Email to GenScript

RBM17 RNA binding motif protein 17 [Homo sapiens (human)]

Gene Symbol RBM17
Entrez Gene ID 84991
Full Name RNA binding motif protein 17
Synonyms SPF45
General protein information
Preferred Names
splicing factor 45
splicing factor 45
splicing factor 45kDa
45 kDa-splicing factor
RNA-binding motif protein 17
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]. lac of sum
Disorder MIM:


Disorder Html:

The following RBM17 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the RBM17 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu11266 NM_032905 Homo sapiens RNA binding motif protein 17 (RBM17), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu11266 NM_001145547 Homo sapiens RNA binding motif protein 17 (RBM17), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu11266
Accession Version NM_032905.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1206bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product splicing factor 45
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CV570433.1, AF542550.1, CN291330.1, AL157395.17 and AA905075.1. On Mar 5, 2009 this sequence version replaced gi:40255242. Summary: This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]. Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF542550.1, BC007871.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)212..214(+)
Misc Feature(2)230..232(+)
Misc Feature(3)287..289(+)
Misc Feature(4)437..439(+)
Misc Feature(5)437..439(+)
Misc Feature(6)689..691(+)
Misc Feature(7)689..691(+)
Misc Feature(8)731..733(+)
Misc Feature(9)890..892(+)
Misc Feature(10)905..907(+)
Misc Feature(11)911..913(+)
Misc Feature(12)923..1063(+)
Misc Feature(13)1133..1417(+)
Exon (1)1..208
Gene Synonym:
Exon (2)209..349
Gene Synonym:
Exon (3)350..466
Gene Synonym:
Exon (4)467..633
Gene Synonym:
Exon (5)634..731
Gene Synonym:
Exon (6)732..788
Gene Synonym:
Exon (7)789..930
Gene Synonym:
Exon (8)931..1082
Gene Synonym:
Exon (9)1083..1156
Gene Synonym:
Exon (10)1157..1255
Gene Synonym:
Exon (11)1256..1328
Gene Synonym:
Exon (12)1329..3335
Gene Synonym:
Position Chain Variation Link
31 31 c, t dbSNP:556917481
37 37 c, t dbSNP:575271689
41 41 c, g dbSNP:543343599
59 59 a, c dbSNP:3750668
81 81 g, t dbSNP:3750669
94 94 a, g dbSNP:140764661
122 122 c, g dbSNP:541180664
134 134 c, g dbSNP:112177726
135 135 c, g dbSNP:529791063
226 226 a, g, t dbSNP:201560984
235 235 g, t dbSNP:200271626
238 238 c, t dbSNP:369487973
239 239 a, g dbSNP:754791552
240 240 a, g dbSNP:778801739
245 245 c, t dbSNP:115013140
257 257 a, c dbSNP:369073008
266 266 g, t dbSNP:757842585
274 274 a, g dbSNP:777403381
280 280 a, c dbSNP:746517584
286 286 a, c, t dbSNP:770552951
295 295 c, t dbSNP:749618542
360 360 c, t dbSNP:758301231
361 361 c, g dbSNP:199867166
368 368 a, g dbSNP:746490028
394 394 c, t dbSNP:756737526
404 404 a, g, t dbSNP:780966136
414 414 c, t dbSNP:780000465
423 423 a, g dbSNP:377370168
438 438 c, g dbSNP:748535463
439 439 c, t dbSNP:772561719
441 441 c, t dbSNP:773621306
442 442 a, g dbSNP:369146616
443 443 c, t dbSNP:766411097
444 444 c, t dbSNP:373376643
445 445 a, c, g dbSNP:145617186
462 462 g, t dbSNP:765462755
473 473 a, g dbSNP:769966706
477 477 a, c dbSNP:775714728
479 479 a, g dbSNP:762783739
491 491 g, t dbSNP:763831757
497 497 c, g dbSNP:751506838
500 500 c, g dbSNP:761709664
508 508 a, t dbSNP:767576511
520 520 c, t dbSNP:376024631
523 523 a, g dbSNP:144792859
529 529 c, t dbSNP:779802362
533 533 a, g dbSNP:753474883
534 534 c, t dbSNP:758786664
536 536 c, t dbSNP:200872049
538 538 g, t dbSNP:377701497
547 547 a, t dbSNP:778058356
557 557 a, g dbSNP:747414195
560 560 a, c, g dbSNP:771365351
567 567 a, g, t dbSNP:770290110
571 571 a, g dbSNP:775748075
589 589 a, g, t dbSNP:201913283
592 592 a, g dbSNP:768480966
594 594 a, g dbSNP:773958740
616 616 a, g dbSNP:761703891
620 620 c, g dbSNP:767521350
632 632 -, aacagc dbSNP:759418544
637 637 a, g dbSNP:760754830
639 639 a, g dbSNP:780062896
651 651 a, g dbSNP:775938505
661 661 c, t dbSNP:550604843
663 663 g, t dbSNP:759121037
666 666 g, t dbSNP:747217457
668 668 a, g dbSNP:764751483
673 673 a, g dbSNP:752445161
703 703 a, g, t dbSNP:147926684
714 714 a, g dbSNP:371677234
715 715 a, g dbSNP:200934845
718 718 c, g dbSNP:756550580
739 739 c, t dbSNP:201553512
752 752 -, c dbSNP:780026372
752 752 c, g dbSNP:754980855
758 758 c, t dbSNP:141782513
760 760 a, c dbSNP:12264240
767 767 c, t dbSNP:758626686
783 783 a, g dbSNP:368547331
784 784 a, g dbSNP:760886159
792 792 c, t dbSNP:752785300
793 793 c, t dbSNP:144970605
795 795 a, g dbSNP:778122809
800 800 a, t dbSNP:751873508
808 808 c, t dbSNP:45575732
832 832 a, g dbSNP:549032031
841 841 c, t dbSNP:578156086
843 843 a, g dbSNP:149022692
845 845 c, g dbSNP:769701493
859 859 c, t dbSNP:779994101
865 865 a, g dbSNP:748746777
868 868 c, t dbSNP:766470471
872 872 a, g dbSNP:372850758
873 873 a, g dbSNP:538717999
885 885 c, t dbSNP:768204127
886 886 a, g dbSNP:554139795
897 897 c, t dbSNP:376906335
898 898 c, t dbSNP:61731884
904 904 c, t dbSNP:776989803
925 925 c, t dbSNP:759849907
931 931 a, g dbSNP:547712079
943 943 a, g dbSNP:148263630
952 952 c, t dbSNP:536478330
957 957 a, g dbSNP:776141370
964 964 c, t dbSNP:763616118
970 970 c, t dbSNP:764707987
985 985 c, t dbSNP:554776074
988 988 a, g dbSNP:761827908
997 997 c, t dbSNP:771676898
1015 1015 c, g, t dbSNP:576220786
1041 1041 a, g dbSNP:766228705
1043 1043 c, t dbSNP:753761759
1048 1048 c, t dbSNP:754844495
1054 1054 a, g dbSNP:778747218
1060 1060 c, t dbSNP:747646881
1061 1061 a, g dbSNP:757896052
1066 1066 c, t dbSNP:12242912
1069 1069 c, t dbSNP:199584750
1070 1070 a, g dbSNP:770273356
1073 1073 a, g dbSNP:569161504
1097 1097 g, t dbSNP:778274713
1098 1098 c, t dbSNP:372269055
1111 1111 a, g dbSNP:771040329
1130 1130 c, t dbSNP:145588908
1137 1137 c, g dbSNP:138018241
1147 1147 c, t dbSNP:746137541
1155 1155 c, g dbSNP:770072476
1171 1171 a, g dbSNP:376554220
1174 1174 a, g dbSNP:17853923
1201 1201 a, g dbSNP:201622570
1204 1204 c, t dbSNP:369303270
1230 1230 a, c, g dbSNP:775801085
1243 1243 c, t dbSNP:367726864
1262 1262 a, g dbSNP:772094602
1267 1267 c, g, t dbSNP:773251313
1280 1280 a, g dbSNP:770542588
1285 1285 a, g dbSNP:776136842
1333 1333 a, c, t dbSNP:545371322
1342 1342 g, t dbSNP:76409649
1348 1348 c, g dbSNP:775168507
1351 1351 a, g dbSNP:762130216
1363 1363 a, g dbSNP:201006751
1382 1382 c, t dbSNP:200401715
1408 1408 c, g dbSNP:767988771
1411 1411 c, g dbSNP:750879262
1438 1438 a, g dbSNP:761185439
1442 1442 c, t dbSNP:766799906
1450 1450 c, t dbSNP:374530909
1451 1451 a, g dbSNP:533871531
1453 1453 a, g dbSNP:765526002
1454 1454 a, t dbSNP:753036509
1461 1461 c, t dbSNP:368514558
1462 1462 a, g dbSNP:758256868
1479 1479 c, g dbSNP:777569195
1480 1480 c, t dbSNP:372768874
1481 1481 a, g, t dbSNP:746787260
1484 1484 a, g dbSNP:781017607
1517 1517 a, c dbSNP:182468817
1523 1523 a, t dbSNP:572775066
1534 1534 a, c dbSNP:772735510
1548 1548 a, g dbSNP:748829498
1553 1553 c, t dbSNP:1053169
1567 1567 a, g dbSNP:41295367
1572 1572 a, g dbSNP:561504050
1595 1595 c, t dbSNP:528958452
1600 1600 g, t dbSNP:544021527
1605 1605 c, t dbSNP:778824935
1620 1620 a, t dbSNP:562594558
1693 1693 c, t dbSNP:116000625
1746 1746 a, c dbSNP:11256838
1748 1748 -, taaaa dbSNP:746797958
1748 1748 -, taaa dbSNP:567140815
1749 1749 -, aaaaa dbSNP:199883895
1749 1749 -, aaaa dbSNP:532107223
1749 1749 -, aaa dbSNP:139904764
1750 1750 -, aaaa dbSNP:762111309
1751 1751 -, aaa dbSNP:773128668
1767 1767 -, aaaa dbSNP:71390125
1768 1768 -, aaa dbSNP:550997106
1769 1769 -, aa dbSNP:71706603
1793 1793 a, g dbSNP:745899727
1810 1810 -, tt dbSNP:772294822
1814 1814 -, tttttc dbSNP:775790217
1819 1819 c, t dbSNP:375866296
1841 1841 a, c dbSNP:551333444
1844 1844 a, g dbSNP:58815069
1845 1845 a, t dbSNP:147738404
1871 1871 c, t dbSNP:191815157
1880 1880 a, g dbSNP:759331587
1910 1910 a, c dbSNP:184053604
1911 1911 a, c dbSNP:538427351
1953 1953 a, g dbSNP:556419701
1983 1983 a, g dbSNP:142640725
2000 2000 a, c dbSNP:768892787
2023 2023 c, t dbSNP:571693411
2031 2031 a, g dbSNP:540741085
2079 2079 -, g dbSNP:777102370
2143 2143 c, g dbSNP:12785001
2145 2145 a, g dbSNP:12765799
2149 2149 c, t dbSNP:538679036
2176 2176 g, t dbSNP:12776352
2196 2196 a, g dbSNP:12770185
2198 2198 c, t dbSNP:12776374
2212 2212 g, t dbSNP:12776385
2215 2215 a, c dbSNP:12785040
2227 2227 g, t dbSNP:554102948
2230 2230 a, t dbSNP:762195946
2240 2240 g, t dbSNP:74417594
2284 2284 c, t dbSNP:540089172
2299 2299 c, t dbSNP:74945871
2309 2309 a, g dbSNP:111856216
2321 2321 a, g dbSNP:573541061
2325 2325 a, g dbSNP:8463
2374 2374 a, g dbSNP:562469907
2381 2381 c, t dbSNP:533016162
2390 2390 a, t dbSNP:529296036
2408 2408 a, g dbSNP:544692670
2466 2466 a, g dbSNP:750470572
2475 2475 a, c dbSNP:146679743
2478 2478 a, g dbSNP:527281102
2488 2488 c, t dbSNP:78718801
2491 2491 g, t dbSNP:766509056
2498 2498 c, t dbSNP:151310683
2502 2502 a, g dbSNP:376773469
2526 2526 a, g dbSNP:369503881
2566 2566 a, g dbSNP:184663863
2595 2595 a, g dbSNP:554238997
2670 2670 c, t dbSNP:371881157
2671 2671 a, g dbSNP:187083253
2686 2686 -, at dbSNP:767017985
2696 2696 a, g dbSNP:539083584
2718 2718 g, t dbSNP:752341223
2719 2719 c, t dbSNP:79834124
2723 2723 -, att dbSNP:370165913
2778 2778 a, g dbSNP:114811047
2865 2865 a, g dbSNP:565782642
2902 2902 g, t dbSNP:76367377
2912 2912 a, c dbSNP:78266224
2920 2920 a, c dbSNP:369740665
2926 2926 -, tgcca dbSNP:199762049
2928 2928 -, c, ccatgctgaatgttaacaagga dbSNP:140820180
2930 2930 -, catgctgaatgttaacaaggac, catgctgaatgttaacaaggacta, tt dbSNP:41295369
2930 2930 a, c, t dbSNP:139950275
2931 2931 -, aacaaggacta dbSNP:547314988
2931 2931 a, t dbSNP:41295371
2932 2932 g, t dbSNP:202158025
2933 2933 c, t dbSNP:142541115
2961 2961 c, t dbSNP:192954794
3011 3011 c, t dbSNP:537664793
3052 3052 c, g dbSNP:753704119
3060 3060 a, t dbSNP:556288146
3067 3067 c, t dbSNP:577673001
3084 3084 c, t dbSNP:376494989
3106 3106 c, t dbSNP:547354890
3109 3109 c, g dbSNP:781551249
3110 3110 g, t dbSNP:753033067
3113 3113 c, g dbSNP:184142453
3125 3125 c, t dbSNP:558593038
3128 3128 c, t dbSNP:41295373
3137 3137 g, t dbSNP:189468387
3151 3151 a, t dbSNP:140193102
3158 3158 -, ac dbSNP:536022716
3303 3303 -, a dbSNP:572365472
3310 3310 -, tatg dbSNP:758035390

Target ORF information:

RefSeq Version NM_032905
Organism Homo sapiens (human)
Definition Homo sapiens RNA binding motif protein 17 (RBM17), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11266
Accession Version NM_001145547.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1206bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product splicing factor 45
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC039322.1, AL157395.17, AF542550.1, CN291330.1 and AA905075.1. Summary: This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC039322.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2144333 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)630..632(+)
Misc Feature(2)648..650(+)
Misc Feature(3)705..707(+)
Misc Feature(4)855..857(+)
Misc Feature(5)1107..1109(+)
Misc Feature(6)1149..1151(+)
Misc Feature(7)1308..1310(+)
Misc Feature(8)1341..1481(+)
Misc Feature(9)1551..1835(+)
Exon (1)1..626
Gene Synonym:
Exon (2)627..767
Gene Synonym:
Exon (3)768..884
Gene Synonym:
Exon (4)885..1051
Gene Synonym:
Exon (5)1052..1149
Gene Synonym:
Exon (6)1150..1206
Gene Synonym:
Exon (7)1207..1348
Gene Synonym:
Exon (8)1349..1500
Gene Synonym:
Exon (9)1501..1574
Gene Synonym:
Exon (10)1575..1673
Gene Synonym:
Exon (11)1674..1746
Gene Synonym:
Exon (12)1747..3753
Gene Synonym:
Position Chain Variation Link
4 4 a, c dbSNP:76943221
19 19 g, t dbSNP:535021391
38 38 c, g dbSNP:577563332
78 78 g, t dbSNP:12261535
79 79 g, t dbSNP:568345136
103 103 -, tcc dbSNP:151234895
104 104 -, tcc dbSNP:781266501
106 106 -, tcc dbSNP:754451462
112 112 c, g dbSNP:535541293
120 120 -, ctc dbSNP:78296807
129 129 c, t dbSNP:192335669
140 140 g, t dbSNP:185693865
149 149 a, g dbSNP:575231136
156 156 c, t dbSNP:781771535
158 158 c, t dbSNP:539775301
167 167 c, t dbSNP:557877181
186 186 c, t dbSNP:763812968
188 188 a, c dbSNP:190568974
191 191 c, t dbSNP:769329360
252 252 c, t dbSNP:772642063
271 271 c, t dbSNP:375228361
273 273 g, t dbSNP:748969091
287 287 c, g dbSNP:540993332
303 303 c, t dbSNP:559571236
308 308 c, g dbSNP:574725755
319 319 c, t dbSNP:4749964
333 333 c, t dbSNP:193080347
359 359 c, t dbSNP:530527524
368 368 c, t dbSNP:757211475
390 390 g, t dbSNP:11256662
426 426 c, g dbSNP:563950138
439 439 c, t dbSNP:750551874
455 455 g, t dbSNP:377311599
496 496 c, t dbSNP:185287479
529 529 g, t dbSNP:548742498
531 531 a, g dbSNP:78205728
546 546 c, t dbSNP:547014901
556 556 c, t dbSNP:758589099
567 567 a, g dbSNP:12219946
584 584 c, g, t dbSNP:61839683
585 585 c, t dbSNP:766710961
602 602 a, g dbSNP:547678832
644 644 a, g, t dbSNP:201560984
653 653 g, t dbSNP:200271626
656 656 c, t dbSNP:369487973
657 657 a, g dbSNP:754791552
658 658 a, g dbSNP:778801739
663 663 c, t dbSNP:115013140
675 675 a, c dbSNP:369073008
684 684 g, t dbSNP:757842585
692 692 a, g dbSNP:777403381
698 698 a, c dbSNP:746517584
704 704 a, c, t dbSNP:770552951
713 713 c, t dbSNP:749618542
778 778 c, t dbSNP:758301231
779 779 c, g dbSNP:199867166
786 786 a, g dbSNP:746490028
812 812 c, t dbSNP:756737526
822 822 a, g, t dbSNP:780966136
832 832 c, t dbSNP:780000465
841 841 a, g dbSNP:377370168
856 856 c, g dbSNP:748535463
857 857 c, t dbSNP:772561719
859 859 c, t dbSNP:773621306
860 860 a, g dbSNP:369146616
861 861 c, t dbSNP:766411097
862 862 c, t dbSNP:373376643
863 863 a, c, g dbSNP:145617186
880 880 g, t dbSNP:765462755
891 891 a, g dbSNP:769966706
895 895 a, c dbSNP:775714728
897 897 a, g dbSNP:762783739
909 909 g, t dbSNP:763831757
915 915 c, g dbSNP:751506838
918 918 c, g dbSNP:761709664
926 926 a, t dbSNP:767576511
938 938 c, t dbSNP:376024631
941 941 a, g dbSNP:144792859
947 947 c, t dbSNP:779802362
951 951 a, g dbSNP:753474883
952 952 c, t dbSNP:758786664
954 954 c, t dbSNP:200872049
956 956 g, t dbSNP:377701497
965 965 a, t dbSNP:778058356
975 975 a, g dbSNP:747414195
978 978 a, c, g dbSNP:771365351
985 985 a, g, t dbSNP:770290110
989 989 a, g dbSNP:775748075
1007 1007 a, g, t dbSNP:201913283
1010 1010 a, g dbSNP:768480966
1012 1012 a, g dbSNP:773958740
1034 1034 a, g dbSNP:761703891
1038 1038 c, g dbSNP:767521350
1050 1050 -, aacagc dbSNP:759418544
1055 1055 a, g dbSNP:760754830
1057 1057 a, g dbSNP:780062896
1069 1069 a, g dbSNP:775938505
1079 1079 c, t dbSNP:550604843
1081 1081 g, t dbSNP:759121037
1084 1084 g, t dbSNP:747217457
1086 1086 a, g dbSNP:764751483
1091 1091 a, g dbSNP:752445161
1121 1121 a, g, t dbSNP:147926684
1132 1132 a, g dbSNP:371677234
1133 1133 a, g dbSNP:200934845
1136 1136 c, g dbSNP:756550580
1157 1157 c, t dbSNP:201553512
1170 1170 -, c dbSNP:780026372
1170 1170 c, g dbSNP:754980855
1176 1176 c, t dbSNP:141782513
1178 1178 a, c dbSNP:12264240
1185 1185 c, t dbSNP:758626686
1201 1201 a, g dbSNP:368547331
1202 1202 a, g dbSNP:760886159
1210 1210 c, t dbSNP:752785300
1211 1211 c, t dbSNP:144970605
1213 1213 a, g dbSNP:778122809
1218 1218 a, t dbSNP:751873508
1226 1226 c, t dbSNP:45575732
1250 1250 a, g dbSNP:549032031
1259 1259 c, t dbSNP:578156086
1261 1261 a, g dbSNP:149022692
1263 1263 c, g dbSNP:769701493
1277 1277 c, t dbSNP:779994101
1283 1283 a, g dbSNP:748746777
1286 1286 c, t dbSNP:766470471
1290 1290 a, g dbSNP:372850758
1291 1291 a, g dbSNP:538717999
1303 1303 c, t dbSNP:768204127
1304 1304 a, g dbSNP:554139795
1315 1315 c, t dbSNP:376906335
1316 1316 c, t dbSNP:61731884
1322 1322 c, t dbSNP:776989803
1343 1343 c, t dbSNP:759849907
1349 1349 a, g dbSNP:547712079
1361 1361 a, g dbSNP:148263630
1370 1370 c, t dbSNP:536478330
1375 1375 a, g dbSNP:776141370
1382 1382 c, t dbSNP:763616118
1388 1388 c, t dbSNP:764707987
1403 1403 c, t dbSNP:554776074
1406 1406 a, g dbSNP:761827908
1415 1415 c, t dbSNP:771676898
1433 1433 c, g, t dbSNP:576220786
1459 1459 a, g dbSNP:766228705
1461 1461 c, t dbSNP:753761759
1466 1466 c, t dbSNP:754844495
1472 1472 a, g dbSNP:778747218
1478 1478 c, t dbSNP:747646881
1479 1479 a, g dbSNP:757896052
1484 1484 c, t dbSNP:12242912
1487 1487 c, t dbSNP:199584750
1488 1488 a, g dbSNP:770273356
1491 1491 a, g dbSNP:569161504
1515 1515 g, t dbSNP:778274713
1516 1516 c, t dbSNP:372269055
1529 1529 a, g dbSNP:771040329
1548 1548 c, t dbSNP:145588908
1555 1555 c, g dbSNP:138018241
1565 1565 c, t dbSNP:746137541
1573 1573 c, g dbSNP:770072476
1589 1589 a, g dbSNP:376554220
1592 1592 a, g dbSNP:17853923
1619 1619 a, g dbSNP:201622570
1622 1622 c, t dbSNP:369303270
1648 1648 a, c, g dbSNP:775801085
1661 1661 c, t dbSNP:367726864
1680 1680 a, g dbSNP:772094602
1685 1685 c, g, t dbSNP:773251313
1698 1698 a, g dbSNP:770542588
1703 1703 a, g dbSNP:776136842
1751 1751 a, c, t dbSNP:545371322
1760 1760 g, t dbSNP:76409649
1766 1766 c, g dbSNP:775168507
1769 1769 a, g dbSNP:762130216
1781 1781 a, g dbSNP:201006751
1800 1800 c, t dbSNP:200401715
1826 1826 c, g dbSNP:767988771
1829 1829 c, g dbSNP:750879262
1856 1856 a, g dbSNP:761185439
1860 1860 c, t dbSNP:766799906
1868 1868 c, t dbSNP:374530909
1869 1869 a, g dbSNP:533871531
1871 1871 a, g dbSNP:765526002
1872 1872 a, t dbSNP:753036509
1879 1879 c, t dbSNP:368514558
1880 1880 a, g dbSNP:758256868
1897 1897 c, g dbSNP:777569195
1898 1898 c, t dbSNP:372768874
1899 1899 a, g, t dbSNP:746787260
1902 1902 a, g dbSNP:781017607
1935 1935 a, c dbSNP:182468817
1941 1941 a, t dbSNP:572775066
1952 1952 a, c dbSNP:772735510
1966 1966 a, g dbSNP:748829498
1971 1971 c, t dbSNP:1053169
1985 1985 a, g dbSNP:41295367
1990 1990 a, g dbSNP:561504050
2013 2013 c, t dbSNP:528958452
2018 2018 g, t dbSNP:544021527
2023 2023 c, t dbSNP:778824935
2038 2038 a, t dbSNP:562594558
2111 2111 c, t dbSNP:116000625
2164 2164 a, c dbSNP:11256838
2166 2166 -, taaaa dbSNP:746797958
2166 2166 -, taaa dbSNP:567140815
2167 2167 -, aaaaa dbSNP:199883895
2167 2167 -, aaaa dbSNP:532107223
2167 2167 -, aaa dbSNP:139904764
2168 2168 -, aaaa dbSNP:762111309
2169 2169 -, aaa dbSNP:773128668
2185 2185 -, aaaa dbSNP:71390125
2186 2186 -, aaa dbSNP:550997106
2187 2187 -, aa dbSNP:71706603
2211 2211 a, g dbSNP:745899727
2228 2228 -, tt dbSNP:772294822
2232 2232 -, tttttc dbSNP:775790217
2237 2237 c, t dbSNP:375866296
2259 2259 a, c dbSNP:551333444
2262 2262 a, g dbSNP:58815069
2263 2263 a, t dbSNP:147738404
2289 2289 c, t dbSNP:191815157
2298 2298 a, g dbSNP:759331587
2328 2328 a, c dbSNP:184053604
2329 2329 a, c dbSNP:538427351
2371 2371 a, g dbSNP:556419701
2401 2401 a, g dbSNP:142640725
2418 2418 a, c dbSNP:768892787
2441 2441 c, t dbSNP:571693411
2449 2449 a, g dbSNP:540741085
2497 2497 -, g dbSNP:777102370
2561 2561 c, g dbSNP:12785001
2563 2563 a, g dbSNP:12765799
2567 2567 c, t dbSNP:538679036
2594 2594 g, t dbSNP:12776352
2614 2614 a, g dbSNP:12770185
2616 2616 c, t dbSNP:12776374
2630 2630 g, t dbSNP:12776385
2633 2633 a, c dbSNP:12785040
2645 2645 g, t dbSNP:554102948
2648 2648 a, t dbSNP:762195946
2658 2658 g, t dbSNP:74417594
2702 2702 c, t dbSNP:540089172
2717 2717 c, t dbSNP:74945871
2727 2727 a, g dbSNP:111856216
2739 2739 a, g dbSNP:573541061
2743 2743 a, g dbSNP:8463
2792 2792 a, g dbSNP:562469907
2799 2799 c, t dbSNP:533016162
2808 2808 a, t dbSNP:529296036
2826 2826 a, g dbSNP:544692670
2884 2884 a, g dbSNP:750470572
2893 2893 a, c dbSNP:146679743
2896 2896 a, g dbSNP:527281102
2906 2906 c, t dbSNP:78718801
2909 2909 g, t dbSNP:766509056
2916 2916 c, t dbSNP:151310683
2920 2920 a, g dbSNP:376773469
2944 2944 a, g dbSNP:369503881
2984 2984 a, g dbSNP:184663863
3013 3013 a, g dbSNP:554238997
3088 3088 c, t dbSNP:371881157
3089 3089 a, g dbSNP:187083253
3104 3104 -, at dbSNP:767017985
3114 3114 a, g dbSNP:539083584
3136 3136 g, t dbSNP:752341223
3137 3137 c, t dbSNP:79834124
3141 3141 -, att dbSNP:370165913
3196 3196 a, g dbSNP:114811047
3283 3283 a, g dbSNP:565782642
3320 3320 g, t dbSNP:76367377
3330 3330 a, c dbSNP:78266224
3338 3338 a, c dbSNP:369740665
3344 3344 -, tgcca dbSNP:199762049
3346 3346 -, c, ccatgctgaatgttaacaagga dbSNP:140820180
3348 3348 -, catgctgaatgttaacaaggac, catgctgaatgttaacaaggacta, tt dbSNP:41295369
3348 3348 a, c, t dbSNP:139950275
3349 3349 -, aacaaggacta dbSNP:547314988
3349 3349 a, t dbSNP:41295371
3350 3350 g, t dbSNP:202158025
3351 3351 c, t dbSNP:142541115
3379 3379 c, t dbSNP:192954794
3429 3429 c, t dbSNP:537664793
3470 3470 c, g dbSNP:753704119
3478 3478 a, t dbSNP:556288146
3485 3485 c, t dbSNP:577673001
3502 3502 c, t dbSNP:376494989
3524 3524 c, t dbSNP:547354890
3527 3527 c, g dbSNP:781551249
3528 3528 g, t dbSNP:753033067
3531 3531 c, g dbSNP:184142453
3543 3543 c, t dbSNP:558593038
3546 3546 c, t dbSNP:41295373
3555 3555 g, t dbSNP:189468387
3569 3569 a, t dbSNP:140193102
3576 3576 -, ac dbSNP:536022716
3721 3721 -, a dbSNP:572365472
3728 3728 -, tatg dbSNP:758035390

Target ORF information:

RefSeq Version NM_001145547
Organism Homo sapiens (human)
Definition Homo sapiens RNA binding motif protein 17 (RBM17), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.