
CAV3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CAV3
Entrez Gene ID 859
Full Name caveolin 3
Synonyms LGMD1C, LQT9, VIP-21, VIP21
General protein information
Preferred Names
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Muscular dystrophy, limb-girdle, type IC, 607801 (3); Rippling

The following CAV3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CAV3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_033337 Homo sapiens caveolin 3 (CAV3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001234 Homo sapiens caveolin 3 (CAV3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu21738
Accession Version NM_033337.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 456bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product caveolin-3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK291892.1, BC102033.1, BX114193.1 and AA993189.1. This sequence is a reference standard in the RefSeqGene project. On Jun 23, 2010 this sequence version replaced gi:15451859. Summary: This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) is longer than variant 2, since it includes a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DA897474.1, AF043101.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142680, SAMEA2146236 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)81..527(+)
Misc Feature(2)267..419(+)
Exon (1)1..191
Gene Synonym:
Exon (2)192..1431
Gene Synonym:
Position Chain Variation Link
13 13 a, g dbSNP:758815809
30 30 c, t dbSNP:201062505
31 31 c, t dbSNP:374841789
32 32 a, g dbSNP:368151958
35 35 c, t dbSNP:760355961
41 41 a, g dbSNP:116840771
45 45 a, g, t dbSNP:72546666
62 62 -, c dbSNP:757329305
63 63 a, c dbSNP:569240109
64 64 a, c dbSNP:750311244
68 68 a, c dbSNP:374409322
71 71 a, c, t dbSNP:368328885
76 76 c, t dbSNP:772475990
77 77 a, g dbSNP:74377241
82 82 c, t dbSNP:375301072
84 84 -, gcagaaga dbSNP:778914298
90 90 -, g dbSNP:199476323
97 97 -, agatctcgaggcccagatcgtcaaggatatccactgca dbSNP:750675944
97 97 c, g dbSNP:781333474
104 104 c, t dbSNP:1974763
105 105 a, g dbSNP:139786391
107 107 a, g dbSNP:587780883
110 110 c, t dbSNP:369206230
116 116 c, t dbSNP:200562715
117 117 a, c, g dbSNP:121909281
130 130 a, g dbSNP:730880424
131 131 c, t dbSNP:775054657
132 132 c, t dbSNP:760170984
142 142 c, t dbSNP:763666060
156 156 c, g dbSNP:199476324
157 157 a, c, g dbSNP:116840778
161 161 a, c dbSNP:116840782
162 162 a, c dbSNP:116840785
163 163 a, c, t dbSNP:116840786
165 165 a, t dbSNP:730880425
166 166 a, g dbSNP:753431407
176 176 c, g, t dbSNP:1008642
177 177 a, g dbSNP:199476325
183 183 a, g dbSNP:750257861
186 186 c, g dbSNP:374523166
194 194 c, g dbSNP:753959620
200 200 c, t dbSNP:13087941
202 202 a, c dbSNP:137901165
206 206 a, c, t dbSNP:374584030
208 208 a, t dbSNP:116840788
209 209 c, g dbSNP:372754279
212 212 c, t dbSNP:115593543
213 213 a, g, t dbSNP:116840789
214 214 a, c, t dbSNP:116840773
216 216 a, g dbSNP:116840793
217 217 a, c dbSNP:199476327
218 218 g, t dbSNP:199476328
221 221 c, t dbSNP:149287333
222 222 c, g dbSNP:748266940
224 224 a, g dbSNP:777363173
230 230 c, g dbSNP:375087776
234 234 a, g dbSNP:116840794
235 235 a, g dbSNP:199476326
237 237 g, t dbSNP:730880419
240 240 g, t dbSNP:774007619
242 242 -, c dbSNP:780411707
242 242 c, t dbSNP:759446749
243 243 a, g dbSNP:72546667
245 245 a, c, t dbSNP:116840774
246 246 a, g dbSNP:116840795
247 247 g, t dbSNP:199476329
248 248 a, g dbSNP:61147808
249 249 c, t dbSNP:199476330
260 260 a, c dbSNP:116840796
262 262 a, g dbSNP:753990961
263 263 -, caccacctt dbSNP:116840800
264 264 a, c dbSNP:116840798
265 265 c, g dbSNP:116840799
266 266 -, caccttcac dbSNP:199476331
267 267 a, c dbSNP:199476332
268 268 c, g dbSNP:121909280
278 278 a, c dbSNP:201593267
281 281 a, c dbSNP:116840775
288 288 c, t dbSNP:750746588
289 289 a, g dbSNP:199476333
291 291 a, t dbSNP:112915664
293 293 c, g dbSNP:116840776
295 295 a, g dbSNP:199476334
297 297 c, t dbSNP:780407324
298 298 a, g dbSNP:201893621
304 304 g, t dbSNP:755505530
310 310 a, c, t dbSNP:72546668
311 311 a, g dbSNP:148846096
313 313 g, t dbSNP:121909282
319 319 a, g dbSNP:778563715
320 320 c, t dbSNP:564597663
321 321 a, g dbSNP:112626848
324 324 c, t dbSNP:137881434
328 328 c, t dbSNP:730880420
329 329 a, g dbSNP:775458945
330 330 a, g dbSNP:104893715
334 334 c, t dbSNP:116840801
335 335 a, g dbSNP:760658807
336 336 c, t dbSNP:768764242
337 337 a, c, t dbSNP:28936685
340 340 -, g dbSNP:747392267
342 342 a, g dbSNP:376624103
344 344 c, t dbSNP:765234409
347 347 c, t dbSNP:750599338
350 350 a, g dbSNP:368976665
353 353 c, t dbSNP:72546669
354 354 a, g, t dbSNP:28936686
364 364 c, g dbSNP:730880421
367 367 -, tctg dbSNP:116840802
367 367 -, tct dbSNP:199476335
367 367 g, t dbSNP:104893714
371 371 a, c dbSNP:200202503
374 374 c, t dbSNP:377495315
375 375 a, t dbSNP:199476336
378 378 c, t dbSNP:199476337
383 383 a, g dbSNP:149375325
384 384 -, gtggtg dbSNP:199476338
384 384 a, g dbSNP:768140051
389 389 a, g dbSNP:794727305
390 390 c, t dbSNP:753153750
391 391 c, t dbSNP:116840805
393 393 c, t dbSNP:756736448
401 401 a, g dbSNP:778311858
413 413 c, t dbSNP:139985460
422 422 c, g dbSNP:758165061
423 423 c, t dbSNP:768101522
431 431 a, c dbSNP:779973988
439 439 a, g dbSNP:746857284
446 446 c, g dbSNP:202101572
453 453 c, t dbSNP:776563500
454 454 a, g dbSNP:116840777
461 461 c, t dbSNP:773934743
476 476 c, t dbSNP:769859957
477 477 a, c, g, t dbSNP:773309037
478 478 a, c, t dbSNP:201267913
479 479 a, c, g dbSNP:559206877
493 493 c, t dbSNP:756611208
494 494 c, t dbSNP:147250678
500 500 c, g dbSNP:104893713
501 501 -, a dbSNP:769063720
506 506 a, c dbSNP:750004840
510 510 a, g dbSNP:142475018
512 512 g, t dbSNP:758111937
519 519 c, t dbSNP:730880422
520 520 a, g dbSNP:140575619
521 521 a, g dbSNP:376749605
522 522 a, c dbSNP:754744050
526 526 a, t dbSNP:730880423
528 528 a, g dbSNP:780870487
532 532 a, g dbSNP:748075760
539 539 a, g dbSNP:769655378
541 541 c, t dbSNP:773251730
542 542 c, g dbSNP:749424132
546 546 -, a dbSNP:781592824
549 549 a, c dbSNP:771005630
552 552 c, t dbSNP:369648984
553 553 a, g dbSNP:137946394
558 558 c, t dbSNP:760529030
560 560 c, g dbSNP:199660879
564 564 a, c dbSNP:767886513
569 569 a, g dbSNP:377314109
571 571 c, g dbSNP:72546670
575 575 a, g dbSNP:764757109
577 577 c, t dbSNP:373719966
578 578 a, c dbSNP:561023124
583 583 -, tggt dbSNP:748670765
645 645 c, t dbSNP:572842599
649 649 c, g dbSNP:72546664
661 661 a, g dbSNP:564759561
693 693 c, t dbSNP:191758422
697 697 c, t dbSNP:566447811
743 743 a, g dbSNP:766271453
764 764 a, g dbSNP:753819211
809 809 c, t dbSNP:77367257
810 810 a, g dbSNP:184247243
818 818 a, g dbSNP:529652431
838 838 a, g dbSNP:759488634
843 843 a, g dbSNP:548206386
845 845 a, g dbSNP:567125845
853 853 a, c dbSNP:534502658
870 870 c, t dbSNP:552778803
872 872 c, t dbSNP:190266441
873 873 a, g dbSNP:538468291
878 878 c, t dbSNP:556362366
906 906 a, g dbSNP:574924076
967 967 c, g dbSNP:568258698
973 973 a, g dbSNP:535471483
1010 1010 c, t dbSNP:553753245
1029 1029 a, g dbSNP:181870481
1059 1059 a, g dbSNP:533857823
1076 1076 c, t dbSNP:13093809
1101 1101 c, t dbSNP:142492213
1102 1102 a, g dbSNP:541345818
1125 1125 a, g dbSNP:187370461
1130 1130 c, t dbSNP:771773640
1131 1131 a, c, g dbSNP:190490095
1178 1178 a, t dbSNP:11476
1191 1191 a, t dbSNP:556491932
1255 1255 a, g dbSNP:541417547
1273 1273 c, g dbSNP:1052354
1274 1274 a, g dbSNP:560215660
1290 1290 a, c dbSNP:180801204
1296 1296 a, g dbSNP:185369734
1310 1310 c, g dbSNP:190133010
1316 1316 a, g dbSNP:7629329
1321 1321 a, c dbSNP:181285740
1338 1338 a, c dbSNP:186579720
1343 1343 a, g dbSNP:568422373
1344 1344 -, c dbSNP:66667169
1344 1344 c, g dbSNP:10882
1361 1361 a, g dbSNP:747752353
1367 1367 a, t dbSNP:771619043
1369 1369 a, g dbSNP:758330289
1382 1382 c, t dbSNP:553716268
1385 1385 a, g dbSNP:555268992
1397 1397 a, g dbSNP:760439034
1400 1400 a, g dbSNP:558996420
1429 1429 -, t dbSNP:760345470

Target ORF information:

RefSeq Version NM_033337
Organism Homo sapiens (human)
Definition Homo sapiens caveolin 3 (CAV3), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21738
Accession Version NM_001234.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 456bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product caveolin-3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK291892.1, Y14747.1, AC068312.5 and AA993189.1. On Nov 9, 2011 this sequence version replaced gi:15451858. Summary: This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) is shorter than variant 1, since it lacks a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: Y14747.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2149178, SAMEA2154361 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)81..527(+)
Misc Feature(2)267..419(+)
Exon (1)1..191
Gene Synonym:
Exon (2)192..539
Gene Synonym:
Exon (3)540..1335
Gene Synonym:
Position Chain Variation Link
13 13 a, g dbSNP:758815809
30 30 c, t dbSNP:201062505
31 31 c, t dbSNP:374841789
32 32 a, g dbSNP:368151958
35 35 c, t dbSNP:760355961
41 41 a, g dbSNP:116840771
45 45 a, g, t dbSNP:72546666
62 62 -, c dbSNP:757329305
63 63 a, c dbSNP:569240109
64 64 a, c dbSNP:750311244
68 68 a, c dbSNP:374409322
71 71 a, c, t dbSNP:368328885
76 76 c, t dbSNP:772475990
77 77 a, g dbSNP:74377241
82 82 c, t dbSNP:375301072
84 84 -, gcagaaga dbSNP:778914298
90 90 -, g dbSNP:199476323
97 97 -, agatctcgaggcccagatcgtcaaggatatccactgca dbSNP:750675944
97 97 c, g dbSNP:781333474
104 104 c, t dbSNP:1974763
105 105 a, g dbSNP:139786391
107 107 a, g dbSNP:587780883
110 110 c, t dbSNP:369206230
116 116 c, t dbSNP:200562715
117 117 a, c, g dbSNP:121909281
130 130 a, g dbSNP:730880424
131 131 c, t dbSNP:775054657
132 132 c, t dbSNP:760170984
142 142 c, t dbSNP:763666060
156 156 c, g dbSNP:199476324
157 157 a, c, g dbSNP:116840778
161 161 a, c dbSNP:116840782
162 162 a, c dbSNP:116840785
163 163 a, c, t dbSNP:116840786
165 165 a, t dbSNP:730880425
166 166 a, g dbSNP:753431407
176 176 c, g, t dbSNP:1008642
177 177 a, g dbSNP:199476325
183 183 a, g dbSNP:750257861
186 186 c, g dbSNP:374523166
194 194 c, g dbSNP:753959620
200 200 c, t dbSNP:13087941
202 202 a, c dbSNP:137901165
206 206 a, c, t dbSNP:374584030
208 208 a, t dbSNP:116840788
209 209 c, g dbSNP:372754279
212 212 c, t dbSNP:115593543
213 213 a, g, t dbSNP:116840789
214 214 a, c, t dbSNP:116840773
216 216 a, g dbSNP:116840793
217 217 a, c dbSNP:199476327
218 218 g, t dbSNP:199476328
221 221 c, t dbSNP:149287333
222 222 c, g dbSNP:748266940
224 224 a, g dbSNP:777363173
230 230 c, g dbSNP:375087776
234 234 a, g dbSNP:116840794
235 235 a, g dbSNP:199476326
237 237 g, t dbSNP:730880419
240 240 g, t dbSNP:774007619
242 242 -, c dbSNP:780411707
242 242 c, t dbSNP:759446749
243 243 a, g dbSNP:72546667
245 245 a, c, t dbSNP:116840774
246 246 a, g dbSNP:116840795
247 247 g, t dbSNP:199476329
248 248 a, g dbSNP:61147808
249 249 c, t dbSNP:199476330
260 260 a, c dbSNP:116840796
262 262 a, g dbSNP:753990961
263 263 -, caccacctt dbSNP:116840800
264 264 a, c dbSNP:116840798
265 265 c, g dbSNP:116840799
266 266 -, caccttcac dbSNP:199476331
267 267 a, c dbSNP:199476332
268 268 c, g dbSNP:121909280
278 278 a, c dbSNP:201593267
281 281 a, c dbSNP:116840775
288 288 c, t dbSNP:750746588
289 289 a, g dbSNP:199476333
291 291 a, t dbSNP:112915664
293 293 c, g dbSNP:116840776
295 295 a, g dbSNP:199476334
297 297 c, t dbSNP:780407324
298 298 a, g dbSNP:201893621
304 304 g, t dbSNP:755505530
310 310 a, c, t dbSNP:72546668
311 311 a, g dbSNP:148846096
313 313 g, t dbSNP:121909282
319 319 a, g dbSNP:778563715
320 320 c, t dbSNP:564597663
321 321 a, g dbSNP:112626848
324 324 c, t dbSNP:137881434
328 328 c, t dbSNP:730880420
329 329 a, g dbSNP:775458945
330 330 a, g dbSNP:104893715
334 334 c, t dbSNP:116840801
335 335 a, g dbSNP:760658807
336 336 c, t dbSNP:768764242
337 337 a, c, t dbSNP:28936685
340 340 -, g dbSNP:747392267
342 342 a, g dbSNP:376624103
344 344 c, t dbSNP:765234409
347 347 c, t dbSNP:750599338
350 350 a, g dbSNP:368976665
353 353 c, t dbSNP:72546669
354 354 a, g, t dbSNP:28936686
364 364 c, g dbSNP:730880421
367 367 -, tctg dbSNP:116840802
367 367 -, tct dbSNP:199476335
367 367 g, t dbSNP:104893714
371 371 a, c dbSNP:200202503
374 374 c, t dbSNP:377495315
375 375 a, t dbSNP:199476336
378 378 c, t dbSNP:199476337
383 383 a, g dbSNP:149375325
384 384 -, gtggtg dbSNP:199476338
384 384 a, g dbSNP:768140051
389 389 a, g dbSNP:794727305
390 390 c, t dbSNP:753153750
391 391 c, t dbSNP:116840805
393 393 c, t dbSNP:756736448
401 401 a, g dbSNP:778311858
413 413 c, t dbSNP:139985460
422 422 c, g dbSNP:758165061
423 423 c, t dbSNP:768101522
431 431 a, c dbSNP:779973988
439 439 a, g dbSNP:746857284
446 446 c, g dbSNP:202101572
453 453 c, t dbSNP:776563500
454 454 a, g dbSNP:116840777
461 461 c, t dbSNP:773934743
476 476 c, t dbSNP:769859957
477 477 a, c, g, t dbSNP:773309037
478 478 a, c, t dbSNP:201267913
479 479 a, c, g dbSNP:559206877
493 493 c, t dbSNP:756611208
494 494 c, t dbSNP:147250678
500 500 c, g dbSNP:104893713
501 501 -, a dbSNP:769063720
506 506 a, c dbSNP:750004840
510 510 a, g dbSNP:142475018
512 512 g, t dbSNP:758111937
519 519 c, t dbSNP:730880422
520 520 a, g dbSNP:140575619
521 521 a, g dbSNP:376749605
522 522 a, c dbSNP:754744050
526 526 a, t dbSNP:730880423
528 528 a, g dbSNP:780870487
532 532 a, g dbSNP:748075760
539 539 a, g dbSNP:769655378
549 549 c, t dbSNP:572842599
553 553 c, g dbSNP:72546664
565 565 a, g dbSNP:564759561
597 597 c, t dbSNP:191758422
601 601 c, t dbSNP:566447811
647 647 a, g dbSNP:766271453
668 668 a, g dbSNP:753819211
713 713 c, t dbSNP:77367257
714 714 a, g dbSNP:184247243
722 722 a, g dbSNP:529652431
742 742 a, g dbSNP:759488634
747 747 a, g dbSNP:548206386
749 749 a, g dbSNP:567125845
757 757 a, c dbSNP:534502658
774 774 c, t dbSNP:552778803
776 776 c, t dbSNP:190266441
777 777 a, g dbSNP:538468291
782 782 c, t dbSNP:556362366
810 810 a, g dbSNP:574924076
871 871 c, g dbSNP:568258698
877 877 a, g dbSNP:535471483
914 914 c, t dbSNP:553753245
933 933 a, g dbSNP:181870481
963 963 a, g dbSNP:533857823
980 980 c, t dbSNP:13093809
1005 1005 c, t dbSNP:142492213
1006 1006 a, g dbSNP:541345818
1029 1029 a, g dbSNP:187370461
1034 1034 c, t dbSNP:771773640
1035 1035 a, c, g dbSNP:190490095
1082 1082 a, t dbSNP:11476
1095 1095 a, t dbSNP:556491932
1159 1159 a, g dbSNP:541417547
1177 1177 c, g dbSNP:1052354
1178 1178 a, g dbSNP:560215660
1194 1194 a, c dbSNP:180801204
1200 1200 a, g dbSNP:185369734
1214 1214 c, g dbSNP:190133010
1220 1220 a, g dbSNP:7629329
1225 1225 a, c dbSNP:181285740
1242 1242 a, c dbSNP:186579720
1247 1247 a, g dbSNP:568422373
1248 1248 -, c dbSNP:66667169
1248 1248 c, g dbSNP:10882
1265 1265 a, g dbSNP:747752353
1271 1271 a, t dbSNP:771619043
1273 1273 a, g dbSNP:758330289
1286 1286 c, t dbSNP:553716268
1289 1289 a, g dbSNP:555268992
1301 1301 a, g dbSNP:760439034
1304 1304 a, g dbSNP:558996420
1333 1333 -, t dbSNP:760345470

Target ORF information:

RefSeq Version NM_001234
Organism Homo sapiens (human)
Definition Homo sapiens caveolin 3 (CAV3), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
