Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


GNPTG N-acetylglucosamine-1-phosphate transferase, gamma subunit [Homo sapiens (human)]

Gene Symbol GNPTG
Entrez Gene ID 84572
Full Name N-acetylglucosamine-1-phosphate transferase, gamma subunit
Synonyms C16orf27, GNPTAG, LP2537, RJD9
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

16

16p13.3

Summary This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]. lac of sum
Disorder MIM:

607838

Disorder Html: Mucolipidosis III gamma, 252605 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu20222 NM_032520 Homo sapiens N-acetylglucosamine-1-phosphate transferase, gamma subunit (GNPTG), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu20222D
Sequence Information ORF Nucleotide Sequence (Length: 918bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product N-acetylglucosamine-1-phosphotransferase subunit gamma precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DT219524.1, BC014592.1, AK312067.1 and AY203933.1. This sequence is a reference standard in the RefSeqGene project. On Feb 12, 2010 this sequence version replaced gi:42476109. Summary: This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY203933.1, BC014592.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGGCGGCGG GGCTGGCGCG GCTCCTGTTG CTCCTCGGGC TCTCGGCCGG CGGGCCCGCG 
CCGGCAGGTG CAGCGAAGAT GAAGGTGGTG GAGGAGCCCA ACGCGTTTGG GGTGAACAAC
CCGTTCTTGC CTCAGGCCAG TCGCCTCCAG GCCAAGAGGG ATCCTTCACC CGTGTCTGGA
CCCGTGCATC TCTTCCGACT CTCGGGCAAG TGCTTCAGCC TGGTGGAGTC CACGTACAAG
TATGAGTTCT GCCCGTTCCA CAACGTGACC CAGCACGAGC AGACCTTCCG CTGGAACGCC
TACAGTGGGA TCCTCGGCAT CTGGCACGAG TGGGAGATCG CCAACAACAC CTTCACGGGC
ATGTGGATGA GGGACGGTGA CGCCTGCCGT TCCCGGAGCC GGCAGAGCAA GGTGGAGCTG
GCGTGTGGAA AAAGCAACCG GCTGGCCCAT GTGTCCGAGC CGAGCACCTG CGTCTACGCG
CTGACGTTCG AGACCCCCCT CGTCTGCCAC CCCCACGCCT TGCTAGTGTA CCCAACCCTG
CCAGAGGCCC TGCAGCGGCA GTGGGACCAG GTAGAGCAGG ACCTGGCCGA TGAGCTGATC
ACCCCCCAGG GCCATGAGAA GTTGCTGAGG ACACTTTTTG AGGATGCTGG CTACTTAAAG
ACCCCAGAAG AAAATGAACC CACCCAGCTG GAGGGAGGTC CTGACAGCTT GGGGTTTGAG
ACCCTGGAAA ACTGCAGGAA GGCTCATAAA GAACTCTCAA AGGAGATCAA AAGGCTGAAA
GGTTTGCTCA CCCAGCACGG CATCCCCTAC ACGAGGCCCA CAGAAACTTC CAACTTGGAG
CACTTGGGCC ACGAGACGCC CAGAGCCAAG TCTCCAGAGC AGCTGCGGGG TGACCCAGGA
CTGCGTGGGA GTTTGTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_115909.1
CDS68..985
Misc Feature(1)41..43(+)
Misc Feature(2)272..454(+)
Exon (1)1..119
Gene:GNPTG
Gene Synonym:
Exon (2)120..177
Gene:GNPTG
Gene Synonym:
Exon (3)178..245
Gene:GNPTG
Gene Synonym:
Exon (4)246..300
Gene:GNPTG
Gene Synonym:
Exon (5)301..384
Gene:GNPTG
Gene Synonym:
Exon (6)385..478
Gene:GNPTG
Gene Synonym:
Exon (7)479..593
Gene:GNPTG
Gene Synonym:
Exon (8)594..676
Gene:GNPTG
Gene Synonym:
Exon (9)677..808
Gene:GNPTG
Gene Synonym:
Exon (10)809..890
Gene:GNPTG
Gene Synonym:
Exon (11)891..1245
Gene:GNPTG
Gene Synonym:
Translation
Position Chain Variation Link
28 28 a, c dbSNP:541284873
31 31 -, tcacttcacgtgaccg dbSNP:59225734
40 40 a, g dbSNP:765220411
46 46 a, g dbSNP:752212692
55 55 c, t dbSNP:11554985
64 64 c, t dbSNP:554707396
76 76 g, t dbSNP:763764801
78 78 a, c, g dbSNP:574801192
79 79 c, g dbSNP:756910244
80 80 c, t dbSNP:543660760
84 84 c, t dbSNP:754225455
86 86 c, t dbSNP:532236241
87 87 a, g dbSNP:779505508
92 92 c, t dbSNP:748243075
93 93 c, t dbSNP:772239803
95 95 c, t dbSNP:562191082
97 97 g, t dbSNP:747247122
104 104 c, g dbSNP:771155803
109 109 c, t dbSNP:776361173
121 121 g, t dbSNP:753208354
125 125 a, g dbSNP:758954616
128 128 c, g dbSNP:778042839
129 129 c, t dbSNP:747111791
132 132 c, t dbSNP:771120488
134 134 c, g dbSNP:547624231
136 136 g, t dbSNP:745677704
141 141 a, c dbSNP:137853826
160 160 c, g dbSNP:8052503
164 164 -, c dbSNP:779788991
169 169 c, g dbSNP:749262844
180 180 c, t dbSNP:372379104
181 181 a, g dbSNP:774278289
182 182 a, g dbSNP:11554987
193 193 c, t dbSNP:375508895
197 197 c, g dbSNP:771564346
205 205 a, c, t dbSNP:538632263
214 214 c, g dbSNP:552514133
228 228 a, t dbSNP:368478807
247 247 a, t dbSNP:767895135
250 250 c, t dbSNP:140264422
251 251 a, c, g dbSNP:200574942
253 253 g, t dbSNP:766619396
258 258 g, t dbSNP:754010312
263 263 c, t dbSNP:193302848
264 264 a, g dbSNP:778810991
265 265 a, g dbSNP:11554988
270 270 c, g, t dbSNP:552402857
271 271 a, c, g, t dbSNP:777517766
277 277 a, g dbSNP:372039531
278 278 c, t dbSNP:745552342
285 285 a, g dbSNP:769323972
286 286 c, t dbSNP:774835763
290 290 a, g dbSNP:762024309
298 298 c, t dbSNP:772637099
300 300 c, t dbSNP:200507633
302 302 a, t dbSNP:767502955
304 304 c, g dbSNP:749952316
305 305 -, aagtat dbSNP:773452586
305 305 a, g dbSNP:368983807
309 309 a, g dbSNP:779778381
310 310 c, t dbSNP:748941730
313 313 c, g dbSNP:754595108
318 318 a, g dbSNP:778178434
321 321 c, g, t dbSNP:747362604
322 322 a, g dbSNP:76594024
326 326 c, t dbSNP:745994739
327 327 a, g dbSNP:769717288
330 330 a, g dbSNP:775604993
331 331 c, t dbSNP:145313679
332 332 a, g dbSNP:764395288
336 336 c, t dbSNP:149197775
337 337 a, c, t dbSNP:543804571
343 343 c, g, t dbSNP:201992413
344 344 a, g dbSNP:201531462
346 346 a, g dbSNP:750277954
351 351 a, c dbSNP:756056220
352 352 c, t dbSNP:765847099
355 355 a, c dbSNP:768511134
355 355 -, c dbSNP:763127645
356 356 c, g, t dbSNP:753385216
357 357 a, g, t dbSNP:778481117
361 361 g, t dbSNP:757581909
362 362 a, g dbSNP:143383133
364 364 c, t dbSNP:201045559
365 365 a, g dbSNP:770325965
369 369 a, g dbSNP:139385234
371 371 a, g dbSNP:749320662
379 379 a, c dbSNP:769001628
382 382 c, g, t dbSNP:774673554
383 383 a, g dbSNP:137852885
385 385 c, t dbSNP:770716391
388 388 c, g dbSNP:776376435
390 390 a, g dbSNP:745850911
392 392 c, g dbSNP:769722097
394 394 c, g, t dbSNP:141533972
395 395 a, g dbSNP:763678034
398 398 c, t dbSNP:774017237
400 400 a, g dbSNP:137852884
406 406 a, c, g, t dbSNP:147048228
407 407 a, g dbSNP:367661016
409 409 -, caa dbSNP:774681948
411 411 a, g dbSNP:138297609
414 414 -, aca dbSNP:193302849
414 414 a, c dbSNP:200975355
417 417 c, t dbSNP:752836392
424 424 a, g dbSNP:758452962
428 428 a, g dbSNP:777887031
429 429 c, t dbSNP:747291812
433 433 c, g dbSNP:757394606
439 439 a, g dbSNP:781036850
442 442 a, c, t dbSNP:141870165
443 443 a, g dbSNP:775359476
446 446 -, gacgcctgccgtt dbSNP:193302850
448 448 c, t dbSNP:748782055
449 449 a, c, g dbSNP:372319167
455 455 c, t dbSNP:761584357
456 456 a, g dbSNP:554418793
461 461 c, t dbSNP:200741370
462 462 a, g dbSNP:11554983
465 465 c, g dbSNP:765865746
467 467 c, t dbSNP:753205380
472 472 a, g dbSNP:763335225
475 475 c, t dbSNP:764279342
489 489 c, g, t dbSNP:756379978
490 490 a, c, g dbSNP:530486639
506 506 c, t dbSNP:775985395
507 507 a, g dbSNP:374890181
508 508 g, t dbSNP:769233183
512 512 -, g dbSNP:281864956
515 515 c, t dbSNP:562132501
517 517 g, t dbSNP:147109185
520 520 a, g dbSNP:767633692
522 522 c, t dbSNP:773268405
523 523 c, g, t dbSNP:760954235
524 524 a, g dbSNP:763065729
527 527 c, t dbSNP:753679575
528 528 c, t dbSNP:754679713
529 529 a, g dbSNP:780619430
531 531 a, g dbSNP:113388753
538 538 c, g, t dbSNP:564859061
539 539 a, g dbSNP:138018487
544 544 -, gtag dbSNP:753596034
544 544 c, t dbSNP:201168011
545 545 a, g dbSNP:756971692
546 546 a, c, g, t dbSNP:374470431
547 547 a, c, g dbSNP:149516834
552 552 a, c, t dbSNP:779179604
553 553 a, g dbSNP:377651982
556 556 c, t dbSNP:370857842
557 557 a, c, g dbSNP:766647003
559 559 a, g dbSNP:759771367
560 560 -, c dbSNP:756959430
561 561 -, c dbSNP:778918094
561 561 c, g, t dbSNP:113167728
562 562 c, t dbSNP:752525561
563 563 c, t dbSNP:758472393
565 565 -, cct dbSNP:750238332
566 566 a, c dbSNP:764053747
567 567 c, t dbSNP:751140111
568 568 c, t dbSNP:756686252
569 569 a, c, g dbSNP:190614894
573 573 a, g dbSNP:11554984
577 577 c, t dbSNP:202240106
580 580 c, t dbSNP:779213852
582 582 a, g dbSNP:748444543
583 583 a, c, t dbSNP:377440797
584 584 a, g dbSNP:748204437
585 585 c, t dbSNP:770954803
588 588 c, t dbSNP:776748274
590 590 -, c dbSNP:193302851
590 590 c, t dbSNP:370286980
592 592 a, c dbSNP:144136497
594 594 c, t dbSNP:772485364
598 598 c, t dbSNP:747918283
599 599 c, t dbSNP:553046300
600 600 a, c dbSNP:11554986
602 602 a, g dbSNP:773159644
604 604 a, c, t dbSNP:760497948
605 605 c, g dbSNP:776105074
615 615 c, t dbSNP:759248626
618 618 a, t dbSNP:773290124
623 623 a, c dbSNP:751880564
624 624 a, c, g dbSNP:139997459
625 625 a, g dbSNP:767745367
631 631 a, g dbSNP:750990691
635 635 c, t dbSNP:756679779
637 637 a, g dbSNP:780352492
641 641 a, g dbSNP:749314645
644 644 c, t dbSNP:755265539
650 650 c, t dbSNP:143490078
652 652 c, g dbSNP:779149342
654 654 c, t dbSNP:747927356
655 655 c, t dbSNP:541942383
656 656 a, g dbSNP:367672512
661 661 a, g dbSNP:747006851
663 663 a, t dbSNP:770850105
664 664 a, c, g, t dbSNP:112266724
668 668 -, c dbSNP:756225251
668 668 a, g, t dbSNP:764889321
670 670 a, c, t dbSNP:146171435
672 672 a, c dbSNP:750752675
675 675 -, c, g dbSNP:193302852
676 676 a, g dbSNP:756694104
677 677 a, g dbSNP:777795921
678 678 -, g dbSNP:193302856
679 679 c, t dbSNP:751373599
686 686 -, t dbSNP:193302857
690 690 g, t dbSNP:757003667
694 694 a, g dbSNP:780930809
698 698 a, t dbSNP:112925416
702 702 -, tt dbSNP:746271025
704 704 g, t dbSNP:552248197
705 705 c, t dbSNP:768131774
706 706 -, t dbSNP:193302858
707 707 -, gaggatgctggctacttaaagaccccag dbSNP:193302859
707 707 c, g dbSNP:748692260
708 708 a, g dbSNP:768377103
709 709 a, g dbSNP:774108877
710 710 c, g dbSNP:761527949
711 711 a, g dbSNP:771470862
714 714 c, t dbSNP:777120261
716 716 a, g dbSNP:760155537
718 718 c, g, t dbSNP:201844106
724 724 a, g dbSNP:762888658
727 727 a, g dbSNP:764405882
730 730 a, c, g dbSNP:751817263
732 732 c, g dbSNP:142548931
734 734 a, g dbSNP:750155751
737 737 a, g dbSNP:756093689
738 738 a, g dbSNP:779807567
745 745 a, t dbSNP:775527344
746 746 c, g dbSNP:748861038
750 750 -, c dbSNP:772287534
750 750 c, t dbSNP:754489307
751 751 c, g dbSNP:150965148
755 755 c, g dbSNP:137853827
757 757 a, g dbSNP:200094858
758 758 c, g dbSNP:771844889
760 760 a, g dbSNP:777140384
763 763 a, g dbSNP:746160240
764 764 a, g dbSNP:374564369
767 767 a, c dbSNP:775816256
769 769 c, g, t dbSNP:532275192
770 770 c, g dbSNP:774413019
772 772 c, t dbSNP:762029401
778 778 -, g dbSNP:776107971
779 779 a, g, t dbSNP:762827756
780 780 a, g dbSNP:202080062
781 781 a, c, g dbSNP:766167977
796 796 a, g dbSNP:368747296
797 797 a, c dbSNP:754928775
804 804 a, g dbSNP:778631467
805 805 a, g dbSNP:202129898
807 807 a, t dbSNP:747594923
808 808 c, g dbSNP:141035347
809 809 g, t dbSNP:773331398
812 812 -, ataaagaact dbSNP:749994383
812 812 c, t dbSNP:760871015
813 813 a, c dbSNP:771116867
814 814 -, a dbSNP:758242017
815 815 -, aaag dbSNP:766055577
822 822 c, t dbSNP:376896298
824 824 c, t dbSNP:759356138
825 825 -, aaaggagatca dbSNP:751562009
825 825 a, c dbSNP:761299690
830 830 a, g dbSNP:752717983
832 832 a, g dbSNP:762958864
835 835 c, g dbSNP:763568351
840 840 a, g dbSNP:751017354
844 844 -, a dbSNP:754893828
848 848 a, c, g dbSNP:371200622
850 850 -, t dbSNP:777891872
853 853 c, g dbSNP:754237014
856 856 c, t dbSNP:755376950
858 858 a, c dbSNP:779227679
860 860 c, g dbSNP:748714052
865 865 a, c, t dbSNP:375787769
866 866 a, g, t dbSNP:370064320
868 868 c, t dbSNP:776873106
869 869 a, c dbSNP:759796840
879 879 c, g dbSNP:374442826
880 880 a, g dbSNP:377647926
881 881 a, g dbSNP:8062558
894 894 c, t dbSNP:540914235
897 897 a, c dbSNP:757687560
901 901 c, t dbSNP:559329222
904 904 a, g dbSNP:61739427
905 905 a, g dbSNP:756430172
910 910 -, cttgggccac dbSNP:746049237
911 911 c, t dbSNP:780387272
913 913 a, c, g dbSNP:749443455
917 917 c, t dbSNP:774003749
919 919 c, g, t dbSNP:374511482
920 920 a, g dbSNP:772723751
922 922 -, gac dbSNP:772539062
924 924 c, t dbSNP:193302860
925 925 a, g, t dbSNP:770600776
929 929 a, c dbSNP:200471078
930 930 a, g dbSNP:759088945
931 931 a, g dbSNP:764577534
935 935 a, t dbSNP:751864147
936 936 a, t dbSNP:762384924
939 939 -, tccaga dbSNP:775705721
940 940 g, t dbSNP:147955846
941 941 c, g dbSNP:768090398
942 942 c, t dbSNP:750563207
945 945 a, c dbSNP:372062796
947 947 c, t dbSNP:780260521
948 948 a, g dbSNP:375089519
949 949 c, g dbSNP:755154799
950 950 c, g dbSNP:778776422
953 953 a, c, t dbSNP:150647450
954 954 a, g dbSNP:561640998
967 967 a, c dbSNP:746913643
968 968 c, t dbSNP:754236475
970 970 a, g dbSNP:141807632
971 971 c, g, t dbSNP:775991626
972 972 a, g dbSNP:769262505
973 973 g, t dbSNP:774790794
976 976 c, g dbSNP:762046443
977 977 a, g dbSNP:7187001
982 982 c, g dbSNP:751017692
984 984 c, g dbSNP:761250229
988 988 c, g, t dbSNP:570294976
989 989 g, t dbSNP:755243924
991 991 g, t dbSNP:778955815
992 992 a, g dbSNP:752565624
1002 1002 c, g dbSNP:758226003
1003 1003 a, g dbSNP:777517352
1008 1008 c, t dbSNP:747006896
1012 1012 c, t dbSNP:189677035
1013 1013 a, g dbSNP:374497551
1014 1014 c, t dbSNP:377184531
1015 1015 a, g dbSNP:375719850
1018 1018 c, g, t dbSNP:376414184
1019 1019 a, c, g dbSNP:775046997
1023 1023 a, g dbSNP:772624200
1029 1029 c, t dbSNP:773712619
1037 1037 c, g dbSNP:761272543
1053 1053 g, t dbSNP:60000415
1081 1081 c, t dbSNP:111882845
1088 1088 a, g dbSNP:149512696
1118 1118 a, t dbSNP:570375445
1123 1123 c, t dbSNP:778271120
1128 1128 a, g dbSNP:752191785
1172 1172 a, t dbSNP:555685957
1176 1176 a, g dbSNP:757707991
1181 1181 a, g dbSNP:575854401
1206 1206 c, t dbSNP:181148746
1209 1209 c, t dbSNP:7192408
1241 1241 -, a dbSNP:539354203
1245 1245 a, g dbSNP:144083031

Target ORF information:

RefSeq Version NM_032520
Organism Homo sapiens (human)
Definition Homo sapiens N-acetylglucosamine-1-phosphate transferase, gamma subunit (GNPTG), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_032520

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGGCGGCGG GGCTGGCGCG GCTCCTGTTG CTCCTCGGGC TCTCGGCCGG CGGGCCCGCG 
CCGGCAGGTG CAGCGAAGAT GAAGGTGGTG GAGGAGCCCA ACGCGTTTGG GGTGAACAAC
CCGTTCTTGC CTCAGGCCAG TCGCCTCCAG GCCAAGAGGG ATCCTTCACC CGTGTCTGGA
CCCGTGCATC TCTTCCGACT CTCGGGCAAG TGCTTCAGCC TGGTGGAGTC CACGTACAAG
TATGAGTTCT GCCCGTTCCA CAACGTGACC CAGCACGAGC AGACCTTCCG CTGGAACGCC
TACAGTGGGA TCCTCGGCAT CTGGCACGAG TGGGAGATCG CCAACAACAC CTTCACGGGC
ATGTGGATGA GGGACGGTGA CGCCTGCCGT TCCCGGAGCC GGCAGAGCAA GGTGGAGCTG
GCGTGTGGAA AAAGCAACCG GCTGGCCCAT GTGTCCGAGC CGAGCACCTG CGTCTACGCG
CTGACGTTCG AGACCCCCCT CGTCTGCCAC CCCCACGCCT TGCTAGTGTA CCCAACCCTG
CCAGAGGCCC TGCAGCGGCA GTGGGACCAG GTAGAGCAGG ACCTGGCCGA TGAGCTGATC
ACCCCCCAGG GCCATGAGAA GTTGCTGAGG ACACTTTTTG AGGATGCTGG CTACTTAAAG
ACCCCAGAAG AAAATGAACC CACCCAGCTG GAGGGAGGTC CTGACAGCTT GGGGTTTGAG
ACCCTGGAAA ACTGCAGGAA GGCTCATAAA GAACTCTCAA AGGAGATCAA AAGGCTGAAA
GGTTTGCTCA CCCAGCACGG CATCCCCTAC ACGAGGCCCA CAGAAACTTC CAACTTGGAG
CACTTGGGCC ACGAGACGCC CAGAGCCAAG TCTCCAGAGC AGCTGCGGGG TGACCCAGGA
CTGCGTGGGA GTTTGTGA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.