Email to GenScript

RUNX2 runt-related transcription factor 2 [Homo sapiens (human)]

Gene Symbol RUNX2
Entrez Gene ID 860
Full Name runt-related transcription factor 2
Synonyms AML3, CBF-alpha-1, CBFA1, CCD, CCD1, CLCD, OSF-2, OSF2, PEA2aA, PEBP2aA
General protein information
Preferred Names
runt-related transcription factor 2
runt-related transcription factor 2
PEA2-alpha A
PEBP2-alpha A
oncogene AML-3
acute myeloid leukemia 3 protein
SL3-3 enhancer factor 1 alpha A subunit
osteoblast-specific transcription factor 2
SL3/AKV core-binding factor alpha A subunit
core-binding factor, runt domain, alpha subunit 1
polyomavirus enhancer-binding protein 2 alpha A subunit
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cleidocranial dysplasia, 119600 (3); Dental anomalies, isolated (3)

The following RUNX2 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the RUNX2 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu56662 XM_011514960 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu56663 XM_011514961 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu56664 XM_011514962 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu56665 XM_011514963 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu56666 XM_011514964 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439
OHu40507 XM_006715232 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu56667 XM_011514965 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu56668 XM_011514966 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu56669 XM_011514967 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu56670 XM_011514968 PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $199
OHu22430 NM_001015051 Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $419
OHu22872 NM_001024630 Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu21119 NM_001278478 Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu56662
Accession Version XM_011514960.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1833bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product runt-related transcription factor 2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1019..1423(+)
Position Chain Variation Link
29 29 a, c dbSNP:557766231
49 49 c, t dbSNP:576181122
53 53 c, g dbSNP:373733030
54 54 a, t dbSNP:576227424
93 93 c, t dbSNP:543513790
105 105 c, t dbSNP:377632251
111 111 -, a dbSNP:770336284
146 146 c, t dbSNP:370013884
179 179 a, c, t dbSNP:78404771
183 183 g, t dbSNP:59983488
197 197 a, g dbSNP:191044472
310 310 a, g dbSNP:183363697
311 311 a, t dbSNP:559791932
334 334 c, g dbSNP:533720661
345 345 a, c dbSNP:551464913
350 350 c, t dbSNP:768372920
360 360 -, agag dbSNP:574843755
378 378 c, g dbSNP:563673110
386 386 a, g dbSNP:373586465
415 415 c, t dbSNP:549026186
416 416 a, c dbSNP:761278947
467 467 c, t dbSNP:767060928
475 475 a, g dbSNP:764602062
476 476 -, a dbSNP:772527355
476 476 c, g dbSNP:754284908
477 477 -, a dbSNP:748227725
480 480 a, g dbSNP:762474209
486 486 a, g dbSNP:765951891
488 488 g, t dbSNP:751140132
500 500 c, t dbSNP:754641139
502 502 c, g dbSNP:780715215
503 503 c, t dbSNP:752481856
523 523 a, g dbSNP:755849928
525 525 c, t dbSNP:567427002
531 531 c, t dbSNP:79058520
532 532 a, g dbSNP:369627478
541 541 a, g dbSNP:778914485
542 542 c, t dbSNP:745978591
549 549 -, aga dbSNP:527702629
549 549 a, c dbSNP:60586642
550 550 a, g dbSNP:772269517
560 560 g, t dbSNP:775587041
562 562 c, t dbSNP:535268603
563 563 a, g dbSNP:773115189
567 567 a, c dbSNP:777173077
569 569 a, c dbSNP:762384261
576 576 c, t dbSNP:765880141
581 581 a, g dbSNP:372340475
583 583 a, g dbSNP:759132634
596 596 c, t dbSNP:767115139
599 599 c, t dbSNP:752289141
605 605 c, t dbSNP:535015975
608 608 a, c dbSNP:763775731
611 611 c, t dbSNP:753655529
612 612 a, g dbSNP:757144784
614 614 c, t dbSNP:778824476
616 616 a, g dbSNP:745887977
622 622 c, t dbSNP:758392852
623 623 a, g dbSNP:780243518
628 628 -, c dbSNP:747352254
630 630 a, g dbSNP:200595267
632 632 c, t dbSNP:747165166
642 642 c, g, t dbSNP:375345686
643 643 a, g dbSNP:748531347
645 645 g, t dbSNP:770369522
646 646 a, t dbSNP:773845542
649 649 a, t dbSNP:763586286
651 651 c, g dbSNP:369440510
652 652 -, ag dbSNP:771239088
659 659 c, t dbSNP:190642427
661 661 c, t dbSNP:750277342
675 675 a, g dbSNP:762747141
699 699 c, t dbSNP:766348640
703 703 c, t dbSNP:751540046
705 705 c, t dbSNP:755074236
706 706 -, a dbSNP:748951752
707 707 -, a dbSNP:775204103
714 714 -, aag dbSNP:139788537
714 714 a, g, t dbSNP:781491444
715 715 -, g dbSNP:773933406
715 715 a, g dbSNP:80053447
732 732 a, c, t dbSNP:75454554
738 738 a, g dbSNP:541256105
745 745 -, cag dbSNP:761442716
755 755 a, g dbSNP:746275240
758 758 c, t dbSNP:779487649
759 759 c, g, t dbSNP:373621180
764 764 a, c dbSNP:768149057
782 782 a, g dbSNP:776156260
785 785 a, c dbSNP:771988272
786 786 c, t dbSNP:780033324
787 787 c, g dbSNP:746920419
789 789 a, g dbSNP:768497827
791 791 a, c dbSNP:776729949
807 807 -, c dbSNP:752723366
809 809 a, c, t dbSNP:114654066
811 811 c, t dbSNP:142582606
813 813 c, g dbSNP:573668161
814 814 -, c dbSNP:397515538
815 815 a, t dbSNP:759530807
823 823 c, t dbSNP:766711626
824 824 c, g dbSNP:534661233
833 833 c, g dbSNP:760049118
845 845 c, g dbSNP:200687912
847 847 a, c dbSNP:202042342
848 848 g, t dbSNP:753332305
867 867 -, gcaacagcagca dbSNP:778221347
868 868 -, gcaacagcagca dbSNP:758522642
868 868 -, c dbSNP:757628582
868 868 g, t dbSNP:756706964
872 872 -, cagcagcagcaacag dbSNP:781355841
875 875 a, c dbSNP:368475300
877 877 -, cagcaa dbSNP:746250446
877 877 a, g dbSNP:578193245
883 883 a, g dbSNP:545654311
884 884 -, cagcagcagcagcaacagcag dbSNP:768156797
884 884 -, cagcagcagcagcaacag dbSNP:747643938
885 885 a, g dbSNP:758173198
886 886 -, cagcagcagcaa dbSNP:773265213
890 890 -, cagcagcaa dbSNP:760467249
897 897 -, gc dbSNP:766342521
898 898 -, cag, cagcag, cagcagcag dbSNP:759395776
898 898 a, g dbSNP:563987595
899 899 -, cag dbSNP:776245966
900 900 a, g dbSNP:779943223
902 902 -, cagcagcagcagcagcaa dbSNP:764217017
904 904 a, g dbSNP:746807573
910 910 a, g dbSNP:768569177
913 913 acagcagcagcagcagcagcaacagcagccg, gcagcaacagcagca dbSNP:730880313
913 913 a, g dbSNP:781003025
919 919 -, cag, cagcag dbSNP:751673070
919 919 a, g dbSNP:575896136
920 920 -, cag dbSNP:757640364
922 922 a, g dbSNP:748186399
925 925 -, cagcagcaa dbSNP:746172653
929 929 a, c dbSNP:769836316
931 931 a, g dbSNP:773334040
934 934 a, g, t dbSNP:763117080
935 935 -, agg dbSNP:756600003
935 935 c, g dbSNP:774631263
938 938 c, g dbSNP:759833497
940 940 -, ggc dbSNP:746557318
940 940 a, g dbSNP:767984534
944 944 -, gcggcggcggct dbSNP:775676263
945 945 a, c dbSNP:753139240
946 946 c, g dbSNP:761281959
947 947 -, gcggcggct dbSNP:764306808
953 953 -, gct dbSNP:761978515
953 953 a, g dbSNP:542999615
955 955 -, gcggcg dbSNP:754255092
956 956 -, gcggcggcg dbSNP:750984370
956 956 -, gcg dbSNP:756546787
957 957 c, t dbSNP:749974335
960 960 c, t dbSNP:758081090
963 963 a, c dbSNP:766130437
964 964 -, gcggcggct dbSNP:777501691
964 964 a, g, t dbSNP:6921145
968 968 a, g dbSNP:781083561
970 970 g, t dbSNP:748015701
973 973 g, t dbSNP:756072084
974 974 a, g dbSNP:777793369
976 976 -, gcggcggctgcggcggcggcggcggctgcg dbSNP:606231174
976 976 g, t dbSNP:749375048
978 978 c, t dbSNP:372138746
979 979 g, t dbSNP:774424659
981 981 a, c dbSNP:746166928
984 984 -, ggcggctgcggcggcggc dbSNP:11498192
984 984 c, t dbSNP:772291669
985 985 a, g dbSNP:775972769
986 986 a, g dbSNP:761037120
988 988 c, t dbSNP:371399056
997 997 c, t dbSNP:376449674
999 999 a, g dbSNP:772777645
1000 1000 a, g dbSNP:368258190
1017 1017 a, g dbSNP:766042547
1020 1020 a, t dbSNP:150962268
1022 1022 a, c dbSNP:754711247
1023 1023 g, t dbSNP:767171242
1027 1027 a, c, g dbSNP:752571746
1028 1028 a, g dbSNP:376849024
1029 1029 c, t dbSNP:749283473
1044 1044 c, t dbSNP:528470044
1045 1045 c, g dbSNP:368977633
1048 1048 c, t dbSNP:140761255
1053 1053 c, t dbSNP:150088136
1057 1057 c, g dbSNP:772361635
1060 1060 a, g dbSNP:368995035
1063 1063 a, c dbSNP:747378618
1069 1069 c, t dbSNP:769224159
1072 1072 c, g dbSNP:552061660
1073 1073 g, t dbSNP:762474281
1096 1096 c, g dbSNP:765787677
1111 1111 c, t dbSNP:181096602
1129 1129 a, c dbSNP:759074837
1135 1135 a, c, g dbSNP:767207344
1139 1139 a, g dbSNP:760449546
1157 1157 c, t dbSNP:759100705
1159 1159 c, t dbSNP:147760046
1163 1163 a, g dbSNP:370512978
1165 1165 a, g dbSNP:760361518
1169 1169 c, t dbSNP:763852761
1177 1177 a, g dbSNP:753653583
1179 1179 c, t dbSNP:373029816
1198 1198 a, g dbSNP:549934715
1201 1201 g, t dbSNP:750408740
1204 1204 c, t dbSNP:758487556
1209 1209 a, g dbSNP:780062825
1230 1230 a, c, g dbSNP:104893995
1245 1245 c, t dbSNP:568476296
1247 1247 a, g dbSNP:201647225
1248 1248 c, g, t dbSNP:104893989
1255 1255 c, g dbSNP:147359883
1259 1259 c, g dbSNP:182416246
1273 1273 c, t dbSNP:115974315
1294 1294 a, g dbSNP:533778847
1296 1296 a, g dbSNP:104893990
1306 1306 c, t dbSNP:779498610
1312 1312 c, t dbSNP:746525189
1315 1315 c, t dbSNP:542875205
1316 1316 a, g dbSNP:113836922
1322 1322 a, g dbSNP:104893993
1330 1330 c, t dbSNP:776247579
1331 1331 a, g dbSNP:147009083
1333 1333 a, c, t dbSNP:528172842
1335 1335 g, t dbSNP:772926106
1337 1337 a, g dbSNP:762910660
1362 1362 a, g dbSNP:138138469
1366 1366 c, g dbSNP:774518258
1369 1369 a, t dbSNP:759679284
1372 1372 a, t dbSNP:767772937
1378 1378 a, t dbSNP:752933596
1387 1387 a, g dbSNP:115763613
1397 1397 c, t dbSNP:104893992
1398 1398 a, g dbSNP:104893991
1399 1399 a, g dbSNP:764473197
1405 1405 c, t dbSNP:754184804
1412 1412 a, c dbSNP:765653239
1426 1426 c, t dbSNP:750894797
1427 1427 c, g dbSNP:373709122
1428 1428 a, g dbSNP:780701424
1431 1431 a, t dbSNP:180860949
1439 1439 a, c, t dbSNP:752156180
1440 1440 c, t dbSNP:186720964
1441 1441 c, t dbSNP:777281204
1444 1444 a, t dbSNP:749040759
1452 1452 c, g dbSNP:770818987
1456 1456 a, c dbSNP:778901535
1461 1461 c, t dbSNP:745752587
1475 1475 c, t dbSNP:11498200
1476 1476 a, g dbSNP:376891808
1485 1485 a, g dbSNP:377128508
1489 1489 c, t dbSNP:768838744
1491 1491 g, t dbSNP:776708490
1505 1505 a, g dbSNP:762058135
1512 1512 a, c, t dbSNP:563772449
1516 1516 a, g dbSNP:12173874
1523 1523 c, t dbSNP:370486033
1527 1527 c, g dbSNP:766812325
1531 1531 a, c dbSNP:576261808
1550 1550 c, t dbSNP:755578627
1587 1587 c, t dbSNP:148326029
1594 1594 c, g dbSNP:760143015
1608 1608 c, g dbSNP:763466386
1609 1609 a, g dbSNP:554000247
1611 1611 c, t dbSNP:201584115
1612 1612 a, g dbSNP:764992178
1615 1615 a, g dbSNP:104893988
1622 1622 c, g dbSNP:370331024
1625 1625 c, g dbSNP:758120505
1626 1626 a, g dbSNP:779939748
1628 1628 g, t dbSNP:746897678
1632 1632 a, t dbSNP:754963913
1634 1634 c, t dbSNP:781207125
1635 1635 c, g dbSNP:748242152
1638 1638 c, g dbSNP:769922027
1643 1643 c, t dbSNP:141447644
1656 1656 c, t dbSNP:749565421
1657 1657 a, g dbSNP:146314825
1658 1658 c, t dbSNP:78532572
1661 1661 c, g dbSNP:774805163
1662 1662 c, g dbSNP:535706340
1663 1663 g, t dbSNP:768076425
1664 1664 c, t dbSNP:776221631
1676 1676 a, g dbSNP:761391105
1683 1683 c, t dbSNP:746114073
1684 1684 a, g, t dbSNP:139514226
1696 1696 a, t dbSNP:757437094
1697 1697 c, t dbSNP:751400416
1701 1701 g, t dbSNP:143092997
1713 1713 a, c dbSNP:781096197
1716 1716 c, g dbSNP:114554762
1722 1722 a, c dbSNP:750138653
1723 1723 c, t dbSNP:566033645
1724 1724 a, g dbSNP:373752642
1725 1725 a, c dbSNP:749426825
1727 1727 a, g dbSNP:771219239
1736 1736 c, t dbSNP:779082630
1737 1737 a, g dbSNP:367898326
1757 1757 a, c dbSNP:758294076
1771 1771 c, g dbSNP:781528018
1801 1801 a, g dbSNP:377639296
1806 1806 a, t dbSNP:185524261
1812 1812 a, g dbSNP:557229443
1822 1822 c, t dbSNP:539437131
1825 1825 c, t dbSNP:767987444
1855 1855 c, t dbSNP:150415537
1872 1872 c, g dbSNP:569724942
1893 1893 c, t dbSNP:753081035
1908 1908 c, t dbSNP:756425872
1924 1924 g, t dbSNP:537643304
1967 1967 a, t dbSNP:138287579
1998 1998 c, g dbSNP:567962701
1999 1999 a, g dbSNP:535043121
2000 2000 a, c dbSNP:553611141
2003 2003 a, c dbSNP:577665369
2006 2006 a, g dbSNP:189593823
2020 2020 c, t dbSNP:557044348
2060 2060 c, g dbSNP:373166327
2064 2064 -, g dbSNP:35011178
2103 2103 c, t dbSNP:543624992
2114 2114 c, g dbSNP:561698935
2123 2123 c, t dbSNP:141476380
2131 2131 c, g dbSNP:369286886
2195 2195 a, g dbSNP:113861074
2306 2306 c, t dbSNP:111973698
2326 2326 c, t dbSNP:748911827
2349 2349 a, g dbSNP:541013378
2359 2359 a, c dbSNP:559588770
2362 2362 c, g dbSNP:111383948
2366 2366 a, g dbSNP:551346856
2381 2381 a, g dbSNP:769083619
2395 2395 a, g dbSNP:147004670
2406 2406 a, g dbSNP:545796338
2419 2419 c, t dbSNP:371638282
2420 2420 a, c dbSNP:73735420
2424 2424 a, c dbSNP:74697776
2438 2438 a, c dbSNP:762115885
2443 2443 c, t dbSNP:76035586
2444 2444 c, g dbSNP:745339808
2445 2445 a, g dbSNP:6458457
2453 2453 a, g dbSNP:571568274
2462 2462 g, t dbSNP:760305503
2475 2475 c, t dbSNP:541949831
2518 2518 c, t dbSNP:538652016
2519 2519 g, t dbSNP:775520055
2522 2522 c, t dbSNP:555168319
2553 2553 a, g dbSNP:374855822
2557 2557 c, g dbSNP:556909324
2565 2565 c, g dbSNP:112534392
2569 2569 c, t dbSNP:575350389
2570 2570 a, g dbSNP:180787852
2576 2576 c, t dbSNP:57853251
2578 2578 g, t dbSNP:753223303
2582 2582 c, t dbSNP:184980328
2584 2584 a, t dbSNP:754533293

Target ORF information:

RefSeq Version XM_011514960
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56663
Accession Version XM_011514961.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1770bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product runt-related transcription factor 2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)650..1054(+)
Misc Feature(2)1634..1918(+)
Position Chain Variation Link
9 9 c, g dbSNP:563673110
17 17 a, g dbSNP:373586465
46 46 c, t dbSNP:549026186
47 47 a, c dbSNP:761278947
98 98 c, t dbSNP:767060928
106 106 a, g dbSNP:764602062
107 107 -, a dbSNP:772527355
107 107 c, g dbSNP:754284908
108 108 -, a dbSNP:748227725
111 111 a, g dbSNP:762474209
117 117 a, g dbSNP:765951891
119 119 g, t dbSNP:751140132
131 131 c, t dbSNP:754641139
133 133 c, g dbSNP:780715215
134 134 c, t dbSNP:752481856
154 154 a, g dbSNP:755849928
156 156 c, t dbSNP:567427002
162 162 c, t dbSNP:79058520
163 163 a, g dbSNP:369627478
172 172 a, g dbSNP:778914485
173 173 c, t dbSNP:745978591
180 180 -, aga dbSNP:527702629
180 180 a, c dbSNP:60586642
181 181 a, g dbSNP:772269517
191 191 g, t dbSNP:775587041
193 193 c, t dbSNP:535268603
194 194 a, g dbSNP:773115189
198 198 a, c dbSNP:777173077
200 200 a, c dbSNP:762384261
207 207 c, t dbSNP:765880141
212 212 a, g dbSNP:372340475
214 214 a, g dbSNP:759132634
227 227 c, t dbSNP:767115139
230 230 c, t dbSNP:752289141
236 236 c, t dbSNP:535015975
239 239 a, c dbSNP:763775731
242 242 c, t dbSNP:753655529
243 243 a, g dbSNP:757144784
245 245 c, t dbSNP:778824476
247 247 a, g dbSNP:745887977
253 253 c, t dbSNP:758392852
254 254 a, g dbSNP:780243518
259 259 -, c dbSNP:747352254
261 261 a, g dbSNP:200595267
263 263 c, t dbSNP:747165166
273 273 c, g, t dbSNP:375345686
274 274 a, g dbSNP:748531347
276 276 g, t dbSNP:770369522
277 277 a, t dbSNP:773845542
280 280 a, t dbSNP:763586286
282 282 c, g dbSNP:369440510
283 283 -, ag dbSNP:771239088
290 290 c, t dbSNP:190642427
292 292 c, t dbSNP:750277342
306 306 a, g dbSNP:762747141
330 330 c, t dbSNP:766348640
334 334 c, t dbSNP:751540046
336 336 c, t dbSNP:755074236
337 337 -, a dbSNP:748951752
338 338 -, a dbSNP:775204103
345 345 -, aag dbSNP:139788537
345 345 a, g, t dbSNP:781491444
346 346 -, g dbSNP:773933406
346 346 a, g dbSNP:80053447
363 363 a, c, t dbSNP:75454554
369 369 a, g dbSNP:541256105
376 376 -, cag dbSNP:761442716
386 386 a, g dbSNP:746275240
389 389 c, t dbSNP:779487649
390 390 c, g, t dbSNP:373621180
395 395 a, c dbSNP:768149057
413 413 a, g dbSNP:776156260
416 416 a, c dbSNP:771988272
417 417 c, t dbSNP:780033324
418 418 c, g dbSNP:746920419
420 420 a, g dbSNP:768497827
422 422 a, c dbSNP:776729949
438 438 -, c dbSNP:752723366
440 440 a, c, t dbSNP:114654066
442 442 c, t dbSNP:142582606
444 444 c, g dbSNP:573668161
445 445 -, c dbSNP:397515538
446 446 a, t dbSNP:759530807
454 454 c, t dbSNP:766711626
455 455 c, g dbSNP:534661233
464 464 c, g dbSNP:760049118
476 476 c, g dbSNP:200687912
478 478 a, c dbSNP:202042342
479 479 g, t dbSNP:753332305
498 498 -, gcaacagcagca dbSNP:778221347
499 499 -, gcaacagcagca dbSNP:758522642
499 499 -, c dbSNP:757628582
499 499 g, t dbSNP:756706964
503 503 -, cagcagcagcaacag dbSNP:781355841
506 506 a, c dbSNP:368475300
508 508 -, cagcaa dbSNP:746250446
508 508 a, g dbSNP:578193245
514 514 a, g dbSNP:545654311
515 515 -, cagcagcagcagcaacagcag dbSNP:768156797
515 515 -, cagcagcagcagcaacag dbSNP:747643938
516 516 a, g dbSNP:758173198
517 517 -, cagcagcagcaa dbSNP:773265213
521 521 -, cagcagcaa dbSNP:760467249
528 528 -, gc dbSNP:766342521
529 529 -, cag, cagcag, cagcagcag dbSNP:759395776
529 529 a, g dbSNP:563987595
530 530 -, cag dbSNP:776245966
531 531 a, g dbSNP:779943223
533 533 -, cagcagcagcagcagcaa dbSNP:764217017
535 535 a, g dbSNP:746807573
541 541 a, g dbSNP:768569177
544 544 acagcagcagcagcagcagcaacagcagccg, gcagcaacagcagca dbSNP:730880313
544 544 a, g dbSNP:781003025
550 550 -, cag, cagcag dbSNP:751673070
550 550 a, g dbSNP:575896136
551 551 -, cag dbSNP:757640364
553 553 a, g dbSNP:748186399
556 556 -, cagcagcaa dbSNP:746172653
560 560 a, c dbSNP:769836316
562 562 a, g dbSNP:773334040
565 565 a, g, t dbSNP:763117080
566 566 -, agg dbSNP:756600003
566 566 c, g dbSNP:774631263
569 569 c, g dbSNP:759833497
571 571 -, ggc dbSNP:746557318
571 571 a, g dbSNP:767984534
575 575 -, gcggcggcggct dbSNP:775676263
576 576 a, c dbSNP:753139240
577 577 c, g dbSNP:761281959
578 578 -, gcggcggct dbSNP:764306808
584 584 -, gct dbSNP:761978515
584 584 a, g dbSNP:542999615
586 586 -, gcggcg dbSNP:754255092
587 587 -, gcggcggcg dbSNP:750984370
587 587 -, gcg dbSNP:756546787
588 588 c, t dbSNP:749974335
591 591 c, t dbSNP:758081090
594 594 a, c dbSNP:766130437
595 595 -, gcggcggct dbSNP:777501691
595 595 a, g, t dbSNP:6921145
599 599 a, g dbSNP:781083561
601 601 g, t dbSNP:748015701
604 604 g, t dbSNP:756072084
605 605 a, g dbSNP:777793369
607 607 -, gcggcggctgcggcggcggcggcggctgcg dbSNP:606231174
607 607 g, t dbSNP:749375048
609 609 c, t dbSNP:372138746
610 610 g, t dbSNP:774424659
612 612 a, c dbSNP:746166928
615 615 -, ggcggctgcggcggcggc dbSNP:11498192
615 615 c, t dbSNP:772291669
616 616 a, g dbSNP:775972769
617 617 a, g dbSNP:761037120
619 619 c, t dbSNP:371399056
628 628 c, t dbSNP:376449674
630 630 a, g dbSNP:772777645
631 631 a, g dbSNP:368258190
648 648 a, g dbSNP:766042547
651 651 a, t dbSNP:150962268
653 653 a, c dbSNP:754711247
654 654 g, t dbSNP:767171242
658 658 a, c, g dbSNP:752571746
659 659 a, g dbSNP:376849024
660 660 c, t dbSNP:749283473
675 675 c, t dbSNP:528470044
676 676 c, g dbSNP:368977633
679 679 c, t dbSNP:140761255
684 684 c, t dbSNP:150088136
688 688 c, g dbSNP:772361635
691 691 a, g dbSNP:368995035
694 694 a, c dbSNP:747378618
700 700 c, t dbSNP:769224159
703 703 c, g dbSNP:552061660
704 704 g, t dbSNP:762474281
727 727 c, g dbSNP:765787677
742 742 c, t dbSNP:181096602
760 760 a, c dbSNP:759074837
766 766 a, c, g dbSNP:767207344
770 770 a, g dbSNP:760449546
788 788 c, t dbSNP:759100705
790 790 c, t dbSNP:147760046
794 794 a, g dbSNP:370512978
796 796 a, g dbSNP:760361518
800 800 c, t dbSNP:763852761
808 808 a, g dbSNP:753653583
810 810 c, t dbSNP:373029816
829 829 a, g dbSNP:549934715
832 832 g, t dbSNP:750408740
835 835 c, t dbSNP:758487556
840 840 a, g dbSNP:780062825
861 861 a, c, g dbSNP:104893995
876 876 c, t dbSNP:568476296
878 878 a, g dbSNP:201647225
879 879 c, g, t dbSNP:104893989
886 886 c, g dbSNP:147359883
890 890 c, g dbSNP:182416246
904 904 c, t dbSNP:115974315
925 925 a, g dbSNP:533778847
927 927 a, g dbSNP:104893990
937 937 c, t dbSNP:779498610
943 943 c, t dbSNP:746525189
946 946 c, t dbSNP:542875205
947 947 a, g dbSNP:113836922
953 953 a, g dbSNP:104893993
961 961 c, t dbSNP:776247579
962 962 a, g dbSNP:147009083
964 964 a, c, t dbSNP:528172842
966 966 g, t dbSNP:772926106
968 968 a, g dbSNP:762910660
993 993 a, g dbSNP:138138469
997 997 c, g dbSNP:774518258
1000 1000 a, t dbSNP:759679284
1003 1003 a, t dbSNP:767772937
1009 1009 a, t dbSNP:752933596
1018 1018 a, g dbSNP:115763613
1028 1028 c, t dbSNP:104893992
1029 1029 a, g dbSNP:104893991
1030 1030 a, g dbSNP:764473197
1036 1036 c, t dbSNP:754184804
1043 1043 a, c dbSNP:765653239
1057 1057 c, t dbSNP:750894797
1058 1058 c, g dbSNP:373709122
1059 1059 a, g dbSNP:780701424
1062 1062 a, t dbSNP:180860949
1070 1070 a, c, t dbSNP:752156180
1071 1071 c, t dbSNP:186720964
1072 1072 c, t dbSNP:777281204
1075 1075 a, t dbSNP:749040759
1083 1083 c, g dbSNP:770818987
1087 1087 a, c dbSNP:778901535
1092 1092 c, t dbSNP:745752587
1106 1106 c, t dbSNP:11498200
1107 1107 a, g dbSNP:376891808
1116 1116 a, g dbSNP:377128508
1120 1120 c, t dbSNP:768838744
1122 1122 g, t dbSNP:776708490
1136 1136 a, g dbSNP:762058135
1143 1143 a, c, t dbSNP:563772449
1147 1147 a, g dbSNP:12173874
1154 1154 c, t dbSNP:370486033
1158 1158 c, g dbSNP:766812325
1162 1162 a, c dbSNP:576261808
1181 1181 c, t dbSNP:755578627
1218 1218 c, t dbSNP:148326029
1225 1225 c, g dbSNP:760143015
1239 1239 c, g dbSNP:763466386
1240 1240 a, g dbSNP:554000247
1242 1242 c, t dbSNP:201584115
1243 1243 a, g dbSNP:764992178
1246 1246 a, g dbSNP:104893988
1253 1253 c, g dbSNP:370331024
1256 1256 c, g dbSNP:758120505
1257 1257 a, g dbSNP:779939748
1259 1259 g, t dbSNP:746897678
1263 1263 a, t dbSNP:754963913
1265 1265 c, t dbSNP:781207125
1266 1266 c, g dbSNP:748242152
1269 1269 c, g dbSNP:769922027
1274 1274 c, t dbSNP:141447644
1287 1287 c, t dbSNP:749565421
1288 1288 a, g dbSNP:146314825
1289 1289 c, t dbSNP:78532572
1292 1292 c, g dbSNP:774805163
1293 1293 c, g dbSNP:535706340
1294 1294 g, t dbSNP:768076425
1295 1295 c, t dbSNP:776221631
1307 1307 a, g dbSNP:761391105
1314 1314 c, t dbSNP:746114073
1315 1315 a, g, t dbSNP:139514226
1327 1327 a, t dbSNP:757437094
1328 1328 c, t dbSNP:751400416
1332 1332 g, t dbSNP:143092997
1344 1344 a, c dbSNP:781096197
1347 1347 c, g dbSNP:114554762
1353 1353 a, c dbSNP:750138653
1354 1354 c, t dbSNP:566033645
1355 1355 a, g dbSNP:373752642
1356 1356 a, c dbSNP:749426825
1358 1358 a, g dbSNP:771219239
1367 1367 c, t dbSNP:779082630
1368 1368 a, g dbSNP:367898326
1423 1423 c, t dbSNP:746139832
1450 1450 a, t dbSNP:770417240
1454 1454 c, g, t dbSNP:140165241
1461 1461 c, g dbSNP:767251365
1487 1487 a, g dbSNP:752525068
1489 1489 a, c dbSNP:760543307
1495 1495 a, g dbSNP:574709560
1511 1511 c, t dbSNP:753780685
1512 1512 a, g dbSNP:757351966
1519 1519 a, c, t dbSNP:778896510
1521 1521 a, g dbSNP:115347084
1526 1526 c, t dbSNP:397515537
1527 1527 a, g dbSNP:780524636
1536 1536 a, t dbSNP:747380594
1539 1539 a, c dbSNP:755482498
1543 1543 c, t dbSNP:115129262
1555 1555 c, t dbSNP:781721459
1556 1556 a, c dbSNP:748644984
1560 1560 -, c dbSNP:730880314
1560 1560 c, t dbSNP:770452837
1561 1561 a, g dbSNP:200992166
1563 1563 c, t dbSNP:376694142
1564 1564 a, t dbSNP:771720805
1583 1583 -, c dbSNP:730880315
1585 1585 c, t dbSNP:775211415
1594 1594 c, t dbSNP:369957440
1595 1595 a, g dbSNP:763860044
1612 1612 c, t dbSNP:776596579
1629 1629 c, t dbSNP:761701398
1635 1635 c, t dbSNP:765308202
1636 1636 c, t dbSNP:376083944
1637 1637 a, g dbSNP:758626590
1651 1651 a, c dbSNP:144760627
1660 1660 a, g dbSNP:766719397
1662 1662 a, c, t dbSNP:751887748
1666 1666 c, t dbSNP:781460245
1670 1670 a, g dbSNP:748640088
1704 1704 c, t dbSNP:369481795
1705 1705 a, g dbSNP:778422878
1711 1711 a, g dbSNP:745399877
1713 1713 c, t dbSNP:771630924
1723 1723 g, t dbSNP:775121825
1724 1724 c, t dbSNP:746700872
1734 1734 c, t dbSNP:768473049
1735 1735 a, c, g dbSNP:756718952
1736 1736 c, g dbSNP:765089321
1737 1737 c, g dbSNP:554124503
1745 1745 c, t dbSNP:373218126
1746 1746 a, g dbSNP:148639759
1751 1751 c, t dbSNP:751811026
1752 1752 c, t dbSNP:144852234
1756 1756 a, c, t dbSNP:755177539
1765 1765 a, t dbSNP:753012526
1767 1767 c, t dbSNP:142108189
1768 1768 a, g, t dbSNP:114897742
1771 1771 a, g dbSNP:371147260
1789 1789 c, t dbSNP:374159865
1791 1791 g, t dbSNP:746611102
1792 1792 c, t dbSNP:745395833
1796 1796 a, g dbSNP:768220317
1797 1797 c, t dbSNP:780973109
1798 1798 a, g dbSNP:147783693
1801 1801 a, g dbSNP:769686958
1809 1809 a, c dbSNP:773277224
1822 1822 c, t dbSNP:202246150
1838 1838 a, g dbSNP:771087017
1840 1840 c, t dbSNP:377403216
1842 1842 c, t dbSNP:774604105
1844 1844 a, g dbSNP:759738332
1846 1846 c, t dbSNP:141100653
1858 1858 c, t dbSNP:564461142
1868 1868 a, g dbSNP:753025447
1886 1886 a, c, g, t dbSNP:11498198
1888 1888 c, t dbSNP:764484914
1893 1893 c, t dbSNP:754318665
1920 1920 c, g dbSNP:104893994
1929 1929 c, t dbSNP:200866173
1939 1939 c, t dbSNP:779494886
1957 1957 c, g dbSNP:751032904
1962 1962 a, c dbSNP:376928739
1962 1962 -, c dbSNP:750479505
1964 1964 c, t dbSNP:780694693
1968 1968 c, t dbSNP:144321470
1969 1969 a, g, t dbSNP:769454803
1989 1989 -, agag dbSNP:550883071
1990 1990 g, t dbSNP:562720936
2050 2050 -, t dbSNP:761177808
2087 2087 a, g dbSNP:529807832
2133 2133 a, g dbSNP:79061067
2139 2139 a, g dbSNP:775436924
2170 2170 a, c dbSNP:566697809
2196 2196 a, c dbSNP:527570415
2199 2199 a, g dbSNP:142301498
2220 2220 a, g dbSNP:542320894
2225 2225 a, g dbSNP:146801654
2239 2239 c, t dbSNP:78935067
2246 2246 a, t dbSNP:180855207
2300 2300 a, g dbSNP:568643332
2325 2325 c, g dbSNP:768542647
2335 2335 c, t dbSNP:535722111
2342 2342 a, g dbSNP:554335585
2366 2366 c, t dbSNP:140502641
2402 2402 a, g dbSNP:773272072
2431 2431 a, t dbSNP:546501035
2478 2478 c, t dbSNP:558207106
2479 2479 a, g dbSNP:770552169
2513 2513 g, t dbSNP:199528647
2513 2513 -, t dbSNP:35084034
2519 2519 g, t dbSNP:45571536
2520 2520 g, t dbSNP:45585135
2521 2521 g, t dbSNP:748683376
2529 2529 -, t dbSNP:398001403
2531 2531 c, t dbSNP:200995981
2597 2597 c, t dbSNP:543940721
2599 2599 c, t dbSNP:185842387
2614 2614 c, g dbSNP:561815219
2629 2629 a, g dbSNP:565794
2635 2635 c, g dbSNP:761021972
2664 2664 c, t dbSNP:766351922
2676 2676 a, c dbSNP:772515276
2680 2680 a, g dbSNP:574072831
2722 2722 a, g dbSNP:143518330
2723 2723 c, t dbSNP:560277927
2733 2733 g, t dbSNP:566712
2736 2736 g, t dbSNP:590091
2751 2751 a, t dbSNP:527608966
2791 2791 c, t dbSNP:552023232
2868 2868 c, t dbSNP:759725273
3005 3005 a, c dbSNP:6906876
3054 3054 a, t dbSNP:188598788
3095 3095 a, c dbSNP:765793000
3113 3113 a, g dbSNP:527904643
3114 3114 c, t dbSNP:753308506
3115 3115 a, g dbSNP:549748553
3122 3122 a, t dbSNP:181813204
3199 3199 c, t dbSNP:756225322
3225 3225 a, g dbSNP:186839291
3255 3255 a, g dbSNP:747265691
3280 3280 a, t dbSNP:764058322
3281 3281 a, g dbSNP:764587864
3321 3321 -, agtc dbSNP:767029587
3336 3336 a, g dbSNP:146749281
3356 3356 -, a dbSNP:147020695
3359 3359 a, t dbSNP:547614137
3369 3369 c, t dbSNP:77856760
3381 3381 a, g dbSNP:540154506
3392 3392 c, t dbSNP:191996120
3455 3455 c, t dbSNP:140371943
3470 3470 a, t dbSNP:757660837
3527 3527 c, g dbSNP:779337167
3547 3547 a, g dbSNP:776703994
3573 3573 a, c dbSNP:756877224
3595 3595 g, t dbSNP:780712881
3605 3605 c, g dbSNP:745340776
3617 3617 c, t dbSNP:755642283
3618 3618 a, t dbSNP:779942831
3629 3629 c, t dbSNP:537488922
3681 3681 c, g dbSNP:555720589
3683 3683 c, g dbSNP:77663988
3780 3780 a, g dbSNP:115078186
3826 3826 c, t dbSNP:560110427
3840 3840 c, t dbSNP:6912472
3910 3910 c, t dbSNP:374058568
3911 3911 a, c dbSNP:546466948
3922 3922 a, g dbSNP:150354057
3998 3998 a, g dbSNP:747904805
4003 4003 a, g dbSNP:771149393
4088 4088 c, g dbSNP:777019780
4089 4089 a, c dbSNP:183868596
4120 4120 a, g dbSNP:144977950
4157 4157 g, t dbSNP:531493813
4170 4170 a, g dbSNP:367933871
4195 4195 c, t dbSNP:186219428
4249 4249 g, t dbSNP:765451254
4303 4303 a, g dbSNP:561705802
4335 4335 a, g dbSNP:763614056
4348 4348 a, g dbSNP:764523126
4400 4400 a, c dbSNP:540392893
4401 4401 c, t dbSNP:149059421
4402 4402 a, g dbSNP:759708464
4450 4450 c, g dbSNP:566289090
4510 4510 c, t dbSNP:7451304
4533 4533 c, g dbSNP:539989584
4540 4540 a, g dbSNP:554964716
4558 4558 g, t dbSNP:568478870
4563 4563 a, g dbSNP:7451384
4578 4578 g, t dbSNP:537428636
4619 4619 -, t dbSNP:11320232
4620 4620 -, t dbSNP:527884872
4633 4633 -, t dbSNP:398001404
4636 4636 c, t dbSNP:199935487
4732 4732 a, g dbSNP:570401980
4744 4744 a, g dbSNP:767148065
4747 4747 a, g dbSNP:537731522
4759 4759 c, g dbSNP:80072481
4766 4766 a, c dbSNP:558458433
4801 4801 a, c dbSNP:567622268
4837 4837 c, t dbSNP:779603310
4840 4840 c, t dbSNP:564322026
4843 4843 a, g dbSNP:371194782
4863 4863 a, g dbSNP:775967518
4867 4867 c, t dbSNP:577713160
4889 4889 a, t dbSNP:545633634
4912 4912 c, t dbSNP:189846967
4951 4951 c, t dbSNP:145866183
4968 4968 a, c dbSNP:182124295
5027 5027 a, g dbSNP:754883079
5032 5032 c, t dbSNP:561547493
5048 5048 c, t dbSNP:528842708
5071 5071 c, t dbSNP:778716561
5080 5080 c, t dbSNP:138689945
5081 5081 g, t dbSNP:1200428
5099 5099 a, g dbSNP:533047925
5100 5100 c, g dbSNP:552035909
5115 5115 c, t dbSNP:372592934
5126 5126 a, g dbSNP:570239093
5139 5139 a, g dbSNP:554368801
5153 5153 c, t dbSNP:746161639
5224 5224 a, g dbSNP:769982069
5247 5247 a, g dbSNP:531131170
5253 5253 a, g dbSNP:549617601
5266 5266 a, g dbSNP:376702554
5278 5278 c, t dbSNP:544428927
5347 5347 c, t dbSNP:534970370
5410 5410 -, g dbSNP:35633395
5411 5411 c, g dbSNP:552941147
5444 5444 c, g dbSNP:571442606
5489 5489 c, t dbSNP:142687054
5493 5493 g, t dbSNP:574186575
5513 5513 a, g dbSNP:62400377
5526 5526 c, t dbSNP:562888619
5569 5569 a, g dbSNP:557555226
5614 5614 a, g dbSNP:146924197

Target ORF information:

RefSeq Version XM_011514961
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56664
Accession Version XM_011514962.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1704bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product runt-related transcription factor 2 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)650..1054(+)
Misc Feature(2)1568..1852(+)
Position Chain Variation Link
9 9 c, g dbSNP:563673110
17 17 a, g dbSNP:373586465
46 46 c, t dbSNP:549026186
47 47 a, c dbSNP:761278947
98 98 c, t dbSNP:767060928
106 106 a, g dbSNP:764602062
107 107 -, a dbSNP:772527355
107 107 c, g dbSNP:754284908
108 108 -, a dbSNP:748227725
111 111 a, g dbSNP:762474209
117 117 a, g dbSNP:765951891
119 119 g, t dbSNP:751140132
131 131 c, t dbSNP:754641139
133 133 c, g dbSNP:780715215
134 134 c, t dbSNP:752481856
154 154 a, g dbSNP:755849928
156 156 c, t dbSNP:567427002
162 162 c, t dbSNP:79058520
163 163 a, g dbSNP:369627478
172 172 a, g dbSNP:778914485
173 173 c, t dbSNP:745978591
180 180 -, aga dbSNP:527702629
180 180 a, c dbSNP:60586642
181 181 a, g dbSNP:772269517
191 191 g, t dbSNP:775587041
193 193 c, t dbSNP:535268603
194 194 a, g dbSNP:773115189
198 198 a, c dbSNP:777173077
200 200 a, c dbSNP:762384261
207 207 c, t dbSNP:765880141
212 212 a, g dbSNP:372340475
214 214 a, g dbSNP:759132634
227 227 c, t dbSNP:767115139
230 230 c, t dbSNP:752289141
236 236 c, t dbSNP:535015975
239 239 a, c dbSNP:763775731
242 242 c, t dbSNP:753655529
243 243 a, g dbSNP:757144784
245 245 c, t dbSNP:778824476
247 247 a, g dbSNP:745887977
253 253 c, t dbSNP:758392852
254 254 a, g dbSNP:780243518
259 259 -, c dbSNP:747352254
261 261 a, g dbSNP:200595267
263 263 c, t dbSNP:747165166
273 273 c, g, t dbSNP:375345686
274 274 a, g dbSNP:748531347
276 276 g, t dbSNP:770369522
277 277 a, t dbSNP:773845542
280 280 a, t dbSNP:763586286
282 282 c, g dbSNP:369440510
283 283 -, ag dbSNP:771239088
290 290 c, t dbSNP:190642427
292 292 c, t dbSNP:750277342
306 306 a, g dbSNP:762747141
330 330 c, t dbSNP:766348640
334 334 c, t dbSNP:751540046
336 336 c, t dbSNP:755074236
337 337 -, a dbSNP:748951752
338 338 -, a dbSNP:775204103
345 345 -, aag dbSNP:139788537
345 345 a, g, t dbSNP:781491444
346 346 -, g dbSNP:773933406
346 346 a, g dbSNP:80053447
363 363 a, c, t dbSNP:75454554
369 369 a, g dbSNP:541256105
376 376 -, cag dbSNP:761442716
386 386 a, g dbSNP:746275240
389 389 c, t dbSNP:779487649
390 390 c, g, t dbSNP:373621180
395 395 a, c dbSNP:768149057
413 413 a, g dbSNP:776156260
416 416 a, c dbSNP:771988272
417 417 c, t dbSNP:780033324
418 418 c, g dbSNP:746920419
420 420 a, g dbSNP:768497827
422 422 a, c dbSNP:776729949
438 438 -, c dbSNP:752723366
440 440 a, c, t dbSNP:114654066
442 442 c, t dbSNP:142582606
444 444 c, g dbSNP:573668161
445 445 -, c dbSNP:397515538
446 446 a, t dbSNP:759530807
454 454 c, t dbSNP:766711626
455 455 c, g dbSNP:534661233
464 464 c, g dbSNP:760049118
476 476 c, g dbSNP:200687912
478 478 a, c dbSNP:202042342
479 479 g, t dbSNP:753332305
498 498 -, gcaacagcagca dbSNP:778221347
499 499 -, gcaacagcagca dbSNP:758522642
499 499 -, c dbSNP:757628582
499 499 g, t dbSNP:756706964
503 503 -, cagcagcagcaacag dbSNP:781355841
506 506 a, c dbSNP:368475300
508 508 -, cagcaa dbSNP:746250446
508 508 a, g dbSNP:578193245
514 514 a, g dbSNP:545654311
515 515 -, cagcagcagcagcaacagcag dbSNP:768156797
515 515 -, cagcagcagcagcaacag dbSNP:747643938
516 516 a, g dbSNP:758173198
517 517 -, cagcagcagcaa dbSNP:773265213
521 521 -, cagcagcaa dbSNP:760467249
528 528 -, gc dbSNP:766342521
529 529 -, cag, cagcag, cagcagcag dbSNP:759395776
529 529 a, g dbSNP:563987595
530 530 -, cag dbSNP:776245966
531 531 a, g dbSNP:779943223
533 533 -, cagcagcagcagcagcaa dbSNP:764217017
535 535 a, g dbSNP:746807573
541 541 a, g dbSNP:768569177
544 544 acagcagcagcagcagcagcaacagcagccg, gcagcaacagcagca dbSNP:730880313
544 544 a, g dbSNP:781003025
550 550 -, cag, cagcag dbSNP:751673070
550 550 a, g dbSNP:575896136
551 551 -, cag dbSNP:757640364
553 553 a, g dbSNP:748186399
556 556 -, cagcagcaa dbSNP:746172653
560 560 a, c dbSNP:769836316
562 562 a, g dbSNP:773334040
565 565 a, g, t dbSNP:763117080
566 566 -, agg dbSNP:756600003
566 566 c, g dbSNP:774631263
569 569 c, g dbSNP:759833497
571 571 -, ggc dbSNP:746557318
571 571 a, g dbSNP:767984534
575 575 -, gcggcggcggct dbSNP:775676263
576 576 a, c dbSNP:753139240
577 577 c, g dbSNP:761281959
578 578 -, gcggcggct dbSNP:764306808
584 584 -, gct dbSNP:761978515
584 584 a, g dbSNP:542999615
586 586 -, gcggcg dbSNP:754255092
587 587 -, gcggcggcg dbSNP:750984370
587 587 -, gcg dbSNP:756546787
588 588 c, t dbSNP:749974335
591 591 c, t dbSNP:758081090
594 594 a, c dbSNP:766130437
595 595 -, gcggcggct dbSNP:777501691
595 595 a, g, t dbSNP:6921145
599 599 a, g dbSNP:781083561
601 601 g, t dbSNP:748015701
604 604 g, t dbSNP:756072084
605 605 a, g dbSNP:777793369
607 607 -, gcggcggctgcggcggcggcggcggctgcg dbSNP:606231174
607 607 g, t dbSNP:749375048
609 609 c, t dbSNP:372138746
610 610 g, t dbSNP:774424659
612 612 a, c dbSNP:746166928
615 615 -, ggcggctgcggcggcggc dbSNP:11498192
615 615 c, t dbSNP:772291669
616 616 a, g dbSNP:775972769
617 617 a, g dbSNP:761037120
619 619 c, t dbSNP:371399056
628 628 c, t dbSNP:376449674
630 630 a, g dbSNP:772777645
631 631 a, g dbSNP:368258190
648 648 a, g dbSNP:766042547
651 651 a, t dbSNP:150962268
653 653 a, c dbSNP:754711247
654 654 g, t dbSNP:767171242
658 658 a, c, g dbSNP:752571746
659 659 a, g dbSNP:376849024
660 660 c, t dbSNP:749283473
675 675 c, t dbSNP:528470044
676 676 c, g dbSNP:368977633
679 679 c, t dbSNP:140761255
684 684 c, t dbSNP:150088136
688 688 c, g dbSNP:772361635
691 691 a, g dbSNP:368995035
694 694 a, c dbSNP:747378618
700 700 c, t dbSNP:769224159
703 703 c, g dbSNP:552061660
704 704 g, t dbSNP:762474281
727 727 c, g dbSNP:765787677
742 742 c, t dbSNP:181096602
760 760 a, c dbSNP:759074837
766 766 a, c, g dbSNP:767207344
770 770 a, g dbSNP:760449546
788 788 c, t dbSNP:759100705
790 790 c, t dbSNP:147760046
794 794 a, g dbSNP:370512978
796 796 a, g dbSNP:760361518
800 800 c, t dbSNP:763852761
808 808 a, g dbSNP:753653583
810 810 c, t dbSNP:373029816
829 829 a, g dbSNP:549934715
832 832 g, t dbSNP:750408740
835 835 c, t dbSNP:758487556
840 840 a, g dbSNP:780062825
861 861 a, c, g dbSNP:104893995
876 876 c, t dbSNP:568476296
878 878 a, g dbSNP:201647225
879 879 c, g, t dbSNP:104893989
886 886 c, g dbSNP:147359883
890 890 c, g dbSNP:182416246
904 904 c, t dbSNP:115974315
925 925 a, g dbSNP:533778847
927 927 a, g dbSNP:104893990
937 937 c, t dbSNP:779498610
943 943 c, t dbSNP:746525189
946 946 c, t dbSNP:542875205
947 947 a, g dbSNP:113836922
953 953 a, g dbSNP:104893993
961 961 c, t dbSNP:776247579
962 962 a, g dbSNP:147009083
964 964 a, c, t dbSNP:528172842
966 966 g, t dbSNP:772926106
968 968 a, g dbSNP:762910660
993 993 a, g dbSNP:138138469
997 997 c, g dbSNP:774518258
1000 1000 a, t dbSNP:759679284
1003 1003 a, t dbSNP:767772937
1009 1009 a, t dbSNP:752933596
1018 1018 a, g dbSNP:115763613
1028 1028 c, t dbSNP:104893992
1029 1029 a, g dbSNP:104893991
1030 1030 a, g dbSNP:764473197
1036 1036 c, t dbSNP:754184804
1043 1043 a, c dbSNP:765653239
1057 1057 c, t dbSNP:750894797
1058 1058 c, g dbSNP:373709122
1059 1059 a, g dbSNP:780701424
1062 1062 a, t dbSNP:180860949
1070 1070 a, c, t dbSNP:752156180
1071 1071 c, t dbSNP:186720964
1072 1072 c, t dbSNP:777281204
1075 1075 a, t dbSNP:749040759
1083 1083 c, g dbSNP:770818987
1087 1087 a, c dbSNP:778901535
1092 1092 c, t dbSNP:745752587
1106 1106 c, t dbSNP:11498200
1107 1107 a, g dbSNP:376891808
1116 1116 a, g dbSNP:377128508
1120 1120 c, t dbSNP:768838744
1122 1122 g, t dbSNP:776708490
1136 1136 a, g dbSNP:762058135
1143 1143 a, c, t dbSNP:563772449
1147 1147 a, g dbSNP:12173874
1154 1154 c, t dbSNP:370486033
1158 1158 c, g dbSNP:766812325
1162 1162 a, c dbSNP:576261808
1181 1181 c, t dbSNP:755578627
1218 1218 c, t dbSNP:148326029
1225 1225 c, g dbSNP:760143015
1239 1239 c, g dbSNP:763466386
1240 1240 a, g dbSNP:554000247
1242 1242 c, t dbSNP:201584115
1243 1243 a, g dbSNP:764992178
1246 1246 a, g dbSNP:104893988
1253 1253 c, g dbSNP:370331024
1256 1256 c, g dbSNP:758120505
1257 1257 a, g dbSNP:779939748
1259 1259 g, t dbSNP:746897678
1263 1263 a, t dbSNP:754963913
1265 1265 c, t dbSNP:781207125
1266 1266 c, g dbSNP:748242152
1269 1269 c, g dbSNP:769922027
1274 1274 c, t dbSNP:141447644
1287 1287 c, t dbSNP:749565421
1288 1288 a, g dbSNP:146314825
1289 1289 c, t dbSNP:78532572
1292 1292 c, g dbSNP:774805163
1293 1293 c, g dbSNP:535706340
1294 1294 g, t dbSNP:768076425
1295 1295 c, t dbSNP:776221631
1307 1307 a, g dbSNP:761391105
1314 1314 c, t dbSNP:746114073
1315 1315 a, g, t dbSNP:139514226
1327 1327 a, t dbSNP:757437094
1328 1328 c, t dbSNP:751400416
1332 1332 g, t dbSNP:143092997
1344 1344 a, c dbSNP:781096197
1347 1347 c, g dbSNP:114554762
1353 1353 a, c dbSNP:750138653
1354 1354 c, t dbSNP:566033645
1355 1355 a, g dbSNP:373752642
1356 1356 a, c dbSNP:749426825
1358 1358 a, g dbSNP:771219239
1367 1367 c, t dbSNP:779082630
1368 1368 a, g dbSNP:367898326
1384 1384 a, t dbSNP:770417240
1388 1388 c, g, t dbSNP:140165241
1395 1395 c, g dbSNP:767251365
1421 1421 a, g dbSNP:752525068
1423 1423 a, c dbSNP:760543307
1429 1429 a, g dbSNP:574709560
1445 1445 c, t dbSNP:753780685
1446 1446 a, g dbSNP:757351966
1453 1453 a, c, t dbSNP:778896510
1455 1455 a, g dbSNP:115347084
1460 1460 c, t dbSNP:397515537
1461 1461 a, g dbSNP:780524636
1470 1470 a, t dbSNP:747380594
1473 1473 a, c dbSNP:755482498
1477 1477 c, t dbSNP:115129262
1489 1489 c, t dbSNP:781721459
1490 1490 a, c dbSNP:748644984
1494 1494 -, c dbSNP:730880314
1494 1494 c, t dbSNP:770452837
1495 1495 a, g dbSNP:200992166
1497 1497 c, t dbSNP:376694142
1498 1498 a, t dbSNP:771720805
1517 1517 -, c dbSNP:730880315
1519 1519 c, t dbSNP:775211415
1528 1528 c, t dbSNP:369957440
1529 1529 a, g dbSNP:763860044
1546 1546 c, t dbSNP:776596579
1563 1563 c, t dbSNP:761701398
1569 1569 c, t dbSNP:765308202
1570 1570 c, t dbSNP:376083944
1571 1571 a, g dbSNP:758626590
1585 1585 a, c dbSNP:144760627
1594 1594 a, g dbSNP:766719397
1596 1596 a, c, t dbSNP:751887748
1600 1600 c, t dbSNP:781460245
1604 1604 a, g dbSNP:748640088
1638 1638 c, t dbSNP:369481795
1639 1639 a, g dbSNP:778422878
1645 1645 a, g dbSNP:745399877
1647 1647 c, t dbSNP:771630924
1657 1657 g, t dbSNP:775121825
1658 1658 c, t dbSNP:746700872
1668 1668 c, t dbSNP:768473049
1669 1669 a, c, g dbSNP:756718952
1670 1670 c, g dbSNP:765089321
1671 1671 c, g dbSNP:554124503
1679 1679 c, t dbSNP:373218126
1680 1680 a, g dbSNP:148639759
1685 1685 c, t dbSNP:751811026
1686 1686 c, t dbSNP:144852234
1690 1690 a, c, t dbSNP:755177539
1699 1699 a, t dbSNP:753012526
1701 1701 c, t dbSNP:142108189
1702 1702 a, g, t dbSNP:114897742
1705 1705 a, g dbSNP:371147260
1723 1723 c, t dbSNP:374159865
1725 1725 g, t dbSNP:746611102
1726 1726 c, t dbSNP:745395833
1730 1730 a, g dbSNP:768220317
1731 1731 c, t dbSNP:780973109
1732 1732 a, g dbSNP:147783693
1735 1735 a, g dbSNP:769686958
1743 1743 a, c dbSNP:773277224
1756 1756 c, t dbSNP:202246150
1772 1772 a, g dbSNP:771087017
1774 1774 c, t dbSNP:377403216
1776 1776 c, t dbSNP:774604105
1778 1778 a, g dbSNP:759738332
1780 1780 c, t dbSNP:141100653
1792 1792 c, t dbSNP:564461142
1802 1802 a, g dbSNP:753025447
1820 1820 a, c, g, t dbSNP:11498198
1822 1822 c, t dbSNP:764484914
1827 1827 c, t dbSNP:754318665
1854 1854 c, g dbSNP:104893994
1863 1863 c, t dbSNP:200866173
1873 1873 c, t dbSNP:779494886
1891 1891 c, g dbSNP:751032904
1896 1896 a, c dbSNP:376928739
1896 1896 -, c dbSNP:750479505
1898 1898 c, t dbSNP:780694693
1902 1902 c, t dbSNP:144321470
1903 1903 a, g, t dbSNP:769454803
1923 1923 -, agag dbSNP:550883071
1924 1924 g, t dbSNP:562720936
1984 1984 -, t dbSNP:761177808
2021 2021 a, g dbSNP:529807832
2067 2067 a, g dbSNP:79061067
2073 2073 a, g dbSNP:775436924
2104 2104 a, c dbSNP:566697809
2130 2130 a, c dbSNP:527570415
2133 2133 a, g dbSNP:142301498
2154 2154 a, g dbSNP:542320894
2159 2159 a, g dbSNP:146801654
2173 2173 c, t dbSNP:78935067
2180 2180 a, t dbSNP:180855207
2234 2234 a, g dbSNP:568643332
2259 2259 c, g dbSNP:768542647
2269 2269 c, t dbSNP:535722111
2276 2276 a, g dbSNP:554335585
2300 2300 c, t dbSNP:140502641
2336 2336 a, g dbSNP:773272072
2365 2365 a, t dbSNP:546501035
2412 2412 c, t dbSNP:558207106
2413 2413 a, g dbSNP:770552169
2447 2447 g, t dbSNP:199528647
2447 2447 -, t dbSNP:35084034
2453 2453 g, t dbSNP:45571536
2454 2454 g, t dbSNP:45585135
2455 2455 g, t dbSNP:748683376
2463 2463 -, t dbSNP:398001403
2465 2465 c, t dbSNP:200995981
2531 2531 c, t dbSNP:543940721
2533 2533 c, t dbSNP:185842387
2548 2548 c, g dbSNP:561815219
2563 2563 a, g dbSNP:565794
2569 2569 c, g dbSNP:761021972
2598 2598 c, t dbSNP:766351922
2610 2610 a, c dbSNP:772515276
2614 2614 a, g dbSNP:574072831
2656 2656 a, g dbSNP:143518330
2657 2657 c, t dbSNP:560277927
2667 2667 g, t dbSNP:566712
2670 2670 g, t dbSNP:590091
2685 2685 a, t dbSNP:527608966
2725 2725 c, t dbSNP:552023232
2802 2802 c, t dbSNP:759725273
2939 2939 a, c dbSNP:6906876
2988 2988 a, t dbSNP:188598788
3029 3029 a, c dbSNP:765793000
3047 3047 a, g dbSNP:527904643
3048 3048 c, t dbSNP:753308506
3049 3049 a, g dbSNP:549748553
3056 3056 a, t dbSNP:181813204
3133 3133 c, t dbSNP:756225322
3159 3159 a, g dbSNP:186839291
3189 3189 a, g dbSNP:747265691
3214 3214 a, t dbSNP:764058322
3215 3215 a, g dbSNP:764587864
3255 3255 -, agtc dbSNP:767029587
3270 3270 a, g dbSNP:146749281
3290 3290 -, a dbSNP:147020695
3293 3293 a, t dbSNP:547614137
3303 3303 c, t dbSNP:77856760
3315 3315 a, g dbSNP:540154506
3326 3326 c, t dbSNP:191996120
3389 3389 c, t dbSNP:140371943
3404 3404 a, t dbSNP:757660837
3461 3461 c, g dbSNP:779337167
3481 3481 a, g dbSNP:776703994
3507 3507 a, c dbSNP:756877224
3529 3529 g, t dbSNP:780712881
3539 3539 c, g dbSNP:745340776
3551 3551 c, t dbSNP:755642283
3552 3552 a, t dbSNP:779942831
3563 3563 c, t dbSNP:537488922
3615 3615 c, g dbSNP:555720589
3617 3617 c, g dbSNP:77663988
3714 3714 a, g dbSNP:115078186
3760 3760 c, t dbSNP:560110427
3774 3774 c, t dbSNP:6912472
3844 3844 c, t dbSNP:374058568
3845 3845 a, c dbSNP:546466948
3856 3856 a, g dbSNP:150354057
3932 3932 a, g dbSNP:747904805
3937 3937 a, g dbSNP:771149393
4022 4022 c, g dbSNP:777019780
4023 4023 a, c dbSNP:183868596
4054 4054 a, g dbSNP:144977950
4091 4091 g, t dbSNP:531493813
4104 4104 a, g dbSNP:367933871
4129 4129 c, t dbSNP:186219428
4183 4183 g, t dbSNP:765451254
4237 4237 a, g dbSNP:561705802
4269 4269 a, g dbSNP:763614056
4282 4282 a, g dbSNP:764523126
4334 4334 a, c dbSNP:540392893
4335 4335 c, t dbSNP:149059421
4336 4336 a, g dbSNP:759708464
4384 4384 c, g dbSNP:566289090
4444 4444 c, t dbSNP:7451304
4467 4467 c, g dbSNP:539989584
4474 4474 a, g dbSNP:554964716
4492 4492 g, t dbSNP:568478870
4497 4497 a, g dbSNP:7451384
4512 4512 g, t dbSNP:537428636
4553 4553 -, t dbSNP:11320232
4554 4554 -, t dbSNP:527884872
4567 4567 -, t dbSNP:398001404
4570 4570 c, t dbSNP:199935487
4666 4666 a, g dbSNP:570401980
4678 4678 a, g dbSNP:767148065
4681 4681 a, g dbSNP:537731522
4693 4693 c, g dbSNP:80072481
4700 4700 a, c dbSNP:558458433
4735 4735 a, c dbSNP:567622268
4771 4771 c, t dbSNP:779603310
4774 4774 c, t dbSNP:564322026
4777 4777 a, g dbSNP:371194782
4797 4797 a, g dbSNP:775967518
4801 4801 c, t dbSNP:577713160
4823 4823 a, t dbSNP:545633634
4846 4846 c, t dbSNP:189846967
4885 4885 c, t dbSNP:145866183
4902 4902 a, c dbSNP:182124295
4961 4961 a, g dbSNP:754883079
4966 4966 c, t dbSNP:561547493
4982 4982 c, t dbSNP:528842708
5005 5005 c, t dbSNP:778716561
5014 5014 c, t dbSNP:138689945
5015 5015 g, t dbSNP:1200428
5033 5033 a, g dbSNP:533047925
5034 5034 c, g dbSNP:552035909
5049 5049 c, t dbSNP:372592934
5060 5060 a, g dbSNP:570239093
5073 5073 a, g dbSNP:554368801
5087 5087 c, t dbSNP:746161639
5158 5158 a, g dbSNP:769982069
5181 5181 a, g dbSNP:531131170
5187 5187 a, g dbSNP:549617601
5200 5200 a, g dbSNP:376702554
5212 5212 c, t dbSNP:544428927
5281 5281 c, t dbSNP:534970370
5344 5344 -, g dbSNP:35633395
5345 5345 c, g dbSNP:552941147
5378 5378 c, g dbSNP:571442606
5423 5423 c, t dbSNP:142687054
5427 5427 g, t dbSNP:574186575
5447 5447 a, g dbSNP:62400377
5460 5460 c, t dbSNP:562888619
5503 5503 a, g dbSNP:557555226
5548 5548 a, g dbSNP:146924197

Target ORF information:

RefSeq Version XM_011514962
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56665
Accession Version XM_011514963.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1659bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product runt-related transcription factor 2 isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1022..1423(+)
Position Chain Variation Link
32 32 a, c dbSNP:557766231
52 52 c, t dbSNP:576181122
56 56 c, g dbSNP:373733030
57 57 a, t dbSNP:576227424
96 96 c, t dbSNP:543513790
108 108 c, t dbSNP:377632251
114 114 -, a dbSNP:770336284
149 149 c, t dbSNP:370013884
182 182 a, c, t dbSNP:78404771
186 186 g, t dbSNP:59983488
200 200 a, g dbSNP:191044472
313 313 a, g dbSNP:183363697
314 314 a, t dbSNP:559791932
337 337 c, g dbSNP:533720661
348 348 a, c dbSNP:551464913
353 353 c, t dbSNP:768372920
363 363 -, agag dbSNP:574843755
381 381 c, g dbSNP:563673110
389 389 a, g dbSNP:373586465
418 418 c, t dbSNP:549026186
419 419 a, c dbSNP:761278947
470 470 c, t dbSNP:767060928
478 478 a, g dbSNP:764602062
479 479 -, a dbSNP:772527355
479 479 c, g dbSNP:754284908
480 480 -, a dbSNP:748227725
483 483 a, g dbSNP:762474209
489 489 a, g dbSNP:765951891
491 491 g, t dbSNP:751140132
503 503 c, t dbSNP:754641139
505 505 c, g dbSNP:780715215
506 506 c, t dbSNP:752481856
526 526 a, g dbSNP:755849928
528 528 c, t dbSNP:567427002
534 534 c, t dbSNP:79058520
535 535 a, g dbSNP:369627478
544 544 a, g dbSNP:778914485
545 545 c, t dbSNP:745978591
552 552 -, aga dbSNP:527702629
552 552 a, c dbSNP:60586642
553 553 a, g dbSNP:772269517
563 563 g, t dbSNP:775587041
565 565 c, t dbSNP:535268603
566 566 a, g dbSNP:773115189
570 570 a, c dbSNP:777173077
572 572 a, c dbSNP:762384261
579 579 c, t dbSNP:765880141
584 584 a, g dbSNP:372340475
586 586 a, g dbSNP:759132634
599 599 c, t dbSNP:767115139
602 602 c, t dbSNP:752289141
608 608 c, t dbSNP:535015975
611 611 a, c dbSNP:763775731
614 614 c, t dbSNP:753655529
615 615 a, g dbSNP:757144784
617 617 c, t dbSNP:778824476
619 619 a, g dbSNP:745887977
625 625 c, t dbSNP:758392852
626 626 a, g dbSNP:780243518
631 631 -, c dbSNP:747352254
633 633 a, g dbSNP:200595267
635 635 c, t dbSNP:747165166
645 645 c, g, t dbSNP:375345686
646 646 a, g dbSNP:748531347
648 648 g, t dbSNP:770369522
649 649 a, t dbSNP:773845542
652 652 a, t dbSNP:763586286
654 654 c, g dbSNP:369440510
655 655 -, ag dbSNP:771239088
662 662 c, t dbSNP:190642427
664 664 c, t dbSNP:750277342
678 678 a, g dbSNP:762747141
702 702 c, t dbSNP:766348640
706 706 c, t dbSNP:751540046
708 708 c, t dbSNP:755074236
709 709 -, a dbSNP:748951752
710 710 -, a dbSNP:775204103
717 717 -, aag dbSNP:139788537
717 717 a, g, t dbSNP:781491444
718 718 -, g dbSNP:773933406
718 718 a, g dbSNP:80053447
735 735 a, c, t dbSNP:75454554
741 741 a, g dbSNP:541256105
748 748 -, cag dbSNP:761442716
758 758 a, g dbSNP:746275240
761 761 c, t dbSNP:779487649
762 762 c, g, t dbSNP:373621180
767 767 a, c dbSNP:768149057
785 785 a, g dbSNP:776156260
788 788 a, c dbSNP:771988272
789 789 c, t dbSNP:780033324
790 790 c, g dbSNP:746920419
792 792 a, g dbSNP:768497827
794 794 a, c dbSNP:776729949
810 810 -, c dbSNP:752723366
812 812 a, c, t dbSNP:114654066
814 814 c, t dbSNP:142582606
816 816 c, g dbSNP:573668161
817 817 -, c dbSNP:397515538
818 818 a, t dbSNP:759530807
826 826 c, t dbSNP:766711626
827 827 c, g dbSNP:534661233
836 836 c, g dbSNP:760049118
848 848 c, g dbSNP:200687912
850 850 a, c dbSNP:202042342
851 851 g, t dbSNP:753332305
870 870 -, gcaacagcagca dbSNP:778221347
871 871 -, gcaacagcagca dbSNP:758522642
871 871 -, c dbSNP:757628582
871 871 g, t dbSNP:756706964
875 875 -, cagcagcagcaacag dbSNP:781355841
878 878 a, c dbSNP:368475300
880 880 -, cagcaa dbSNP:746250446
880 880 a, g dbSNP:578193245
886 886 a, g dbSNP:545654311
887 887 -, cagcagcagcagcaacagcag dbSNP:768156797
887 887 -, cagcagcagcagcaacag dbSNP:747643938
888 888 a, g dbSNP:758173198
889 889 -, cagcagcagcaa dbSNP:773265213
893 893 -, cagcagcaa dbSNP:760467249
900 900 -, gc dbSNP:766342521
901 901 -, cag, cagcag, cagcagcag dbSNP:759395776
901 901 a, g dbSNP:563987595
902 902 -, cag dbSNP:776245966
903 903 a, g dbSNP:779943223
905 905 -, cagcagcagcagcagcaa dbSNP:764217017
907 907 a, g dbSNP:746807573
913 913 a, g dbSNP:768569177
916 916 acagcagcagcagcagcagcaacagcagccg, gcagcaacagcagca dbSNP:730880313
916 916 a, g dbSNP:781003025
922 922 -, cag, cagcag dbSNP:751673070
922 922 a, g dbSNP:575896136
923 923 -, cag dbSNP:757640364
925 925 a, g dbSNP:748186399
928 928 -, cagcagcaa dbSNP:746172653
932 932 a, c dbSNP:769836316
934 934 a, g dbSNP:773334040
937 937 a, g, t dbSNP:763117080
938 938 -, agg dbSNP:756600003
938 938 c, g dbSNP:774631263
941 941 c, g dbSNP:759833497
943 943 -, ggc dbSNP:746557318
943 943 a, g dbSNP:767984534
947 947 -, gcggcggcggct dbSNP:775676263
948 948 a, c dbSNP:753139240
949 949 c, g dbSNP:761281959
950 950 -, gcggcggct dbSNP:764306808
956 956 -, gct dbSNP:761978515
956 956 a, g dbSNP:542999615
958 958 -, gcggcg dbSNP:754255092
959 959 -, gcggcggcg dbSNP:750984370
959 959 -, gcg dbSNP:756546787
960 960 c, t dbSNP:749974335
963 963 c, t dbSNP:758081090
966 966 a, c dbSNP:766130437
967 967 -, gcggcggct dbSNP:777501691
967 967 a, g, t dbSNP:6921145
971 971 a, g dbSNP:781083561
973 973 g, t dbSNP:748015701
976 976 g, t dbSNP:756072084
977 977 a, g dbSNP:777793369
979 979 -, gcggcggctgcggcggcggcggcggctgcg dbSNP:606231174
979 979 g, t dbSNP:749375048
981 981 c, t dbSNP:372138746
982 982 g, t dbSNP:774424659
984 984 a, c dbSNP:746166928
987 987 -, ggcggctgcggcggcggc dbSNP:11498192
987 987 c, t dbSNP:772291669
988 988 a, g dbSNP:775972769
989 989 a, g dbSNP:761037120
991 991 c, t dbSNP:371399056
1000 1000 c, t dbSNP:376449674
1002 1002 a, g dbSNP:772777645
1003 1003 a, g dbSNP:368258190
1020 1020 a, g dbSNP:766042547
1023 1023 a, t dbSNP:150962268
1025 1025 a, c dbSNP:754711247
1026 1026 g, t dbSNP:767171242
1030 1030 a, c, g dbSNP:752571746
1031 1031 a, g dbSNP:376849024
1032 1032 c, t dbSNP:749283473
1047 1047 c, t dbSNP:528470044
1048 1048 c, g dbSNP:368977633
1051 1051 c, t dbSNP:140761255
1056 1056 c, t dbSNP:150088136
1060 1060 c, g dbSNP:772361635
1063 1063 a, g dbSNP:368995035
1066 1066 a, c dbSNP:747378618
1072 1072 c, t dbSNP:769224159
1075 1075 c, g dbSNP:552061660
1076 1076 g, t dbSNP:762474281
1099 1099 c, g dbSNP:765787677
1114 1114 c, t dbSNP:181096602
1132 1132 a, c dbSNP:759074837
1138 1138 a, c, g dbSNP:767207344
1142 1142 a, g dbSNP:760449546
1160 1160 c, t dbSNP:759100705
1162 1162 c, t dbSNP:147760046
1166 1166 a, g dbSNP:370512978
1168 1168 a, g dbSNP:760361518
1172 1172 c, t dbSNP:763852761
1180 1180 a, g dbSNP:753653583
1182 1182 c, t dbSNP:373029816
1201 1201 a, g dbSNP:549934715
1204 1204 g, t dbSNP:750408740
1207 1207 c, t dbSNP:758487556
1212 1212 a, g dbSNP:780062825
1233 1233 a, c, g dbSNP:104893995
1248 1248 c, t dbSNP:568476296
1250 1250 a, g dbSNP:201647225
1251 1251 c, g, t dbSNP:104893989
1258 1258 c, g dbSNP:147359883
1262 1262 c, g dbSNP:182416246
1276 1276 c, t dbSNP:115974315
1297 1297 a, g dbSNP:533778847
1299 1299 a, g dbSNP:104893990
1309 1309 c, t dbSNP:779498610
1315 1315 c, t dbSNP:746525189
1318 1318 c, t dbSNP:542875205
1319 1319 a, g dbSNP:113836922
1325 1325 a, g dbSNP:104893993
1333 1333 c, t dbSNP:776247579
1334 1334 a, g dbSNP:147009083
1336 1336 a, c, t dbSNP:528172842
1338 1338 g, t dbSNP:772926106
1340 1340 a, g dbSNP:762910660
1365 1365 a, g dbSNP:138138469
1369 1369 c, g dbSNP:774518258
1372 1372 a, t dbSNP:759679284
1375 1375 a, t dbSNP:767772937
1381 1381 a, t dbSNP:752933596
1390 1390 a, g dbSNP:115763613
1400 1400 c, t dbSNP:104893992
1401 1401 a, g dbSNP:104893991
1402 1402 a, g dbSNP:764473197
1408 1408 c, t dbSNP:754184804
1416 1416 c, t dbSNP:148326029
1423 1423 c, g dbSNP:760143015
1437 1437 c, g dbSNP:763466386
1438 1438 a, g dbSNP:554000247
1440 1440 c, t dbSNP:201584115
1441 1441 a, g dbSNP:764992178
1444 1444 a, g dbSNP:104893988
1451 1451 c, g dbSNP:370331024
1454 1454 c, g dbSNP:758120505
1455 1455 a, g dbSNP:779939748
1457 1457 g, t dbSNP:746897678
1461 1461 a, t dbSNP:754963913
1463 1463 c, t dbSNP:781207125
1464 1464 c, g dbSNP:748242152
1467 1467 c, g dbSNP:769922027
1472 1472 c, t dbSNP:141447644
1485 1485 c, t dbSNP:749565421
1486 1486 a, g dbSNP:146314825
1487 1487 c, t dbSNP:78532572
1490 1490 c, g dbSNP:774805163
1491 1491 c, g dbSNP:535706340
1492 1492 g, t dbSNP:768076425
1493 1493 c, t dbSNP:776221631
1505 1505 a, g dbSNP:761391105
1512 1512 c, t dbSNP:746114073
1513 1513 a, g, t dbSNP:139514226
1525 1525 a, t dbSNP:757437094
1526 1526 c, t dbSNP:751400416
1530 1530 g, t dbSNP:143092997
1542 1542 a, c dbSNP:781096197
1545 1545 c, g dbSNP:114554762
1551 1551 a, c dbSNP:750138653
1552 1552 c, t dbSNP:566033645
1553 1553 a, g dbSNP:373752642
1554 1554 a, c dbSNP:749426825
1556 1556 a, g dbSNP:771219239
1565 1565 c, t dbSNP:779082630
1566 1566 a, g dbSNP:367898326
1586 1586 a, c dbSNP:758294076
1600 1600 c, g dbSNP:781528018
1630 1630 a, g dbSNP:377639296
1635 1635 a, t dbSNP:185524261
1641 1641 a, g dbSNP:557229443
1651 1651 c, t dbSNP:539437131
1654 1654 c, t dbSNP:767987444
1684 1684 c, t dbSNP:150415537
1701 1701 c, g dbSNP:569724942
1722 1722 c, t dbSNP:753081035
1737 1737 c, t dbSNP:756425872
1753 1753 g, t dbSNP:537643304
1796 1796 a, t dbSNP:138287579
1827 1827 c, g dbSNP:567962701
1828 1828 a, g dbSNP:535043121
1829 1829 a, c dbSNP:553611141
1832 1832 a, c dbSNP:577665369
1835 1835 a, g dbSNP:189593823
1849 1849 c, t dbSNP:557044348
1889 1889 c, g dbSNP:373166327
1893 1893 -, g dbSNP:35011178
1932 1932 c, t dbSNP:543624992
1943 1943 c, g dbSNP:561698935
1952 1952 c, t dbSNP:141476380
1960 1960 c, g dbSNP:369286886
2024 2024 a, g dbSNP:113861074
2135 2135 c, t dbSNP:111973698
2155 2155 c, t dbSNP:748911827
2178 2178 a, g dbSNP:541013378
2188 2188 a, c dbSNP:559588770
2191 2191 c, g dbSNP:111383948
2195 2195 a, g dbSNP:551346856
2210 2210 a, g dbSNP:769083619
2224 2224 a, g dbSNP:147004670
2235 2235 a, g dbSNP:545796338
2248 2248 c, t dbSNP:371638282
2249 2249 a, c dbSNP:73735420
2253 2253 a, c dbSNP:74697776
2267 2267 a, c dbSNP:762115885
2272 2272 c, t dbSNP:76035586
2273 2273 c, g dbSNP:745339808
2274 2274 a, g dbSNP:6458457
2282 2282 a, g dbSNP:571568274
2291 2291 g, t dbSNP:760305503
2304 2304 c, t dbSNP:541949831
2347 2347 c, t dbSNP:538652016
2348 2348 g, t dbSNP:775520055
2351 2351 c, t dbSNP:555168319
2382 2382 a, g dbSNP:374855822
2386 2386 c, g dbSNP:556909324
2394 2394 c, g dbSNP:112534392
2398 2398 c, t dbSNP:575350389
2399 2399 a, g dbSNP:180787852
2405 2405 c, t dbSNP:57853251
2407 2407 g, t dbSNP:753223303
2411 2411 c, t dbSNP:184980328
2413 2413 a, t dbSNP:754533293

Target ORF information:

RefSeq Version XM_011514963
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56666
Accession Version XM_011514964.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1527bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product runt-related transcription factor 2 isoform X5
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1008..1412(+)
Position Chain Variation Link
18 18 a, c dbSNP:557766231
38 38 c, t dbSNP:576181122
42 42 c, g dbSNP:373733030
43 43 a, t dbSNP:576227424
82 82 c, t dbSNP:543513790
94 94 c, t dbSNP:377632251
100 100 -, a dbSNP:770336284
135 135 c, t dbSNP:370013884
168 168 a, c, t dbSNP:78404771
172 172 g, t dbSNP:59983488
186 186 a, g dbSNP:191044472
299 299 a, g dbSNP:183363697
300 300 a, t dbSNP:559791932
323 323 c, g dbSNP:533720661
334 334 a, c dbSNP:551464913
339 339 c, t dbSNP:768372920
349 349 -, agag dbSNP:574843755
367 367 c, g dbSNP:563673110
375 375 a, g dbSNP:373586465
404 404 c, t dbSNP:549026186
405 405 a, c dbSNP:761278947
456 456 c, t dbSNP:767060928
464 464 a, g dbSNP:764602062
465 465 -, a dbSNP:772527355
465 465 c, g dbSNP:754284908
466 466 -, a dbSNP:748227725
469 469 a, g dbSNP:762474209
475 475 a, g dbSNP:765951891
477 477 g, t dbSNP:751140132
489 489 c, t dbSNP:754641139
491 491 c, g dbSNP:780715215
492 492 c, t dbSNP:752481856
512 512 a, g dbSNP:755849928
514 514 c, t dbSNP:567427002
520 520 c, t dbSNP:79058520
521 521 a, g dbSNP:369627478
530 530 a, g dbSNP:778914485
531 531 c, t dbSNP:745978591
538 538 -, aga dbSNP:527702629
538 538 a, c dbSNP:60586642
539 539 a, g dbSNP:772269517
549 549 g, t dbSNP:775587041
551 551 c, t dbSNP:535268603
552 552 a, g dbSNP:773115189
556 556 a, c dbSNP:777173077
558 558 a, c dbSNP:762384261
565 565 c, t dbSNP:765880141
570 570 a, g dbSNP:372340475
572 572 a, g dbSNP:759132634
585 585 c, t dbSNP:767115139
588 588 c, t dbSNP:752289141
594 594 c, t dbSNP:535015975
597 597 a, c dbSNP:763775731
600 600 c, t dbSNP:753655529
601 601 a, g dbSNP:757144784
603 603 c, t dbSNP:778824476
605 605 a, g dbSNP:745887977
611 611 c, t dbSNP:758392852
612 612 a, g dbSNP:780243518
617 617 -, c dbSNP:747352254
619 619 a, g dbSNP:200595267
621 621 c, t dbSNP:747165166
631 631 c, g, t dbSNP:375345686
632 632 a, g dbSNP:748531347
634 634 g, t dbSNP:770369522
635 635 a, t dbSNP:773845542
638 638 a, t dbSNP:763586286
640 640 c, g dbSNP:369440510
641 641 -, ag dbSNP:771239088
648 648 c, t dbSNP:190642427
650 650 c, t dbSNP:750277342
664 664 a, g dbSNP:762747141
688 688 c, t dbSNP:766348640
692 692 c, t dbSNP:751540046
694 694 c, t dbSNP:755074236
695 695 -, a dbSNP:748951752
696 696 -, a dbSNP:775204103
703 703 -, aag dbSNP:139788537
703 703 a, g, t dbSNP:781491444
704 704 -, g dbSNP:773933406
704 704 a, g dbSNP:80053447
721 721 a, c, t dbSNP:75454554
727 727 a, g dbSNP:541256105
734 734 -, cag dbSNP:761442716
744 744 a, g dbSNP:746275240
747 747 c, t dbSNP:779487649
748 748 c, g, t dbSNP:373621180
753 753 a, c dbSNP:768149057
771 771 a, g dbSNP:776156260
774 774 a, c dbSNP:771988272
775 775 c, t dbSNP:780033324
776 776 c, g dbSNP:746920419
778 778 a, g dbSNP:768497827
780 780 a, c dbSNP:776729949
796 796 -, c dbSNP:752723366
798 798 a, c, t dbSNP:114654066
800 800 c, t dbSNP:142582606
802 802 c, g dbSNP:573668161
803 803 -, c dbSNP:397515538
804 804 a, t dbSNP:759530807
812 812 c, t dbSNP:766711626
813 813 c, g dbSNP:534661233
822 822 c, g dbSNP:760049118
834 834 c, g dbSNP:200687912
836 836 a, c dbSNP:202042342
837 837 g, t dbSNP:753332305
856 856 -, gcaacagcagca dbSNP:778221347
857 857 -, gcaacagcagca dbSNP:758522642
857 857 -, c dbSNP:757628582
857 857 g, t dbSNP:756706964
861 861 -, cagcagcagcaacag dbSNP:781355841
864 864 a, c dbSNP:368475300
866 866 -, cagcaa dbSNP:746250446
866 866 a, g dbSNP:578193245
872 872 a, g dbSNP:545654311
873 873 -, cagcagcagcagcaacagcag dbSNP:768156797
873 873 -, cagcagcagcagcaacag dbSNP:747643938
874 874 a, g dbSNP:758173198
875 875 -, cagcagcagcaa dbSNP:773265213
879 879 -, cagcagcaa dbSNP:760467249
886 886 -, gc dbSNP:766342521
887 887 -, cag, cagcag, cagcagcag dbSNP:759395776
887 887 a, g dbSNP:563987595
888 888 -, cag dbSNP:776245966
889 889 a, g dbSNP:779943223
891 891 -, cagcagcagcagcagcaa dbSNP:764217017
893 893 a, g dbSNP:746807573
899 899 a, g dbSNP:768569177
902 902 acagcagcagcagcagcagcaacagcagccg, gcagcaacagcagca dbSNP:730880313
902 902 a, g dbSNP:781003025
908 908 -, cag, cagcag dbSNP:751673070
908 908 a, g dbSNP:575896136
909 909 -, cag dbSNP:757640364
911 911 a, g dbSNP:748186399
914 914 -, cagcagcaa dbSNP:746172653
918 918 a, c dbSNP:769836316
920 920 a, g dbSNP:773334040
923 923 a, g, t dbSNP:763117080
924 924 -, agg dbSNP:756600003
924 924 c, g dbSNP:774631263
927 927 c, g dbSNP:759833497
929 929 -, ggc dbSNP:746557318
929 929 a, g dbSNP:767984534
933 933 -, gcggcggcggct dbSNP:775676263
934 934 a, c dbSNP:753139240
935 935 c, g dbSNP:761281959
936 936 -, gcggcggct dbSNP:764306808
942 942 -, gct dbSNP:761978515
942 942 a, g dbSNP:542999615
944 944 -, gcggcg dbSNP:754255092
945 945 -, gcggcggcg dbSNP:750984370
945 945 -, gcg dbSNP:756546787
946 946 c, t dbSNP:749974335
949 949 c, t dbSNP:758081090
952 952 a, c dbSNP:766130437
953 953 -, gcggcggct dbSNP:777501691
953 953 a, g, t dbSNP:6921145
957 957 a, g dbSNP:781083561
959 959 g, t dbSNP:748015701
962 962 g, t dbSNP:756072084
963 963 a, g dbSNP:777793369
965 965 -, gcggcggctgcggcggcggcggcggctgcg dbSNP:606231174
965 965 g, t dbSNP:749375048
967 967 c, t dbSNP:372138746
968 968 g, t dbSNP:774424659
970 970 a, c dbSNP:746166928
973 973 -, ggcggctgcggcggcggc dbSNP:11498192
973 973 c, t dbSNP:772291669
974 974 a, g dbSNP:775972769
975 975 a, g dbSNP:761037120
977 977 c, t dbSNP:371399056
986 986 c, t dbSNP:376449674
988 988 a, g dbSNP:772777645
989 989 a, g dbSNP:368258190
1006 1006 a, g dbSNP:766042547
1009 1009 a, t dbSNP:150962268
1011 1011 a, c dbSNP:754711247
1012 1012 g, t dbSNP:767171242
1016 1016 a, c, g dbSNP:752571746
1017 1017 a, g dbSNP:376849024
1018 1018 c, t dbSNP:749283473
1033 1033 c, t dbSNP:528470044
1034 1034 c, g dbSNP:368977633
1037 1037 c, t dbSNP:140761255
1042 1042 c, t dbSNP:150088136
1046 1046 c, g dbSNP:772361635
1049 1049 a, g dbSNP:368995035
1052 1052 a, c dbSNP:747378618
1058 1058 c, t dbSNP:769224159
1061 1061 c, g dbSNP:552061660
1062 1062 g, t dbSNP:762474281
1085 1085 c, g dbSNP:765787677
1100 1100 c, t dbSNP:181096602
1118 1118 a, c dbSNP:759074837
1124 1124 a, c, g dbSNP:767207344
1128 1128 a, g dbSNP:760449546
1146 1146 c, t dbSNP:759100705
1148 1148 c, t dbSNP:147760046
1152 1152 a, g dbSNP:370512978
1154 1154 a, g dbSNP:760361518
1158 1158 c, t dbSNP:763852761
1166 1166