Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

BRIP1 BRCA1 interacting protein C-terminal helicase 1 [Homo sapiens (human)]

Gene Symbol BRIP1
Entrez Gene ID 83990
Full Name BRCA1 interacting protein C-terminal helicase 1
Synonyms BACH1, FANCJ, OF
General protein information
Preferred Names
Fanconi anemia group J protein
Fanconi anemia group J protein
ATP-dependent RNA helicase BRIP1
BRCA1/BRCA2-associated helicase 1
BRCA1-associated C-terminal helicase 1
BRCA1-binding helicase-like protein BACH1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Breast cancer, early-onset, 114480 (3); Fanconi anemia,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu73257 XM_011525332 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73257 XM_011525333 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73257 XM_011525334 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73258 XM_011525335 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73259 XM_011525336 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73260 XM_011525337 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73261 XM_011525338 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu73262 XM_011525339 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu73263 XM_011525340 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X9, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu73264 XM_011525341 PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X10, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu21213 NM_032043 Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu73257D
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1417..3387(+)
Misc Feature(2)1426..1929(+)
Misc Feature(3)2782..3339(+)
Position Chain Variation Link
30 30 a, g dbSNP:7503488
43 43 a, t dbSNP:756872543
63 63 a, g dbSNP:76551053
78 78 -, gcttaaagat dbSNP:548678896
96 96 c, t dbSNP:755855605
108 108 c, g dbSNP:145073204
132 132 a, g dbSNP:764398336
141 141 a, g dbSNP:752502969
142 142 a, g dbSNP:560765726
184 184 -, tg dbSNP:544121197
207 207 a, g dbSNP:370923463
213 213 c, t dbSNP:141306575
215 215 c, g dbSNP:530468488
216 216 c, g dbSNP:565185322
262 262 c, t dbSNP:545287870
280 280 -, t dbSNP:3840867
281 281 -, t dbSNP:34753867
281 281 c, t dbSNP:759466028
281 281 -, t dbSNP:559771069
346 346 c, t dbSNP:376399814
355 355 c, t dbSNP:376981898
389 389 g, t dbSNP:572973022
426 426 c, t dbSNP:775977840
447 447 -, t dbSNP:112243287
471 471 c, g dbSNP:559475592
480 480 a, g dbSNP:2048718
488 488 a, c dbSNP:180948389
513 513 a, c dbSNP:554590681
550 550 c, g dbSNP:79220357
555 555 c, t dbSNP:4988339
558 558 c, t dbSNP:148498140
568 568 a, g dbSNP:761838059
622 622 c, t dbSNP:558845941
647 647 c, g, t dbSNP:371225829
663 663 a, c dbSNP:377620948
680 680 a, g dbSNP:754270436
685 685 a, g dbSNP:764585550
689 689 c, t dbSNP:751194347
694 694 a, g dbSNP:45512093
708 708 a, c, t dbSNP:752411477
713 713 c, t dbSNP:786203418
714 714 c, t dbSNP:767215118
717 717 c, t dbSNP:759187663
720 720 c, g, t dbSNP:45566938
731 731 a, g dbSNP:587781387
735 735 c, t dbSNP:762827371
753 753 a, g dbSNP:45458996
767 767 a, t dbSNP:786202674
771 771 a, g dbSNP:769585673
772 772 a, g dbSNP:747867580
778 778 a, t dbSNP:776386693
781 781 c, t dbSNP:772319724
785 785 c, g dbSNP:786201468
787 787 a, g dbSNP:373104267
792 792 a, c dbSNP:774586397
805 805 c, t dbSNP:770930270
810 810 c, t dbSNP:749323434
814 814 c, t dbSNP:758270108
817 817 a, g, t dbSNP:587781292
823 823 a, c, g dbSNP:28903098
825 825 -, c dbSNP:587782065
827 827 a, c dbSNP:755317452
842 842 gc, tt dbSNP:786202417
842 842 g, t dbSNP:751182362
843 843 c, t dbSNP:779686432
847 847 a, g dbSNP:757909937
857 857 a, g dbSNP:749920386
865 865 g, t dbSNP:765205377
868 868 g, t dbSNP:786202861
870 870 a, g dbSNP:764252214
877 877 c, t dbSNP:575595017
879 879 a, g dbSNP:141436143
885 885 c, t dbSNP:763819127
889 889 a, g dbSNP:372581879
896 896 c, t dbSNP:779629295
909 909 c, t dbSNP:186802750
910 910 a, g dbSNP:769573395
924 924 g, t dbSNP:745422385
928 928 a, g dbSNP:565078834
931 931 c, t dbSNP:756707967
933 933 -, attacc dbSNP:759174262
933 933 a, g dbSNP:45528833
938 938 c, t dbSNP:587781830
942 942 -, ttgttgtgcatg dbSNP:730881648
946 946 -, tgt dbSNP:587781388
951 951 a, g dbSNP:764027029
958 958 c, t dbSNP:755930156
960 960 a, g dbSNP:786202281
965 965 a, g dbSNP:529201896
974 974 -, acaa dbSNP:763009188
975 975 c, g dbSNP:766561078
977 977 a, g dbSNP:781121675
980 980 a, t dbSNP:773532701
981 981 c, t dbSNP:201617644
983 983 c, t dbSNP:587782427
991 991 a, g dbSNP:777068696
996 996 g, t dbSNP:769190318
1000 1000 c, t dbSNP:587780247
1001 1001 a, g dbSNP:143615668
1002 1002 a, t dbSNP:772283705
1010 1010 a, g dbSNP:587782734
1016 1016 a, c dbSNP:201790351
1022 1022 c, t dbSNP:778480809
1026 1026 a, g dbSNP:756764576
1031 1031 c, g dbSNP:748793974
1033 1033 g, t dbSNP:786203890
1041 1041 c, t dbSNP:786202477
1043 1043 a, g dbSNP:730881637
1046 1046 c, g dbSNP:777630298
1054 1054 a, c, g dbSNP:45617634
1070 1070 c, t dbSNP:587780831
1071 1071 c, t dbSNP:779324498
1078 1078 -, a dbSNP:587781416
1078 1078 a, t dbSNP:730881623
1079 1079 a, c dbSNP:753965650
1081 1081 a, t dbSNP:764256720
1096 1096 c, t dbSNP:786201292
1097 1097 c, t dbSNP:587780251
1099 1099 g, t dbSNP:202072866
1110 1110 a, g dbSNP:768008017
1114 1114 a, g dbSNP:116952709
1121 1121 c, t dbSNP:774677996
1122 1122 ata, ct dbSNP:786203429
1124 1124 -, a dbSNP:786203521
1130 1130 a, g dbSNP:770613242
1132 1132 a, g dbSNP:762701532
1141 1141 a, g dbSNP:772695469
1147 1147 c, t dbSNP:587781786
1157 1157 a, c dbSNP:769364081
1165 1165 a, g dbSNP:786203916
1168 1168 c, t dbSNP:747604569
1169 1169 a, g, t dbSNP:61757643
1173 1173 c, g dbSNP:746838904
1179 1179 a, c dbSNP:780024960
1184 1184 c, t dbSNP:758218234
1186 1186 c, t dbSNP:748211848
1201 1201 c, t dbSNP:4988345
1202 1202 a, g dbSNP:761432927
1204 1204 c, t dbSNP:776248182
1207 1207 a, t dbSNP:546727788
1210 1210 g, t dbSNP:746963627
1221 1221 a, g dbSNP:775509896
1234 1234 a, g, t dbSNP:201047375
1237 1237 a, g dbSNP:745645356
1239 1239 a, c dbSNP:778116059
1240 1240 a, g dbSNP:730881624
1245 1245 c, t dbSNP:786201596
1253 1253 a, g dbSNP:756269682
1256 1256 a, g dbSNP:748268716
1260 1260 c, t dbSNP:781282996
1261 1261 a, g dbSNP:4988346
1268 1268 c, t dbSNP:4988347
1271 1271 a, g dbSNP:550707862
1272 1272 c, t dbSNP:758851721
1273 1273 c, t dbSNP:530897769
1274 1274 c, t dbSNP:533184563
1279 1279 c, t dbSNP:144969738
1288 1288 a, g dbSNP:778275257
1294 1294 g, t dbSNP:761401027
1295 1295 c, t dbSNP:776372251
1296 1296 c, g dbSNP:587780832
1301 1301 c, t dbSNP:565458815
1302 1302 a, g, t dbSNP:367614726
1303 1303 c, t dbSNP:775636640
1305 1305 a, g dbSNP:771891225
1310 1310 a, g dbSNP:748912293
1312 1312 c, t dbSNP:150313156
1313 1313 a, c, t dbSNP:140097800
1316 1316 c, t dbSNP:780026145
1317 1317 -, t dbSNP:779466229
1321 1321 c, t dbSNP:772140734
1322 1322 a, g dbSNP:376760085
1325 1325 c, g dbSNP:779409059
1328 1328 a, c dbSNP:12947398
1332 1332 a, g dbSNP:202035881
1334 1334 g, t dbSNP:587782156
1337 1337 a, g dbSNP:754242563
1339 1339 c, t dbSNP:730881630
1340 1340 a, g dbSNP:587782238
1345 1345 a, g dbSNP:777618772
1346 1346 c, g dbSNP:373774920
1351 1351 c, t dbSNP:786201733
1352 1352 a, g dbSNP:786203708
1356 1356 a, g dbSNP:752356873
1358 1358 -, a dbSNP:757771711
1363 1363 c, g dbSNP:45459799
1373 1373 c, t dbSNP:759031349
1374 1374 a, g dbSNP:751460179
1375 1375 a, g dbSNP:766340391
1379 1379 c, g dbSNP:762781085
1380 1380 a, c dbSNP:772957320
1381 1381 a, g dbSNP:769535320
1385 1385 a, g dbSNP:587780834
1386 1386 a, g dbSNP:45512798
1392 1392 c, t dbSNP:775721645
1395 1395 c, t dbSNP:772048413
1397 1397 c, t dbSNP:745955726
1398 1398 a, g dbSNP:548018916
1405 1405 c, t dbSNP:771542690
1412 1412 c, t dbSNP:587781860
1416 1416 a, c dbSNP:786202300
1420 1420 a, g dbSNP:376893571
1424 1424 a, g dbSNP:756499865
1435 1435 c, t dbSNP:752309409
1436 1436 a, g dbSNP:780834054
1453 1453 g, t dbSNP:754515912
1462 1462 a, g dbSNP:138743097
1474 1474 c, t dbSNP:28997569
1475 1475 a, g dbSNP:758360637
1479 1479 a, g dbSNP:61754143
1481 1481 c, t dbSNP:550031006
1484 1484 c, t dbSNP:730881631
1488 1488 g, t dbSNP:587782514
1500 1500 a, g dbSNP:765027420
1501 1501 a, c dbSNP:587781797
1504 1504 a, g dbSNP:62620988
1507 1507 a, g dbSNP:587781425
1515 1515 c, g dbSNP:45549332
1521 1521 g, t dbSNP:759584091
1529 1529 c, g dbSNP:45624635
1532 1532 a, g dbSNP:771096783
1536 1536 c, t dbSNP:144940449
1538 1538 a, g dbSNP:141055990
1540 1540 c, t dbSNP:770289817
1548 1548 a, g dbSNP:748545827
1551 1551 c, t dbSNP:147739458
1552 1552 a, g dbSNP:145601931
1553 1553 a, g dbSNP:148556781
1562 1562 a, g dbSNP:746599076
1574 1574 -, a dbSNP:786202610
1574 1574 a, g dbSNP:28997570
1581 1581 a, g dbSNP:137852985
1586 1586 c, g, t dbSNP:750376292
1596 1596 a, g dbSNP:786201326
1605 1605 a, g dbSNP:786202337
1608 1608 a, g dbSNP:374974885
1616 1616 -, a dbSNP:587778138
1616 1616 a, g dbSNP:587782731
1625 1625 a, g dbSNP:112076926
1643 1643 a, g dbSNP:746681841
1648 1648 c, t dbSNP:587778139
1656 1656 a, t dbSNP:779627397
1659 1659 a, g dbSNP:771630777
1668 1668 c, t dbSNP:745379285
1670 1670 a, g dbSNP:778863018
1676 1676 g, t dbSNP:587782771
1677 1677 a, g dbSNP:587780252
1681 1681 a, g dbSNP:757196702
1684 1684 a, g, t dbSNP:535414791
1689 1689 a, g dbSNP:786201808
1696 1696 c, g dbSNP:777653224
1702 1702 c, t dbSNP:755796609
1715 1715 a, g dbSNP:751841684
1724 1724 c, t dbSNP:786201819
1729 1729 c, g dbSNP:149364097
1731 1731 c, t dbSNP:763189201
1737 1737 a, g dbSNP:544977115
1738 1738 c, t dbSNP:730881632
1739 1739 a, g dbSNP:762417690
1745 1745 c, t dbSNP:776939714
1750 1750 c, t dbSNP:730881633
1751 1751 -, g dbSNP:751209171
1753 1753 g, t dbSNP:769081927
1754 1754 -, ttac dbSNP:766110015
1755 1755 a, g dbSNP:761017296
1756 1756 -, agtcca dbSNP:762883121
1756 1756 a, c dbSNP:775191379
1758 1758 a, c dbSNP:771682192
1761 1761 a, g dbSNP:730881634
1766 1766 -, a dbSNP:587781639
1767 1767 c, t dbSNP:745432312
1773 1773 c, t dbSNP:139701369
1774 1774 a, t dbSNP:770306753
1777 1777 a, g dbSNP:749251680
1789 1789 c, t dbSNP:587781325
1790 1790 a, g dbSNP:786202218
1793 1793 a, g dbSNP:777511615
1798 1798 a, ct dbSNP:587783377
1798 1798 a, c dbSNP:786202637
1801 1801 c, t dbSNP:755992778
1808 1808 c, t dbSNP:786202192
1810 1810 -, ca dbSNP:587780224
1823 1823 a, g, t dbSNP:569696977
1837 1837 c, t dbSNP:748001678
1840 1840 a, t dbSNP:730881635
1849 1849 a, g dbSNP:587780825
1852 1852 a, g dbSNP:781168634
1854 1854 c, t dbSNP:754755989
1860 1860 a, g dbSNP:550092661
1868 1868 a, c dbSNP:778992385
1873 1873 a, c dbSNP:587782039
1876 1876 a, g dbSNP:786203967
1878 1878 c, t dbSNP:757427498
1879 1879 a, g dbSNP:587782816
1882 1882 g, t dbSNP:764711572
1885 1885 c, t dbSNP:756636362
1888 1888 -, tgtg dbSNP:730881647
1891 1891 c, t dbSNP:369631413
1892 1892 a, g dbSNP:786202780
1901 1901 c, t dbSNP:767872861
1904 1904 a, g dbSNP:759835916
1910 1910 g, t dbSNP:587782247
1914 1914 -, aacagaagttcagcttcggttt dbSNP:786202415
1922 1922 c, t dbSNP:45576134
1924 1924 c, t dbSNP:368796923
1930 1930 c, t dbSNP:587780225
1931 1931 a, g dbSNP:772570870
1939 1939 c, t dbSNP:150624408
1940 1940 a, g dbSNP:748105919
1941 1941 a, g dbSNP:148429663
1948 1948 a, c dbSNP:768633507
1952 1952 a, g dbSNP:746778889
1967 1967 a, c dbSNP:779237423
1970 1970 a, c dbSNP:587781463
1980 1980 a, g dbSNP:757400610
1988 1988 a, g dbSNP:730881636
1996 1996 a, c, t dbSNP:756119073
1999 1999 c, t dbSNP:587780226
2000 2000 a, g dbSNP:753214212
2016 2016 c, t dbSNP:200581792
2020 2020 a, c dbSNP:786203496
2027 2027 a, g dbSNP:775171520
2036 2036 c, t dbSNP:771861055
2040 2040 c, t dbSNP:730881640
2041 2041 a, g dbSNP:587780227
2045 2045 a, t dbSNP:769918040
2046 2046 a, c dbSNP:786202553
2047 2047 a, t dbSNP:587780826
2053 2053 c, g dbSNP:748221377
2056 2056 g, t dbSNP:587780228
2059 2059 a, c, g dbSNP:752052351
2061 2061 a, c dbSNP:780310294
2064 2064 c, t dbSNP:758735370
2067 2067 c, g, t dbSNP:587780875
2085 2085 a, g dbSNP:764979728
2109 2109 -, aactt dbSNP:768736851
2116 2116 c, t dbSNP:761452695
2117 2117 a, g dbSNP:45501097
2125 2125 g, t dbSNP:587780229
2126 2126 a, g, t dbSNP:200062099
2127 2127 c, t dbSNP:775431508
2128 2128 a, g dbSNP:142744352
2130 2130 c, t dbSNP:759360709
2139 2139 c, t dbSNP:773489367
2151 2151 g, t dbSNP:587780230
2168 2168 c, t dbSNP:536081549
2169 2169 g, t dbSNP:370658123
2183 2183 a, g dbSNP:746329838
2194 2194 -, a dbSNP:775735278
2195 2195 c, t dbSNP:755306832
2226 2226 a, g dbSNP:779454200
2234 2234 c, t dbSNP:786202169
2236 2236 a, g dbSNP:786201701
2243 2243 c, g dbSNP:757629526
2244 2244 a, t dbSNP:730881638
2255 2255 a, g dbSNP:587781726
2258 2258 -, t dbSNP:772248310
2266 2266 a, g dbSNP:748962730
2270 2270 a, g dbSNP:138784299
2275 2275 a, c dbSNP:4988350
2289 2289 c, g dbSNP:56024614
2300 2300 a, g, t dbSNP:199616792
2303 2303 a, t dbSNP:4988349
2307 2307 c, t dbSNP:786203897
2310 2310 c, t dbSNP:373709958
2325 2325 g, t dbSNP:754414731
2327 2327 a, g dbSNP:587782405
2328 2328 c, t dbSNP:372760869
2334 2334 g, t dbSNP:587782254
2335 2335 c, g dbSNP:766302517
2336 2336 c, t dbSNP:375246789
2337 2337 a, g dbSNP:750213758
2339 2339 c, t dbSNP:369340666
2344 2344 c, g dbSNP:777217004
2345 2345 -, a dbSNP:749762964
2350 2350 c, t dbSNP:752797989
2356 2356 c, t dbSNP:767648925
2368 2368 a, g dbSNP:45533636
2371 2371 -, gat dbSNP:780590493
2372 2372 a, g dbSNP:577768294
2375 2375 c, t dbSNP:755635967
2376 2376 c, t dbSNP:786202979
2379 2379 a, c dbSNP:142572387
2388 2388 g, t dbSNP:763458922
2390 2390 c, g dbSNP:373228183
2394 2394 a, g dbSNP:370087045
2395 2395 -, ttg dbSNP:754566378
2401 2401 c, g dbSNP:786202587
2405 2405 c, t dbSNP:377302300
2411 2411 -, a dbSNP:587778131
2411 2411 a, g dbSNP:587778132
2415 2415 a, g dbSNP:587780829
2418 2418 a, g dbSNP:786202592
2419 2419 c, t dbSNP:28997571
2420 2420 a, g dbSNP:768224857
2422 2422 g, t dbSNP:746494295
2425 2425 c, t dbSNP:780020495
2426 2426 a, g dbSNP:587778133
2429 2429 a, g dbSNP:750288231
2436 2436 c, t dbSNP:778774207
2438 2438 a, c dbSNP:756946068
2458 2458 g, t dbSNP:587780231
2460 2460 a, g dbSNP:753023295
2465 2465 c, t dbSNP:587781559
2468 2468 a, g dbSNP:759727507
2474 2474 c, t dbSNP:751667661
2481 2481 c, t dbSNP:771672834
2482 2482 c, t dbSNP:745367580
2484 2484 g, t dbSNP:375625993
2488 2488 g, t dbSNP:770750488
2493 2493 c, t dbSNP:370393808
2507 2507 a, g dbSNP:112505689
2509 2509 a, g dbSNP:189758577
2512 2512 a, g dbSNP:749200646
2515 2515 a, g dbSNP:777741543
2537 2537 -, g dbSNP:587781985
2555 2555 a, c, t dbSNP:587781321
2556 2556 a, g dbSNP:145504336
2572 2572 -, a dbSNP:763818712
2573 2573 a, c dbSNP:780407946
2574 2574 a, g dbSNP:145796331
2581 2581 a, c, g dbSNP:765314472
2582 2582 c, t dbSNP:587780232
2583 2583 c, g dbSNP:28997572
2587 2587 c, t dbSNP:754280136
2593 2593 g, t dbSNP:541203428
2598 2598 c, t dbSNP:764456240
2601 2601 c, t dbSNP:763534423
2624 2624 a, t dbSNP:554791910
2625 2625 a, g dbSNP:538015264
2685 2685 g, t dbSNP:786202760
2686 2686 a, g dbSNP:780475484
2690 2690 a, c, g dbSNP:746066323
2695 2695 a, g dbSNP:778867622
2696 2696 c, t dbSNP:757305097
2697 2697 c, t dbSNP:754400631
2700 2700 a, g dbSNP:778250103
2702 2702 c, t dbSNP:756511744
2706 2706 c, t dbSNP:786201877
2707 2707 c, t dbSNP:753036322
2708 2708 c, g dbSNP:767872111
2714 2714 -, g dbSNP:760782298
2716 2716 c, t dbSNP:786203170
2717 2717 a, g dbSNP:759142191
2728 2728 a, g dbSNP:571340013
2733 2733 a, c dbSNP:376628979
2737 2737 -, c dbSNP:34224865
2740 2740 a, g dbSNP:765816425
2754 2754 -, t dbSNP:775537066
2754 2754 a, t dbSNP:762535496
2756 2756 a, g dbSNP:587778135
2762 2762 a, g dbSNP:786203619
2772 2772 c, g dbSNP:786202395
2782 2782 c, t dbSNP:786203872
2783 2783 -, tt dbSNP:587778134
2791 2791 c, g dbSNP:773347072
2800 2800 a, g dbSNP:769820537
2805 2805 c, g dbSNP:112414873
2811 2811 a, g dbSNP:556955136
2815 2815 a, c dbSNP:587782356
2831 2831 c, t dbSNP:147755155
2832 2832 a, t dbSNP:768436074
2844 2844 a, g dbSNP:766047812
2851 2851 a, c dbSNP:762590242
2852 2852 -, cc dbSNP:760863397
2852 2852 a, t dbSNP:756412722
2852 2852 a, tcc dbSNP:786203384
2863 2863 c, t dbSNP:764803896
2864 2864 a, g, t dbSNP:200313471
2873 2873 c, t dbSNP:768393936
2875 2875 a, g dbSNP:760515227
2896 2896 c, g dbSNP:774478325
2899 2899 c, t dbSNP:771122056
2908 2908 -, acag dbSNP:778385829
2911 2911 a, g dbSNP:145616741
2913 2913 c, t dbSNP:749460936
2916 2916 c, t dbSNP:777860588
2917 2917 -, gtagaa dbSNP:770198861
2923 2923 c, t dbSNP:769797684
2933 2933 a, g dbSNP:748616469
2937 2937 a, g dbSNP:781712098
2954 2954 a, g dbSNP:755361298
2960 2960 c, t dbSNP:587780234
2961 2961 g, t dbSNP:747365105
2964 2964 c, g, t dbSNP:45589637
2972 2972 a, c, g dbSNP:750033391
2976 2976 c, t dbSNP:374362388
2977 2977 a, g dbSNP:587780235
2980 2980 a, g dbSNP:111536363
2981 2981 -, tcaa dbSNP:587782726
2991 2991 a, t dbSNP:587782556
2993 2993 g, t dbSNP:764061653
2995 2995 c, g dbSNP:760438320
2999 2999 -, aa dbSNP:730881649
3002 3002 a, g dbSNP:745578572
3017 3017 -, t dbSNP:587780236
3018 3018 a, g dbSNP:786201526
3028 3028 c, t dbSNP:587778136
3029 3029 a, g, t dbSNP:200960251
3030 3030 c, t dbSNP:61754141
3032 3032 a, g dbSNP:371484780
3039 3039 a, g dbSNP:752509701
3040 3040 a, g dbSNP:371227751
3045 3045 a, c, g dbSNP:369434185
3054 3054 c, t dbSNP:148752066
3057 3057 -, ctcagat dbSNP:758128094
3061 3061 a, g dbSNP:146091205
3068 3068 a, g dbSNP:571108955
3069 3069 g, t dbSNP:375146450
3072 3072 c, t dbSNP:786203725
3073 3073 c, g, t dbSNP:768555161
3074 3074 a, g dbSNP:747568830
3082 3082 a, c dbSNP:776131401
3087 3087 a, g dbSNP:772636536
3088 3088 a, g dbSNP:142806416
3089 3089 c, t dbSNP:778758437
3108 3108 a, t dbSNP:587783045
3114 3114 a, g dbSNP:372122365
3120 3120 a, g dbSNP:554514054
3121 3121 c, t dbSNP:587782574
3126 3126 g, t dbSNP:560088455
3134 3134 a, g dbSNP:730881622
3136 3136 c, t dbSNP:137852986
3137 3137 a, g dbSNP:375082407
3138 3138 a, t dbSNP:540236878
3144 3144 c, g, t dbSNP:574552037
3150 3150 a, c, t dbSNP:748981650
3153 3153 c, t dbSNP:762039913
3155 3155 a, g dbSNP:777277034
3159 3159 a, c dbSNP:769413097
3160 3160 a, g dbSNP:747622456
3163 3163 c, t dbSNP:786201708
3166 3166 a, g dbSNP:587780237
3167 3167 g, t dbSNP:781153382
3171 3171 c, t dbSNP:754927538
3172 3172 c, g dbSNP:587780238
3177 3177 a, t dbSNP:751455420
3178 3178 c, t dbSNP:779915262
3184 3184 c, t dbSNP:201869624
3185 3185 a, g dbSNP:45468199
3189 3189 a, g dbSNP:764195906
3191 3191 a, g dbSNP:786204250
3208 3208 c, t dbSNP:760887592
3209 3209 a, g dbSNP:587781572
3212 3212 g, t dbSNP:45479297
3213 3213 a, g, t dbSNP:587780239
3216 3216 c, t dbSNP:767666616
3221 3221 a, g dbSNP:760127237
3222 3222 c, t dbSNP:774939280
3223 3223 a, c dbSNP:786203898
3236 3236 a, g dbSNP:771382903
3238 3238 c, t dbSNP:768222842
3239 3239 a, g dbSNP:4988355
3241 3241 a, g dbSNP:199831248
3247 3247 c, g dbSNP:746492294
3249 3249 c, t dbSNP:775547651
3253 3253 a, c dbSNP:771929845
3268 3268 c, t dbSNP:786201802
3286 3286 a, c, t dbSNP:45572934
3287 3287 a, g dbSNP:374334794
3289 3289 c, t dbSNP:786202317
3297 3297 g, t dbSNP:587781793
3298 3298 a, g dbSNP:745782331
3307 3307 c, t dbSNP:146031731
3308 3308 a, g, t dbSNP:200894063
3311 3311 a, g dbSNP:781556845
3312 3312 c, t dbSNP:370175724
3313 3313 a, g dbSNP:28904918
3314 3314 c, t dbSNP:766432760
3323 3323 c, t dbSNP:587780242
3326 3326 c, g dbSNP:774415723
3330 3330 a, g dbSNP:745318756
3334 3334 a, g dbSNP:149529390
3337 3337 c, t dbSNP:578022079
3338 3338 a, g dbSNP:781609846
3339 3339 -, g dbSNP:587781974
3342 3342 a, g dbSNP:769021796
3343 3343 a, c dbSNP:182028200
3344 3344 a, g dbSNP:747213803
3355 3355 c, t dbSNP:786203288
3357 3357 c, t dbSNP:199721657
3359 3359 c, t dbSNP:587781964
3361 3361 a, g dbSNP:758444508
3371 3371 a, g dbSNP:750961319
3375 3375 a, g dbSNP:786201336
3381 3381 a, g dbSNP:4986765
3394 3394 a, t dbSNP:587780243
3406 3406 c, t dbSNP:757668121
3415 3415 a, g dbSNP:754224663
3428 3428 -, ccat dbSNP:760551339
3430 3430 a, g dbSNP:764406913
3433 3433 a, g dbSNP:587781644
3437 3437 a, t dbSNP:752340544
3450 3450 a, g dbSNP:587780244
3460 3460 a, g dbSNP:759080195
3465 3465 a, t dbSNP:774467171
3467 3467 c, t dbSNP:786201919
3469 3469 c, g dbSNP:587781853
3470 3470 c, t dbSNP:770966270
3474 3474 a, g dbSNP:570751937
3476 3476 -, t dbSNP:752780954
3479 3479 a, c dbSNP:571949350
3492 3492 c, t dbSNP:555200296
3495 3495 c, t dbSNP:150780318
3497 3497 a, c, t dbSNP:587781298
3499 3499 c, t dbSNP:4986764
3509 3509 g, t dbSNP:587782410
3516 3516 a, c dbSNP:730881625
3530 3530 g, t dbSNP:772087074
3535 3535 a, c dbSNP:745940032
3545 3545 c, t dbSNP:778916092
3548 3548 g, t dbSNP:4988356
3550 3550 a, g dbSNP:754280048
3555 3555 c, t dbSNP:374335608
3556 3556 a, g dbSNP:199643061
3560 3560 c, g dbSNP:756490117
3564 3564 a, g dbSNP:786201396
3567 3567 -, a dbSNP:767549540
3569 3569 a, g dbSNP:370330739
3572 3572 c, t dbSNP:786204143
3573 3573 c, g, t dbSNP:767164240
3574 3574 c, g, t dbSNP:140233356
3575 3575 a, c, g dbSNP:148232408
3579 3579 a, g dbSNP:786203633
3585 3585 a, g dbSNP:786201414
3591 3591 c, t dbSNP:45499991
3595 3595 a, g dbSNP:730881626
3598 3598 a, g dbSNP:200239986
3601 3601 a, c dbSNP:587780245
3602 3602 c, t dbSNP:201672040
3603 3603 a, c dbSNP:786201685
3607 3607 a, c dbSNP:587782244
3610 3610 c, t dbSNP:74824981
3611 3611 c, g dbSNP:761639530
3614 3614 c, t dbSNP:786203077
3615 3615 c, t dbSNP:786202095
3617 3617 a, t dbSNP:145859791
3627 3627 c, t dbSNP:367728797
3629 3629 c, t dbSNP:786201632
3637 3637 a, c, g dbSNP:113697814
3646 3646 a, g dbSNP:587782679
3658 3658 a, g dbSNP:786203224
3674 3674 c, t dbSNP:770352467
3677 3677 a, g dbSNP:587780246
3679 3679 a, g dbSNP:730881627
3681 3681 a, g dbSNP:75091137
3683 3683 c, t dbSNP:781622986
3691 3691 -, a dbSNP:774684620
3691 3691 a, t dbSNP:755337038
3692 3692 a, t dbSNP:587781417
3693 3693 g, t dbSNP:746715917
3701 3701 c, g dbSNP:182087528
3707 3707 c, t dbSNP:758032378
3734 3734 -, caaa dbSNP:771028677
3734 3734 c, t dbSNP:749978235
3735 3735 a, g dbSNP:45466996
3736 3736 -, aaga dbSNP:786203717
3738 3738 c, g dbSNP:757225144
3748 3748 -, tgacagct dbSNP:763443434
3749 3749 a, g dbSNP:753664225
3750 3750 c, g, t dbSNP:546083449
3753 3753 a, g dbSNP:751823379
3755 3755 a, g dbSNP:766562396
3769 3769 a, g, t dbSNP:587781328
3771 3771 a, g dbSNP:786201171
3786 3786 c, t dbSNP:188258913
3787 3787 a, g dbSNP:769692303
3794 3794 c, t dbSNP:747907706
3795 3795 a, g dbSNP:776990704
3808 3808 a, g dbSNP:587782808
3812 3812 c, t dbSNP:747345595
3813 3813 c, t dbSNP:61754142
3814 3814 a, g dbSNP:147119272
3815 3815 g, t dbSNP:587781744
3816 3816 a, g, t dbSNP:778500245
3820 3820 c, t dbSNP:756712872
3822 3822 a, g dbSNP:786201657
3823 3823 a, g dbSNP:371185409
3825 3825 a, g dbSNP:777660106
3830 3830 c, g dbSNP:755949409
3830 3830 -, g dbSNP:773433456
3833 3833 c, g, t dbSNP:767255426
3840 3840 g, t dbSNP:763162379
3843 3843 c, t dbSNP:202228407
3844 3844 a, c dbSNP:765416041
3847 3847 c, t dbSNP:45437094
3848 3848 a, g dbSNP:367816363
3861 3861 a, g dbSNP:769310105
3866 3866 c, t dbSNP:761225576
3868 3868 a, g dbSNP:776002434
3884 3884 c, t dbSNP:786203344
3889 3889 c, t dbSNP:772507914
3893 3893 a, c dbSNP:373040333
3922 3922 a, g dbSNP:149016505
3925 3925 a, c dbSNP:778430337
3929 3929 c, t dbSNP:770517912
3932 3932 c, t dbSNP:575998972
3939 3939 a, g dbSNP:45540240
3940 3940 -, t dbSNP:730881645
3952 3952 -, t dbSNP:748598593
3953 3953 c, t dbSNP:777213170
3958 3958 a, g dbSNP:756074244
3959 3959 a, c dbSNP:786204068
3967 3967 a, t dbSNP:368867532
3968 3968 c, t dbSNP:183928474
3976 3976 a, t dbSNP:786202927
3978 3978 a, g, t dbSNP:570238270
3980 3980 c, t dbSNP:150813402
3981 3981 g, t dbSNP:587781666
3982 3982 a, g dbSNP:786204230
3984 3984 -, t dbSNP:779741278
3987 3987 c, t dbSNP:754003636
4004 4004 -, a dbSNP:771654971
4004 4004 a, g dbSNP:786202024
4009 4009 g, t dbSNP:764205156
4010 4010 c, t dbSNP:761278503
4016 4016 a, g dbSNP:776129117
4018 4018 c, t dbSNP:768065626
4019 4019 c, t dbSNP:587780830
4020 4020 a, g dbSNP:375911315
4029 4029 c, t dbSNP:774105218
4033 4033 c, g dbSNP:770509300
4038 4038 c, t dbSNP:748928248
4040 4040 g, t dbSNP:772709195
4042 4042 a, g dbSNP:587781923
4049 4049 a, g dbSNP:748140041
4052 4052 c, t dbSNP:781102464
4060 4060 c, t dbSNP:111943191
4075 4075 c, g dbSNP:587780248
4080 4080 c, t dbSNP:369843642
4093 4093 g, t dbSNP:779860140
4098 4098 c, t dbSNP:757427210
4111 4111 a, g dbSNP:754056526
4118 4118 -, cag dbSNP:745344948
4122 4122 a, c dbSNP:145855459
4126 4126 a, g dbSNP:45552539
4132 4132 a, t dbSNP:786202549
4134 4134 -, ctat dbSNP:778664039
4145 4145 -, c dbSNP:756853672
4147 4147 a, g dbSNP:369340444
4155 4155 c, t dbSNP:4986763
4156 4156 a, g, t dbSNP:587780249
4175 4175 a, g dbSNP:774605759
4180 4180 a, g dbSNP:786202247
4184 4184 -, a dbSNP:753683450
4188 4188 a, c dbSNP:28997573
4192 4192 c, g dbSNP:757363615
4203 4203 c, t dbSNP:4987050
4204 4204 a, g dbSNP:769359514
4208 4208 a, g dbSNP:45603843
4212 4212 c, t dbSNP:747624574
4214 4214 c, g dbSNP:776599258
4219 4219 g, t dbSNP:368610199
4224 4224 c, t dbSNP:746898528
4233 4233 c, t dbSNP:144245485
4237 4237 a, c dbSNP:771889454
4247 4247 a, c dbSNP:749589266
4249 4249 g, t dbSNP:587782029
4251 4251 a, c dbSNP:375741316
4252 4252 c, g dbSNP:587782552
4265 4265 c, g dbSNP:786202662
4267 4267 a, g dbSNP:372799558
4269 4269 -, t dbSNP:777367075
4273 4273 a, c dbSNP:756313788
4275 4275 a, g dbSNP:181186298
4277 4277 a, t dbSNP:752850661
4279 4279 a, g dbSNP:781289228
4290 4290 c, t dbSNP:755440956
4299 4299 a, g dbSNP:752044406
4300 4300 a, g dbSNP:766709841
4301 4301 a, g dbSNP:763298204
4303 4303 a, g dbSNP:367610893
4306 4306 a, g dbSNP:786201962
4311 4311 c, t dbSNP:764848326
4315 4315 a, g dbSNP:761405340
4334 4334 a, g dbSNP:587781677
4343 4343 a, g dbSNP:730881628
4349 4349 a, g dbSNP:776010326
4351 4351 at, ga dbSNP:587782615
4359 4359 a, t dbSNP:768156067
4364 4364 a, t dbSNP:139539831
4366 4366 a, g dbSNP:760589795
4371 4371 a, t dbSNP:548674096
4373 4373 a, g dbSNP:112214651
4380 4380 c, t dbSNP:374392860
4388 4388 c, t dbSNP:771805501
4391 4391 -, c dbSNP:756079324
4395 4395 a, g, t dbSNP:542698396
4406 4406 g, t dbSNP:778805688
4408 4408 -, g dbSNP:752586524
4409 4409 a, g dbSNP:770175142
4411 4411 c, g dbSNP:748310432
4420 4420 a, c dbSNP:781140410
4424 4424 a, g dbSNP:755069935
4425 4425 c, t dbSNP:370581038
4436 4436 g, t dbSNP:780578438
4445 4445 g, t dbSNP:587778137
4454 4454 c, t dbSNP:587781819
4455 4455 c, t dbSNP:786203915
4459 4459 c, t dbSNP:587781886
4461 4461 c, t dbSNP:758809865
4471 4471 g, t dbSNP:587780250
4472 4472 g, t dbSNP:765545033
4474 4474 -, at dbSNP:730881646
4474 4474 a, c dbSNP:761468878
4476 4476 a, g dbSNP:753516000
4487 4487 g, t dbSNP:763579793
4508 4508 g, t dbSNP:760202569
4516 4516 -, a dbSNP:755091088
4526 4526 c, t dbSNP:754001752
4533 4533 a, g dbSNP:202123733
4535 4535 c, g dbSNP:772160050
4541 4541 a, g dbSNP:759511390
4571 4571 a, c dbSNP:4988358
4581 4581 g, t dbSNP:557749565
4583 4583 g, t dbSNP:539702731
4584 4584 a, g dbSNP:569535272
4610 4610 g, t dbSNP:562726845
4622 4622 a, g dbSNP:150444311
4626 4626 a, g dbSNP:143361598
4629 4629 a, g dbSNP:775842351
4638 4638 c, g dbSNP:767771825
4645 4645 g, t dbSNP:538867472
4646 4646 g, t dbSNP:540229694
4647 4647 c, g dbSNP:113345004
4649 4649 -, t dbSNP:376507309
4652 4652 c, t dbSNP:1978111
4653 4653 c, t dbSNP:554326644
4659 4659 -, t dbSNP:111519368
4666 4666 c, g dbSNP:111898257
4668 4668 a, g dbSNP:774889346
4676 4676 -, ctgt dbSNP:551479702
4729 4729 c, t dbSNP:764128633
4757 4757 c, t dbSNP:774821210
4774 4774 c, g dbSNP:189935192
4777 4777 -, a dbSNP:531656835
4874 4874 c, t dbSNP:556729826
4890 4890 -, ct dbSNP:546666211
4954 4954 c, g dbSNP:539677174
4977 4977 c, t dbSNP:7213430
4982 4982 c, t dbSNP:772711204
4994 4994 g, t dbSNP:377169249
5003 5003 c, t dbSNP:533893805
5018 5018 a, g dbSNP:371689236
5086 5086 a, t dbSNP:568447515
5097 5097 c, t dbSNP:368711371
5110 5110 a, g dbSNP:116292412
5153 5153 a, g dbSNP:769375960
5154 5154 c, g dbSNP:569287586
5208 5208 g, t dbSNP:552378907
5223 5223 c, t dbSNP:137967725
5255 5255 g, t dbSNP:560463291
5268 5268 a, g dbSNP:376898714
5273 5273 c, t dbSNP:185040281
5346 5346 g, t dbSNP:540541914
5369 5369 a, c dbSNP:193165407
5391 5391 a, g dbSNP:747741322
5396 5396 a, g dbSNP:571471772
5410 5410 a, g dbSNP:560959350
5472 5472 a, g dbSNP:367962443
5517 5517 a, g dbSNP:543935297
5542 5542 -, tat dbSNP:564290244
5594 5594 c, t dbSNP:575280579
5679 5679 -, ttct dbSNP:560881577
5696 5696 a, t dbSNP:113940104
5711 5711 c, t dbSNP:374389912
5727 5727 a, t dbSNP:372430235
5745 5745 c, t dbSNP:374318992
5757 5757 a, g dbSNP:73991940
5784 5784 c, t dbSNP:545980168
5792 5792 c, g dbSNP:746812029
5807 5807 a, t dbSNP:577034037
5811 5811 g, t dbSNP:368664791
5868 5868 c, t dbSNP:59115933
5882 5882 a, g dbSNP:554909015
5887 5887 g, t dbSNP:754698039
5891 5891 a, g dbSNP:568330176
5903 5903 a, t dbSNP:554933640
5996 5996 a, t dbSNP:537881525
6043 6043 a, g dbSNP:569331035
6050 6050 a, c dbSNP:552744287
6066 6066 -, aa dbSNP:772163923
6097 6097 a, g dbSNP:374453575
6140 6140 c, g dbSNP:145338121
6169 6169 a, g dbSNP:566674578
6248 6248 c, g dbSNP:546886816
6286 6286 a, g dbSNP:746869920
6287 6287 a, t dbSNP:190169023
6297 6297 c, t dbSNP:780101170
6314 6314 c, t dbSNP:114037902
6341 6341 a, g dbSNP:546189831
6354 6354 a, g dbSNP:758416895
6362 6362 g, t dbSNP:184666432
6425 6425 a, g dbSNP:778892658
6428 6428 c, t dbSNP:192638855
6430 6430 a, g dbSNP:754507753
6458 6458 c, t dbSNP:140267868
6501 6501 a, g dbSNP:564955157

Target ORF information:

RefSeq Version XM_011525332
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu73257D
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1413..3383(+)
Misc Feature(2)1422..1925(+)
Misc Feature(3)2778..3335(+)
Position Chain Variation Link
30 30 a, g dbSNP:7503488
43 43 a, t dbSNP:756872543
63 63 a, g dbSNP:76551053
78 78 -, gcttaaagat dbSNP:548678896
96 96 c, t dbSNP:755855605
108 108 c, g dbSNP:145073204
132 132 a, g dbSNP:764398336
141 141 a, g dbSNP:752502969
142 142 a, g dbSNP:560765726
184 184 -, tg dbSNP:544121197
207 207 a, g dbSNP:370923463
213 213 c, t dbSNP:141306575
215 215 c, g dbSNP:530468488
216 216 c, g dbSNP:565185322
262 262 c, t dbSNP:545287870
280 280 -, t dbSNP:3840867
281 281 -, t dbSNP:34753867
281 281 c, t dbSNP:759466028
281 281 -, t dbSNP:559771069
346 346 c, t dbSNP:376399814
355 355 c, t dbSNP:376981898
389 389 g, t dbSNP:572973022
426 426 c, t dbSNP:775977840
447 447 -, t dbSNP:112243287
471 471 c, g dbSNP:559475592
480 480 a, g dbSNP:2048718
488 488 a, c dbSNP:180948389
513 513 a, c dbSNP:554590681
550 550 c, g dbSNP:79220357
555 555 c, t dbSNP:4988339
558 558 c, t dbSNP:148498140
568 568 a, g dbSNP:761838059
622 622 c, t dbSNP:558845941
647 647 c, g, t dbSNP:371225829
659 659 a, c dbSNP:377620948
676 676 a, g dbSNP:754270436
681 681 a, g dbSNP:764585550
685 685 c, t dbSNP:751194347
690 690 a, g dbSNP:45512093
704 704 a, c, t dbSNP:752411477
709 709 c, t dbSNP:786203418
710 710 c, t dbSNP:767215118
713 713 c, t dbSNP:759187663
716 716 c, g, t dbSNP:45566938
727 727 a, g dbSNP:587781387
731 731 c, t dbSNP:762827371
749 749 a, g dbSNP:45458996
763 763 a, t dbSNP:786202674
767 767 a, g dbSNP:769585673
768 768 a, g dbSNP:747867580
774 774 a, t dbSNP:776386693
777 777 c, t dbSNP:772319724
781 781 c, g dbSNP:786201468
783 783 a, g dbSNP:373104267
788 788 a, c dbSNP:774586397
801 801 c, t dbSNP:770930270
806 806 c, t dbSNP:749323434
810 810 c, t dbSNP:758270108
813 813 a, g, t dbSNP:587781292
819 819 a, c, g dbSNP:28903098
821 821 -, c dbSNP:587782065
823 823 a, c dbSNP:755317452
838 838 gc, tt dbSNP:786202417
838 838 g, t dbSNP:751182362
839 839 c, t dbSNP:779686432
843 843 a, g dbSNP:757909937
853 853 a, g dbSNP:749920386
861 861 g, t dbSNP:765205377
864 864 g, t dbSNP:786202861
866 866 a, g dbSNP:764252214
873 873 c, t dbSNP:575595017
875 875 a, g dbSNP:141436143
881 881 c, t dbSNP:763819127
885 885 a, g dbSNP:372581879
892 892 c, t dbSNP:779629295
905 905 c, t dbSNP:186802750
906 906 a, g dbSNP:769573395
920 920 g, t dbSNP:745422385
924 924 a, g dbSNP:565078834
927 927 c, t dbSNP:756707967
929 929 -, attacc dbSNP:759174262
929 929 a, g dbSNP:45528833
934 934 c, t dbSNP:587781830
938 938 -, ttgttgtgcatg dbSNP:730881648
942 942 -, tgt dbSNP:587781388
947 947 a, g dbSNP:764027029
954 954 c, t dbSNP:755930156
956 956 a, g dbSNP:786202281
961 961 a, g dbSNP:529201896
970 970 -, acaa dbSNP:763009188
971 971 c, g dbSNP:766561078
973 973 a, g dbSNP:781121675
976 976 a, t dbSNP:773532701
977 977 c, t dbSNP:201617644
979 979 c, t dbSNP:587782427
987 987 a, g dbSNP:777068696
992 992 g, t dbSNP:769190318
996 996 c, t dbSNP:587780247
997 997 a, g dbSNP:143615668
998 998 a, t dbSNP:772283705
1006 1006 a, g dbSNP:587782734
1012 1012 a, c dbSNP:201790351
1018 1018 c, t dbSNP:778480809
1022 1022 a, g dbSNP:756764576
1027 1027 c, g dbSNP:748793974
1029 1029 g, t dbSNP:786203890
1037 1037 c, t dbSNP:786202477
1039 1039 a, g dbSNP:730881637
1042 1042 c, g dbSNP:777630298
1050 1050 a, c, g dbSNP:45617634
1066 1066 c, t dbSNP:587780831
1067 1067 c, t dbSNP:779324498
1074 1074 -, a dbSNP:587781416
1074 1074 a, t dbSNP:730881623
1075 1075 a, c dbSNP:753965650
1077 1077 a, t dbSNP:764256720
1092 1092 c, t dbSNP:786201292
1093 1093 c, t dbSNP:587780251
1095 1095 g, t dbSNP:202072866
1106 1106 a, g dbSNP:768008017
1110 1110 a, g dbSNP:116952709
1117 1117 c, t dbSNP:774677996
1118 1118 ata, ct dbSNP:786203429
1120 1120 -, a dbSNP:786203521
1126 1126 a, g dbSNP:770613242
1128 1128 a, g dbSNP:762701532
1137 1137 a, g dbSNP:772695469
1143 1143 c, t dbSNP:587781786
1153 1153 a, c dbSNP:769364081
1161 1161 a, g dbSNP:786203916
1164 1164 c, t dbSNP:747604569
1165 1165 a, g, t dbSNP:61757643
1169 1169 c, g dbSNP:746838904
1175 1175 a, c dbSNP:780024960
1180 1180 c, t dbSNP:758218234
1182 1182 c, t dbSNP:748211848
1197 1197 c, t dbSNP:4988345
1198 1198 a, g dbSNP:761432927
1200 1200 c, t dbSNP:776248182
1203 1203 a, t dbSNP:546727788
1206 1206 g, t dbSNP:746963627
1217 1217 a, g dbSNP:775509896
1230 1230 a, g, t dbSNP:201047375
1233 1233 a, g dbSNP:745645356
1235 1235 a, c dbSNP:778116059
1236 1236 a, g dbSNP:730881624
1241 1241 c, t dbSNP:786201596
1249 1249 a, g dbSNP:756269682
1252 1252 a, g dbSNP:748268716
1256 1256 c, t dbSNP:781282996
1257 1257 a, g dbSNP:4988346
1264 1264 c, t dbSNP:4988347
1267 1267 a, g dbSNP:550707862
1268 1268 c, t dbSNP:758851721
1269 1269 c, t dbSNP:530897769
1270 1270 c, t dbSNP:533184563
1275 1275 c, t dbSNP:144969738
1284 1284 a, g dbSNP:778275257
1290 1290 g, t dbSNP:761401027
1291 1291 c, t dbSNP:776372251
1292 1292 c, g dbSNP:587780832
1297 1297 c, t dbSNP:565458815
1298 1298 a, g, t dbSNP:367614726
1299 1299 c, t dbSNP:775636640
1301 1301 a, g dbSNP:771891225
1306 1306 a, g dbSNP:748912293
1308 1308 c, t dbSNP:150313156
1309 1309 a, c, t dbSNP:140097800
1312 1312 c, t dbSNP:780026145
1313 1313 -, t dbSNP:779466229
1317 1317 c, t dbSNP:772140734
1318 1318 a, g dbSNP:376760085
1321 1321 c, g dbSNP:779409059
1324 1324 a, c dbSNP:12947398
1328 1328 a, g dbSNP:202035881
1330 1330 g, t dbSNP:587782156
1333 1333 a, g dbSNP:754242563
1335 1335 c, t dbSNP:730881630
1336 1336 a, g dbSNP:587782238
1341 1341 a, g dbSNP:777618772
1342 1342 c, g dbSNP:373774920
1347 1347 c, t dbSNP:786201733
1348 1348 a, g dbSNP:786203708
1352 1352 a, g dbSNP:752356873
1354 1354 -, a dbSNP:757771711
1359 1359 c, g dbSNP:45459799
1369 1369 c, t dbSNP:759031349
1370 1370 a, g dbSNP:751460179
1371 1371 a, g dbSNP:766340391
1375 1375 c, g dbSNP:762781085
1376 1376 a, c dbSNP:772957320
1377 1377 a, g dbSNP:769535320
1381 1381 a, g dbSNP:587780834
1382 1382 a, g dbSNP:45512798
1388 1388 c, t dbSNP:775721645
1391 1391 c, t dbSNP:772048413
1393 1393 c, t dbSNP:745955726
1394 1394 a, g dbSNP:548018916
1401 1401 c, t dbSNP:771542690
1408 1408 c, t dbSNP:587781860
1412 1412 a, c dbSNP:786202300
1416 1416 a, g dbSNP:376893571
1420 1420 a, g dbSNP:756499865
1431 1431 c, t dbSNP:752309409
1432 1432 a, g dbSNP:780834054
1449 1449 g, t dbSNP:754515912
1458 1458 a, g dbSNP:138743097
1470 1470 c, t dbSNP:28997569
1471 1471 a, g dbSNP:758360637
1475 1475 a, g dbSNP:61754143
1477 1477 c, t dbSNP:550031006
1480 1480 c, t dbSNP:730881631
1484 1484 g, t dbSNP:587782514
1496 1496 a, g dbSNP:765027420
1497 1497 a, c dbSNP:587781797
1500 1500 a, g dbSNP:62620988
1503 1503 a, g dbSNP:587781425
1511 1511 c, g dbSNP:45549332
1517 1517 g, t dbSNP:759584091
1525 1525 c, g dbSNP:45624635
1528 1528 a, g dbSNP:771096783
1532 1532 c, t dbSNP:144940449
1534 1534 a, g dbSNP:141055990
1536 1536 c, t dbSNP:770289817
1544 1544 a, g dbSNP:748545827
1547 1547 c, t dbSNP:147739458
1548 1548 a, g dbSNP:145601931
1549 1549 a, g dbSNP:148556781
1558 1558 a, g dbSNP:746599076
1570 1570 -, a dbSNP:786202610
1570 1570 a, g dbSNP:28997570
1577 1577 a, g dbSNP:137852985
1582 1582 c, g, t dbSNP:750376292
1592 1592 a, g dbSNP:786201326
1601 1601 a, g dbSNP:786202337
1604 1604 a, g dbSNP:374974885
1612 1612 -, a dbSNP:587778138
1612 1612 a, g dbSNP:587782731
1621 1621 a, g dbSNP:112076926
1639 1639 a, g dbSNP:746681841
1644 1644 c, t dbSNP:587778139
1652 1652 a, t dbSNP:779627397
1655 1655 a, g dbSNP:771630777
1664 1664 c, t dbSNP:745379285
1666 1666 a, g dbSNP:778863018
1672 1672 g, t dbSNP:587782771
1673 1673 a, g dbSNP:587780252
1677 1677 a, g dbSNP:757196702
1680 1680 a, g, t dbSNP:535414791
1685 1685 a, g dbSNP:786201808
1692 1692 c, g dbSNP:777653224
1698 1698 c, t dbSNP:755796609
1711 1711 a, g dbSNP:751841684
1720 1720 c, t dbSNP:786201819
1725 1725 c, g dbSNP:149364097
1727 1727 c, t dbSNP:763189201
1733 1733 a, g dbSNP:544977115
1734 1734 c, t dbSNP:730881632
1735 1735 a, g dbSNP:762417690
1741 1741 c, t dbSNP:776939714
1746 1746 c, t dbSNP:730881633
1747 1747 -, g dbSNP:751209171
1749 1749 g, t dbSNP:769081927
1750 1750 -, ttac dbSNP:766110015
1751 1751 a, g dbSNP:761017296
1752 1752 -, agtcca dbSNP:762883121
1752 1752 a, c dbSNP:775191379
1754 1754 a, c dbSNP:771682192
1757 1757 a, g dbSNP:730881634
1762 1762 -, a dbSNP:587781639
1763 1763 c, t dbSNP:745432312
1769 1769 c, t dbSNP:139701369
1770 1770 a, t dbSNP:770306753
1773 1773 a, g dbSNP:749251680
1785 1785 c, t dbSNP:587781325
1786 1786 a, g dbSNP:786202218
1789 1789 a, g dbSNP:777511615
1794 1794 a, ct dbSNP:587783377
1794 1794 a, c dbSNP:786202637
1797 1797 c, t dbSNP:755992778
1804 1804 c, t dbSNP:786202192
1806 1806 -, ca dbSNP:587780224
1819 1819 a, g, t dbSNP:569696977
1833 1833 c, t dbSNP:748001678
1836 1836 a, t dbSNP:730881635
1845 1845 a, g dbSNP:587780825
1848 1848 a, g dbSNP:781168634
1850 1850 c, t dbSNP:754755989
1856 1856 a, g dbSNP:550092661
1864 1864 a, c dbSNP:778992385
1869 1869 a, c dbSNP:587782039
1872 1872 a, g dbSNP:786203967
1874 1874 c, t dbSNP:757427498
1875 1875 a, g dbSNP:587782816
1878 1878 g, t dbSNP:764711572
1881 1881 c, t dbSNP:756636362
1884 1884 -, tgtg dbSNP:730881647
1887 1887 c, t dbSNP:369631413
1888 1888 a, g dbSNP:786202780
1897 1897 c, t dbSNP:767872861
1900 1900 a, g dbSNP:759835916
1906 1906 g, t dbSNP:587782247
1910 1910 -, aacagaagttcagcttcggttt dbSNP:786202415
1918 1918 c, t dbSNP:45576134
1920 1920 c, t dbSNP:368796923
1926 1926 c, t dbSNP:587780225
1927 1927 a, g dbSNP:772570870
1935 1935 c, t dbSNP:150624408
1936 1936 a, g dbSNP:748105919
1937 1937 a, g dbSNP:148429663
1944 1944 a, c dbSNP:768633507
1948 1948 a, g dbSNP:746778889
1963 1963 a, c dbSNP:779237423
1966 1966 a, c dbSNP:587781463
1976 1976 a, g dbSNP:757400610
1984 1984 a, g dbSNP:730881636
1992 1992 a, c, t dbSNP:756119073
1995 1995 c, t dbSNP:587780226
1996 1996 a, g dbSNP:753214212
2012 2012 c, t dbSNP:200581792
2016 2016 a, c dbSNP:786203496
2023 2023 a, g dbSNP:775171520
2032 2032 c, t dbSNP:771861055
2036 2036 c, t dbSNP:730881640
2037 2037 a, g dbSNP:587780227
2041 2041 a, t dbSNP:769918040
2042 2042 a, c dbSNP:786202553
2043 2043 a, t dbSNP:587780826
2049 2049 c, g dbSNP:748221377
2052 2052 g, t dbSNP:587780228
2055 2055 a, c, g dbSNP:752052351
2057 2057 a, c dbSNP:780310294
2060 2060 c, t dbSNP:758735370
2063 2063 c, g, t dbSNP:587780875
2081 2081 a, g dbSNP:764979728
2105 2105 -, aactt dbSNP:768736851
2112 2112 c, t dbSNP:761452695
2113 2113 a, g dbSNP:45501097
2121 2121 g, t dbSNP:587780229
2122 2122 a, g, t dbSNP:200062099
2123 2123 c, t dbSNP:775431508
2124 2124 a, g dbSNP:142744352
2126 2126 c, t dbSNP:759360709
2135 2135 c, t dbSNP:773489367
2147 2147 g, t dbSNP:587780230
2164 2164 c, t dbSNP:536081549
2165 2165 g, t dbSNP:370658123
2179 2179 a, g dbSNP:746329838
2190 2190 -, a dbSNP:775735278
2191 2191 c, t dbSNP:755306832
2222 2222 a, g dbSNP:779454200
2230 2230 c, t dbSNP:786202169
2232 2232 a, g dbSNP:786201701
2239 2239 c, g dbSNP:757629526
2240 2240 a, t dbSNP:730881638
2251 2251 a, g dbSNP:587781726
2254 2254 -, t dbSNP:772248310
2262 2262 a, g dbSNP:748962730
2266 2266 a, g dbSNP:138784299
2271 2271 a, c dbSNP:4988350
2285 2285 c, g dbSNP:56024614
2296 2296 a, g, t dbSNP:199616792
2299 2299 a, t dbSNP:4988349
2303 2303 c, t dbSNP:786203897
2306 2306 c, t dbSNP:373709958
2321 2321 g, t dbSNP:754414731
2323 2323 a, g dbSNP:587782405
2324 2324 c, t dbSNP:372760869
2330 2330 g, t dbSNP:587782254
2331 2331 c, g dbSNP:766302517
2332 2332 c, t dbSNP:375246789
2333 2333 a, g dbSNP:750213758
2335 2335 c, t dbSNP:369340666
2340 2340 c, g dbSNP:777217004
2341 2341 -, a dbSNP:749762964
2346 2346 c, t dbSNP:752797989
2352 2352 c, t dbSNP:767648925
2364 2364 a, g dbSNP:45533636
2367 2367 -, gat dbSNP:780590493
2368 2368 a, g dbSNP:577768294
2371 2371 c, t dbSNP:755635967
2372 2372 c, t dbSNP:786202979
2375 2375 a, c dbSNP:142572387
2384 2384 g, t dbSNP:763458922
2386 2386 c, g dbSNP:373228183
2390 2390 a, g dbSNP:370087045
2391 2391 -, ttg dbSNP:754566378
2397 2397 c, g dbSNP:786202587
2401 2401 c, t dbSNP:377302300
2407 2407 -, a dbSNP:587778131
2407 2407 a, g dbSNP:587778132
2411 2411 a, g dbSNP:587780829
2414 2414 a, g dbSNP:786202592
2415 2415 c, t dbSNP:28997571
2416 2416 a, g dbSNP:768224857
2418 2418 g, t dbSNP:746494295
2421 2421 c, t dbSNP:780020495
2422 2422 a, g dbSNP:587778133
2425 2425 a, g dbSNP:750288231
2432 2432 c, t dbSNP:778774207
2434 2434 a, c dbSNP:756946068
2454 2454 g, t dbSNP:587780231
2456 2456 a, g dbSNP:753023295
2461 2461 c, t dbSNP:587781559
2464 2464 a, g dbSNP:759727507
2470 2470 c, t dbSNP:751667661
2477 2477 c, t dbSNP:771672834
2478 2478 c, t dbSNP:745367580
2480 2480 g, t dbSNP:375625993
2484 2484 g, t dbSNP:770750488
2489 2489 c, t dbSNP:370393808
2503 2503 a, g dbSNP:112505689
2505 2505 a, g dbSNP:189758577
2508 2508 a, g dbSNP:749200646
2511 2511 a, g dbSNP:777741543
2533 2533 -, g dbSNP:587781985
2551 2551 a, c, t dbSNP:587781321
2552 2552 a, g dbSNP:145504336
2568 2568 -, a dbSNP:763818712
2569 2569 a, c dbSNP:780407946
2570 2570 a, g dbSNP:145796331
2577 2577 a, c, g dbSNP:765314472
2578 2578 c, t dbSNP:587780232
2579 2579 c, g dbSNP:28997572
2583 2583 c, t dbSNP:754280136
2589 2589 g, t dbSNP:541203428
2594 2594 c, t dbSNP:764456240
2597 2597 c, t dbSNP:763534423
2620 2620 a, t dbSNP:554791910
2621 2621 a, g dbSNP:538015264
2681 2681 g, t dbSNP:786202760
2682 2682 a, g dbSNP:780475484
2686 2686 a, c, g dbSNP:746066323
2691 2691 a, g dbSNP:778867622
2692 2692 c, t dbSNP:757305097
2693 2693 c, t dbSNP:754400631
2696 2696 a, g dbSNP:778250103
2698 2698 c, t dbSNP:756511744
2702 2702 c, t dbSNP:786201877
2703 2703 c, t dbSNP:753036322
2704 2704 c, g dbSNP:767872111
2710 2710 -, g dbSNP:760782298
2712 2712 c, t dbSNP:786203170
2713 2713 a, g dbSNP:759142191
2724 2724 a, g dbSNP:571340013
2729 2729 a, c dbSNP:376628979
2733 2733 -, c dbSNP:34224865
2736 2736 a, g dbSNP:765816425
2750 2750 -, t dbSNP:775537066
2750 2750 a, t dbSNP:762535496
2752 2752 a, g dbSNP:587778135
2758 2758 a, g dbSNP:786203619
2768 2768 c, g dbSNP:786202395
2778 2778 c, t dbSNP:786203872
2779 2779 -, tt dbSNP:587778134
2787 2787 c, g dbSNP:773347072
2796 2796 a, g dbSNP:769820537
2801 2801 c, g dbSNP:112414873
2807 2807 a, g dbSNP:556955136
2811 2811 a, c dbSNP:587782356
2827 2827 c, t dbSNP:147755155
2828 2828 a, t dbSNP:768436074
2840 2840 a, g dbSNP:766047812
2847 2847 a, c dbSNP:762590242
2848 2848 -, cc dbSNP:760863397
2848 2848 a, t dbSNP:756412722
2848 2848 a, tcc dbSNP:786203384
2859 2859 c, t dbSNP:764803896
2860 2860 a, g, t dbSNP:200313471
2869 2869 c, t dbSNP:768393936
2871 2871 a, g dbSNP:760515227
2892 2892 c, g dbSNP:774478325
2895 2895 c, t dbSNP:771122056
2904 2904 -, acag dbSNP:778385829
2907 2907 a, g dbSNP:145616741
2909 2909 c, t dbSNP:749460936
2912 2912 c, t dbSNP:777860588
2913 2913 -, gtagaa dbSNP:770198861
2919 2919 c, t dbSNP:769797684
2929 2929 a, g dbSNP:748616469
2933 2933 a, g dbSNP:781712098
2950 2950 a, g dbSNP:755361298
2956 2956 c, t dbSNP:587780234
2957 2957 g, t dbSNP:747365105
2960 2960 c, g, t dbSNP:45589637
2968 2968 a, c, g dbSNP:750033391
2972 2972 c, t dbSNP:374362388
2973 2973 a, g dbSNP:587780235
2976 2976 a, g dbSNP:111536363
2977 2977 -, tcaa dbSNP:587782726
2987 2987 a, t dbSNP:587782556
2989 2989 g, t dbSNP:764061653
2991 2991 c, g dbSNP:760438320
2995 2995 -, aa dbSNP:730881649
2998 2998 a, g dbSNP:745578572
3013 3013 -, t dbSNP:587780236
3014 3014 a, g dbSNP:786201526
3024 3024 c, t dbSNP:587778136
3025 3025 a, g, t dbSNP:200960251
3026 3026 c, t dbSNP:61754141
3028 3028 a, g dbSNP:371484780
3035 3035 a, g dbSNP:752509701
3036 3036 a, g dbSNP:371227751
3041 3041 a, c, g dbSNP:369434185
3050 3050 c, t dbSNP:148752066
3053 3053 -, ctcagat dbSNP:758128094
3057 3057 a, g dbSNP:146091205
3064 3064 a, g dbSNP:571108955
3065 3065 g, t dbSNP:375146450
3068 3068 c, t dbSNP:786203725
3069 3069 c, g, t dbSNP:768555161
3070 3070 a, g dbSNP:747568830
3078 3078 a, c dbSNP:776131401
3083 3083 a, g dbSNP:772636536
3084 3084 a, g dbSNP:142806416
3085 3085 c, t dbSNP:778758437
3104 3104 a, t dbSNP:587783045
3110 3110 a, g dbSNP:372122365
3116 3116 a, g dbSNP:554514054
3117 3117 c, t dbSNP:587782574
3122 3122 g, t dbSNP:560088455
3130 3130 a, g dbSNP:730881622
3132 3132 c, t dbSNP:137852986
3133 3133 a, g dbSNP:375082407
3134 3134 a, t dbSNP:540236878
3140 3140 c, g, t dbSNP:574552037
3146 3146 a, c, t dbSNP:748981650
3149 3149 c, t dbSNP:762039913
3151 3151 a, g dbSNP:777277034
3155 3155 a, c dbSNP:769413097
3156 3156 a, g dbSNP:747622456
3159 3159 c, t dbSNP:786201708
3162 3162 a, g dbSNP:587780237
3163 3163 g, t dbSNP:781153382
3167 3167 c, t dbSNP:754927538
3168 3168 c, g dbSNP:587780238
3173 3173 a, t dbSNP:751455420
3174 3174 c, t dbSNP:779915262
3180 3180 c, t dbSNP:201869624
3181 3181 a, g dbSNP:45468199
3185 3185 a, g dbSNP:764195906
3187 3187 a, g dbSNP:786204250
3204 3204 c, t dbSNP:760887592
3205 3205 a, g dbSNP:587781572
3208 3208 g, t dbSNP:45479297
3209 3209 a, g, t dbSNP:587780239
3212 3212 c, t dbSNP:767666616
3217 3217 a, g dbSNP:760127237
3218 3218 c, t dbSNP:774939280
3219 3219 a, c dbSNP:786203898
3232 3232 a, g dbSNP:771382903
3234 3234 c, t dbSNP:768222842
3235 3235 a, g dbSNP:4988355
3237 3237 a, g dbSNP:199831248
3243 3243 c, g dbSNP:746492294
3245 3245 c, t dbSNP:775547651
3249 3249 a, c dbSNP:771929845
3264 3264 c, t dbSNP:786201802
3282 3282 a, c, t dbSNP:45572934
3283 3283 a, g dbSNP:374334794
3285 3285 c, t dbSNP:786202317
3293 3293 g, t dbSNP:587781793
3294 3294 a, g dbSNP:745782331
3303 3303 c, t dbSNP:146031731
3304 3304 a, g, t dbSNP:200894063
3307 3307 a, g dbSNP:781556845
3308 3308 c, t dbSNP:370175724
3309 3309 a, g dbSNP:28904918
3310 3310 c, t dbSNP:766432760
3319 3319 c, t dbSNP:587780242
3322 3322 c, g dbSNP:774415723
3326 3326 a, g dbSNP:745318756
3330 3330 a, g dbSNP:149529390
3333 3333 c, t dbSNP:578022079
3334 3334 a, g dbSNP:781609846
3335 3335 -, g dbSNP:587781974
3338 3338 a, g dbSNP:769021796
3339 3339 a, c dbSNP:182028200
3340 3340 a, g dbSNP:747213803
3351 3351 c, t dbSNP:786203288
3353 3353 c, t dbSNP:199721657
3355 3355 c, t dbSNP:587781964
3357 3357 a, g dbSNP:758444508
3367 3367 a, g dbSNP:750961319
3371 3371 a, g dbSNP:786201336
3377 3377 a, g dbSNP:4986765
3390 3390 a, t dbSNP:587780243
3402 3402 c, t dbSNP:757668121
3411 3411 a, g dbSNP:754224663
3424 3424 -, ccat dbSNP:760551339
3426 3426 a, g dbSNP:764406913
3429 3429 a, g dbSNP:587781644
3433 3433 a, t dbSNP:752340544
3446 3446 a, g dbSNP:587780244
3456 3456 a, g dbSNP:759080195
3461 3461 a, t dbSNP:774467171
3463 3463 c, t dbSNP:786201919
3465 3465 c, g dbSNP:587781853
3466 3466 c, t dbSNP:770966270
3470 3470 a, g dbSNP:570751937
3472 3472 -, t dbSNP:752780954
3475 3475 a, c dbSNP:571949350
3488 3488 c, t dbSNP:555200296
3491 3491 c, t dbSNP:150780318
3493 3493 a, c, t dbSNP:587781298
3495 3495 c, t dbSNP:4986764
3505 3505 g, t dbSNP:587782410
3512 3512 a, c dbSNP:730881625
3526 3526 g, t dbSNP:772087074
3531 3531 a, c dbSNP:745940032
3541 3541 c, t dbSNP:778916092
3544 3544 g, t dbSNP:4988356
3546 3546 a, g dbSNP:754280048
3551 3551 c, t dbSNP:374335608
3552 3552 a, g dbSNP:199643061
3556 3556 c, g dbSNP:756490117
3560 3560 a, g dbSNP:786201396
3563 3563 -, a dbSNP:767549540
3565 3565 a, g dbSNP:370330739
3568 3568 c, t dbSNP:786204143
3569 3569 c, g, t dbSNP:767164240
3570 3570 c, g, t dbSNP:140233356
3571 3571 a, c, g dbSNP:148232408
3575 3575 a, g dbSNP:786203633
3581 3581 a, g dbSNP:786201414
3587 3587 c, t dbSNP:45499991
3591 3591 a, g dbSNP:730881626
3594 3594 a, g dbSNP:200239986
3597 3597 a, c dbSNP:587780245
3598 3598 c, t dbSNP:201672040
3599 3599 a, c dbSNP:786201685
3603 3603 a, c dbSNP:587782244
3606 3606 c, t dbSNP:74824981
3607 3607 c, g dbSNP:761639530
3610 3610 c, t dbSNP:786203077
3611 3611 c, t dbSNP:786202095
3613 3613 a, t dbSNP:145859791
3623 3623 c, t dbSNP:367728797
3625 3625 c, t dbSNP:786201632
3633 3633 a, c, g dbSNP:113697814
3642 3642 a, g dbSNP:587782679
3654 3654 a, g dbSNP:786203224
3670 3670 c, t dbSNP:770352467
3673 3673 a, g dbSNP:587780246
3675 3675 a, g dbSNP:730881627
3677 3677 a, g dbSNP:75091137
3679 3679 c, t dbSNP:781622986
3687 3687 -, a dbSNP:774684620
3687 3687 a, t dbSNP:755337038
3688 3688 a, t dbSNP:587781417
3689 3689 g, t dbSNP:746715917
3697 3697 c, g dbSNP:182087528
3703 3703 c, t dbSNP:758032378
3730 3730 -, caaa dbSNP:771028677
3730 3730 c, t dbSNP:749978235
3731 3731 a, g dbSNP:45466996
3732 3732 -, aaga dbSNP:786203717
3734 3734 c, g dbSNP:757225144
3744 3744 -, tgacagct dbSNP:763443434
3745 3745 a, g dbSNP:753664225
3746 3746 c, g, t dbSNP:546083449
3749 3749 a, g dbSNP:751823379
3751 3751 a, g dbSNP:766562396
3765 3765 a, g, t dbSNP:587781328
3767 3767 a, g dbSNP:786201171
3782 3782 c, t dbSNP:188258913
3783 3783 a, g dbSNP:769692303
3790 3790 c, t dbSNP:747907706
3791 3791 a, g dbSNP:776990704
3804 3804 a, g dbSNP:587782808
3808 3808 c, t dbSNP:747345595
3809 3809 c, t dbSNP:61754142
3810 3810 a, g dbSNP:147119272
3811 3811 g, t dbSNP:587781744
3812 3812 a, g, t dbSNP:778500245
3816 3816 c, t dbSNP:756712872
3818 3818 a, g dbSNP:786201657
3819 3819 a, g dbSNP:371185409
3821 3821 a, g dbSNP:777660106
3826 3826 c, g dbSNP:755949409
3826 3826 -, g dbSNP:773433456
3829 3829 c, g, t dbSNP:767255426
3836 3836 g, t dbSNP:763162379
3839 3839 c, t dbSNP:202228407
3840 3840 a, c dbSNP:765416041
3843 3843 c, t dbSNP:45437094
3844 3844 a, g dbSNP:367816363
3857 3857 a, g dbSNP:769310105
3862 3862 c, t dbSNP:761225576
3864 3864 a, g dbSNP:776002434
3880 3880 c, t dbSNP:786203344
3885 3885 c, t dbSNP:772507914
3889 3889 a, c dbSNP:373040333
3918 3918 a, g dbSNP:149016505
3921 3921 a, c dbSNP:778430337
3925 3925 c, t dbSNP:770517912
3928 3928 c, t dbSNP:575998972
3935 3935 a, g dbSNP:45540240
3936 3936 -, t dbSNP:730881645
3948 3948 -, t dbSNP:748598593
3949 3949 c, t dbSNP:777213170
3954 3954 a, g dbSNP:756074244
3955 3955 a, c dbSNP:786204068
3963 3963 a, t dbSNP:368867532
3964 3964 c, t dbSNP:183928474
3972 3972 a, t dbSNP:786202927
3974 3974 a, g, t dbSNP:570238270
3976 3976 c, t dbSNP:150813402
3977 3977 g, t dbSNP:587781666
3978 3978 a, g dbSNP:786204230
3980 3980 -, t dbSNP:779741278
3983 3983 c, t dbSNP:754003636
4000 4000 -, a dbSNP:771654971
4000 4000 a, g dbSNP:786202024
4005 4005 g, t dbSNP:764205156
4006 4006 c, t dbSNP:761278503
4012 4012 a, g dbSNP:776129117
4014 4014 c, t dbSNP:768065626
4015 4015 c, t dbSNP:587780830
4016 4016 a, g dbSNP:375911315
4025 4025 c, t dbSNP:774105218
4029 4029 c, g dbSNP:770509300
4034 4034 c, t dbSNP:748928248
4036 4036 g, t dbSNP:772709195
4038 4038 a, g dbSNP:587781923
4045 4045 a, g dbSNP:748140041
4048 4048 c, t dbSNP:781102464
4056 4056 c, t dbSNP:111943191
4071 4071 c, g dbSNP:587780248
4076 4076 c, t dbSNP:369843642
4089 4089 g, t dbSNP:779860140
4094 4094 c, t dbSNP:757427210
4107 4107 a, g dbSNP:754056526
4114 4114 -, cag dbSNP:745344948
4118 4118 a, c dbSNP:145855459
4122 4122 a, g dbSNP:45552539
4128 4128 a, t dbSNP:786202549
4130 4130 -, ctat dbSNP:778664039
4141 4141 -, c dbSNP:756853672
4143 4143 a, g dbSNP:369340444
4151 4151 c, t dbSNP:4986763
4152 4152 a, g, t dbSNP:587780249
4171 4171 a, g dbSNP:774605759
4176 4176 a, g dbSNP:786202247
4180 4180 -, a dbSNP:753683450
4184 4184 a, c dbSNP:28997573
4188 4188 c, g dbSNP:757363615
4199 4199 c, t dbSNP:4987050
4200 4200 a, g dbSNP:769359514
4204 4204 a, g dbSNP:45603843
4208 4208 c, t dbSNP:747624574
4210 4210 c, g dbSNP:776599258
4215 4215 g, t dbSNP:368610199
4220 4220 c, t dbSNP:746898528
4229 4229 c, t dbSNP:144245485
4233 4233 a, c dbSNP:771889454
4243 4243 a, c dbSNP:749589266
4245 4245 g, t dbSNP:587782029
4247 4247 a, c dbSNP:375741316
4248 4248 c, g dbSNP:587782552
4261 4261 c, g dbSNP:786202662
4263 4263 a, g dbSNP:372799558
4265 4265 -, t dbSNP:777367075
4269 4269 a, c dbSNP:756313788
4271 4271 a, g dbSNP:181186298
4273 4273 a, t dbSNP:752850661
4275 4275 a, g dbSNP:781289228
4286 4286 c, t dbSNP:755440956
4295 4295 a, g dbSNP:752044406
4296 4296 a, g dbSNP:766709841
4297 4297 a, g dbSNP:763298204
4299 4299 a, g dbSNP:367610893
4302 4302 a, g dbSNP:786201962
4307 4307 c, t dbSNP:764848326
4311 4311 a, g dbSNP:761405340
4330 4330 a, g dbSNP:587781677
4339 4339 a, g dbSNP:730881628
4345 4345 a, g dbSNP:776010326
4347 4347 at, ga dbSNP:587782615
4355 4355 a, t dbSNP:768156067
4360 4360 a, t dbSNP:139539831
4362 4362 a, g dbSNP:760589795
4367 4367 a, t dbSNP:548674096
4369 4369 a, g dbSNP:112214651
4376 4376 c, t dbSNP:374392860
4384 4384 c, t dbSNP:771805501
4387 4387 -, c dbSNP:756079324
4391 4391 a, g, t dbSNP:542698396
4402 4402 g, t dbSNP:778805688
4404 4404 -, g dbSNP:752586524
4405 4405 a, g dbSNP:770175142
4407 4407 c, g dbSNP:748310432
4416 4416 a, c dbSNP:781140410
4420 4420 a, g dbSNP:755069935
4421 4421 c, t dbSNP:370581038
4432 4432 g, t dbSNP:780578438
4441 4441 g, t dbSNP:587778137
4450 4450 c, t dbSNP:587781819
4451 4451 c, t dbSNP:786203915
4455 4455 c, t dbSNP:587781886
4457 4457 c, t dbSNP:758809865
4467 4467 g, t dbSNP:587780250
4468 4468 g, t dbSNP:765545033
4470 4470 -, at dbSNP:730881646
4470 4470 a, c dbSNP:761468878
4472 4472 a, g dbSNP:753516000
4483 4483 g, t dbSNP:763579793
4504 4504 g, t dbSNP:760202569
4512 4512 -, a dbSNP:755091088
4522 4522 c, t dbSNP:754001752
4529 4529 a, g dbSNP:202123733
4531 4531 c, g dbSNP:772160050
4537 4537 a, g dbSNP:759511390
4567 4567 a, c dbSNP:4988358
4577 4577 g, t dbSNP:557749565
4579 4579 g, t dbSNP:539702731
4580 4580 a, g dbSNP:569535272
4606 4606 g, t dbSNP:562726845
4618 4618 a, g dbSNP:150444311
4622 4622 a, g dbSNP:143361598
4625 4625 a, g dbSNP:775842351
4634 4634 c, g dbSNP:767771825
4641 4641 g, t dbSNP:538867472
4642 4642 g, t dbSNP:540229694
4643 4643 c, g dbSNP:113345004
4645 4645 -, t dbSNP:376507309
4648 4648 c, t dbSNP:1978111
4649 4649 c, t dbSNP:554326644
4655 4655 -, t dbSNP:111519368
4662 4662 c, g dbSNP:111898257
4664 4664 a, g dbSNP:774889346
4672 4672 -, ctgt dbSNP:551479702
4725 4725 c, t dbSNP:764128633
4753 4753 c, t dbSNP:774821210
4770 4770 c, g dbSNP:189935192
4773 4773 -, a dbSNP:531656835
4870 4870 c, t dbSNP:556729826
4886 4886 -, ct dbSNP:546666211
4950 4950 c, g dbSNP:539677174
4973 4973 c, t dbSNP:7213430
4978 4978 c, t dbSNP:772711204
4990 4990 g, t dbSNP:377169249
4999 4999 c, t dbSNP:533893805
5014 5014 a, g dbSNP:371689236
5082 5082 a, t dbSNP:568447515
5093 5093 c, t dbSNP:368711371
5106 5106 a, g dbSNP:116292412
5149 5149 a, g dbSNP:769375960
5150 5150 c, g dbSNP:569287586
5204 5204 g, t dbSNP:552378907
5219 5219 c, t dbSNP:137967725
5251 5251 g, t dbSNP:560463291
5264 5264 a, g dbSNP:376898714
5269 5269 c, t dbSNP:185040281
5342 5342 g, t dbSNP:540541914
5365 5365 a, c dbSNP:193165407
5387 5387 a, g dbSNP:747741322
5392 5392 a, g dbSNP:571471772
5406 5406 a, g dbSNP:560959350
5468 5468 a, g dbSNP:367962443
5513 5513 a, g dbSNP:543935297
5538 5538 -, tat dbSNP:564290244
5590 5590 c, t dbSNP:575280579
5675 5675 -, ttct dbSNP:560881577
5692 5692 a, t dbSNP:113940104
5707 5707 c, t dbSNP:374389912
5723 5723 a, t dbSNP:372430235
5741 5741 c, t dbSNP:374318992
5753 5753 a, g dbSNP:73991940
5780 5780 c, t dbSNP:545980168
5788 5788 c, g dbSNP:746812029
5803 5803 a, t dbSNP:577034037
5807 5807 g, t dbSNP:368664791
5864 5864 c, t dbSNP:59115933
5878 5878 a, g dbSNP:554909015
5883 5883 g, t dbSNP:754698039
5887 5887 a, g dbSNP:568330176
5899 5899 a, t dbSNP:554933640
5992 5992 a, t dbSNP:537881525
6039 6039 a, g dbSNP:569331035
6046 6046 a, c dbSNP:552744287
6062 6062 -, aa dbSNP:772163923
6093 6093 a, g dbSNP:374453575
6136 6136 c, g dbSNP:145338121
6165 6165 a, g dbSNP:566674578
6244 6244 c, g dbSNP:546886816
6282 6282 a, g dbSNP:746869920
6283 6283 a, t dbSNP:190169023
6293 6293 c, t dbSNP:780101170
6310 6310 c, t dbSNP:114037902
6337 6337 a, g dbSNP:546189831
6350 6350 a, g dbSNP:758416895
6358 6358 g, t dbSNP:184666432
6421 6421 a, g dbSNP:778892658
6424 6424 c, t dbSNP:192638855
6426 6426 a, g dbSNP:754507753
6454 6454 c, t dbSNP:140267868
6497 6497 a, g dbSNP:564955157

Target ORF information:

RefSeq Version XM_011525333
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu73257D
Sequence Information ORF Nucleotide Sequence (Length: 3810bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Fanconi anemia group J protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1322..3292(+)
Misc Feature(2)1331..1834(+)
Misc Feature(3)2687..3244(+)
Position Chain Variation Link
32 32 a, g dbSNP:7212884
41 41 c, t dbSNP:755769153
52 52 g, t dbSNP:752414798
133 133 c, t dbSNP:779818099
143 143 c, t dbSNP:567823137
148 148 a, g dbSNP:550715267
166 166 a, g dbSNP:377018932
231 231 -, a dbSNP:775139545
316 316 c, t dbSNP:537120108
341 341 c, t dbSNP:571297291
394 394 c, t dbSNP:372805424
467 467 c, t dbSNP:551265650
500 500 c, t dbSNP:528422757
508 508 c, t dbSNP:780953002
531 531 -, aact dbSNP:552602799
568 568 a, c dbSNP:377620948
585 585 a, g dbSNP:754270436
590 590 a, g dbSNP:764585550
594 594 c, t dbSNP:751194347
599 599 a, g dbSNP:45512093
613 613 a, c, t dbSNP:752411477
618 618 c, t dbSNP:786203418
619 619 c, t dbSNP:767215118
622 622 c, t dbSNP:759187663
625 625 c, g, t dbSNP:45566938
636 636 a, g dbSNP:587781387
640 640 c, t dbSNP:762827371
658 658 a, g dbSNP:45458996
672 672 a, t dbSNP:786202674
676 676 a, g dbSNP:769585673
677 677 a, g dbSNP:747867580
683 683 a, t dbSNP:776386693
686 686 c, t dbSNP:772319724
690 690 c, g dbSNP:786201468
692 692 a, g dbSNP:373104267
697 697 a, c dbSNP:774586397
710 710 c, t dbSNP:770930270
715 715 c, t dbSNP:749323434
719 719 c, t dbSNP:758270108
722 722 a, g, t dbSNP:587781292
728 728 a, c, g dbSNP:28903098
730 730 -, c dbSNP:587782065
732 732 a, c dbSNP:755317452
747 747 gc, tt dbSNP:786202417
747 747 g, t dbSNP:751182362
748 748 c, t dbSNP:779686432
752 752 a, g dbSNP:757909937
762 762 a, g dbSNP:749920386
770 770 g, t dbSNP:765205377
773 773 g, t dbSNP:786202861
775 775 a, g dbSNP:764252214
782 782 c, t dbSNP:575595017
784 784 a, g dbSNP:141436143
790 790 c, t dbSNP:763819127
794 794 a, g dbSNP:372581879
801 801 c, t dbSNP:779629295
814 814 c, t dbSNP:186802750
815 815 a, g dbSNP:769573395
829 829 g, t dbSNP:745422385
833 833 a, g dbSNP:565078834
836 836 c, t dbSNP:756707967
838 838 -, attacc dbSNP:759174262
838 838 a, g dbSNP:45528833
843 843 c, t dbSNP:587781830
847 847 -, ttgttgtgcatg dbSNP:730881648
851 851 -, tgt dbSNP:587781388
856 856 a, g dbSNP:764027029
863 863 c, t dbSNP:755930156
865 865 a, g dbSNP:786202281
870 870 a, g dbSNP:529201896
879 879 -, acaa dbSNP:763009188
880 880 c, g dbSNP:766561078
882 882 a, g dbSNP:781121675
885 885 a, t dbSNP:773532701
886 886 c, t dbSNP:201617644
888 888 c, t dbSNP:587782427
896 896 a, g dbSNP:777068696
901 901 g, t dbSNP:769190318
905 905 c, t dbSNP:587780247
906 906 a, g dbSNP:143615668
907 907 a, t dbSNP:772283705
915 915 a, g dbSNP:587782734
921 921 a, c dbSNP:201790351
927 927 c, t dbSNP:778480809
931 931 a, g dbSNP:756764576
936 936 c, g dbSNP:748793974
938 938 g, t dbSNP:786203890
946 946 c, t dbSNP:786202477
948 948 a, g dbSNP:730881637
951 951 c, g dbSNP:777630298
959 959 a, c, g dbSNP:45617634
975 975 c, t dbSNP:587780831
976 976 c, t dbSNP:779324498
983 983 -, a dbSNP:587781416
983 983 a, t dbSNP:730881623
984 984 a, c dbSNP:753965650
986 986 a, t dbSNP:764256720
1001 1001 c, t dbSNP:786201292
1002 1002 c, t dbSNP:587780251
1004 1004 g, t dbSNP:202072866
1015 1015 a, g dbSNP:768008017
1019 1019 a, g dbSNP:116952709
1026 1026 c, t dbSNP:774677996
1027 1027 ata, ct dbSNP:786203429
1029 1029 -, a dbSNP:786203521
1035 1035 a, g dbSNP:770613242
1037 1037 a, g dbSNP:762701532
1046 1046 a, g dbSNP:772695469
1052 1052 c, t dbSNP:587781786
1062 1062 a, c dbSNP:769364081
1070 1070 a, g dbSNP:786203916
1073 1073 c, t dbSNP:747604569
1074 1074 a, g, t dbSNP:61757643
1078 1078 c, g dbSNP:746838904
1084 1084 a, c dbSNP:780024960
1089 1089 c, t dbSNP:758218234
1091 1091 c, t dbSNP:748211848
1106 1106 c, t dbSNP:4988345
1107 1107 a, g dbSNP:761432927
1109 1109 c, t dbSNP:776248182
1112 1112 a, t dbSNP:546727788
1115 1115 g, t dbSNP:746963627
1126 1126 a, g dbSNP:775509896
1139 1139 a, g, t dbSNP:201047375
1142 1142 a, g dbSNP:745645356
1144 1144 a, c dbSNP:778116059
1145 1145 a, g dbSNP:730881624
1150 1150 c, t dbSNP:786201596
1158 1158 a, g dbSNP:756269682
1161 1161 a, g dbSNP:748268716
1165 1165 c, t dbSNP:781282996
1166 1166 a, g dbSNP:4988346
1173 1173 c, t dbSNP:4988347
1176 1176 a, g dbSNP:550707862
1177 1177 c, t dbSNP:758851721
1178 1178 c, t dbSNP:530897769
1179 1179 c, t dbSNP:533184563
1184 1184 c, t dbSNP:144969738
1193 1193 a, g dbSNP:778275257
1199 1199 g, t dbSNP:761401027
1200 1200 c, t dbSNP:776372251
1201 1201 c, g dbSNP:587780832
1206 1206 c, t dbSNP:565458815
1207 1207 a, g, t dbSNP:367614726
1208 1208 c, t dbSNP:775636640
1210 1210 a, g dbSNP:771891225
1215 1215 a, g dbSNP:748912293
1217 1217 c, t dbSNP:150313156
1218 1218 a, c, t dbSNP:140097800
1221 1221 c, t dbSNP:780026145
1222 1222 -, t dbSNP:779466229
1226 1226 c, t dbSNP:772140734
1227 1227 a, g dbSNP:376760085
1230 1230 c, g dbSNP:779409059
1233 1233 a, c dbSNP:12947398
1237 1237 a, g dbSNP:202035881
1239 1239 g, t dbSNP:587782156
1242 1242 a, g dbSNP:754242563
1244 1244 c, t dbSNP:730881630
1245 1245 a, g dbSNP:587782238
1250 1250 a, g dbSNP:777618772
1251 1251 c, g dbSNP:373774920
1256 1256 c, t dbSNP:786201733
1257 1257 a, g dbSNP:786203708
1261 1261 a, g dbSNP:752356873
1263 1263 -, a dbSNP:757771711
1268 1268 c, g dbSNP:45459799
1278 1278 c, t dbSNP:759031349
1279 1279 a, g dbSNP:751460179
1280 1280 a, g dbSNP:766340391
1284 1284 c, g dbSNP:762781085
1285 1285 a, c dbSNP:772957320
1286 1286 a, g dbSNP:769535320
1290 1290 a, g dbSNP:587780834
1291 1291 a, g dbSNP:45512798
1297 1297 c, t dbSNP:775721645
1300 1300 c, t dbSNP:772048413
1302 1302 c, t dbSNP:745955726
1303 1303 a, g dbSNP:548018916
1310 1310 c, t dbSNP:771542690
1317 1317 c, t dbSNP:587781860
1321 1321 a, c dbSNP:786202300
1325 1325 a, g dbSNP:376893571
1329 1329 a, g dbSNP:756499865
1340 1340 c, t dbSNP:752309409
1341 1341 a, g dbSNP:780834054
1358 1358 g, t dbSNP:754515912
1367 1367 a, g dbSNP:138743097
1379 1379 c, t dbSNP:28997569
1380 1380 a, g dbSNP:758360637
1384 1384 a, g dbSNP:61754143
1386 1386 c, t dbSNP:550031006
1389 1389 c, t dbSNP:730881631
1393 1393 g, t dbSNP:587782514
1405 1405 a, g dbSNP:765027420
1406 1406 a, c dbSNP:587781797
1409 1409 a, g dbSNP:62620988
1412 1412 a, g dbSNP:587781425
1420 1420 c, g dbSNP:45549332
1426 1426 g, t dbSNP:759584091
1434 1434 c, g dbSNP:45624635
1437 1437 a, g dbSNP:771096783
1441 1441 c, t dbSNP:144940449
1443 1443 a, g dbSNP:141055990
1445 1445 c, t dbSNP:770289817
1453 1453 a, g dbSNP:748545827
1456 1456 c, t dbSNP:147739458
1457 1457 a, g dbSNP:145601931
1458 1458 a, g dbSNP:148556781
1467 1467 a, g dbSNP:746599076
1479 1479 -, a dbSNP:786202610
1479 1479 a, g dbSNP:28997570
1486 1486 a, g dbSNP:137852985
1491 1491 c, g, t dbSNP:750376292
1501 1501 a, g dbSNP:786201326
1510 1510 a, g dbSNP:786202337
1513 1513 a, g dbSNP:374974885
1521 1521 -, a dbSNP:587778138
1521 1521 a, g dbSNP:587782731
1530 1530 a, g dbSNP:112076926
1548 1548 a, g dbSNP:746681841
1553 1553 c, t dbSNP:587778139
1561 1561 a, t dbSNP:779627397
1564 1564 a, g dbSNP:771630777
1573 1573 c, t dbSNP:745379285
1575 1575 a, g dbSNP:778863018
1581 1581 g, t dbSNP:587782771
1582 1582 a, g dbSNP:587780252
1586 1586 a, g dbSNP:757196702
1589 1589 a, g, t dbSNP:535414791
1594 1594 a, g dbSNP:786201808
1601 1601 c, g dbSNP:777653224
1607 1607 c, t dbSNP:755796609
1620 1620 a, g dbSNP:751841684
1629 1629 c, t dbSNP:786201819
1634 1634 c, g dbSNP:149364097
1636 1636 c, t dbSNP:763189201
1642 1642 a, g dbSNP:544977115
1643 1643 c, t dbSNP:730881632
1644 1644 a, g dbSNP:762417690
1650 1650 c, t dbSNP:776939714
1655 1655 c, t dbSNP:730881633
1656 1656 -, g dbSNP:751209171
1658 1658 g, t dbSNP:769081927
1659 1659 -, ttac dbSNP:766110015
1660 1660 a, g dbSNP:761017296
1661 1661 -, agtcca dbSNP:762883121
1661 1661 a, c dbSNP:775191379
1663 1663 a, c dbSNP:771682192
1666 1666 a, g dbSNP:730881634
1671 1671 -, a dbSNP:587781639
1672 1672 c, t dbSNP:745432312
1678 1678 c, t dbSNP:139701369
1679 1679 a, t dbSNP:770306753
1682 1682 a, g dbSNP:749251680
1694 1694 c, t dbSNP:587781325
1695 1695 a, g dbSNP:786202218
1698 1698 a, g dbSNP:777511615
1703 1703 a, ct dbSNP:587783377
1703 1703 a, c dbSNP:786202637
1706 1706 c, t dbSNP:755992778
1713 1713 c, t dbSNP:786202192
1715 1715 -, ca dbSNP:587780224
1728 1728 a, g, t dbSNP:569696977
1742 1742 c, t dbSNP:748001678
1745 1745 a, t dbSNP:730881635
1754 1754 a, g dbSNP:587780825
1757 1757 a, g dbSNP:781168634
1759 1759 c, t dbSNP:754755989
1765 1765 a, g dbSNP:550092661
1773 1773 a, c dbSNP:778992385
1778 1778 a, c dbSNP:587782039
1781 1781 a, g dbSNP:786203967
1783 1783 c, t dbSNP:757427498
1784 1784 a, g dbSNP:587782816
1787 1787 g, t dbSNP:764711572
1790 1790 c, t dbSNP:756636362
1793 1793 -, tgtg dbSNP:730881647
1796 1796 c, t dbSNP:369631413
1797 1797 a, g dbSNP:786202780
1806 1806 c, t dbSNP:767872861
1809 1809 a, g dbSNP:759835916
1815 1815 g, t dbSNP:587782247
1819 1819 -, aacagaagttcagcttcggttt dbSNP:786202415
1827 1827 c, t dbSNP:45576134
1829 1829 c, t dbSNP:368796923
1835 1835 c, t dbSNP:587780225
1836 1836 a, g dbSNP:772570870
1844 1844 c, t dbSNP:150624408
1845 1845 a, g dbSNP:748105919
1846 1846 a, g dbSNP:148429663
1853 1853 a, c dbSNP:768633507
1857 1857 a, g dbSNP:746778889
1872 1872 a, c dbSNP:779237423
1875 1875 a, c dbSNP:587781463
1885 1885 a, g dbSNP:757400610
1893 1893 a, g dbSNP:730881636
1901 1901 a, c, t dbSNP:756119073
1904 1904 c, t dbSNP:587780226
1905 1905 a, g dbSNP:753214212
1921 1921 c, t dbSNP:200581792
1925 1925 a, c dbSNP:786203496
1932 1932 a, g dbSNP:775171520
1941 1941 c, t dbSNP:771861055
1945 1945 c, t dbSNP:730881640
1946 1946 a, g dbSNP:587780227
1950 1950 a, t dbSNP:769918040
1951 1951 a, c dbSNP:786202553
1952 1952 a, t dbSNP:587780826
1958 1958 c, g dbSNP:748221377
1961 1961 g, t dbSNP:587780228
1964 1964 a, c, g dbSNP:752052351
1966 1966 a, c dbSNP:780310294
1969 1969 c, t dbSNP:758735370
1972 1972 c, g, t dbSNP:587780875
1990 1990 a, g dbSNP:764979728
2014 2014 -, aactt dbSNP:768736851
2021 2021 c, t dbSNP:761452695
2022 2022 a, g dbSNP:45501097
2030 2030 g, t dbSNP:587780229
2031 2031 a, g, t dbSNP:200062099
2032 2032 c, t dbSNP:775431508
2033 2033 a, g dbSNP:142744352
2035 2035 c, t dbSNP:759360709
2044 2044 c, t dbSNP:773489367
2056 2056 g, t dbSNP:587780230