
ZNF469 cDNA ORF clone, Homo sapiens (human)

Gene Symbol ZNF469
Entrez Gene ID 84627
Full Name zinc finger protein 469
Synonyms BCS, BCS1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a zinc-finger protein. Low-percent homology to certain collagens suggests that it may function as a transcription factor or extra-nuclear regulator factor for the synthesis or organization of collagen fibers. Mutations in this gene cause brittle cornea syndrome. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Brittle cornea syndrome, 229200 (3)

The following ZNF469 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ZNF469 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu73626 NM_001127464 Homo sapiens zinc finger protein 469 (ZNF469), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu73627 XM_011523386 PREDICTED: Homo sapiens zinc finger protein 469 (ZNF469), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu73627 XM_011523387 PREDICTED: Homo sapiens zinc finger protein 469 (ZNF469), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu73627 XM_011523388 PREDICTED: Homo sapiens zinc finger protein 469 (ZNF469), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu73626
Accession Version NM_001127464.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 11778bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 11-DEC-2014
Organism Homo sapiens (human)
Product zinc finger protein 469
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC135049.2 and KF456226.1. This sequence is a reference standard in the RefSeqGene project. On Dec 9, 2014 this sequence version replaced gi:188536003. Summary: This gene encodes a zinc-finger protein. Low-percent homology to certain collagens suggests that it may function as a transcription factor or extra-nuclear regulator factor for the synthesis or organization of collagen fibers. Mutations in this gene cause brittle cornea syndrome. [provided by RefSeq, Jul 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on the predicted transcript XR_040937 and supporting data in Abu et al, PMID 18452888, but have not been experimentally confirmed. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)4..1266(+)
Misc Feature(2)763..2169(+)
Misc Feature(3)3304..4545(+)
Misc Feature(4)4819..6732(+)
Misc Feature(5)6355..7698(+)
Misc Feature(6)7414..8979(+)
Misc Feature(7)9265..9327(+)
Misc Feature(8)9265..9327(+)
Misc Feature(9)9280..9507(+)
Misc Feature(10)9358..9402(+)
Misc Feature(11)9358..9399(+)
Misc Feature(12)9445..9507(+)
Misc Feature(13)9445..9507(+)
Misc Feature(14)9931..9993(+)
Misc Feature(15)9931..9993(+)
Misc Feature(16)9946..10233(+)
Misc Feature(17)10015..10110(+)
Misc Feature(18)10015..10107(+)
Misc Feature(19)10174..10236(+)
Misc Feature(20)10174..10236(+)
Misc Feature(21)10282..11730(+)
Exon (1)1..3179
Gene Synonym:
Exon (2)3180..13203
Gene Synonym:
Position Chain Variation Link
14 14 a, g dbSNP:762382027
24 24 a, g dbSNP:551558555
26 26 c, t dbSNP:569870332
30 30 a, g dbSNP:281165936
30 30 a, g dbSNP:750924473
36 36 a, c, g dbSNP:371091595
54 54 g, t dbSNP:766704042
61 61 c, t dbSNP:754101639
62 62 a, g dbSNP:145178398
77 77 c, g dbSNP:273585616
79 79 a, c dbSNP:567229543
81 81 a, g dbSNP:534464702
92 92 a, c dbSNP:779285670
98 98 c, t dbSNP:752770883
99 99 a, g dbSNP:273585631
116 116 c, t dbSNP:552640649
131 131 a, c dbSNP:577277281
135 135 c, t dbSNP:538850431
139 139 a, g dbSNP:138954293
146 146 a, g dbSNP:575883577
183 183 c, t dbSNP:746875261
186 186 a, g, t dbSNP:770775791
203 203 c, t dbSNP:780900228
210 210 c, t dbSNP:745660773
216 216 g, t dbSNP:543285355
248 248 c, t dbSNP:775103017
290 290 c, t dbSNP:273585617
291 291 a, g dbSNP:762564817
311 311 c, t dbSNP:768011450
327 327 a, g dbSNP:192479136
333 333 a, g dbSNP:761028591
334 334 a, g dbSNP:766853024
337 337 a, g dbSNP:281865144
349 349 c, g dbSNP:754318367
356 356 a, g dbSNP:759962057
380 380 c, t dbSNP:765601628
381 381 a, g dbSNP:116028037
402 402 c, t dbSNP:569036398
448 448 a, g dbSNP:565385445
457 457 a, c, g dbSNP:532620482
460 460 a, c dbSNP:757211390
464 464 c, g dbSNP:71394098
470 470 a, g dbSNP:781096189
471 471 c, g dbSNP:545236998
482 482 c, t dbSNP:769547100
491 491 a, c, t dbSNP:755989926
492 492 a, g dbSNP:563480285
519 519 c, g dbSNP:530740920
525 525 c, t dbSNP:773666313
526 526 a, g dbSNP:761379794
532 532 c, t dbSNP:771620429
533 533 c, t dbSNP:777251198
536 536 c, g dbSNP:760014906
600 600 c, t dbSNP:377475711
601 601 a, g dbSNP:765651977
614 614 a, c dbSNP:752980662
623 623 c, t dbSNP:549255859
624 624 a, g dbSNP:764375272
627 627 c, g, t dbSNP:113227277
641 641 a, g dbSNP:767484077
643 643 c, g dbSNP:750321195
663 663 c, t dbSNP:370275746
674 674 c, t dbSNP:528085500
675 675 a, c dbSNP:779765231
676 676 a, g dbSNP:546141859
677 677 a, c dbSNP:571025240
689 689 g, t dbSNP:554483098
697 697 a, g dbSNP:538330967
703 703 c, t dbSNP:557160829
712 712 a, g dbSNP:748253495
714 714 g, t dbSNP:771673417
720 720 a, g dbSNP:273585632
723 723 c, t dbSNP:150745096
725 725 g, t dbSNP:536586591
726 726 c, t dbSNP:555256402
742 742 c, t dbSNP:573414361
744 744 c, t dbSNP:775787434
747 747 a, g dbSNP:763365403
749 749 a, t dbSNP:764273631
750 750 c, t dbSNP:774602779
751 751 a, c dbSNP:540655479
756 756 a, c dbSNP:767535517
757 757 a, g dbSNP:750372510
760 760 a, g dbSNP:755977911
765 765 a, g dbSNP:766334275
770 770 a, c dbSNP:753630744
772 772 a, g dbSNP:558954436
793 793 a, g dbSNP:754776767
806 806 g, t dbSNP:775471773
819 819 c, t dbSNP:778467047
833 833 c, t dbSNP:577446263
834 834 c, g dbSNP:544693811
845 845 a, g dbSNP:757999676
869 869 c, t dbSNP:117501524
870 870 a, g dbSNP:746516114
891 891 c, g dbSNP:770483852
897 897 c, t dbSNP:776044690
929 929 a, g dbSNP:749656105
930 930 a, g dbSNP:533289994
936 936 a, g dbSNP:769026765
937 937 g, t dbSNP:774459354
941 941 c, t dbSNP:777666112
942 942 a, g dbSNP:767588443
943 943 a, g dbSNP:530720576
946 946 a, g dbSNP:368772806
949 949 a, g dbSNP:766274133
951 951 c, t dbSNP:561239255
952 952 a, g dbSNP:139066376
959 959 c, t dbSNP:765028361
960 960 a, g dbSNP:752405331
963 963 c, t dbSNP:758193918
969 969 a, c dbSNP:113483623
974 974 c, t dbSNP:546224574
975 975 a, g dbSNP:751166329
987 987 a, g dbSNP:756761096
992 992 c, t dbSNP:149485731
996 996 c, g dbSNP:532123606
1020 1020 c, t dbSNP:273585633
1037 1037 -, cccc dbSNP:148030358
1047 1047 c, g, t dbSNP:550642046
1048 1048 g, t dbSNP:568820656
1065 1065 a, c, g dbSNP:748505843
1069 1069 c, t dbSNP:11648572
1084 1084 c, t dbSNP:554839262
1088 1088 c, t dbSNP:771000169
1089 1089 c, g dbSNP:776451293
1090 1090 a, g dbSNP:759454921
1094 1094 a, c, t dbSNP:567183966
1095 1095 a, g dbSNP:534477237
1098 1098 a, c, t dbSNP:11640794
1111 1111 a, g dbSNP:774539844
1130 1130 c, t dbSNP:756739680
1143 1143 a, c dbSNP:74032864
1167 1167 -, tgggc dbSNP:779228663
1182 1182 a, g dbSNP:538381325
1189 1189 c, t dbSNP:754305342
1208 1208 a, g dbSNP:560397272
1224 1224 a, g dbSNP:556627507
1264 1264 a, c dbSNP:574791859
1275 1275 c, t dbSNP:779376868
1285 1285 a, g dbSNP:113937803
1303 1303 a, g dbSNP:772392648
1347 1347 a, c dbSNP:777999978
1363 1363 a, c dbSNP:560911127
1397 1397 c, g dbSNP:572830358
1406 1406 c, g dbSNP:770926082
1418 1418 a, g dbSNP:775578805
1444 1444 c, t dbSNP:540133783
1449 1449 g, t dbSNP:776840891
1466 1466 c, t dbSNP:759524656
1467 1467 a, g dbSNP:769822891
1471 1471 a, g dbSNP:117555121
1483 1483 c, t dbSNP:202205643
1488 1488 a, c dbSNP:763933273
1489 1489 a, g dbSNP:28723506
1499 1499 c, t dbSNP:761461530
1507 1507 c, t dbSNP:767072775
1508 1508 a, g dbSNP:550263442
1522 1522 a, g dbSNP:750005577
1524 1524 -, g dbSNP:200675426
1528 1528 a, g dbSNP:755555951
1529 1529 c, g dbSNP:7199961
1547 1547 c, g dbSNP:753160761
1550 1550 a, g dbSNP:758781186
1552 1552 c, t dbSNP:778051482
1584 1584 a, g dbSNP:143852982
1609 1609 a, g dbSNP:184458982
1615 1615 a, t dbSNP:189476639
1627 1627 a, g dbSNP:281865145
1654 1654 a, g dbSNP:769955501
1661 1661 a, c dbSNP:775591971
1663 1663 a, g dbSNP:749179728
1689 1689 c, t dbSNP:751136702
1690 1690 c, g dbSNP:768576385
1693 1693 a, g dbSNP:774268255
1697 1697 c, t dbSNP:181785233
1698 1698 c, t dbSNP:767246206
1701 1701 g, t dbSNP:281165932
1719 1719 c, t dbSNP:552893295
1741 1741 c, t dbSNP:760259912
1742 1742 c, g dbSNP:765823220
1743 1743 a, g dbSNP:753212011
1768 1768 a, g dbSNP:571115191
1773 1773 c, t dbSNP:764574730
1775 1775 c, t dbSNP:538240075
1776 1776 a, g dbSNP:12927001
1781 1781 c, t dbSNP:757534069
1782 1782 a, g, t dbSNP:574891457
1787 1787 c, t dbSNP:756276800
1797 1797 c, t dbSNP:780217260
1799 1799 c, t dbSNP:749374208
1800 1800 a, g dbSNP:768772320
1801 1801 g, t dbSNP:778691885
1809 1809 c, t dbSNP:748014455
1817 1817 c, t dbSNP:771721358
1827 1827 a, g dbSNP:148616993
1829 1829 c, t dbSNP:369993792
1839 1839 c, t dbSNP:770428996
1866 1866 a, g dbSNP:776185811
1870 1870 a, c, g dbSNP:759028761
1878 1878 c, t dbSNP:751974223
1887 1887 c, t dbSNP:762262311
1896 1896 a, g dbSNP:554795578
1899 1899 -, ctt dbSNP:746110444
1911 1911 a, g dbSNP:373169260
1913 1913 c, t dbSNP:572690908
1932 1932 c, g dbSNP:539996728
1953 1953 a, g dbSNP:564837770
1958 1958 a, c dbSNP:780409854
1961 1961 c, g, t dbSNP:754019937
1974 1974 -, c dbSNP:57752057
1977 1977 c, g dbSNP:778939804
1979 1979 a, t dbSNP:747984776
1986 1986 c, g dbSNP:771912038
1994 1994 c, t dbSNP:184583062
1996 1996 c, g dbSNP:746798998
2017 2017 a, g dbSNP:770623245
2018 2018 c, g dbSNP:776239249
2033 2033 a, c dbSNP:759081607
2034 2034 c, t dbSNP:58401704
2035 2035 a, g dbSNP:551591362
2042 2042 c, t dbSNP:762160933
2063 2063 a, c dbSNP:281865146
2074 2074 a, c dbSNP:529827333
2085 2085 c, t dbSNP:74547407
2086 2086 a, g dbSNP:761098712
2112 2112 c, t dbSNP:766745848
2119 2119 c, t dbSNP:188954563
2127 2127 a, g dbSNP:527898359
2130 2130 c, t dbSNP:12918876
2132 2132 c, g dbSNP:571184307
2143 2143 c, t dbSNP:758331281
2163 2163 c, t dbSNP:538121526
2168 2168 c, g dbSNP:777747160
2178 2178 a, g dbSNP:746849844
2184 2184 c, t dbSNP:757009906
2213 2213 a, g dbSNP:780848959
2265 2265 c, g dbSNP:745465850
2266 2266 c, t dbSNP:769351837
2268 2268 c, t dbSNP:550176820
2270 2270 g, t dbSNP:753664726
2297 2297 a, g dbSNP:144492145
2331 2331 c, t dbSNP:773822941
2332 2332 a, g dbSNP:761152033
2335 2335 a, g dbSNP:568359965
2345 2345 c, t dbSNP:535983876
2370 2370 a, g dbSNP:147859144
2373 2373 c, t dbSNP:759606452
2379 2379 c, t dbSNP:570471039
2381 2381 c, t dbSNP:565787076
2387 2387 c, t dbSNP:752775388
2402 2402 c, g dbSNP:745770324
2406 2406 c, t dbSNP:758477114
2407 2407 g, t dbSNP:113484918
2431 2431 c, t dbSNP:751453279
2434 2434 c, t dbSNP:745749813
2448 2448 c, t dbSNP:780898205
2463 2463 c, t dbSNP:745660819
2475 2475 c, t dbSNP:755782224
2477 2477 c, t dbSNP:772056680
2478 2478 g, t dbSNP:273585634
2485 2485 a, g dbSNP:748786439
2486 2486 c, t dbSNP:768172449
2489 2489 c, g dbSNP:773878123
2511 2511 c, g dbSNP:747457964
2540 2540 c, t dbSNP:558293585
2541 2541 a, g dbSNP:777200054
2544 2544 c, t dbSNP:759928652
2547 2547 c, g dbSNP:765421239
2572 2572 a, c dbSNP:181719686
2574 2574 c, g dbSNP:74384633
2587 2587 a, t dbSNP:764106193
2605 2605 a, g dbSNP:751502450
2607 2607 a, g dbSNP:757252816
2620 2620 -, tccggccccagaggtcccagc dbSNP:113102840
2632 2632 a, g dbSNP:556173403
2643 2643 c, g dbSNP:273585635
2652 2652 c, t dbSNP:767431034
2653 2653 c, g dbSNP:139653501
2666 2666 c, t dbSNP:145186655
2669 2669 a, g dbSNP:779602484
2671 2671 a, g dbSNP:753481187
2693 2693 c, t dbSNP:754458926
2699 2699 c, g, t dbSNP:273585618
2700 2700 c, g dbSNP:747652441
2707 2707 a, g dbSNP:771622085
2717 2717 c, t dbSNP:77951481
2728 2728 a, g dbSNP:746253538
2729 2729 c, g, t dbSNP:770131798
2730 2730 c, g dbSNP:546435811
2731 2731 c, t dbSNP:775593194
2744 2744 a, t dbSNP:763172050
2750 2750 c, g dbSNP:768862670
2760 2760 c, t dbSNP:774473762
2768 2768 a, g dbSNP:566719722
2789 2789 a, c, g dbSNP:564654481
2803 2803 a, g dbSNP:117995699
2804 2804 a, g dbSNP:773608978
2810 2810 a, t dbSNP:550198026
2811 2811 a, t dbSNP:377534548
2812 2812 a, g dbSNP:760409743
2814 2814 a, g dbSNP:140480823
2841 2841 a, g dbSNP:150435442
2863 2863 c, t dbSNP:754739533
2872 2872 a, c dbSNP:778692904
2873 2873 c, t dbSNP:370402083
2877 2877 c, t dbSNP:752301003
2880 2880 c, g dbSNP:757944441
2904 2904 -, gtcggg dbSNP:281865147
2908 2908 -, ggcggc dbSNP:775423936
2913 2913 a, c dbSNP:60462217
2921 2921 a, g dbSNP:565851013
2924 2924 c, t dbSNP:746332381
2929 2929 a, g dbSNP:770061832
2931 2931 c, t dbSNP:539527724
2945 2945 a, g dbSNP:558361075
2950 2950 g, t dbSNP:768917926
3027 3027 a, g dbSNP:186499941
3046 3046 g, t dbSNP:774526856
3067 3067 a, c dbSNP:761910925
3070 3070 a, g dbSNP:772088854
3082 3082 c, g dbSNP:538182235
3091 3091 c, t dbSNP:773036378
3095 3095 a, c dbSNP:556195040
3100 3100 a, g dbSNP:766218970
3108 3108 a, c dbSNP:574630552
3109 3109 a, t dbSNP:753720576
3111 3111 g, t dbSNP:12927115
3117 3117 g, t dbSNP:759380807
3119 3119 a, c dbSNP:273585619
3121 3121 a, g dbSNP:191396489
3125 3125 a, g dbSNP:181077813
3136 3136 c, t dbSNP:572206377
3153 3153 c, t dbSNP:9924504
3169 3169 a, c dbSNP:751031024
3170 3170 -, aga dbSNP:760578785
3194 3194 a, g dbSNP:533979613
3210 3210 -, cgaggagga dbSNP:768453073
3216 3216 a, g dbSNP:760454346
3222 3222 a, g dbSNP:543947244
3236 3236 a, g dbSNP:281865148
3237 3237 a, g dbSNP:763826959
3242 3242 c, t dbSNP:562264117
3248 3248 c, t dbSNP:765069829
3257 3257 c, g, t dbSNP:568046708
3266 3266 c, g dbSNP:757120684
3323 3323 a, g dbSNP:763640994
3337 3337 g, t dbSNP:547419772
3344 3344 g, t dbSNP:367683886
3349 3349 -, gaa dbSNP:776668013
3353 3353 c, t dbSNP:756692377
3356 3356 a, g dbSNP:766943377
3364 3364 c, g dbSNP:754292270
3368 3368 c, t dbSNP:755348435
3374 3374 c, t dbSNP:779180717
3378 3378 c, t dbSNP:748507690
3388 3388 a, c, t dbSNP:184894059
3396 3396 a, g dbSNP:747150324
3411 3411 c, g dbSNP:770873172
3415 3415 a, g dbSNP:776725237
3420 3420 c, t dbSNP:533300920
3422 3422 c, t dbSNP:769853271
3432 3432 c, t dbSNP:111557381
3436 3436 a, c dbSNP:762820212
3438 3438 a, g dbSNP:9938800
3456 3456 a, g dbSNP:537650415
3466 3466 a, g dbSNP:553460850
3467 3467 c, g dbSNP:773837873
3480 3480 c, g dbSNP:761406489
3481 3481 a, c dbSNP:766878740
3483 3483 a, c dbSNP:754347295
3484 3484 a, g dbSNP:7197071
3497 3497 a, g dbSNP:765714860
3510 3510 a, c dbSNP:753105781
3514 3514 a, c dbSNP:758656171
3517 3517 g, t dbSNP:758315492
3523 3523 c, t dbSNP:778085437
3564 3564 a, c dbSNP:568281394
3566 3566 c, t dbSNP:115183769
3581 3581 c, t dbSNP:553831899
3588 3588 c, g dbSNP:757366332
3614 3614 a, g dbSNP:781493176
3623 3623 c, g dbSNP:745934280
3630 3630 c, t dbSNP:572061351
3665 3665 c, t dbSNP:539399156
3666 3666 c, g, t dbSNP:557569932
3667 3667 a, g dbSNP:768287765
3668 3668 c, t dbSNP:190928557
3674 3674 c, t dbSNP:761304483
3675 3675 g, t dbSNP:543669472
3684 3684 a, g dbSNP:771706762
3689 3689 a, c dbSNP:141255631
3706 3706 a, g dbSNP:760152717
3735 3735 g, t dbSNP:765769896
3739 3739 a, g dbSNP:753159087
3750 3750 c, t dbSNP:763396048
3758 3758 c, g dbSNP:764302046
3783 3783 c, t dbSNP:751952704
3786 3786 c, t dbSNP:574020033
3791 3791 c, g dbSNP:183126539
3806 3806 a, g dbSNP:750571274
3810 3810 a, c, g dbSNP:115790991
3811 3811 a, g dbSNP:533167413
3827 3827 a, g dbSNP:749120381
3834 3834 a, g dbSNP:768501538
3835 3835 -, a dbSNP:777337062
3835 3835 a, g, t dbSNP:568553875
3836 3836 a, g dbSNP:551317630
3847 3847 c, t dbSNP:187453092
3856 3856 c, t dbSNP:771757508
3861 3861 c, t dbSNP:748313775
3866 3866 a, g dbSNP:772817384
3870 3870 a, c dbSNP:760206158
3872 3872 a, c dbSNP:770376107
3874 3874 a, c dbSNP:776071197
3880 3880 c, t dbSNP:531001062
3908 3908 c, t dbSNP:764653097
3927 3927 c, t dbSNP:549744162
3963 3963 c, t dbSNP:762207129
3972 3972 g, t dbSNP:568223916
3981 3981 c, t dbSNP:750626241
4008 4008 g, t dbSNP:756277188
4010 4010 c, g dbSNP:766498455
4016 4016 -, c dbSNP:34835550
4030 4030 a, g dbSNP:368674617
4042 4042 a, t dbSNP:547723365
4053 4053 c, t dbSNP:770080221
4054 4054 c, t dbSNP:778886933
4069 4069 c, t dbSNP:565933848
4071 4071 c, t dbSNP:747930231
4112 4112 a, c dbSNP:758146135
4114 4114 a, c dbSNP:145158875
4119 4119 a, g dbSNP:765741474
4132 4132 g, t dbSNP:557997233
4139 4139 c, t dbSNP:770568316
4142 4142 c, t dbSNP:776065579
4143 4143 a, g dbSNP:371897217
4151 4151 c, g dbSNP:576089886
4171 4171 a, g dbSNP:769088579
4172 4172 a, g dbSNP:774882800
4173 4173 c, t dbSNP:762292362
4174 4174 a, g, t dbSNP:387907063
4183 4183 a, g dbSNP:773575681
4191 4191 c, g dbSNP:761043511
4201 4201 c, g dbSNP:766610177
4202 4202 c, t dbSNP:62047114
4203 4203 a, g dbSNP:753910069
4224 4224 c, t dbSNP:755053882
4225 4225 a, g dbSNP:765117778
4230 4230 a, g dbSNP:576048519
4232 4232 c, t dbSNP:752630858
4233 4233 a, g dbSNP:537125745
4236 4236 a, g dbSNP:374090900
4243 4243 a, t dbSNP:746794907
4247 4247 c, t dbSNP:113957796
4259 4259 c, t dbSNP:4782300
4260 4260 a, g dbSNP:780866854
4263 4263 c, t dbSNP:573889729
4279 4279 c, g dbSNP:116532825
4281 4281 a, c dbSNP:281165937
4289 4289 a, c, g dbSNP:535450942
4292 4292 g, t dbSNP:559625962
4295 4295 c, g dbSNP:748602541
4300 4300 a, g dbSNP:577890057
4308 4308 c, g dbSNP:773767800
4309 4309 a, g dbSNP:763106149
4313 4313 c, g dbSNP:545090576
4315 4315 c, t dbSNP:761094844
4322 4322 a, g dbSNP:116072997
4329 4329 c, t dbSNP:776873127
4335 4335 g, t dbSNP:12445417
4336 4336 c, g dbSNP:765302112
4337 4337 c, t dbSNP:199897247
4338 4338 a, g dbSNP:368877287
4343 4343 a, g dbSNP:763632522
4349 4349 c, g dbSNP:751396157
4350 4350 c, t dbSNP:74032865
4351 4351 a, g dbSNP:529103356
4352 4352 a, g dbSNP:750038143
4356 4356 a, g dbSNP:755586686
4359 4359 a, g dbSNP:547585456
4362 4362 c, t dbSNP:748790994
4363 4363 g, t dbSNP:273585620
4367 4367 a, g dbSNP:772751192
4371 4371 c, t dbSNP:375783673
4372 4372 a, g dbSNP:373777402
4379 4379 c, t dbSNP:565994438
4388 4388 c, t dbSNP:375045076
4389 4389 a, g dbSNP:771276595
4390 4390 a, g dbSNP:190630095
4394 4394 c, t dbSNP:369382753
4395 4395 a, g dbSNP:373162171
4423 4423 c, g dbSNP:139043003
4442 4442 c, t dbSNP:555452824
4443 4443 a, g dbSNP:368668712
4445 4445 -, tgc dbSNP:555544144
4445 4445 c, t dbSNP:764050771
4447 4447 c, t dbSNP:375762899
4451 4451 c, t dbSNP:751453361
4455 4455 c, t dbSNP:566977919
4457 4457 a, g dbSNP:370153731
4471 4471 g, t dbSNP:534912168
4472 4472 c, t dbSNP:767278971
4473 4473 a, g dbSNP:750183688
4486 4486 c, g dbSNP:553117275
4487 4487 g, t dbSNP:111916311
4490 4490 c, g dbSNP:545662898
4495 4495 a, g dbSNP:557124622
4496 4496 c, t dbSNP:183617173
4497 4497 a, g dbSNP:188162391
4502 4502 a, c dbSNP:747460229
4515 4515 a, c dbSNP:142246629
4522 4522 c, t dbSNP:781667585
4524 4524 c, t dbSNP:746198528
4525 4525 a, g dbSNP:528560466
4527 4527 c, t dbSNP:775651401
4528 4528 a, g dbSNP:200684392
4530 4530 c, t dbSNP:768668858
4531 4531 a, g dbSNP:559565235
4556 4556 a, g dbSNP:775367818
4557 4557 a, t dbSNP:761880505
4562 4562 a, g dbSNP:533119259
4566 4566 c, t dbSNP:750201625
4567 4567 a, g dbSNP:143740518
4576 4576 a, g dbSNP:760352871
4577 4577 a, g, t dbSNP:766157054
4590 4590 c, t dbSNP:546141547
4591 4591 a, g dbSNP:376951144
4616 4616 c, t dbSNP:754549081
4623 4623 c, g, t dbSNP:764771501
4661 4661 a, g dbSNP:758312819
4664 4664 a, g dbSNP:766287849
4671 4671 a, g, t dbSNP:370447132
4675 4675 c, g dbSNP:756421713
4677 4677 a, g dbSNP:780272537
4687 4687 g, t dbSNP:755066385
4694 4694 c, t dbSNP:768864900
4695 4695 a, g dbSNP:774473871
4713 4713 c, t dbSNP:548676256
4714 4714 a, g dbSNP:748152457
4729 4729 c, t dbSNP:772083795
4741 4741 c, t dbSNP:564352128
4742 4742 a, g dbSNP:748403721
4745 4745 a, g dbSNP:567038987
4765 4765 c, t dbSNP:557351664
4770 4770 c, t dbSNP:776427158
4771 4771 a, g dbSNP:759327672
4778 4778 c, t dbSNP:764967759
4779 4779 a, g, t dbSNP:778048230
4782 4782 a, c dbSNP:553180337
4785 4785 a, g dbSNP:768092775
4786 4786 c, g dbSNP:571503983
4799 4799 c, t dbSNP:750838324
4800 4800 a, g dbSNP:141666432
4802 4802 a, g dbSNP:780466908
4804 4804 a, g dbSNP:749642726
4808 4808 a, g dbSNP:755244502
4823 4823 a, g dbSNP:557636016
4825 4825 c, t dbSNP:575820215
4826 4826 a, c, g dbSNP:273585621
4836 4836 a, g dbSNP:777779701
4842 4842 a, g dbSNP:117310292
4863 4863 a, g dbSNP:770986542
4864 4864 a, g dbSNP:776625365
4868 4868 a, g dbSNP:773925755
4871 4871 c, g dbSNP:754736361
4887 4887 a, g dbSNP:769603060
4888 4888 a, t dbSNP:554985503
4892 4892 c, g dbSNP:762538480
4899 4899 a, g dbSNP:763449856
4905 4905 c, t dbSNP:369706261
4909 4909 a, c dbSNP:746317483
4922 4922 c, t dbSNP:200070902
4923 4923 a, t dbSNP:761231918
4926 4926 c, t dbSNP:766852564
4930 4930 c, t dbSNP:754238957
4933 4933 c, t dbSNP:540726153
4937 4937 a, g dbSNP:755293349
4971 4971 c, t dbSNP:779214600
4989 4989 c, t dbSNP:752800323
5003 5003 c, t dbSNP:115487796
5017 5017 a, g dbSNP:777781528
5023 5023 a, t dbSNP:747069935
5030 5030 c, t dbSNP:768667107
5035 5035 c, t dbSNP:771039755
5039 5039 c, g dbSNP:781236434
5055 5055 c, g dbSNP:776240249
5060 5060 a, g dbSNP:281865149
5061 5061 a, g dbSNP:577775261
5063 5063 c, t dbSNP:375253239
5066 5066 a, c, t dbSNP:544832628
5067 5067 c, g dbSNP:768346137
5069 5069 a, g dbSNP:773784923
5078 5078 g, t dbSNP:568197988
5110 5110 c, t dbSNP:778724356
5121 5121 c, t dbSNP:772934232
5123 5123 a, g dbSNP:766899690
5145 5145 a, c dbSNP:192819567
5146 5146 a, g dbSNP:759903465
5161 5161 g, t dbSNP:765449902
5166 5166 c, t dbSNP:753101134
5169 5169 c, g dbSNP:371449478
5179 5179 a, g dbSNP:530685019
5181 5181 c, t dbSNP:367692750
5182 5182 a, g dbSNP:371328036
5193 5193 a, g dbSNP:528219067
5197 5197 a, g dbSNP:757365430
5208 5208 c, t dbSNP:781292856
5210 5210 g, t dbSNP:546280073
5211 5211 g, t dbSNP:756078052
5213 5213 a, g dbSNP:571207087
5222 5222 c, t dbSNP:150543090
5230 5230 a, c dbSNP:768236457
5248 5248 a, c dbSNP:528985816
5253 5253 a, g dbSNP:140280704
5254 5254 c, g dbSNP:773949576
5256 5256 c, g, t dbSNP:184374078
5257 5257 a, g dbSNP:555047442
5260 5260 a, g dbSNP:760027621
5263 5263 a, g dbSNP:754873241
5266 5266 a, g dbSNP:775765033
5279 5279 a, g dbSNP:763345014
5284 5284 c, g dbSNP:764246971
5294 5294 c, t dbSNP:573261438
5313 5313 g, t dbSNP:547430660
5316 5316 c, t dbSNP:751776082
5330 5330 a, c dbSNP:78446958
5352 5352 c, t dbSNP:767773120
5353 5353 a, g dbSNP:750521936
5362 5362 c, t dbSNP:756058946
5365 5365 c, g dbSNP:559099409
5367 5367 a, g dbSNP:767627500
5369 5369 a, t dbSNP:780013286
5380 5380 c, t dbSNP:749072244
5395 5395 c, g dbSNP:754750136
5404 5404 g, t dbSNP:778548266
5425 5425 a, g dbSNP:752804551
5439 5439 a, g dbSNP:577241365
5453 5453 c, t dbSNP:539550777
5455 5455 a, g dbSNP:771704621
5456 5456 c, t dbSNP:374091782
5464 5464 a, c dbSNP:199932922
5474 5474 a, g dbSNP:563324563
5476 5476 a, g dbSNP:770241774
5477 5477 g, t dbSNP:776017867
5492 5492 c, t dbSNP:575524015
5493 5493 a, g dbSNP:764487066
5498 5498 a, g dbSNP:774853134
5532 5532 a, g dbSNP:762188003
5534 5534 c, t dbSNP:767834641
5559 5559 c, t dbSNP:539613654
5560 5560 a, g dbSNP:74032866
5577 5577 a, c, g dbSNP:9931465
5587 5587 a, t dbSNP:569996393
5591 5591 a, g dbSNP:528085780
5597 5597 a, t dbSNP:281865150
5613 5613 c, t dbSNP:111986360
5614 5614 c, t dbSNP:754730500
5623 5623 c, t dbSNP:757657013
5624 5624 a, g dbSNP:565007481
5677 5677 g, t dbSNP:758095145
5682 5682 a, g dbSNP:777372376
5689 5689 c, t dbSNP:746531499
5690 5690 g, t dbSNP:770417916
5695 5695 c, t dbSNP:537085488
5726 5726 a, c dbSNP:555474158
5740 5740 a, g dbSNP:114755302
5771 5771 a, g dbSNP:746407463
5772 5772 c, t dbSNP:186652137
5773 5773 c, g dbSNP:774908636
5778 5778 c, g, t dbSNP:201666199
5779 5779 a, g dbSNP:772675428
5805 5805 a, g dbSNP:773437968
5819 5819 a, c dbSNP:760679863
5829 5829 c, t dbSNP:139723958
5830 5830 a, g dbSNP:766410344
5831 5831 g, t dbSNP:573931575
5851 5851 a, g dbSNP:780898496
5858 5858 c, g dbSNP:548906722
5862 5862 c, t dbSNP:753855061
5867 5867 a, g dbSNP:567121358
5923 5923 c, g dbSNP:765135685
5932 5932 a, g dbSNP:752527135
5948 5948 a, g dbSNP:79155191
5951 5951 c, t dbSNP:777417920
5952 5952 a, g dbSNP:149961653
5955 5955 c, t dbSNP:756857979
5962 5962 a, g dbSNP:368679510
5991 5991 a, g dbSNP:373300146
5994 5994 c, g dbSNP:769330310
5997 5997 c, t dbSNP:577303475
5998 5998 a, g dbSNP:192580109
6004 6004 a, g dbSNP:748549582
6006 6006 c, g dbSNP:754253956
6007 6007 a, c, g dbSNP:273585622
6015 6015 a, c dbSNP:557168382
6038 6038 g, t dbSNP:575336882
6055 6055 a, t dbSNP:542373398
6093 6093 a, g dbSNP:771042751
6095 6095 a, c dbSNP:273585623
6120 6120 a, g dbSNP:575840696
6130 6130 a, g dbSNP:770234550
6140 6140 a, g dbSNP:775748814
6143 6143 a, g dbSNP:554464152
6152 6152 c, t dbSNP:765190704
6175 6175 a, g dbSNP:144986357
6177 6177 a, g dbSNP:539874684
6186 6186 c, t dbSNP:564703948
6195 6195 a, c dbSNP:751300834
6213 6213 -, ag dbSNP:764745826
6222 6222 a, c dbSNP:532279011
6230 6230 c, t dbSNP:543961799
6237 6237 c, t dbSNP:767048513
6238 6238 a, g dbSNP:749986676
6242 6242 a, g dbSNP:755640019
6243 6243 c, g dbSNP:769399225
6284 6284 c, t dbSNP:779580911
6293 6293 a, g dbSNP:748594806
6294 6294 a, c dbSNP:758964921
6304 6304 c, g dbSNP:562559927
6308 6308 c, t dbSNP:747310515
6309 6309 a, c dbSNP:771223271
6310 6310 a, c dbSNP:776675534
6317 6317 a, t dbSNP:772920337
6329 6329 c, t dbSNP:530318278
6330 6330 a, g, t dbSNP:548774131
6333 6333 c, t dbSNP:369067040
6347 6347 a, g dbSNP:56704016
6356 6356 a, g dbSNP:763917433
6358 6358 a, g dbSNP:552571715
6359 6359 c, g dbSNP:761477298
6378 6378 a, g, t dbSNP:61472141
6386 6386 a, g dbSNP:13334190
6388 6388 g, t dbSNP:766049010
6396 6396 c, t dbSNP:370190101
6405 6405 a, g dbSNP:572299080
6429 6429 c, g dbSNP:568170941
6434 6434 a, c dbSNP:572334434
6457 6457 a, g dbSNP:113838400
6468 6468 c, g, t dbSNP:12919507
6494 6494 c, t dbSNP:781489620
6495 6495 a, g dbSNP:572828624
6507 6507 a, g dbSNP:373975520
6524 6524 c, t dbSNP:376402207
6528 6528 c, t dbSNP:540133355
6545 6545 c, t dbSNP:564413710
6555 6555 c, t dbSNP:749336655
6581 6581 c, t dbSNP:78213929
6593 6593 c, t dbSNP:768673377
6612 6612 c, t dbSNP:377506846
6613 6613 a, g dbSNP:369117913
6614 6614 a, t dbSNP:761793209
6647 6647 a, c dbSNP:771701091
6651 6651 a, c dbSNP:773133696
6655 6655 a, g, t dbSNP:371739743
6662 6662 c, t dbSNP:766105867
6679 6679 g, t dbSNP:576769267
6684 6684 c, t dbSNP:753436673
6693 6693 a, g dbSNP:76442115
6695 6695 a, g dbSNP:75136873
6711 6711 c, t dbSNP:751953666
6716 6716 a, g dbSNP:181887079
6717 6717 a, t dbSNP:542478842
6725 6725 a, c dbSNP:273585624
6736 6736 a, g dbSNP:560650237
6741 6741 a, g dbSNP:780211919
6743 6743 c, t dbSNP:749410217
6745 6745 a, g dbSNP:760816769
6747 6747 c, g dbSNP:778917466
6762 6762 c, t dbSNP:748097865
6795 6795 c, t dbSNP:528038930
6796 6796 a, g dbSNP:773187176
6799 6799 a, g dbSNP:760511796
6804 6804 g, t dbSNP:770737265
6843 6843 c, g dbSNP:776372059
6848 6848 g, t dbSNP:759098851
6857 6857 c, t dbSNP:764584228
6860 6860 c, g dbSNP:77490207
6880 6880 a, g dbSNP:571086007
6881 6881 c, t dbSNP:531612776
6889 6889 a, g dbSNP:767983355
6894 6894 c, g, t dbSNP:185282301
6900 6900 a, g dbSNP:764025593
6912 6912 c, g dbSNP:780270582
6914 6914 a, g dbSNP:753943817
6921 6921 c, t dbSNP:576401425
6923 6923 a, g dbSNP:535533519
6927 6927 c, t dbSNP:748233261
6928 6928 a, g dbSNP:772172396
6956 6956 c, t dbSNP:777810908
6958 6958 g, t dbSNP:554390357
6977 6977 c, t dbSNP:746820435
6980 6980 g, t dbSNP:770790427
6989 6989 c, t dbSNP:776427057
6995 6995 c, t dbSNP:76389306
7005 7005 c, t dbSNP:779456576
7018 7018 a, g dbSNP:533944505
7019 7019 a, g dbSNP:558575823
7032 7032 c, g dbSNP:762487170
7046 7046 c, t dbSNP:768036751
7047 7047 a, g dbSNP:773655006
7072 7072 c, g dbSNP:12598474
7073 7073 a, g dbSNP:766801309
7074 7074 g, t dbSNP:778636214
7076 7076 a, g dbSNP:111828626
7084 7084 c, g dbSNP:117474182
7099 7099 a, g dbSNP:755200044
7111 7111 c, t dbSNP:759032227
7116 7116 c, t dbSNP:537461157
7118 7118 c, t dbSNP:556181977
7150 7150 a, c dbSNP:376972141
7152 7152 a, c dbSNP:758501052
7156 7156 a, c dbSNP:777864425
7173 7173 c, g dbSNP:780605331
7181 7181 a, c, t dbSNP:201540905
7183 7183 a, c dbSNP:199727372
7185 7185 a, c, g dbSNP:560708919
7186 7186 c, g dbSNP:775161092
7188 7188 a, g dbSNP:572687871
7218 7218 c, t dbSNP:748812352
7224 7224 g, t dbSNP:768091619
7228 7228 c, g dbSNP:546332627
7234 7234 a, g dbSNP:761232264
7237 7237 c, t dbSNP:546137802
7253 7253 a, g dbSNP:532015720
7256 7256 c, g dbSNP:558035857
7262 7262 a, g dbSNP:549934027
7289 7289 c, t dbSNP:765397845
7291 7291 a, g dbSNP:752904821
7293 7293 a, c, g dbSNP:758555802
7319 7319 c, t dbSNP:751675982
7348 7348 g, t dbSNP:528848596
7361 7361 a, g dbSNP:757300563
7366 7366 a, g dbSNP:561743358
7371 7371 a, c, g dbSNP:529386410
7382 7382 a, g dbSNP:547492890
7387 7387 a, g dbSNP:74032867
7402 7402 c, t dbSNP:749010605
7411 7411 c, t dbSNP:752436384
7413 7413 a, g dbSNP:768288160
7422 7422 c, t dbSNP:778439886
7423 7423 a, g dbSNP:747622601
7424 7424 a, c, t dbSNP:141218390
7425 7425 a, g dbSNP:759829909
7430 7430 c, t dbSNP:552311966
7431 7431 a, g dbSNP:775992269
7439 7439 c, t dbSNP:570690992
7440 7440 a, g dbSNP:559000174
7441 7441 a, g dbSNP:538124163
7447 7447 c, g dbSNP:751720944
7465 7465 c, g dbSNP:761936790
7469 7469 a, c dbSNP:201943633
7489 7489 c, g dbSNP:574478833
7490 7490 c, t dbSNP:756003807
7491 7491 a, g, t dbSNP:535400159
7511 7511 g, t dbSNP:553909579
7527 7527 c, g dbSNP:199519673
7529 7529 a, g dbSNP:754660921
7531 7531 a, c dbSNP:546113899
7539 7539 c, t dbSNP:778493391
7543 7543 c, t dbSNP:747677679
7544 7544 a, g dbSNP:771550262
7551 7551 c, t dbSNP:781553869
7555 7555 a, t dbSNP:746453038
7561 7561 a, g dbSNP:759325304
7591 7591 a, g dbSNP:146789160
7601 7601 g, t dbSNP:763370615
7611 7611 a, g dbSNP:769023709
7623 7623 c, t dbSNP:140697844
7632 7632 a, g dbSNP:775513309
7643 7643 c, t dbSNP:760483469
7662 7662 c, g dbSNP:764262910
7665 7665 a, g dbSNP:761805581
7680 7680 a, g dbSNP:117149938
7688 7688 a, t dbSNP:750459820
7711 7711 a, g dbSNP:760719090
7721 7721 c, t dbSNP:150488251
7733 7733 a, c dbSNP:529250336
7747 7747 a, g dbSNP:281865151
7749 7749 a, g dbSNP:559434849
7753 7753 c, t dbSNP:754715853
7754 7754 a, c, g dbSNP:370285147
7763 7763 a, g dbSNP:368063668
7766 7766 a, g dbSNP:200019229
7777 7777 a, g dbSNP:552116287
7787 7787 c, t dbSNP:777399076
7809 7809 a, c dbSNP:746478601
7813 7813 a, g dbSNP:756676447
7814 7814 a, g dbSNP:780659413
7822 7822 a, g dbSNP:570624682
7847 7847 a, g dbSNP:281865152
7848 7848 g, t dbSNP:765538457
7849 7849 a, g dbSNP:774855163
7851 7851 a, g dbSNP:189596398
7873 7873 a, g dbSNP:772158825
7874 7874 c, g dbSNP:773376777
7877 7877 a, t dbSNP:550109690
7878 7878 c, t dbSNP:568314844
7885 7885 g, t dbSNP:766329089
7889 7889 a, t dbSNP:776496661
7890 7890 c, t dbSNP:750884042
7891 7891 a, g dbSNP:370043591
7892 7892 a, g dbSNP:535466615
7897 7897 a, g dbSNP:138259179
7899 7899 c, t dbSNP:181124665
7901 7901 c, g dbSNP:765084818
7909 7909 a, t dbSNP:372973682
7917 7917 a, g dbSNP:565666003
7918 7918 a, g dbSNP:185140766
7937 7937 c, t dbSNP:539516112
7940 7940 c, t dbSNP:751102147
7980 7980 c, t dbSNP:558108271
7983 7983 a, g dbSNP:116213189
7988 7988 a, g dbSNP:573064293
7992 7992 a, g dbSNP:149200506
7996 7996 c, t dbSNP:540443650
8005 8005 a, g dbSNP:748426466
8009 8009 a, t dbSNP:3812956
8028 8028 a, g dbSNP:773262065
8037 8037 a, g dbSNP:116696830
8079 8079 c, t dbSNP:113274745
8098 8098 a, c, t dbSNP:143073976
8115 8115 g, t dbSNP:533314130
8118 8118 a, g dbSNP:562061509
8120 8120 c, t dbSNP:545477758
8122 8122 a, g dbSNP:374110064
8128 8128 a, g dbSNP:3812955
8135 8135 g, t dbSNP:531537482
8154 8154 a, g dbSNP:372014903
8168 8168 c, t dbSNP:376638940
8169 8169 a, g dbSNP:549975755
8176 8176 a, g dbSNP:568379728
8205 8205 a, g dbSNP:756963806
8212 8212 a, g dbSNP:767192305
8213 8213 c, g, t dbSNP:529180104
8218 8218 a, g dbSNP:561418885
8241 8241 a, g dbSNP:753131806
8246 8246 a, t dbSNP:3812954
8260 8260 c, t dbSNP:553227769
8261 8261 a, c dbSNP:557835484
8272 8272 -, t dbSNP:35399328
8281 8281 a, g dbSNP:569619739
8287 8287 a, g dbSNP:771130310
8297 8297 c, t dbSNP:202188220
8298 8298 a, g dbSNP:745918304
8317 8317 c, g dbSNP:555522972
8325 8325 c, t dbSNP:376502074
8346 8346 a, c, g, t dbSNP:574024256
8367 8367 c, t dbSNP:774180906
8374 8374 a, g dbSNP:761603858
8376 8376 a, c dbSNP:767243686
8382 8382 a, g dbSNP:749980410
8401 8401 a, g dbSNP:760217531
8405 8405 c, g dbSNP:541325052
8407 8407 a, g dbSNP:753082153
8411 8411 a, g dbSNP:371361395
8419 8419 c, g dbSNP:200153921
8505 8505 c, t dbSNP:778058572
8506 8506 c, g dbSNP:751901105
8515 8515 a, g dbSNP:745468033
8519 8519 a, g dbSNP:757511935
8520 8520 c, t dbSNP:3812953
8540 8540 c, t dbSNP:563827222
8541 8541 acg, gca dbSNP:386794006
8541 8541 a, g dbSNP:138771545
8542 8542 c, t dbSNP:543678278
8543 8543 a, g dbSNP:1983014
8557 8557 c, t dbSNP:529243785
8558 8558 a, g dbSNP:142753357
8565 8565 a, g dbSNP:761656880
8579 8579 c, t dbSNP:771869636
8580 8580 a, g dbSNP:772945899
8594 8594 c, t dbSNP:529013712
8603 8603 a, g dbSNP:565789702
8610 8610 c, t dbSNP:114884145
8611 8611 a, g dbSNP:202129382
8612 8612 a, g dbSNP:79815243
8616 8616 c, t dbSNP:764632868
8618 8618 c, g dbSNP:751952593
8621 8621 c, t dbSNP:536725615
8622 8622 a, g dbSNP:767731436
8635 8635 c, t dbSNP:750710598
8636 8636 c, g dbSNP:756344990
8645 8645 c, t dbSNP:780044721
8646 8646 a, g, t dbSNP:549214055
8649 8649 c, g dbSNP:567512563
8650 8650 c, t dbSNP:534850616
8654 8654 c, g dbSNP:747973451
8655 8655 c, t dbSNP:774404190
8656 8656 a, g dbSNP:768452919
8690 8690 c, t dbSNP:771929127
8691 8691 a, g dbSNP:188044647
8700 8700 c, t dbSNP:773139907
8701 8701 a, g dbSNP:578166707
8704 8704 g, t dbSNP:76792613
8711 8711 a, c dbSNP:776046885
8712 8712 a, t dbSNP:759047524
8717 8717 a, t dbSNP:764531239
8721 8721 c, t dbSNP:774772360
8722 8722 c, g dbSNP:762301873
8731 8731 c, t dbSNP:767926139
8740 8740 a, g dbSNP:372436770
8749 8749 a, g dbSNP:750763580
8750 8750 a, t dbSNP:756327266
8772 8772 c, t dbSNP:766581620
8776 8776 c, t dbSNP:557063759
8782 8782 a, c dbSNP:575854370
8783 8783 c, g dbSNP:543133296
8784 8784 c, t dbSNP:137930753
8785 8785 a, g dbSNP:573884006
8847 8847 c, g dbSNP:758398877
8852 8852 c, t dbSNP:773307182
8853 8853 c, t dbSNP:777763779
8854 8854 a, g dbSNP:746790100
8865 8865 a, g dbSNP:540837720
8900 8900 c, t dbSNP:759398721
8906 8906 g, t dbSNP:559611442
8912 8912 g, t dbSNP:273585625
8920 8920 a, c dbSNP:141776185
8924 8924 c, t dbSNP:774968087
8925 8925 a, g dbSNP:762354725
8926 8926 g, t dbSNP:772048540
8941 8941 g, t dbSNP:767979406
8942 8942 a, c dbSNP:773595581
8952 8952 c, t dbSNP:761048739
8955 8955 c, t dbSNP:766519781
8956 8956 a, g dbSNP:201438224
8960 8960 a, g dbSNP:759678019
8963 8963 c, t dbSNP:765473138
8969 8969 c, t dbSNP:752805730
8970 8970 c, t dbSNP:761979697
8971 8971 a, g dbSNP:765339766
8979 8979 c, t dbSNP:374160099
8990 8990 g, t dbSNP:548681380
8995 8995 c, t dbSNP:376513000
8996 8996 a, g dbSNP:566978194
9003 9003 c, t dbSNP:780843955
9004 9004 a, g dbSNP:773580012
9011 9011 -, ttcccgggaacaccc dbSNP:281865162
9015 9015 c, t dbSNP:745592403
9036 9036 a, g dbSNP:534910156
9040 9040 c, t dbSNP:546845105
9041 9041 a, g dbSNP:150598363
9047 9047 c, t dbSNP:273585626
9077 9077 a, c dbSNP:139565761
9104 9104 a, c dbSNP:760948619
9118 9118 a, g dbSNP:771396967
9129 9129 c, t dbSNP:267604675
9130 9130 a, g dbSNP:557364171
9132 9132 c, t dbSNP:759853163
9141 9141 c, t dbSNP:765528112
9146 9146 a, g dbSNP:376981441
9150 9150 -, c dbSNP:762598893
9150 9150 c, t dbSNP:576267702
9159 9159 a, g dbSNP:752856857
9162 9162 a, g dbSNP:763079136
9184 9184 c, g dbSNP:764139968
9185 9185 a, g dbSNP:751447615
9224 9224 a, g dbSNP:757127806
9237 9237 a, g dbSNP:543846859
9243 9243 c, g dbSNP:369198557
9250 9250 c, t dbSNP:766808845
9281 9281 a, g dbSNP:376055908
9284 9284 a, c, g dbSNP:536601676
9289 9289 c, t dbSNP:543370102
9298 9298 c, g dbSNP:748808102
9308 9308 a, g dbSNP:768083750
9315 9315 a, c dbSNP:573336973
9333 9333 c, t dbSNP:747613949
9334 9334 a, g dbSNP:771322819
9341 9341 c, t dbSNP:541252488
9347 9347 c, t dbSNP:559258806
9364 9364 a, g dbSNP:777096338
9367 9367 c, t dbSNP:755567767
9378 9378 c, t dbSNP:759941304
9432 9432 c, t dbSNP:577913880
9447 9447 c, t dbSNP:775797987
9471 9471 c, g dbSNP:273585636
9476 9476 g, t dbSNP:751127263
9488 9488 a, g dbSNP:764291525
9499 9499 c, t dbSNP:774273165
9508 9508 a, g dbSNP:761848003
9520 9520 c, g dbSNP:767316063
9536 9536 c, t dbSNP:563202944
9539 9539 a, g, t dbSNP:756776866
9556 9556 c, g, t dbSNP:766019888
9562 9562 a, g dbSNP:754615656
9612 9612 a, g dbSNP:573582117
9618 9618 a, c dbSNP:180767077
9619 9619 a, g dbSNP:548544358
9621 9621 a, g dbSNP:757816736
9648 9648 c, t dbSNP:781504847
9652 9652 a, g dbSNP:746250202
9661 9661 a, g dbSNP:560665168
9672 9672 a, g dbSNP:775994248
9715 9715 c, t dbSNP:528159004
9719 9719 a, g dbSNP:749570458
9728 9728 c, t dbSNP:547200758
9737 9737 a, g dbSNP:774519167
9746 9746 a, g dbSNP:761748460
9749 9749 a, c dbSNP:571738263
9761 9761 c, t dbSNP:532698360
9765 9765 -, c dbSNP:766085142
9766 9766 a, g dbSNP:773064083
9772 9772 g, t dbSNP:760598299
9786 9786 c, t dbSNP:766216457
9791 9791 c, g dbSNP:753611720
9810 9810 c, t dbSNP:551298094
9816 9816 a, c dbSNP:569542889
9821 9821 c, t dbSNP:536657800
9835 9835 a, g dbSNP:273585627
9837 9837 a, g dbSNP:533072680
9857 9857 a, g dbSNP:757791330
9896 9896 c, t dbSNP:186421933
9900 9900 a, g dbSNP:534030108
9915 9915 a, g dbSNP:781724789
9921 9921 c, t dbSNP:553175600
9926 9926 a, g dbSNP:756665535
9928 9928 a, g dbSNP:780605971
9932 9932 g, t dbSNP:112040151
9950 9950 a, g dbSNP:79339739
9963 9963 c, t dbSNP:113196966
10016 10016 a, g dbSNP:387907062
10026 10026 c, t dbSNP:545144029
10029 10029 c, g dbSNP:778941342
10041 10041 c, t dbSNP:748259983
10048 10048 c, g dbSNP:192272765
10094 10094 a, g dbSNP:773264104
10098 10098 a, g dbSNP:760657834
10101 10101 c, g dbSNP:149732077
10115 10115 c, g, t dbSNP:776446488
10115 10115 c, t dbSNP:281165933
10131 10131 a, g dbSNP:764956489
10140 10140 c, t dbSNP:752225566
10142 10142 c, t dbSNP:762664895
10150 10150 c, t dbSNP:763756847
10151 10151 a, g dbSNP:751080818
10170 10170 c, t dbSNP:756718444
10203 10203 a, g dbSNP:780657555
10217 10217 -, cccc dbSNP:146088640
10219 10219 c, g, t dbSNP:754267225
10225 10225 a, g dbSNP:779327196
10240 10240 -, g dbSNP:764470052
10240 10240 -, a dbSNP:756543273
10241 10241 c, g dbSNP:199528724
10242 10242 c, g, t dbSNP:56236932
10243 10243 a, c, g, t dbSNP:532857190
10244 10244 a, c, g, t dbSNP:140056980
10245 10245 c, g dbSNP:551160595
10246 10246 a, c, g dbSNP:569602115
10247 10247 a, g, t dbSNP:530393871
10249 10249 c, t dbSNP:766994242
10260 10260 c, t dbSNP:754366630
10270 10270 a, g dbSNP:548646578
10276 10276 c, t dbSNP:755495104
10277 10277 a, g dbSNP:75288466
10307 10307 a, g dbSNP:753078494
10312 10312 c, t dbSNP:758582590
10353 10353 a, g dbSNP:534158007
10356 10356 c, t dbSNP:747109021
10357 10357 a, g dbSNP:757261226
10378 10378 a, g dbSNP:781244140
10380 10380 g, t dbSNP:745853380
10387 10387 -, cct dbSNP:145451469
10388 10388 c, g dbSNP:183437633
10395 10395 c, t dbSNP:775177892
10400 10400 g, t dbSNP:770014757
10404 10404 a, c dbSNP:186812279
10420 10420 c, g dbSNP:749061080
10421 10421 a, g dbSNP:768435913
10434 10434 a, g dbSNP:376379111
10444 10444 c, t dbSNP:761550303
10449 10449 a, g dbSNP:767190349
10454 10454 c, t dbSNP:772753807
10455 10455 a, g dbSNP:759998900
10459 10459 a, g dbSNP:535466651
10472 10472 a, c dbSNP:549031654
10488 10488 c, t dbSNP:763317477
10489 10489 a, g dbSNP:273585628
10498 10498 a, g dbSNP:758708056
10508 10508 c, t dbSNP:764305025
10512 10512 c, t dbSNP:751846178
10515 10515 c, t dbSNP:78022634
10516 10516 a, g dbSNP:781179587
10521 10521 a, c, g dbSNP:375672779
10527 10527 a, g dbSNP:774846173
10555 10555 c, g dbSNP:542510511
10565 10565 a, g dbSNP:554186104
10567 10567 c, t dbSNP:779982960
10572 10572 a, g dbSNP:191234581
10578 10578 c, t dbSNP:540197421
10590 10590 c, t dbSNP:564844058
10605 10605 c, t dbSNP:532215253
10615 10615 c, g dbSNP:544844686
10616 10616 a, g dbSNP:199610834
10618 10618 a, g dbSNP:753228322
10623 10623 c, t dbSNP:760186083
10624 10624 a, g dbSNP:57052487
10625 10625 c, t dbSNP:776001734
10626 10626 a, g dbSNP:548910839
10633 10633 a, g dbSNP:183149417
10656 10656 c, t dbSNP:527707590
10657 10657 a, g dbSNP:552510121
10660 10660 c, g dbSNP:757512156
10664 10664 a, c dbSNP:767728536
10678 10678 a, g dbSNP:750481489
10693 10693 c, g dbSNP:756152614
10711 10711 g, t dbSNP:199760004
10721 10721 c, t dbSNP:764764326
10722 10722 a, g dbSNP:753881778
10724 10724 a, g dbSNP:537930010
10748 10748 c, t dbSNP:778889305
10749 10749 a, g dbSNP:550409509
10754 10754 a, g dbSNP:568704426
10771 10771 a, c, g dbSNP:111494864
10772 10772 c, t dbSNP:777429612
10786 10786 c, t dbSNP:554588038
10787 10787 a, g dbSNP:746511029
10789 10789 a, g dbSNP:563548368
10796 10796 c, t dbSNP:770544807
10804 10804 c, t dbSNP:200668806
10805 10805 a, g dbSNP:758123475
10813 10813 g, t dbSNP:769122348
10816 10816 a, g dbSNP:533583323
10843 10843 c, t dbSNP:273585637
10846 10846 c, t dbSNP:142967775
10854 10854 a, g dbSNP:762107279
10864 10864 g, t dbSNP:767637123
10888 10888 c, g dbSNP:1105066
10891 10891 a, g dbSNP:3812951
10893 10893 a, g dbSNP:766526523
10901 10901 a, g dbSNP:562527410
10902 10902 a, c dbSNP:754994105
10905 10905 c, t dbSNP:575091053
10906 10906 a, g dbSNP:904783
10923 10923 c, t dbSNP:560637615
10924 10924 a, g dbSNP:527970445
10937 10937 c, t dbSNP:368960114
10949 10949 a, g dbSNP:781084356
10954 10954 a, t dbSNP:746733236
10967 10967 c, t dbSNP:770468538
10968 10968 a, g dbSNP:780722176
10976 10976 c, t dbSNP:745344513
10995 10995 c, g dbSNP:769163265
10997 10997 a, g dbSNP:552320342
11001 11001 c, t dbSNP:528519376
11002 11002 c, t dbSNP:551655104
11004 11004 a, t dbSNP:762301880
11006 11006 c, t dbSNP:772545154
11021 11021 c, t dbSNP:773423006
11022 11022 a, g dbSNP:372538769
11023 11023 a, g dbSNP:151127652
11040 11040 c, t dbSNP:753986673
11050 11050 a, g dbSNP:759634111
11052 11052 a, c dbSNP:765273961
11053 11053 c, t dbSNP:748126365
11079 11079 c, t dbSNP:758259528
11080 11080 a, g, t dbSNP:549874193
11101 11101 a, g dbSNP:273585629
11104 11104 c, t dbSNP:756967408
11116 11116 a, g dbSNP:568186734
11119 11119 a, g dbSNP:536054902
11137 11137 a, g dbSNP:745385522
11145 11145 c, g dbSNP:755687249
11154 11154 a, t dbSNP:779525596
11178 11178 c, t dbSNP:769834740
11179 11179 a, g dbSNP:548347344
11193 11193 c, t dbSNP:372634401
11194 11194 a, g dbSNP:547014159
11204 11204 c, g dbSNP:773654552
11208 11208 a, c dbSNP:747285771
11212 11212 c, g dbSNP:771295092
11222 11222 c, g dbSNP:776930117
11234 11234 a, g dbSNP:571622809
11237 11237 a, g dbSNP:765475094
11252 11252 a, g dbSNP:281165934
11264 11264 a, g dbSNP:775689897
11273 11273 c, g dbSNP:749325593
11276 11276 a, c dbSNP:762988622
11291 11291 a, g dbSNP:763899122
11317 11317 a, c dbSNP:751394494
11322 11322 a, c, t dbSNP:141042464
11325 11325 c, g dbSNP:150233193
11341 11341 a, g dbSNP:201834513
11352 11352 a, g dbSNP:537795437
11355 11355 c, g dbSNP:556316560
11370 11370 a, g dbSNP:377311926
11375 11375 g, t dbSNP:373034137
11419 11419 a, c, g dbSNP:574550673
11447 11447 c, t dbSNP:777126253
11450 11450 a, c dbSNP:746145535
11453 11453 a, g dbSNP:542091960
11461 11461 c, t dbSNP:770109867
11462 11462 a, g dbSNP:775672255
11477 11477 c, t dbSNP:560718586
11482 11482 c, t dbSNP:762894872
11483 11483 a, g dbSNP:187075195
11484 11484 c, t dbSNP:367547260
11485 11485 a, g dbSNP:371430688
11493 11493 a, g dbSNP:191554921
11495 11495 a, c dbSNP:767349224
11502 11502 c, g dbSNP:750184195
11508 11508 c, t dbSNP:760347312
11525 11525 c, t dbSNP:765964469
11530 11530 a, c dbSNP:753399570
11548 11548 c, g dbSNP:754381335
11549 11549 a, g dbSNP:531617542
11561 11561 c, t dbSNP:376013703
11562 11562 a, g dbSNP:534962147
11574 11574 -, t dbSNP:35531824
11574 11574 c, g dbSNP:182269913
11613 11613 a, c dbSNP:561879014
11615 11615 c, t dbSNP:273585630
11630 11630 c, t dbSNP:529322092
11639 11639 a, g dbSNP:760729082
11649 11649 c, g dbSNP:569775102
11661 11661 a, c dbSNP:770164776
11667 11667 a, c dbSNP:780082667
11672 11672 c, t dbSNP:749520338
11673 11673 a, g dbSNP:4782301
11675 11675 a, t dbSNP:188087134
11677 11677 -, cccacc dbSNP:757227922
11683 11683 c, t dbSNP:555406841
11684 11684 a, g dbSNP:577777350
11684 11684 c, g dbSNP:281165935
11687 11687 c, t dbSNP:139259830
11688 11688 a, g dbSNP:771953783
11692 11692 -, gag dbSNP:779142679
11692 11692 a, g dbSNP:773010511
11696 11696 -, acaccca dbSNP:746016112
11724 11724 c, t dbSNP:370915546
11738 11738 c, g dbSNP:766057875
11765 11765 a, c dbSNP:552446802
11766 11766 c, t dbSNP:753503425
11772 11772 c, t dbSNP:4782362
11786 11786 a, g dbSNP:45504291
11787 11787 a, g dbSNP:752224410
11803 11803 c, t dbSNP:757870827
11804 11804 a, g dbSNP:781746633
11814 11814 a, g dbSNP:556180135
11824 11824 a, c, t dbSNP:78600508
11825 11825 a, g dbSNP:749518886
11826 11826 c, g dbSNP:535536089
11848 11848 a, g dbSNP:541906245
11852 11852 a, c dbSNP:765856566
11867 11867 c, t dbSNP:554114091
11870 11870 c, t dbSNP:112273342
11895 11895 c, t dbSNP:751192653
11904 11904 c, t dbSNP:572612589
11905 11905 c, g dbSNP:754617170
11931 11931 a, g dbSNP:546035711
11943 11943 a, g dbSNP:781170964
11974 11974 a, g dbSNP:558044069
11993 11993 c, t dbSNP:576310853
11994 11994 a, g dbSNP:146964491
11996 11996 a, g dbSNP:137889724
12031 12031 g, t dbSNP:529386427
12042 12042 a, g dbSNP:193210256
12049 12049 a, t dbSNP:559540332
12050 12050 c, g dbSNP:777858202
12063 12063 c, t dbSNP:35994806
12084 12084 c, t dbSNP:749194753
12088 12088 c, t dbSNP:552052800
12099 12099 c, t dbSNP:367997421
12102 12102 c, t dbSNP:144138294
12103 12103 a, g dbSNP:531613870
12107 12107 c, t dbSNP:549851440
12136 12136 c, t dbSNP:568056144
12139 12139 c, g dbSNP:779013419
12150 12150 c, g dbSNP:763763225
12154 12154 c, t dbSNP:561775866
12156 12156 a, t dbSNP:535069029
12165 12165 a, g dbSNP:552550397
12198 12198 a, g dbSNP:45532839
12199 12199 g, t dbSNP:148260049
12235 12235 a, c dbSNP:3896672
12240 12240 c, g dbSNP:185208626
12257 12257 -, g dbSNP:767268168
12269 12269 c, t dbSNP:557906701
12270 12270 a, g dbSNP:190108769
12277 12277 a, g dbSNP:537339757
12296 12296 a, g dbSNP:563015267
12309 12309 a, c dbSNP:555600307
12325 12325 -, gcctcctccctctgaccacagggtcat dbSNP:3838248
12325 12325 g, t dbSNP:370886541
12354 12354 -, cctcctccctctgaccacagggtcatg dbSNP:150183251
12375 12375 g, t dbSNP:573980326
12377 12377 c, g dbSNP:146233624
12382 12382 -, tcctccctctgaccacagggtcatgcc dbSNP:6145934
12383 12383 ag, t dbSNP:386794007
12384 12384 g, t dbSNP:146538838
12396 12396 g, t dbSNP:3859020
12400 12400 c, t dbSNP:578023492
12412 12412 a, c dbSNP:74032868
12426 12426 c, t dbSNP:564270292
12427 12427 c, g dbSNP:561472955
12437 12437 a, g dbSNP:531681945
12443 12443 a, g dbSNP:75706884
12468 12468 a, g dbSNP:561920350
12482 12482 c, g dbSNP:528906158
12490 12490 a, g dbSNP:765836612
12491 12491 c, t dbSNP:751048783
12492 12492 a, g dbSNP:547061496
12502 12502 c, t dbSNP:372563659
12503 12503 a, g dbSNP:759170815
12531 12531 a, c dbSNP:139329995
12549 12549 a, g dbSNP:199513682
12550 12550 c, t dbSNP:539154916
12566 12566 a, g dbSNP:3894713
12623 12623 c, t dbSNP:7187709
12638 12638 -, t dbSNP:35684712
12647 12647 -, tt dbSNP:375918815
12651 12651 c, t dbSNP:537200439
12683 12683 g, t dbSNP:555660063
12685 12685 a, g dbSNP:1048192
12699 12699 -, g dbSNP:11382974
12708 12708 a, g dbSNP:772482116
12725 12725 a, g dbSNP:773393619
12726 12726 a, c dbSNP:535054186
12750 12750 c, t dbSNP:7196385
12779 12779 a, g dbSNP:3848234
12783 12783 a, g dbSNP:192750521
12800 12800 c, g dbSNP:146343053
12813 12813 a, g dbSNP:566779096
12835 12835 c, t dbSNP:778912495
12843 12843 a, g dbSNP:61736856
12849 12849 a, t dbSNP:536887736
12864 12864 a, g dbSNP:565707464
12870 12870 a, c, g dbSNP:562048163
12885 12885 a, c, t dbSNP:372569052
12889 12889 a, c dbSNP:529151428
12960 12960 a, g dbSNP:184099653
13003 13003 c, t dbSNP:559074687
13009 13009 c, t dbSNP:532726437
13010 13010 g, t dbSNP:551063996
13026 13026 c, t dbSNP:569382688
13080 13080 c, t dbSNP:758683459
13095 13095 c, g dbSNP:369207257
13100 13100 c, t dbSNP:549150844
13101 13101 a, g dbSNP:780254370
13110 13110 c, t dbSNP:188504260
13161 13161 c, t dbSNP:770868947
13169 13169 -, t dbSNP:35900533
13177 13177 a, g dbSNP:747172591
13191 13191 c, t dbSNP:535003390

Target ORF information:

RefSeq Version NM_001127464
Organism Homo sapiens (human)
Definition Homo sapiens zinc finger protein 469 (ZNF469), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu73627
Accession Version XM_011523386.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 11862bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product zinc finger protein 469 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010498.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)457..1719(+)
Misc Feature(2)1216..2622(+)
Misc Feature(3)3841..5082(+)
Misc Feature(4)5356..7269(+)
Misc Feature(5)6892..8235(+)
Misc Feature(6)7951..9516(+)
Misc Feature(7)9802..9864(+)
Misc Feature(8)9802..9864(+)
Misc Feature(9)9817..10044(+)
Misc Feature(10)9895..9939(+)
Misc Feature(11)9895..9936(+)
Misc Feature(12)9982..10044(+)
Misc Feature(13)9982..10044(+)
Misc Feature(14)10468..10530(+)
Misc Feature(15)10468..10530(+)
Misc Feature(16)10483..10770(+)
Misc Feature(17)10552..10647(+)
Misc Feature(18)10552..10644(+)
Misc Feature(19)10711..10773(+)
Misc Feature(20)10711..10773(+)
Misc Feature(21)10819..12267(+)
Position Chain Variation Link
1 1 c, t dbSNP:567268455
4 4 c, t dbSNP:534294881
5 5 a, g dbSNP:768188052
38 38 a, g dbSNP:147896262
78 78 a, g dbSNP:774876631
169 169 a, g dbSNP:550142323
192 192 a, g dbSNP:568322996
214 214 c, t dbSNP:535448418
215 215 a, g dbSNP:547053444
240 240 c, t dbSNP:190425908
252 252 a, g dbSNP:149128544
294 294 c, t dbSNP:538567133
297 297 c, t dbSNP:755378733
304 304 a, g dbSNP:550486567
318 318 a, g dbSNP:781357772
331 331 c, g dbSNP:563648318
353 353 a, g dbSNP:184639832
365 365 a, c dbSNP:542673017
371 371 a, g dbSNP:188198388
415 415 c, t dbSNP:750999813
416 416 a, g dbSNP:528607462
425 425 c, t dbSNP:766689830
426 426 a, g dbSNP:547114021
428 428 c, t dbSNP:559629715
429 429 a, g dbSNP:550573015
436 436 a, c dbSNP:568661500
445 445 a, g dbSNP:774913036
467 467 a, g dbSNP:762382027
477 477 a, g dbSNP:551558555
479 479 c, t dbSNP:569870332
483 483 a, g dbSNP:281165936
483 483 a, g dbSNP:750924473
489 489 a, c, g dbSNP:371091595
507 507 g, t dbSNP:766704042
514 514 c, t dbSNP:754101639
515 515 a, g dbSNP:145178398
530 530 c, g dbSNP:273585616
532 532 a, c dbSNP:567229543
534 534 a, g dbSNP:534464702
545 545 a, c dbSNP:779285670
551 551 c, t dbSNP:752770883
552 552 a, g dbSNP:273585631
569 569 c, t dbSNP:552640649
584 584 a, c dbSNP:577277281
588 588 c, t dbSNP:538850431
592 592 a, g dbSNP:138954293
599 599 a, g dbSNP:575883577
636 636 c, t dbSNP:746875261
639 639 a, g, t dbSNP:770775791
656 656 c, t dbSNP:780900228
663 663 c, t dbSNP:745660773
669 669 g, t dbSNP:543285355
701 701 c, t dbSNP:775103017
743 743 c, t dbSNP:273585617
744 744 a, g dbSNP:762564817
764 764 c, t dbSNP:768011450
780 780 a, g dbSNP:192479136
786 786 a, g dbSNP:761028591
787 787 a, g dbSNP:766853024
790 790 a, g dbSNP:281865144
802 802 c, g dbSNP:754318367
809 809 a, g dbSNP:759962057
833 833 c, t dbSNP:765601628
834 834 a, g dbSNP:116028037
855 855 c, t dbSNP:569036398
901 901 a, g dbSNP:565385445
910 910 a, c, g dbSNP:532620482
913 913 a, c dbSNP:757211390
917 917 c, g dbSNP:71394098
923 923 a, g dbSNP:781096189
924 924 c, g dbSNP:545236998
935 935 c, t dbSNP:769547100
944 944 a, c, t dbSNP:755989926
945 945 a, g dbSNP:563480285
972 972 c, g dbSNP:530740920
978 978 c, t dbSNP:773666313
979 979 a, g dbSNP:761379794
985 985 c, t dbSNP:771620429
986 986 c, t dbSNP:777251198
989 989 c, g dbSNP:760014906
1053 1053 c, t dbSNP:377475711
1054 1054 a, g dbSNP:765651977
1067 1067 a, c dbSNP:752980662
1076 1076 c, t dbSNP:549255859
1077 1077 a, g dbSNP:764375272
1080 1080 c, g, t dbSNP:113227277
1094 1094 a, g dbSNP:767484077
1096 1096 c, g dbSNP:750321195
1116 1116 c, t dbSNP:370275746
1127 1127 c, t dbSNP:528085500
1128 1128 a, c dbSNP:779765231
1129 1129 a, g dbSNP:546141859
1130 1130 a, c dbSNP:571025240
1142 1142 g, t dbSNP:554483098
1150 1150 a, g dbSNP:538330967
1156 1156 c, t dbSNP:557160829
1165 1165 a, g dbSNP:748253495
1167 1167 g, t dbSNP:771673417
1173 1173 a, g dbSNP:273585632
1176 1176 c, t dbSNP:150745096
1178 1178 g, t dbSNP:536586591
1179 1179 c, t dbSNP:555256402
1195 1195 c, t dbSNP:573414361
1197 1197 c, t dbSNP:775787434
1200 1200 a, g dbSNP:763365403
1202 1202 a, t dbSNP:764273631
1203 1203 c, t dbSNP:774602779
1204 1204 a, c dbSNP:540655479
1209 1209 a, c dbSNP:767535517
1210 1210 a, g dbSNP:750372510
1213 1213 a, g dbSNP:755977911
1218 1218 a, g dbSNP:766334275
1223 1223 a, c dbSNP:753630744
1225 1225 a, g dbSNP:558954436
1246 1246 a, g dbSNP:754776767
1259 1259 g, t dbSNP:775471773
1272 1272 c, t dbSNP:778467047
1286 1286 c, t dbSNP:577446263
1287 1287 c, g dbSNP:544693811
1298 1298 a, g dbSNP:757999676
1322 1322 c, t dbSNP:117501524
1323 1323 a, g dbSNP:746516114
1344 1344 c, g dbSNP:770483852
1350 1350 c, t dbSNP:776044690
1382 1382 a, g dbSNP:749656105
1383 1383 a, g dbSNP:533289994
1389 1389 a, g dbSNP:769026765
1390 1390 g, t dbSNP:774459354
1394 1394 c, t dbSNP:777666112
1395 1395 a, g dbSNP:767588443
1396 1396 a, g dbSNP:530720576
1399 1399 a, g dbSNP:368772806
1402 1402 a, g dbSNP:766274133
1404 1404 c, t dbSNP:561239255
1405 1405 a, g dbSNP:139066376
1412 1412 c, t dbSNP:765028361
1413 1413 a, g dbSNP:752405331
1416 1416 c, t dbSNP:758193918
1422 1422 a, c dbSNP:113483623
1427 1427 c, t dbSNP:546224574
1428 1428 a, g dbSNP:751166329
1440 1440 a, g dbSNP:756761096
1445 1445 c, t dbSNP:149485731
1449 1449 c, g dbSNP:532123606
1473 1473 c, t dbSNP:273585633
1490 1490 -, cccc dbSNP:148030358
1500 1500 c, g, t dbSNP:550642046
1501 1501 g, t dbSNP:568820656
1518 1518 a, c, g dbSNP:748505843
1522 1522 c, t dbSNP:11648572
1537 1537 c, t dbSNP:554839262
1541 1541 c, t dbSNP:771000169
1542 1542 c, g dbSNP:776451293
1543 1543 a, g dbSNP:759454921
1547 1547 a, c, t dbSNP:567183966
1548 1548 a, g dbSNP:534477237
1551 1551 a, c, t dbSNP:11640794
1564 1564 a, g dbSNP:774539844
1583 1583 c, t dbSNP:756739680
1596 1596 a, c dbSNP:74032864
1620 1620 -, tgggc dbSNP:779228663
1635 1635 a, g dbSNP:538381325
1642 1642 c, t dbSNP:754305342
1661 1661 a, g dbSNP:560397272
1677 1677 a, g dbSNP:556627507
1717 1717 a, c dbSNP:574791859
1728 1728 c, t dbSNP:779376868
1738 1738 a, g dbSNP:113937803
1756 1756 a, g dbSNP:772392648
1800 1800 a, c dbSNP:777999978
1816 1816 a, c dbSNP:560911127
1850 1850 c, g dbSNP:572830358
1859 1859 c, g dbSNP:770926082
1871 1871 a, g dbSNP:775578805
1897 1897 c, t dbSNP:540133783
1902 1902 g, t dbSNP:776840891
1919 1919 c, t dbSNP:759524656
1920 1920 a, g dbSNP:769822891
1924 1924 a, g dbSNP:117555121
1936 1936 c, t dbSNP:202205643
1941 1941 a, c dbSNP:763933273
1942 1942 a, g dbSNP:28723506
1952 1952 c, t dbSNP:761461530
1960 1960 c, t dbSNP:767072775
1961 1961 a, g dbSNP:550263442
1975 1975 a, g dbSNP:750005577
1977 1977 -, g dbSNP:200675426
1981 1981 a, g dbSNP:755555951
1982 1982 c, g dbSNP:7199961
2000 2000 c, g dbSNP:753160761
2003 2003 a, g dbSNP:758781186
2005 2005 c, t dbSNP:778051482
2037 2037 a, g dbSNP:143852982
2062 2062 a, g dbSNP:184458982
2068 2068 a, t dbSNP:189476639
2080 2080 a, g dbSNP:281865145
2107 2107 a, g dbSNP:769955501
2114 2114 a, c dbSNP:775591971
2116 2116 a, g dbSNP:749179728
2142 2142 c, t dbSNP:751136702
2143 2143 c, g dbSNP:768576385
2146 2146 a, g dbSNP:774268255
2150 2150 c, t dbSNP:181785233
2151 2151 c, t dbSNP:767246206
2154 2154 g, t dbSNP:281165932
2172 2172 c, t dbSNP:552893295
2194 2194 c, t dbSNP:760259912
2195 2195 c, g dbSNP:765823220
2196 2196 a, g dbSNP:753212011
2221 2221 a, g dbSNP:571115191
2226 2226 c, t dbSNP:764574730
2228 2228 c, t dbSNP:538240075
2229 2229 a, g dbSNP:12927001
2234 2234 c, t dbSNP:757534069
2235 2235 a, g, t dbSNP:574891457
2240 2240 c, t dbSNP:756276800
2250 2250 c, t dbSNP:780217260
2252 2252 c, t dbSNP:749374208
2253 2253 a, g dbSNP:768772320
2254 2254 g, t dbSNP:778691885
2262 2262 c, t dbSNP:748014455
2270 2270 c, t dbSNP:771721358
2280 2280 a, g dbSNP:148616993
2282 2282 c, t dbSNP:369993792
2292 2292 c, t dbSNP:770428996
2319 2319 a, g dbSNP:776185811
2323 2323 a, c, g dbSNP:759028761
2331 2331 c, t dbSNP:751974223
2340 2340 c, t dbSNP:762262311
2349 2349 a, g dbSNP:554795578
2352 2352 -, ctt dbSNP:746110444
2364 2364 a, g dbSNP:373169260
2366 2366 c, t dbSNP:572690908
2385 2385 c, g dbSNP:539996728
2406 2406 a, g dbSNP:564837770
2411 2411 a, c dbSNP:780409854
2414 2414 c, g, t dbSNP:754019937
2427 2427 -, c dbSNP:57752057
2430 2430 c, g dbSNP:778939804
2432 2432 a, t dbSNP:747984776
2439 2439 c, g dbSNP:771912038
2447 2447 c, t dbSNP:184583062
2449 2449 c, g dbSNP:746798998
2470 2470 a, g dbSNP:770623245
2471 2471 c, g dbSNP:776239249
2486 2486 a, c dbSNP:759081607
2487 2487 c, t dbSNP:58401704
2488 2488 a, g dbSNP:551591362
2495 2495 c, t dbSNP:762160933
2516 2516 a, c dbSNP:281865146
2527 2527 a, c dbSNP:529827333
2538 2538 c, t dbSNP:74547407
2539 2539 a, g dbSNP:761098712
2565 2565 c, t dbSNP:766745848
2572 2572 c, t dbSNP:188954563
2580 2580 a, g dbSNP:527898359
2583 2583 c, t dbSNP:12918876
2585 2585 c, g dbSNP:571184307
2596 2596 c, t dbSNP:758331281
2616 2616 c, t dbSNP:538121526
2621 2621 c, g dbSNP:777747160
2631 2631 a, g dbSNP:746849844
2637 2637 c, t dbSNP:757009906
2666 2666 a, g dbSNP:780848959
2718 2718 c, g dbSNP:745465850
2719 2719 c, t dbSNP:769351837
2721 2721 c, t dbSNP:550176820
2723 2723 g, t dbSNP:753664726
2750 2750 a, g dbSNP:144492145
2784 2784 c, t dbSNP:773822941
2785 2785 a, g dbSNP:761152033
2788 2788 a, g dbSNP:568359965
2798 2798 c, t dbSNP:535983876
2823 2823 a, g dbSNP:147859144
2826 2826 c, t dbSNP:759606452
2832 2832 c, t dbSNP:570471039
2834 2834 c, t dbSNP:565787076
2840 2840 c, t dbSNP:752775388
2855 2855 c, g dbSNP:745770324
2859 2859 c, t dbSNP:758477114
2860 2860 g, t dbSNP:113484918
2884 2884 c, t dbSNP:751453279
2887 2887 c, t dbSNP:745749813
2901 2901 c, t dbSNP:780898205
2916 2916 c, t dbSNP:745660819
2928 2928 c, t dbSNP:755782224
2930 2930 c, t dbSNP:772056680
2931 2931 g, t dbSNP:273585634
2938 2938 a, g dbSNP:748786439
2939 2939 c, t dbSNP:768172449
2942 2942 c, g dbSNP:773878123
2964 2964 c, g dbSNP:747457964
2993 2993 c, t dbSNP:558293585
2994 2994 a, g dbSNP:777200054
2997 2997 c, t dbSNP:759928652
3000 3000 c, g dbSNP:765421239
3025 3025 a, c dbSNP:181719686
3027 3027 c, g dbSNP:74384633
3040 3040 a, t dbSNP:764106193
3058 3058 a, g dbSNP:751502450
3060 3060 a, g dbSNP:757252816
3073 3073 -, tccggccccagaggtcccagc dbSNP:113102840
3085 3085 a, g dbSNP:556173403
3096 3096 c, g dbSNP:273585635
3105 3105 c, t dbSNP:767431034
3106 3106 c, g dbSNP:139653501
3119 3119 c, t dbSNP:145186655
3122 3122 a, g dbSNP:779602484
3124 3124 a, g dbSNP:753481187
3146 3146 c, t dbSNP:754458926
3152 3152 c, g, t dbSNP:273585618
3153 3153 c, g dbSNP:747652441
3160 3160 a, g dbSNP:771622085
3170 3170 c, t dbSNP:77951481
3181 3181 a, g dbSNP:746253538
3182 3182 c, g, t dbSNP:770131798
3183 3183 c, g dbSNP:546435811
3184 3184 c, t dbSNP:775593194
3197 3197 a, t dbSNP:763172050
3203 3203 c, g dbSNP:768862670
3213 3213 c, t dbSNP:774473762
3221 3221 a, g dbSNP:566719722
3242 3242 a, c, g dbSNP:564654481
3256 3256 a, g dbSNP:117995699
3257 3257 a, g dbSNP:773608978
3263 3263 a, t dbSNP:550198026
3264 3264 a, t dbSNP:377534548
3265 3265 a, g dbSNP:760409743
3267 3267 a, g dbSNP:140480823
3294 3294 a, g dbSNP:150435442
3316 3316 c, t dbSNP:754739533
3325 3325 a, c dbSNP:778692904
3326 3326 c, t dbSNP:370402083
3330 3330 c, t dbSNP:752301003
3333 3333 c, g dbSNP:757944441
3357 3357 -, gtcggg dbSNP:281865147
3361 3361 -, ggcggc dbSNP:775423936
3366 3366 a, c dbSNP:60462217
3374 3374 a, g dbSNP:565851013
3377 3377 c, t dbSNP:746332381
3382 3382 a, g dbSNP:770061832
3384 3384 c, t dbSNP:539527724
3398 3398 a, g dbSNP:558361075
3403 3403 g, t dbSNP:768917926
3480 3480 a, g dbSNP:186499941
3499 3499 g, t dbSNP:774526856
3520 3520 a, c dbSNP:761910925
3523 3523 a, g dbSNP:772088854
3535 3535 c, g dbSNP:538182235
3544 3544 c, t dbSNP:773036378
3548 3548 a, c dbSNP:556195040
3553 3553 a, g dbSNP:766218970
3561 3561 a, c dbSNP:574630552
3562 3562 a, t dbSNP:753720576
3564 3564 g, t dbSNP:12927115
3570 3570 g, t dbSNP:759380807
3572 3572 a, c dbSNP:273585619
3574 3574 a, g dbSNP:191396489
3578 3578 a, g dbSNP:181077813
3589 3589 c, t dbSNP:572206377
3606 3606 c, t dbSNP:9924504
3622 3622 a, c dbSNP:751031024
3623 3623 -, aga dbSNP:760578785
3636 3636 c, t dbSNP:756703220
3648 3648 a, g dbSNP:780404491
3659 3659 c, t dbSNP:749693950
3663 3663 a, c dbSNP:755295096
3666 3666 g, t dbSNP:564742614
3669 3669 c, t dbSNP:779127073
3693 3693 c, t dbSNP:748311445
3695 3695 g, t dbSNP:772048474
3700 3700 a, g dbSNP:773405012
3731 3731 a, g dbSNP:533979613
3747 3747 -, cgaggagga dbSNP:768453073
3753 3753 a, g dbSNP:760454346
3759 3759 a, g dbSNP:543947244
3773 3773 a, g dbSNP:281865148
3774 3774 a, g dbSNP:763826959
3779 3779 c, t dbSNP:562264117
3785 3785 c, t dbSNP:765069829
3794 3794 c, g, t dbSNP:568046708
3803 3803 c, g dbSNP:757120684
3860 3860 a, g dbSNP:763640994
3874 3874 g, t dbSNP:547419772
3881 3881 g, t dbSNP:367683886
3886 3886 -, gaa dbSNP:776668013
3890 3890 c, t dbSNP:756692377
3893 3893 a, g dbSNP:766943377
3901 3901 c, g dbSNP:754292270
3905 3905 c, t dbSNP:755348435
3911 3911 c, t dbSNP:779180717
3915 3915 c, t dbSNP:748507690
3925 3925 a, c, t dbSNP:184894059
3933 3933 a, g dbSNP:747150324
3948 3948 c, g dbSNP:770873172
3952 3952 a, g dbSNP:776725237
3957 3957 c, t dbSNP:533300920
3959 3959 c, t dbSNP:769853271
3969 3969 c, t dbSNP:111557381
3973 3973 a, c dbSNP:762820212
3975 3975 a, g dbSNP:9938800
3993 3993 a, g dbSNP:537650415
4003 4003 a, g dbSNP:553460850
4004 4004 c, g dbSNP:773837873
4017 4017 c, g dbSNP:761406489
4018 4018 a, c dbSNP:766878740
4020 4020 a, c dbSNP:754347295
4021 4021 a, g dbSNP:7197071
4034 4034 a, g dbSNP:765714860
4047 4047 a, c dbSNP:753105781
4051 4051 a, c dbSNP:758656171
4054 4054 g, t dbSNP:758315492
4060 4060 c, t dbSNP:778085437
4101 4101 a, c dbSNP:568281394
4103 4103 c, t dbSNP:115183769
4118 4118 c, t dbSNP:553831899
4125 4125 c, g dbSNP:757366332
4151 4151 a, g dbSNP:781493176
4160 4160 c, g dbSNP:745934280
4167 4167 c, t dbSNP:572061351
4202 4202 c, t dbSNP:539399156
4203 4203 c, g, t dbSNP:557569932
4204 4204 a, g dbSNP:768287765
4205 4205 c, t dbSNP:190928557
4211 4211 c, t dbSNP:761304483
4212 4212 g, t dbSNP:543669472
4221 4221 a, g dbSNP:771706762
4226 4226 a, c dbSNP:141255631
4243 4243 a, g dbSNP:760152717
4272 4272 g, t dbSNP:765769896
4276 4276 a, g dbSNP:753159087
4287 4287 c, t dbSNP:763396048
4295 4295 c, g dbSNP:764302046
4320 4320 c, t dbSNP:751952704
4323 4323 c, t dbSNP:574020033
4328 4328 c, g dbSNP:183126539
4343 4343 a, g dbSNP:750571274
4347 4347 a, c, g dbSNP:115790991
4348 4348 a, g dbSNP:533167413
4364 4364 a, g dbSNP:749120381
4371 4371 a, g dbSNP:768501538
4372 4372 -, a dbSNP:777337062