284 1284 c, g dbSNP:762781085
1285 1285 a, c dbSNP:772957320
1286 1286 a, g dbSNP:769535320
1290 1290 a, g dbSNP:587780834
1291 1291 a, g dbSNP:45512798
1297 1297 c, t dbSNP:775721645
1300 1300 c, t dbSNP:772048413
1302 1302 c, t dbSNP:745955726
1303 1303 a, g dbSNP:548018916
1310 1310 c, t dbSNP:771542690
1317 1317 c, t dbSNP:587781860
1321 1321 a, c dbSNP:786202300
1325 1325 a, g dbSNP:376893571
1329 1329 a, g dbSNP:756499865
1340 1340 c, t dbSNP:752309409
1341 1341 a, g dbSNP:780834054
1358 1358 g, t dbSNP:754515912
1367 1367 a, g dbSNP:138743097
1379 1379 c, t dbSNP:28997569
1380 1380 a, g dbSNP:758360637
1384 1384 a, g dbSNP:61754143
1386 1386 c, t dbSNP:550031006
1389 1389 c, t dbSNP:730881631
1393 1393 g, t dbSNP:587782514
1405 1405 a, g dbSNP:765027420
1406 1406 a, c dbSNP:587781797
1409 1409 a, g dbSNP:62620988
1412 1412 a, g dbSNP:587781425