Home » Species Summary » Homo sapiens » SQSTM1 cDNA ORF clone
Email to GenScript

SQSTM1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SQSTM1
Entrez Gene ID 8878
Full Name sequestosome 1
Synonyms A170, FTDALS3, OSIL, PDB3, ZIP3, p60, p62, p62B
General protein information
Preferred Names
EBI3-associated protein p60
oxidative stress induced like
ubiquitin-binding protein p62
EBI3-associated protein of 60 kDa
phosphotyrosine independent ligand for the Lck SH2 domain p62
phosphotyrosine-independent ligand for the Lck SH2 domain of 62 kDa
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]. lac of sum
Disorder MIM:


Disorder Html: Paget disease of bone, 602080 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_001142298 NP_001135770 sequestosome-1 isoform 2
NM_001142299 NP_001135771 sequestosome-1 isoform 2
NM_003900 NP_003891 sequestosome-1 isoform 1
XM_011534683 XP_011532985 sequestosome-1 isoform X1
XM_011534684 XP_011532986 sequestosome-1 isoform X2

hsa04380 Osteoclast differentiation
R-HSA-168256 Immune System
R-HSA-1280215 Cytokine Signaling in Immune system
R-HSA-446652 Interleukin-1 signaling
R-HSA-449147 Signaling by Interleukins
R-HSA-162582 Signal Transduction
R-HSA-166520 Signalling by NGF
R-HSA-193704 p75 NTR receptor-mediated signalling
R-HSA-204998 Cell death signalling via NRAGE, NRIF and NADE
R-HSA-205043 NRIF signals cell death from the nucleus
R-HSA-209560 NF-kB is activated and signals survival
R-HSA-193639 p75NTR signals via NF-kB
R-HSA-209543 p75NTR recruits signalling complexes
Pathway Interaction Database
il1pathway IL1-mediated signaling events
trkrpathway Neurotrophic factor-mediated Trk receptor signaling
p75ntrpathway p75(NTR)-mediated signaling
tnfpathway TNF receptor signaling pathway
WP615 Senescence and Autophagy
WP2380 BDNF signaling pathway
WP2018 RANKL/RANK Signaling Pathway

Homo sapiens (human) SQSTM1 NP_003891.1
Pan troglodytes (chimpanzee) SQSTM1 XP_001153075.1
Macaca mulatta (Rhesus monkey) SQSTM1 XP_001102347.1
Bos taurus (cattle) SQSTM1 NP_788814.1
Mus musculus (house mouse) Sqstm1 NP_035148.1
Rattus norvegicus (Norway rat) Sqstm1 NP_787037.2
Gallus gallus (chicken) SQSTM1 XP_001233249.2
Danio rerio (zebrafish) sqstm1 NP_998338.1
Xenopus (Silurana) tropicalis (western clawed frog) sqstm1 NP_001007894.1


ID Name Evidence
GO:0005634 nucleus IEA
GO:0005654 nucleoplasm EXP
GO:0005737 cytoplasm IEA
GO:0005770 late endosome IEA
GO:0005829 cytosol EXP
GO:0005829 cytosol TAS


ID Name Evidence
GO:0005080 protein kinase C binding IPI
GO:0005515 protein binding IPI
GO:0008270 zinc ion binding IEA
GO:0019901 protein kinase binding IDA
GO:0030971 receptor tyrosine kinase binding TAS
GO:0042169 SH2 domain binding IDA
GO:0043130 ubiquitin binding EXP
GO:0043130 ubiquitin binding IDA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0006511 ubiquitin-dependent protein catabolic process TAS
GO:0006914 autophagy TAS
GO:0006915 apoptosis EXP
GO:0006916 anti-apoptosis EXP
GO:0006950 response to stress TAS
GO:0008104 protein localization TAS
GO:0008624 induction of apoptosis by extracellular signals EXP
GO:0016197 endosome transport TAS
GO:0016236 macroautophagy ISS
GO:0030154 cell differentiation IEA
GO:0035556 intracellular signal transduction TAS
GO:0043122 regulation of I-kappaB kinase/NF-kappaB cascade IMP
GO:0045944 positive regulation of transcription from RNA polymerase II promoter TAS
GO:0048011 nerve growth factor receptor signaling pathway TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SQSTM1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SQSTM1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_001142298 Homo sapiens sequestosome 1 (SQSTM1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001142299 Homo sapiens sequestosome 1 (SQSTM1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_003900 Homo sapiens sequestosome 1 (SQSTM1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu62276 XM_011534683 PREDICTED: Homo sapiens sequestosome 1 (SQSTM1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $199.00
OHu62277 XM_011534684 PREDICTED: Homo sapiens sequestosome 1 (SQSTM1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $199.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu26213
Accession Version NM_001142298.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1071bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-JUL-2015
Organism Homo sapiens (human)
Product sequestosome-1 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI549805.1, BC000951.2, BC017222.1 and BU625974.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]. Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an in-frame downstream start codon compared to variant 1. This results in an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC001874.1, BC000951.2 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)262..264(+)
Misc Feature(2)361..414(+)
Misc Feature(3)484..612(+)
Misc Feature(4)490..597(+)
Misc Feature(5)490..570(+)
Misc Feature(6)493..555(+)
Misc Feature(7)526..612(+)
Misc Feature(8)532..597(+)
Misc Feature(9)1285..1404(+)
Misc Feature(10)1318..1404(+)
Exon (1)1..204
Gene Synonym:
Exon (2)205..313
Gene Synonym:
Exon (3)314..409
Gene Synonym:
Exon (4)410..639
Gene Synonym:
Exon (5)640..781
Gene Synonym:
Exon (6)782..862
Gene Synonym:
Exon (7)863..1077
Gene Synonym:
Exon (8)1078..1273
Gene Synonym:
Exon (9)1274..2916
Gene Synonym:
Position Chain Variation Link
58 58 -, ccaggtgcg dbSNP:767181562
65 65 g, t dbSNP:767976485
69 69 -, caggtgcgg dbSNP:750040585
69 69 c, t dbSNP:200371423
76 76 c, g dbSNP:534803525
86 86 a, g dbSNP:764634468
92 92 g, t dbSNP:553253185
99 99 a, c dbSNP:757369621
119 119 c, g dbSNP:779297930
120 120 a, g dbSNP:202144612
131 131 c, t dbSNP:758517604
149 149 c, t dbSNP:779964578
155 155 a, g dbSNP:538699566
158 158 a, g dbSNP:148799128
170 170 c, t dbSNP:201297801
172 172 a, g dbSNP:542286553
173 173 a, g dbSNP:781043093
176 176 a, g dbSNP:747689541
199 199 c, t dbSNP:769247344
213 213 a, t dbSNP:550228062
214 214 a, g dbSNP:568252008
228 228 a, g dbSNP:535449962
249 249 -, c dbSNP:372235632
317 317 a, g dbSNP:754647146
321 321 c, t dbSNP:780842511
322 322 a, g dbSNP:376802604
323 323 c, g dbSNP:11548643
324 324 c, g dbSNP:757587948
330 330 a, g dbSNP:371268375
342 342 c, t dbSNP:746426826
346 346 a, g dbSNP:374178647
347 347 a, g dbSNP:780177259
348 348 c, g, t dbSNP:148366738
349 349 a, c, g dbSNP:368853286
359 359 c, t dbSNP:539682696
360 360 a, c dbSNP:752464933
368 368 c, t dbSNP:773117648
371 371 c, t dbSNP:763040103
373 373 c, t dbSNP:766411872
375 375 a, c, t dbSNP:150883783
376 376 a, g dbSNP:181263868
383 383 a, t dbSNP:752438818
388 388 a, g dbSNP:755702835
390 390 -, c dbSNP:749099216
395 395 a, g dbSNP:569811115
401 401 a, g dbSNP:750784335
403 403 a, c dbSNP:537142935
404 404 c, t dbSNP:11548641
411 411 c, g dbSNP:11548637
416 416 a, g dbSNP:748170760
420 420 a, c, g dbSNP:762547578
421 421 g, t dbSNP:749114620
423 423 c, t dbSNP:770804860
425 425 a, c, g dbSNP:778554903
427 427 c, t dbSNP:771903158
430 430 a, g dbSNP:775073015
433 433 c, t dbSNP:760122315
436 436 c, t dbSNP:139372286
440 440 c, t dbSNP:371719657
441 441 a, c dbSNP:770397751
443 443 a, c, t dbSNP:761423892
444 444 a, g, t dbSNP:144289539
449 449 c, t dbSNP:767842142
451 451 c, t dbSNP:752833104
452 452 a, g dbSNP:537503261
454 454 a, c, g dbSNP:756209668
458 458 c, t dbSNP:147810437
459 459 a, g dbSNP:376214713
460 460 c, t dbSNP:200152247
463 463 c, g, t dbSNP:548787835
464 464 a, g dbSNP:779807674
475 475 c, t dbSNP:746553762
476 476 a, g dbSNP:768195831
477 477 c, t dbSNP:776096990
480 480 a, c, t dbSNP:11548640
482 482 a, g dbSNP:769325755
486 486 a, g dbSNP:774780830
487 487 a, g dbSNP:528070897
492 492 c, t dbSNP:768088721
493 493 a, g dbSNP:753212399
501 501 c, t dbSNP:761229380
507 507 c, g dbSNP:768110162
509 509 c, t dbSNP:372480231
510 510 c, t dbSNP:375411629
513 513 a, g dbSNP:778947500
523 523 c, t dbSNP:750256905
524 524 a, g dbSNP:758090054
528 528 c, t dbSNP:779868430
534 534 -, agcgtctgcccagactacgacttgtgt dbSNP:754933881
536 536 a, g dbSNP:370096430
537 537 a, c dbSNP:374417389
538 538 a, g dbSNP:200973006
542 542 c, g dbSNP:747589923
552 552 c, t dbSNP:769497182
553 553 a, g dbSNP:772687435
564 564 c, t dbSNP:145037913
565 565 a, g dbSNP:145056421
570 570 c, t dbSNP:775988188
571 571 a, g dbSNP:767512628
573 573 a, g dbSNP:764632233
581 581 a, g dbSNP:776866832
582 582 c, g, t dbSNP:35266480
585 585 a, g dbSNP:765529281
586 586 a, c dbSNP:750652295
589 589 c, g, t dbSNP:758625124
590 590 a, g, t dbSNP:118160361
599 599 c, g dbSNP:376662069
600 600 c, t dbSNP:781049091
604 604 c, g dbSNP:368741963
606 606 c, t dbSNP:372518286
607 607 a, g dbSNP:755537361
608 608 a, c dbSNP:777302431
612 612 c, t dbSNP:748939282
614 614 c, t dbSNP:770616208
616 616 a, g dbSNP:377198490
619 619 a, c dbSNP:747322992
621 621 c, g dbSNP:199931327
625 625 a, g dbSNP:200731802
626 626 a, g dbSNP:762352281
631 631 c, t dbSNP:765281544
633 633 c, g, t dbSNP:750169565
648 648 a, g dbSNP:370203737
650 650 a, c, t dbSNP:113956324
654 654 c, t dbSNP:759721454
655 655 c, t dbSNP:567433223
656 656 a, g dbSNP:535606152
657 657 c, t dbSNP:760538532
660 660 g, t dbSNP:764039094
661 661 c, t dbSNP:753313263
664 664 c, t dbSNP:756791819
665 665 a, g dbSNP:778537429
670 670 a, g dbSNP:371832577
678 678 c, t dbSNP:758110159
679 679 a, g dbSNP:781478225
680 680 a, g dbSNP:534814879
687 687 c, t dbSNP:527602
688 688 a, g dbSNP:373585056
688 688 -, g dbSNP:773598132
689 689 a, g dbSNP:770216826
690 690 c, g dbSNP:11548634
700 700 c, t dbSNP:11548635
707 707 c, t dbSNP:578084747
713 713 c, t dbSNP:749357493
723 723 c, t dbSNP:771036207
727 727 a, c dbSNP:774388295
729 729 c, t dbSNP:545300445
732 732 a, g dbSNP:772219487
735 735 -, tcc dbSNP:747274001
740 740 c, g dbSNP:368010261
742 742 c, t dbSNP:201263163
743 743 a, g dbSNP:763972646
756 756 c, t dbSNP:753854571
758 758 a, g, t dbSNP:761822261
770 770 c, t dbSNP:199663339
771 771 a, g dbSNP:758128093
782 782 c, t dbSNP:202235745
784 784 c, t dbSNP:765200636
787 787 c, g dbSNP:772861524
790 790 c, t dbSNP:762503146
791 791 c, t dbSNP:151191977
792 792 a, g dbSNP:751263705
795 795 a, g dbSNP:140341924
798 798 a, g dbSNP:764575577
799 799 a, g dbSNP:754194273
803 803 c, t dbSNP:757778292
804 804 a, c, g dbSNP:145688323
808 808 a, g dbSNP:758549044
819 819 -, gaa dbSNP:767056938
820 820 a, g dbSNP:11548633
825 825 c, t dbSNP:747314158
826 826 a, g dbSNP:768757828
827 827 c, t dbSNP:142719499
832 832 c, g dbSNP:747892889
835 835 a, t dbSNP:769873457
837 837 a, t dbSNP:773244178
842 842 c, t dbSNP:762767720
862 862 g, t dbSNP:765959386
864 864 c, t dbSNP:769297000
866 866 c, t dbSNP:753016349
867 867 g, t dbSNP:756387572
871 871 a, c, g dbSNP:182522590
872 872 c, t dbSNP:770910704
877 877 a, g dbSNP:778679611
878 878 c, t dbSNP:745788957
879 879 c, t dbSNP:372827450
880 880 a, g dbSNP:774986849
882 882 c, t dbSNP:760388024
883 883 a, g dbSNP:768230977
891 891 c, t dbSNP:145001811
892 892 a, g dbSNP:763179729
895 895 a, g dbSNP:766939503
896 896 a, g dbSNP:774758833
897 897 a, g dbSNP:200889080
903 903 a, c dbSNP:568368794
904 904 a, c dbSNP:535756371
907 907 c, t dbSNP:138928957
908 908 a, g dbSNP:149424705
910 910 c, g dbSNP:753685955
911 911 c, t dbSNP:757045797
912 912 a, g dbSNP:778751638
913 913 a, c dbSNP:745853858
914 914 c, t dbSNP:185313167
915 915 c, g dbSNP:779544030
917 917 -, ccgtctct dbSNP:766055750
919 919 a, g dbSNP:376283809
921 921 c, g dbSNP:369606717
927 927 a, g dbSNP:200388590
929 929 a, g dbSNP:747803543
930 930 c, g dbSNP:55793208
932 932 a, g dbSNP:201923000
935 935 a, c, t dbSNP:202119215
941 941 c, t dbSNP:200445838
943 943 -, gag dbSNP:752009611
955 955 a, g dbSNP:148559402
956 956 a, g dbSNP:760785371
958 958 c, t dbSNP:764205744
965 965 c, t dbSNP:754060027
974 974 a, g dbSNP:757493001
982 982 g, t dbSNP:765011708
984 984 c, t dbSNP:4935
986 986 c, t dbSNP:758346353
995 995 -, gggtgggaatgttga dbSNP:754741710
995 995 c, t dbSNP:376459756
996 996 a, g, t dbSNP:148984239
999 999 a, t dbSNP:780729747
1005 1005 a, c, t dbSNP:139575774
1013 1013 a, g, t dbSNP:769482708
1014 1014 c, t dbSNP:11548642
1016 1016 c, t dbSNP:143746604
1019 1019 c, t dbSNP:150926394
1020 1020 a, g dbSNP:370970067
1027 1027 c, t dbSNP:768680051
1031 1031 a, c, t dbSNP:541356917
1032 1032 a, g dbSNP:139482113
1033 1033 a, g dbSNP:750241714
1034 1034 a, g dbSNP:762699098
1035 1035 a, g dbSNP:766129922
1036 1036 c, g dbSNP:751545372
1041 1041 a, g dbSNP:577797455
1042 1042 a, g dbSNP:545080321
1044 1044 a, g dbSNP:4797
1050 1050 c, t dbSNP:200695664
1051 1051 a, g dbSNP:777431896
1054 1054 c, t dbSNP:140315612
1062 1062 c, t dbSNP:56092424
1063 1063 a, g dbSNP:61748794
1067 1067 a, g dbSNP:747589104
1068 1068 a, g dbSNP:769143668
1069 1069 c, t dbSNP:140226523
1070 1070 a, g dbSNP:752889531
1089 1089 c, g dbSNP:760518420
1091 1091 c, t dbSNP:763767102
1092 1092 a, g dbSNP:146164139
1093 1093 c, g dbSNP:367902954
1094 1094 a, g dbSNP:148294622
1104 1104 -, agg dbSNP:778047147
1104 1104 a, g dbSNP:141436407
1106 1106 a, g dbSNP:755411592
1125 1125 c, t dbSNP:781390659
1127 1127 a, t dbSNP:748746226
1129 1129 c, g dbSNP:756607693
1139 1139 -, aag dbSNP:747073722
1146 1146 a, g dbSNP:150470670
1147 1147 a, g dbSNP:749308026
1151 1151 c, t dbSNP:772889843
1152 1152 a, g dbSNP:10058037
1153 1153 a, t dbSNP:774512680
1156 1156 -, a dbSNP:771124822
1162 1162 g, t dbSNP:765610848
1168 1168 -, ca dbSNP:781417955
1182 1182 a, g dbSNP:541743205
1183 1183 c, t dbSNP:575125039
1185 1185 a, g dbSNP:771948860
1191 1191 c, t dbSNP:201591177
1192 1192 a, g dbSNP:535932454
1196 1196 a, g dbSNP:375495050
1198 1198 c, t dbSNP:776303544
1202 1202 a, g dbSNP:761368437
1203 1203 c, t dbSNP:764810220
1212 1212 c, t dbSNP:750140541
1213 1213 c, t dbSNP:368657568
1216 1216 c, t dbSNP:143956614
1222 1222 c, g dbSNP:767990596
1224 1224 a, g dbSNP:752937017
1227 1227 a, g dbSNP:756626155
1230 1230 c, t dbSNP:778199086
1232 1232 c, g dbSNP:753946383
1236 1236 a, g dbSNP:569052431
1237 1237 c, g dbSNP:147305175
1242 1242 a, g dbSNP:778833279
1248 1248 c, t dbSNP:746170903
1250 1250 c, t dbSNP:772122047
1258 1258 c, t dbSNP:779915504
1261 1261 c, t dbSNP:746755240
1267 1267 c, g dbSNP:768745808
1268 1268 c, t dbSNP:776749939
1269 1269 a, g, t dbSNP:372271201
1271 1271 c, g dbSNP:772591130
1280 1280 a, g dbSNP:758452325
1283 1283 c, t dbSNP:104893941
1284 1284 a, g dbSNP:75700262
1285 1285 c, t dbSNP:539942101
1286 1286 a, g dbSNP:200551825
1290 1290 a, g dbSNP:747890873
1293 1293 c, t dbSNP:756095586
1295 1295 a, c dbSNP:777527845
1296 1296 a, g dbSNP:749217241
1302 1302 c, t dbSNP:770396685
1309 1309 a, c dbSNP:201795943
1314 1314 a, g dbSNP:745585269
1315 1315 a, t dbSNP:771657338
1317 1317 c, t dbSNP:777004439
1318 1318 a, g dbSNP:771966860
1323 1323 c, t dbSNP:368933511
1324 1324 g, t dbSNP:773645716
1329 1329 c, t dbSNP:763506589
1338 1338 c, t dbSNP:766437927
1339 1339 a, g dbSNP:143511494
1342 1342 a, t dbSNP:755261626
1353 1353 a, g dbSNP:148278350
1365 1365 c, t dbSNP:371720013
1372 1372 -, ta dbSNP:772772504
1375 1375 c, g dbSNP:755901084
1378 1378 a, g dbSNP:777601802
1380 1380 c, t dbSNP:374985304
1381 1381 a, g dbSNP:757212984
1385 1385 c, t dbSNP:201239306
1386 1386 a, g dbSNP:143977783
1387 1387 a, g dbSNP:771743528
1391 1391 -, g dbSNP:760169726
1392 1392 g, t dbSNP:573881131
1393 1393 c, g dbSNP:746655349
1396 1396 a, c dbSNP:770118706
1397 1397 c, t dbSNP:773625766
1407 1407 c, t dbSNP:763376504
1414 1414 c, t dbSNP:534476029
1416 1416 c, t dbSNP:774591916
1421 1421 c, t dbSNP:759646319
1422 1422 a, g dbSNP:182058393
1423 1423 a, c dbSNP:752910741
1424 1424 c, t dbSNP:199854262
1425 1425 a, g, t dbSNP:11548636
1428 1428 g, t dbSNP:753600779
1431 1431 -, acc dbSNP:765964997
1434 1434 a, c dbSNP:757166561
1438 1438 c, t dbSNP:778783549
1439 1439 -, tgcccacctcttc dbSNP:753485135
1439 1439 g, t dbSNP:750331363
1444 1444 -, cctcttctgcgtgcc dbSNP:765122407
1444 1444 a, t dbSNP:757952273
1445 1445 -, cctcttctgcgtgcc dbSNP:138527258
1448 1448 c, g dbSNP:779531319
1451 1451 a, c dbSNP:369114803
1455 1455 -, gtgcccctcttctgt dbSNP:752519655
1455 1455 -, t dbSNP:758468329
1455 1455 a, g dbSNP:768290894
1461 1461 c, t dbSNP:778010441
1463 1463 c, g, t dbSNP:760432280
1465 1465 -, tctg dbSNP:777849713
1465 1465 c, t dbSNP:775033427
1466 1466 c, g dbSNP:760096900
1469 1469 c, t dbSNP:373148815
1470 1470 c, g dbSNP:376209849
1474 1474 c, g, t dbSNP:370200075
1481 1481 -, tt dbSNP:751702490
1488 1488 g, t dbSNP:753608025
1490 1490 a, g dbSNP:577638223
1491 1491 c, t dbSNP:369609665
1492 1492 a, c, g dbSNP:750423230
1497 1497 a, c dbSNP:140407570
1498 1498 c, t dbSNP:751025643
1513 1513 c, t dbSNP:11548622
1514 1514 a, g dbSNP:155790
1514 1514 -, g dbSNP:757311547
1517 1517 c, g, t dbSNP:775814512
1527 1527 c, t dbSNP:747720686
1532 1532 c, t dbSNP:763290503
1540 1540 a, g dbSNP:771468767
1544 1544 -, ag dbSNP:781300399
1605 1605 -, tg dbSNP:575415090
1606 1606 -, tg dbSNP:386418446
1606 1606 g, t dbSNP:186996560
1607 1607 -, tg dbSNP:754001389
1615 1615 -, gt dbSNP:71714822
1619 1619 -, tg dbSNP:10688915
1621 1621 -, tga dbSNP:778634431
1623 1623 a, g dbSNP:11249660
1642 1642 a, g dbSNP:17409649
1645 1645 a, c dbSNP:17409643
1680 1680 c, t dbSNP:543706405
1683 1683 c, t dbSNP:746273783
1689 1689 c, t dbSNP:117531194
1691 1691 c, t dbSNP:529602681
1710 1710 c, g dbSNP:11548631
1720 1720 a, g dbSNP:559922612
1739 1739 c, g dbSNP:533446391
1750 1750 c, t dbSNP:11548630
1765 1765 -, ttttg dbSNP:771841908
1766 1766 c, t dbSNP:551056409
1818 1818 a, g dbSNP:188873621
1819 1819 c, t dbSNP:181341443
1827 1827 g, t dbSNP:150371553
1858 1858 -, gtgtt dbSNP:775566403
1925 1925 c, g dbSNP:764211030
1936 1936 c, t dbSNP:138055371
1937 1937 a, g dbSNP:185559724
1943 1943 g, t dbSNP:534941108
1952 1952 -, t dbSNP:768333264
1970 1970 g, t dbSNP:1060271
1972 1972 c, t dbSNP:14800
1981 1981 c, g dbSNP:746444162
1989 1989 c, g dbSNP:767960499
1991 1991 c, t dbSNP:14799
1992 1992 c, t dbSNP:776124208
2015 2015 c, t dbSNP:772638668
2022 2022 c, t dbSNP:11548623
2023 2023 a, g dbSNP:11548620
2031 2031 g, t dbSNP:775444139
2032 2032 c, t dbSNP:760769659
2033 2033 c, t dbSNP:577802143
2034 2034 c, g dbSNP:768589839
2036 2036 a, g dbSNP:776961227
2038 2038 a, c dbSNP:538337173
2039 2039 c, g dbSNP:556686676
2044 2044 c, t dbSNP:11548626
2047 2047 g, t dbSNP:772928838
2049 2049 a, c dbSNP:762893891
2051 2051 -, t dbSNP:746140288
2052 2052 c, t dbSNP:11548628
2054 2054 a, g dbSNP:766287584
2055 2055 c, g, t dbSNP:11548619
2063 2063 -, taat dbSNP:769882808
2064 2064 c, t dbSNP:10173
2073 2073 a, g dbSNP:766911366
2083 2083 a, c, t dbSNP:14801
2088 2088 -, ac dbSNP:780452209
2091 2091 -, atgacgttaaagcactttaatct dbSNP:769151251
2091 2091 -, a dbSNP:749644765
2093 2093 a, t dbSNP:112765500
2098 2098 a, t dbSNP:190193171
2122 2122 a, g dbSNP:542177571
2126 2126 a, t dbSNP:560957240
2141 2141 c, g dbSNP:149508576
2149 2149 a, g dbSNP:541743046
2154 2154 -, tctt dbSNP:144467418
2166 2166 g, t dbSNP:780421957
2181 2181 c, g, t dbSNP:752454397
2185 2185 -, cctcctaacaagtgtatctcgattaataa dbSNP:774786383
2189 2189 -, t dbSNP:760128130
2191 2191 -, acaagtgtatctcg dbSNP:770438256
2191 2191 a, t dbSNP:779423592
2193 2193 c, t dbSNP:746176027
2198 2198 -, tatc dbSNP:763592667
2199 2199 g, t dbSNP:759005945
2201 2201 a, t dbSNP:780652376
2204 2204 c, t dbSNP:559679314
2205 2205 a, g, t dbSNP:768839085
2206 2206 a, g dbSNP:748885911
2207 2207 -, taa dbSNP:775975516
2207 2207 c, t dbSNP:748378859
2213 2213 a, c dbSNP:769948339
2214 2214 c, t dbSNP:773016719
2217 2217 a, g dbSNP:73334055
2218 2218 c, t dbSNP:370269451
2221 2221 c, g dbSNP:766053650
2224 2224 c, t dbSNP:774391024
2226 2226 a, g dbSNP:759375479
2228 2228 -, atcacacatcatc dbSNP:759284983
2233 2233 a, g dbSNP:776303445
2234 2234 -, cat dbSNP:764971145
2238 2238 a, c dbSNP:754632178
2243 2243 c, t dbSNP:755839994
2244 2244 a, g dbSNP:552007127
2246 2246 a, c dbSNP:563731385
2250 2250 c, t dbSNP:758847992
2255 2255 c, t dbSNP:780269320
2260 2260 a, g dbSNP:747619918
2261 2261 c, t dbSNP:755377558
2262 2262 a, g dbSNP:781266614
2263 2263 a, g dbSNP:748178902
2264 2264 -, ag dbSNP:752607373
2264 2264 a, g dbSNP:770038029
2268 2268 a, g dbSNP:148611524
2274 2274 -, a dbSNP:762770205
2274 2274 c, t dbSNP:749485375
2278 2278 c, t dbSNP:770814240
2279 2279 a, c, g dbSNP:142061446
2284 2284 a, g dbSNP:759522250
2285 2285 -, t dbSNP:764149779
2286 2286 c, t dbSNP:771844281
2287 2287 a, c, t dbSNP:150786805
2288 2288 a, g dbSNP:763677235
2293 2293 g, t dbSNP:374714786
2301 2301 c, t dbSNP:753602551
2302 2302 a, t dbSNP:761368110
2304 2304 c, t dbSNP:139424223
2305 2305 a, g dbSNP:751816628
2312 2312 a, g dbSNP:755533137
2313 2313 a, g dbSNP:781637325
2324 2324 c, t dbSNP:753168881
2333 2333 -, agtcc dbSNP:751473908
2333 2333 g, t dbSNP:756233444
2334 2334 a, g dbSNP:777813552
2335 2335 c, g dbSNP:749587982
2342 2342 a, c, t dbSNP:531042257
2343 2343 a, g dbSNP:745599933
2349 2349 c, t dbSNP:772077418
2352 2352 a, g dbSNP:775618569
2360 2360 c, t dbSNP:772022233
2361 2361 a, g dbSNP:760679087
2368 2368 -, ct dbSNP:757109530
2371 2371 -, t dbSNP:781379450
2376 2376 c, t dbSNP:768348048
2382 2382 c, t dbSNP:776215636
2384 2384 c, g, t dbSNP:11548638
2385 2385 -, a dbSNP:750453657
2387 2387 -, c dbSNP:756422494
2387 2387 c, t dbSNP:377076809
2388 2388 a, g dbSNP:375294105
2391 2391 a, g dbSNP:144080871
2401 2401 c, t dbSNP:767842607
2402 2402 a, g dbSNP:540010749
2404 2404 a, g dbSNP:756605512
2405 2405 a, g dbSNP:777834009
2417 2417 c, t dbSNP:370481237
2418 2418 a, g dbSNP:199727564
2424 2424 c, g dbSNP:778961691
2425 2425 a, g dbSNP:746082405
2427 2427 c, t dbSNP:772051734
2428 2428 c, t dbSNP:570055949
2433 2433 a, g dbSNP:746949003
2438 2438 -, cttct dbSNP:780179500
2453 2453 a, g dbSNP:146092066
2459 2459 -, g dbSNP:749671180
2460 2460 a, g dbSNP:776230758
2471 2471 c, g dbSNP:116069534
2472 2472 c, g dbSNP:769319285
2475 2475 a, c dbSNP:772785564
2476 2476 c, g dbSNP:762650433
2483 2483 c, g dbSNP:767934309
2484 2484 c, t dbSNP:371482381
2497 2497 c, t dbSNP:761182927
2500 2500 a, g dbSNP:764533820
2501 2501 -, gtcc dbSNP:755291116
2503 2503 -, c dbSNP:779431270
2504 2504 c, t dbSNP:61746305
2508 2508 c, t dbSNP:757320769
2509 2509 c, t dbSNP:765347184
2510 2510 a, g dbSNP:750678816
2517 2517 c, g, t dbSNP:758628629
2518 2518 c, g dbSNP:746754910
2520 2520 c, t dbSNP:200300835
2521 2521 g, t dbSNP:754999782
2529 2529 a, g dbSNP:781035932
2532 2532 a, g dbSNP:61742526
2538 2538 -, at dbSNP:748732103
2538 2538 a, g dbSNP:763199567
2542 2542 c, g dbSNP:199887787
2547 2547 c, t dbSNP:748941071
2554 2554 a, g dbSNP:770512697
2556 2556 a, t dbSNP:775853768
2562 2562 a, c, g dbSNP:368323623
2569 2569 c, t dbSNP:10277
2571 2571 c, t dbSNP:774468810
2572 2572 a, g dbSNP:143664576
2574 2574 c, g dbSNP:372880666
2583 2583 a, g dbSNP:541354577
2590 2590 g, t dbSNP:766672073
2606 2606 c, t dbSNP:751804819
2607 2607 a, g dbSNP:754872474
2608 2608 a, g dbSNP:781024263
2612 2612 c, t dbSNP:748097828
2621 2621 a, c dbSNP:756011095
2622 2622 c, g dbSNP:777158440
2628 2628 a, g dbSNP:748746630
2630 2630 c, g dbSNP:553584436
2636 2636 c, t dbSNP:778576827
2637 2637 -, a dbSNP:772438323
2645 2645 c, t dbSNP:767667234
2646 2646 a, c, g dbSNP:768969990
2660 2660 c, t dbSNP:762242695
2661 2661 a, g dbSNP:770287311
2665 2665 c, t dbSNP:765194020
2667 2667 -, ctc dbSNP:776265041
2671 2671 c, t dbSNP:773459500
2681 2681 a, g dbSNP:763168668
2684 2684 c, t dbSNP:766549467
2691 2691 g, t dbSNP:751892071
2692 2692 g, t dbSNP:759825154
2697 2697 c, t dbSNP:767217752
2698 2698 a, c dbSNP:752475897
2699 2699 a, c dbSNP:756026168
2703 2703 c, g dbSNP:777724565
2706 2706 c, t dbSNP:376933990
2711 2711 c, g dbSNP:371031967
2712 2712 c, g dbSNP:753743592
2724 2724 c, g, t dbSNP:201824663
2728 2728 a, g dbSNP:745524145
2729 2729 -, ag dbSNP:745365806
2737 2737 c, t dbSNP:771699503
2742 2742 a, g dbSNP:781433632
2743 2743 c, t dbSNP:748507473
2744 2744 a, g dbSNP:376162024
2745 2745 c, g dbSNP:773908994
2746 2746 c, t dbSNP:763544769
2753 2753 g, t dbSNP:1065154
2759 2759 c, g dbSNP:774501769
2765 2765 c, t dbSNP:759688377
2767 2767 c, t dbSNP:199862884
2780 2780 a, g dbSNP:531005543
2796 2796 -, ctgggccttgg dbSNP:758268512
2825 2825 c, t dbSNP:182968597
2848 2848 a, g dbSNP:561116387

Target ORF information:

RefSeq Version NM_001142298
Organism Homo sapiens (human)
Definition Homo sapiens sequestosome 1 (SQSTM1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26213
Accession Version NM_001142299.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1071bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-JUL-2015
Organism Homo sapiens (human)
Product sequestosome-1 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA541885.1, BC000951.2, BC017222.1 and BU625974.1. Summary: This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]. Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an in-frame downstream start codon compared to variant 1. This results in an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 differ in the 5' UTR, but encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC001874.1, BC000951.2 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)179..181(+)
Misc Feature(2)278..331(+)
Misc Feature(3)401..529(+)
Misc Feature(4)407..514(+)
Misc Feature(5)407..487(+)
Misc Feature(6)410..472(+)
Misc Feature(7)443..529(+)
Misc Feature(8)449..514(+)
Misc Feature(9)1202..1321(+)
Misc Feature(10)1235..1321(+)
Exon (1)1..121
Gene Synonym:
Exon (2)122..230
Gene Synonym:
Exon (3)231..326
Gene Synonym:
Exon (4)327..556
Gene Synonym:
Exon (5)557..698
Gene Synonym:
Exon (6)699..779
Gene Synonym:
Exon (7)780..994
Gene Synonym:
Exon (8)995..1190
Gene Synonym:
Exon (9)1191..2833
Gene Synonym:
Position Chain Variation Link
56 56 a, g dbSNP:538860028
120 120 a, t dbSNP:59066892
121 121 c, g dbSNP:181836948
130 130 a, t dbSNP:550228062
131 131 a, g dbSNP:568252008
145 145 a, g dbSNP:535449962
166 166 -, c dbSNP:372235632
234 234 a, g dbSNP:754647146
238 238 c, t dbSNP:780842511
239 239 a, g dbSNP:376802604
240 240 c, g dbSNP:11548643
241 241 c, g dbSNP:757587948
247 247 a, g dbSNP:371268375
259 259 c, t dbSNP:746426826
263 263 a, g dbSNP:374178647
264 264 a, g dbSNP:780177259
265 265 c, g, t dbSNP:148366738
266 266 a, c, g dbSNP:368853286
276 276 c, t dbSNP:539682696
277 277 a, c dbSNP:752464933
285 285 c, t dbSNP:773117648
288 288 c, t dbSNP:763040103
290 290 c, t dbSNP:766411872
292 292 a, c, t dbSNP:150883783
293 293 a, g dbSNP:181263868
300 300 a, t dbSNP:752438818
305 305 a, g dbSNP:755702835
307 307 -, c dbSNP:749099216
312 312 a, g dbSNP:569811115
318 318 a, g dbSNP:750784335
320 320 a, c dbSNP:537142935
321 321 c, t dbSNP:11548641
328 328 c, g dbSNP:11548637
333 333 a, g dbSNP:748170760
337 337 a, c, g dbSNP:762547578
338 338 g, t dbSNP:749114620
340 340 c, t dbSNP:770804860
342 342 a, c, g dbSNP:778554903
344 344 c, t dbSNP:771903158
347 347 a, g dbSNP:775073015
350 350 c, t dbSNP:760122315
353 353 c, t dbSNP:139372286
357 357 c, t dbSNP:371719657
358 358 a, c dbSNP:770397751
360 360 a, c, t dbSNP:761423892
361 361 a, g, t dbSNP:144289539
366 366 c, t dbSNP:767842142
368 368 c, t dbSNP:752833104
369 369 a, g dbSNP:537503261
371 371 a, c, g dbSNP:756209668
375 375 c, t dbSNP:147810437
376 376 a, g dbSNP:376214713
377 377 c, t dbSNP:200152247
380 380 c, g, t dbSNP:548787835
381 381 a, g dbSNP:779807674
392 392 c, t dbSNP:746553762
393 393 a, g dbSNP:768195831
394 394 c, t dbSNP:776096990
397 397 a, c, t dbSNP:11548640
399 399 a, g dbSNP:769325755
403 403 a, g dbSNP:774780830
404 404 a, g dbSNP:528070897
409 409 c, t dbSNP:768088721
410 410 a, g dbSNP:753212399
418 418 c, t dbSNP:761229380
424 424 c, g dbSNP:768110162
426 426 c, t dbSNP:372480231
427 427 c, t dbSNP:375411629
430 430 a, g dbSNP:778947500
440 440 c, t dbSNP:750256905
441 441 a, g dbSNP:758090054
445 445 c, t dbSNP:779868430
451 451 -, agcgtctgcccagactacgacttgtgt dbSNP:754933881
453 453 a, g dbSNP:370096430
454 454 a, c dbSNP:374417389
455 455 a, g dbSNP:200973006
459 459 c, g dbSNP:747589923
469 469 c, t dbSNP:769497182
470 470 a, g dbSNP:772687435
481 481 c, t dbSNP:145037913
482 482 a, g dbSNP:145056421
487 487 c, t dbSNP:775988188
488 488 a, g dbSNP:767512628
490 490 a, g dbSNP:764632233
498 498 a, g dbSNP:776866832
499 499 c, g, t dbSNP:35266480
502 502 a, g dbSNP:765529281
503 503 a, c dbSNP:750652295
506 506 c, g, t dbSNP:758625124
507 507 a, g, t dbSNP:118160361
516 516 c, g dbSNP:376662069
517 517 c, t dbSNP:781049091
521 521 c, g dbSNP:368741963
523 523 c, t dbSNP:372518286
524 524 a, g dbSNP:755537361
525 525 a, c dbSNP:777302431
529 529 c, t dbSNP:748939282
531 531 c, t dbSNP:770616208
533 533 a, g dbSNP:377198490
536 536 a, c dbSNP:747322992
538 538 c, g dbSNP:199931327
542 542 a, g dbSNP:200731802
543 543 a, g dbSNP:762352281
548 548 c, t dbSNP:765281544
550 550 c, g, t dbSNP:750169565
565 565 a, g dbSNP:370203737
567 567 a, c, t dbSNP:113956324
571 571 c, t dbSNP:759721454
572 572 c, t dbSNP:567433223
573 573 a, g dbSNP:535606152
574 574 c, t dbSNP:760538532
577 577 g, t dbSNP:764039094
578 578 c, t dbSNP:753313263
581 581 c, t dbSNP:756791819
582 582 a, g dbSNP:778537429
587 587 a, g dbSNP:371832577
595 595 c, t dbSNP:758110159
596 596 a, g dbSNP:781478225
597 597 a, g dbSNP:534814879
604 604 c, t dbSNP:527602
605 605 a, g dbSNP:373585056
605 605 -, g dbSNP:773598132
606 606 a, g dbSNP:770216826
607 607 c, g dbSNP:11548634
617 617 c, t dbSNP:11548635
624 624 c, t dbSNP:578084747
630 630 c, t dbSNP:749357493
640 640 c, t dbSNP:771036207
644 644 a, c dbSNP:774388295
646 646 c, t dbSNP:545300445
649 649 a, g dbSNP:772219487
652 652 -, tcc dbSNP:747274001
657 657 c, g dbSNP:368010261
659 659 c, t dbSNP:201263163
660 660 a, g dbSNP:763972646
673 673 c, t dbSNP:753854571
675 675 a, g, t dbSNP:761822261
687 687 c, t dbSNP:199663339
688 688 a, g dbSNP:758128093
699 699 c, t dbSNP:202235745
701 701 c, t dbSNP:765200636
704 704 c, g dbSNP:772861524
707 707 c, t dbSNP:762503146
708 708 c, t dbSNP:151191977
709 709 a, g dbSNP:751263705
712 712 a, g dbSNP:140341924
715 715 a, g dbSNP:764575577
716 716 a, g dbSNP:754194273
720 720 c, t dbSNP:757778292
721 721 a, c, g dbSNP:145688323
725 725 a, g dbSNP:758549044
736 736 -, gaa dbSNP:767056938
737 737 a, g dbSNP:11548633
742 742 c, t dbSNP:747314158
743 743 a, g dbSNP:768757828
744 744 c, t dbSNP:142719499
749 749 c, g dbSNP:747892889
752 752 a, t dbSNP:769873457
754 754 a, t dbSNP:773244178
759 759 c, t dbSNP:762767720
779 779 g, t dbSNP:765959386
781 781 c, t dbSNP:769297000
783 783 c, t dbSNP:753016349
784 784 g, t dbSNP:756387572
788 788 a, c, g dbSNP:182522590
789 789 c, t dbSNP:770910704
794 794 a, g dbSNP:778679611
795 795 c, t dbSNP:745788957
796 796 c, t dbSNP:372827450
797 797 a, g dbSNP:774986849
799 799 c, t dbSNP:760388024
800 800 a, g dbSNP:768230977
808 808 c, t dbSNP:145001811
809 809 a, g dbSNP:763179729
812 812 a, g dbSNP:766939503
813 813 a, g dbSNP:774758833
814 814 a, g dbSNP:200889080
820 820 a, c dbSNP:568368794
821 821 a, c dbSNP:535756371
824 824 c, t dbSNP:138928957
825 825 a, g dbSNP:149424705
827 827 c, g dbSNP:753685955
828 828 c, t dbSNP:757045797
829 829 a, g dbSNP:778751638
830 830 a, c dbSNP:745853858
831 831 c, t dbSNP:185313167
832 832 c, g dbSNP:779544030
834 834 -, ccgtctct dbSNP:766055750
836 836 a, g dbSNP:376283809
838 838 c, g dbSNP:369606717
844 844 a, g dbSNP:200388590
846 846 a, g dbSNP:747803543
847 847 c, g dbSNP:55793208
849 849 a, g dbSNP:201923000
852 852 a, c, t dbSNP:202119215
858 858 c, t dbSNP:200445838
860 860 -, gag dbSNP:752009611
872 872 a, g dbSNP:148559402
873 873 a, g dbSNP:760785371
875 875 c, t dbSNP:764205744
882 882 c, t dbSNP:754060027
891 891 a, g dbSNP:757493001
899 899 g, t dbSNP:765011708
901 901 c, t dbSNP:4935
903 903 c, t dbSNP:758346353
912 912 -, gggtgggaatgttga dbSNP:754741710
912 912 c, t dbSNP:376459756
913 913 a, g, t dbSNP:148984239
916 916 a, t dbSNP:780729747
922 922 a, c, t dbSNP:139575774
930 930 a, g, t dbSNP:769482708
931 931 c, t dbSNP:11548642
933 933 c, t dbSNP:143746604
936 936 c, t dbSNP:150926394
937 937 a, g dbSNP:370970067
944 944 c, t dbSNP:768680051
948 948 a, c, t dbSNP:541356917
949 949 a, g dbSNP:139482113
950 950 a, g dbSNP:750241714
951 951 a, g dbSNP:762699098
952 952 a, g dbSNP:766129922
953 953 c, g dbSNP:751545372
958 958 a, g dbSNP:577797455
959 959 a, g dbSNP:545080321
961 961 a, g dbSNP:4797
967 967 c, t dbSNP:200695664
968 968 a, g dbSNP:777431896
971 971 c, t dbSNP:140315612
979 979 c, t dbSNP:56092424
980 980 a, g dbSNP:61748794
984 984 a, g dbSNP:747589104
985 985 a, g dbSNP:769143668
986 986 c, t dbSNP:140226523
987 987 a, g dbSNP:752889531
1006 1006 c, g dbSNP:760518420
1008 1008 c, t dbSNP:763767102
1009 1009 a, g dbSNP:146164139
1010 1010 c, g dbSNP:367902954
1011 1011 a, g dbSNP:148294622
1021 1021 -, agg dbSNP:778047147
1021 1021 a, g dbSNP:141436407
1023 1023 a, g dbSNP:755411592
1042 1042 c, t dbSNP:781390659
1044 1044 a, t dbSNP:748746226
1046 1046 c, g dbSNP:756607693
1056 1056 -, aag dbSNP:747073722
1063 1063 a, g dbSNP:150470670
1064 1064 a, g dbSNP:749308026
1068 1068 c, t dbSNP:772889843
1069 1069 a, g dbSNP:10058037
1070 1070 a, t dbSNP:774512680
1073 1073 -, a dbSNP:771124822
1079 1079 g, t dbSNP:765610848
1085 1085 -, ca dbSNP:781417955
1099 1099 a, g dbSNP:541743205
1100 1100 c, t dbSNP:575125039
1102 1102 a, g dbSNP:771948860
1108 1108 c, t dbSNP:201591177
1109 1109 a, g dbSNP:535932454
1113 1113 a, g dbSNP:375495050
1115 1115 c, t dbSNP:776303544
1119 1119 a, g dbSNP:761368437
1120 1120 c, t dbSNP:764810220
1129 1129 c, t dbSNP:750140541
1130 1130 c, t dbSNP:368657568
1133 1133 c, t dbSNP:143956614
1139 1139 c, g dbSNP:767990596
1141 1141 a, g dbSNP:752937017
1144 1144 a, g dbSNP:756626155
1147 1147 c, t dbSNP:778199086
1149 1149 c, g dbSNP:753946383
1153 1153 a, g dbSNP:569052431
1154 1154 c, g dbSNP:147305175
1159 1159 a, g dbSNP:778833279
1165 1165 c, t dbSNP:746170903
1167 1167 c, t dbSNP:772122047
1175 1175 c, t dbSNP:779915504
1178 1178 c, t dbSNP:746755240
1184 1184 c, g dbSNP:768745808
1185 1185 c, t dbSNP:776749939
1186 1186 a, g, t dbSNP:372271201
1188 1188 c, g dbSNP:772591130
1197 1197 a, g dbSNP:758452325
1200 1200 c, t dbSNP:104893941
1201 1201 a, g dbSNP:75700262
1202 1202 c, t dbSNP:539942101
1203 1203 a, g dbSNP:200551825
1207 1207 a, g dbSNP:747890873
1210 1210 c, t dbSNP:756095586
1212 1212 a, c dbSNP:777527845
1213 1213 a, g dbSNP:749217241
1219 1219 c, t dbSNP:770396685
1226 1226 a, c dbSNP:201795943
1231 1231 a, g dbSNP:745585269
1232 1232 a, t dbSNP:771657338
1234 1234 c, t dbSNP:777004439
1235 1235 a, g dbSNP:771966860
1240 1240 c, t dbSNP:368933511
1241 1241 g, t dbSNP:773645716
1246 1246 c, t dbSNP:763506589
1255 1255 c, t dbSNP:766437927
1256 1256 a, g dbSNP:143511494
1259 1259 a, t dbSNP:755261626
1270 1270 a, g dbSNP:148278350
1282 1282 c, t dbSNP:371720013
1289 1289 -, ta dbSNP:772772504
1292 1292 c, g dbSNP:755901084
1295 1295 a, g dbSNP:777601802
1297 1297 c, t dbSNP:374985304
1298 1298 a, g dbSNP:757212984
1302 1302 c, t dbSNP:201239306
1303 1303 a, g dbSNP:143977783
1304 1304 a, g dbSNP:771743528
1308 1308 -, g dbSNP:760169726
1309 1309 g, t dbSNP:573881131
1310 1310 c, g dbSNP:746655349
1313 1313 a, c dbSNP:770118706
1314 1314 c, t dbSNP:773625766
1324 1324 c, t dbSNP:763376504
1331 1331 c, t dbSNP:534476029
1333 1333 c, t dbSNP:774591916
1338 1338 c, t dbSNP:759646319
1339 1339 a, g dbSNP:182058393
1340 1340 a, c dbSNP:752910741
1341 1341 c, t dbSNP:199854262
1342 1342 a, g, t dbSNP:11548636
1345 1345 g, t dbSNP:753600779
1348 1348 -, acc dbSNP:765964997
1351 1351 a, c dbSNP:757166561
1355 1355 c, t dbSNP:778783549
1356 1356 -, tgcccacctcttc dbSNP:753485135
1356 1356 g, t dbSNP:750331363
1361 1361 -, cctcttctgcgtgcc dbSNP:765122407
1361 1361 a, t dbSNP:757952273
1362 1362 -, cctcttctgcgtgcc dbSNP:138527258
1365 1365 c, g dbSNP:779531319
1368 1368 a, c dbSNP:369114803
1372 1372 -, gtgcccctcttctgt dbSNP:752519655
1372 1372 -, t dbSNP:758468329
1372 1372 a, g dbSNP:768290894
1378 1378 c, t dbSNP:778010441
1380 1380 c, g, t dbSNP:760432280
1382 1382 -, tctg dbSNP:777849713
1382 1382 c, t dbSNP:775033427
1383 1383 c, g dbSNP:760096900
1386 1386 c, t dbSNP:373148815
1387 1387 c, g dbSNP:376209849
1391 1391 c, g, t dbSNP:370200075
1398 1398 -, tt dbSNP:751702490
1405 1405 g, t dbSNP:753608025
1407 1407 a, g dbSNP:577638223
1408 1408 c, t dbSNP:369609665
1409 1409 a, c, g dbSNP:750423230
1414 1414 a, c dbSNP:140407570
1415 1415 c, t dbSNP:751025643
1430 1430 c, t dbSNP:11548622
1431 1431 a, g dbSNP:155790
1431 1431 -, g dbSNP:757311547
1434 1434 c, g, t dbSNP:775814512
1444 1444 c, t dbSNP:747720686
1449 1449 c, t dbSNP:763290503
1457 1457 a, g dbSNP:771468767
1461 1461 -, ag dbSNP:781300399
1522 1522 -, tg dbSNP:575415090
1523 1523 -, tg dbSNP:386418446
1523 1523 g, t dbSNP:186996560
1524 1524 -, tg dbSNP:754001389
1532 1532 -, gt dbSNP:71714822
1536 1536 -, tg dbSNP:10688915
1538 1538 -, tga dbSNP:778634431
1540 1540 a, g dbSNP:11249660
1559 1559 a, g dbSNP:17409649
1562 1562 a, c dbSNP:17409643
1597 1597 c, t dbSNP:543706405
1600 1600 c, t dbSNP:746273783
1606 1606 c, t dbSNP:117531194
1608 1608 c, t dbSNP:529602681
1627 1627 c, g dbSNP:11548631
1637 1637 a, g dbSNP:559922612
1656 1656 c, g dbSNP:533446391
1667 1667 c, t dbSNP:11548630
1682 1682 -, ttttg dbSNP:771841908
1683 1683 c, t dbSNP:551056409
1735 1735 a, g dbSNP:188873621
1736 1736 c, t dbSNP:181341443
1744 1744 g, t dbSNP:150371553
1775 1775 -, gtgtt dbSNP:775566403
1842 1842 c, g dbSNP:764211030
1853 1853 c, t dbSNP:138055371
1854 1854 a, g dbSNP:185559724
1860 1860 g, t dbSNP:534941108
1869 1869 -, t dbSNP:768333264
1887 1887 g, t dbSNP:1060271
1889 1889 c, t dbSNP:14800
1898 1898 c, g dbSNP:746444162
1906 1906 c, g dbSNP:767960499
1908 1908 c, t dbSNP:14799
1909 1909 c, t dbSNP:776124208
1932 1932 c, t dbSNP:772638668
1939 1939 c, t dbSNP:11548623
1940 1940 a, g dbSNP:11548620
1948 1948 g, t dbSNP:775444139
1949 1949 c, t dbSNP:760769659
1950 1950 c, t dbSNP:577802143
1951 1951 c, g dbSNP:768589839
1953 1953 a, g dbSNP:776961227
1955 1955 a, c dbSNP:538337173
1956 1956 c, g dbSNP:556686676
1961 1961 c, t dbSNP:11548626
1964 1964 g, t dbSNP:772928838
1966 1966 a, c dbSNP:762893891
1968 1968 -, t dbSNP:746140288
1969 1969 c, t dbSNP:11548628
1971 1971 a, g dbSNP:766287584
1972 1972 c, g, t dbSNP:11548619
1980 1980 -, taat dbSNP:769882808
1981 1981 c, t dbSNP:10173
1990 1990 a, g dbSNP:766911366
2000 2000 a, c, t dbSNP:14801
2005 2005 -, ac dbSNP:780452209
2008 2008 -, atgacgttaaagcactttaatct dbSNP:769151251
2008 2008 -, a dbSNP:749644765
2010 2010 a, t dbSNP:112765500
2015 2015 a, t dbSNP:190193171
2039 2039 a, g dbSNP:542177571
2043 2043 a, t dbSNP:560957240
2058 2058 c, g dbSNP:149508576
2066 2066 a, g dbSNP:541743046
2071 2071 -, tctt dbSNP:144467418
2083 2083 g, t dbSNP:780421957
2098 2098 c, g, t dbSNP:752454397
2102 2102 -, cctcctaacaagtgtatctcgattaataa dbSNP:774786383
2106 2106 -, t dbSNP:760128130
2108 2108 -, acaagtgtatctcg dbSNP:770438256
2108 2108 a, t dbSNP:779423592
2110 2110 c, t dbSNP:746176027
2115 2115 -, tatc dbSNP:763592667
2116 2116 g, t dbSNP:759005945
2118 2118 a, t dbSNP:780652376
2121 2121 c, t dbSNP:559679314
2122 2122 a, g, t dbSNP:768839085
2123 2123 a, g dbSNP:748885911
2124 2124 -, taa dbSNP:775975516
2124 2124 c, t dbSNP:748378859
2130 2130 a, c dbSNP:769948339
2131 2131 c, t dbSNP:773016719
2134 2134 a, g dbSNP:73334055
2135 2135 c, t dbSNP:370269451
2138 2138 c, g dbSNP:766053650
2141 2141 c, t dbSNP:774391024
2143 2143 a, g dbSNP:759375479
2145 2145 -, atcacacatcatc dbSNP:759284983
2150 2150 a, g dbSNP:776303445
2151 2151 -, cat dbSNP:764971145
2155 2155 a, c dbSNP:754632178
2160 2160 c, t dbSNP:755839994
2161 2161 a, g dbSNP:552007127
2163 2163 a, c dbSNP:563731385
2167 2167 c, t dbSNP:758847992
2172 2172 c, t dbSNP:780269320
2177 2177 a, g dbSNP:747619918
2178 2178 c, t dbSNP:755377558
2179 2179 a, g dbSNP:781266614
2180 2180 a, g dbSNP:748178902
2181 2181 -, ag dbSNP:752607373
2181 2181 a, g dbSNP:770038029
2185 2185 a, g dbSNP:148611524
2191 2191 -, a dbSNP:762770205
2191 2191 c, t dbSNP:749485375
2195 2195 c, t dbSNP:770814240
2196 2196 a, c, g dbSNP:142061446
2201 2201 a, g dbSNP:759522250
2202 2202 -, t dbSNP:764149779
2203 2203 c, t dbSNP:771844281
2204 2204 a, c, t dbSNP:150786805
2205 2205 a, g dbSNP:763677235
2210 2210 g, t dbSNP:374714786
2218 2218 c, t dbSNP:753602551
2219 2219 a, t dbSNP:761368110
2221 2221 c, t dbSNP:139424223
2222 2222 a, g dbSNP:751816628
2229 2229 a, g dbSNP:755533137
2230 2230 a, g dbSNP:781637325
2241 2241 c, t dbSNP:753168881
2250 2250 -, agtcc dbSNP:751473908
2250 2250 g, t dbSNP:756233444
2251 2251 a, g dbSNP:777813552
2252 2252 c, g dbSNP:749587982
2259 2259 a, c, t dbSNP:531042257
2260 2260 a, g dbSNP:745599933
2266 2266 c, t dbSNP:772077418
2269 2269 a, g dbSNP:775618569
2277 2277 c, t dbSNP:772022233
2278 2278 a, g dbSNP:760679087
2285 2285 -, ct dbSNP:757109530
2288 2288 -, t dbSNP:781379450
2293 2293 c, t dbSNP:768348048
2299 2299 c, t dbSNP:776215636
2301 2301 c, g, t dbSNP:11548638
2302 2302 -, a dbSNP:750453657
2304 2304 -, c dbSNP:756422494
2304 2304 c, t dbSNP:377076809
2305 2305 a, g dbSNP:375294105
2308 2308 a, g dbSNP:144080871
2318 2318 c, t dbSNP:767842607
2319 2319 a, g dbSNP:540010749
2321 2321 a, g dbSNP:756605512
2322 2322 a, g dbSNP:777834009
2334 2334 c, t dbSNP:370481237
2335 2335 a, g dbSNP:199727564
2341 2341 c, g dbSNP:778961691
2342 2342 a, g dbSNP:746082405
2344 2344 c, t dbSNP:772051734
2345 2345 c, t dbSNP:570055949
2350 2350 a, g dbSNP:746949003
2355 2355 -, cttct dbSNP:780179500
2370 2370 a, g dbSNP:146092066
2376 2376 -, g dbSNP:749671180
2377 2377 a, g dbSNP:776230758
2388 2388 c, g dbSNP:116069534
2389 2389 c, g dbSNP:769319285
2392 2392 a, c dbSNP:772785564
2393 2393 c, g dbSNP:762650433
2400 2400 c, g dbSNP:767934309
2401 2401 c, t dbSNP:371482381
2414 2414 c, t dbSNP:761182927
2417 2417 a, g dbSNP:764533820
2418 2418 -, gtcc dbSNP:755291116
2420 2420 -, c dbSNP:779431270
2421 2421 c, t dbSNP:61746305
2425 2425 c, t dbSNP:757320769
2426 2426 c, t dbSNP:765347184
2427 2427 a, g dbSNP:750678816
2434 2434 c, g, t dbSNP:758628629
2435 2435 c, g dbSNP:746754910
2437 2437 c, t dbSNP:200300835
2438 2438 g, t dbSNP:754999782
2446 2446 a, g dbSNP:781035932
2449 2449 a, g dbSNP:61742526
2455 2455 -, at dbSNP:748732103
2455 2455 a, g dbSNP:763199567
2459 2459 c, g dbSNP:199887787
2464 2464 c, t dbSNP:748941071
2471 2471 a, g dbSNP:770512697
2473 2473 a, t dbSNP:775853768
2479 2479 a, c, g dbSNP:368323623
2486 2486 c, t dbSNP:10277
2488 2488 c, t dbSNP:774468810
2489 2489 a, g dbSNP:143664576
2491 2491 c, g dbSNP:372880666
2500 2500 a, g dbSNP:541354577
2507 2507 g, t dbSNP:766672073
2523 2523 c, t dbSNP:751804819
2524 2524 a, g dbSNP:754872474
2525 2525 a, g dbSNP:781024263
2529 2529 c, t dbSNP:748097828
2538 2538 a, c dbSNP:756011095
2539 2539 c, g dbSNP:777158440
2545 2545 a, g dbSNP:748746630
2547 2547 c, g dbSNP:553584436
2553 2553 c, t dbSNP:778576827
2554 2554 -, a dbSNP:772438323
2562 2562 c, t dbSNP:767667234
2563 2563 a, c, g dbSNP:768969990
2577 2577 c, t dbSNP:762242695
2578 2578 a, g dbSNP:770287311
2582 2582 c, t dbSNP:765194020
2584 2584 -, ctc dbSNP:776265041
2588 2588 c, t dbSNP:773459500
2598 2598 a, g dbSNP:763168668
2601 2601 c, t dbSNP:766549467
2608 2608 g, t dbSNP:751892071
2609 2609 g, t dbSNP:759825154
2614 2614 c, t dbSNP:767217752
2615 2615 a, c dbSNP:752475897
2616 2616 a, c dbSNP:756026168
2620 2620 c, g dbSNP:777724565
2623 2623 c, t dbSNP:376933990
2628 2628 c, g dbSNP:371031967
2629 2629 c, g dbSNP:753743592
2641 2641 c, g, t dbSNP:201824663
2645 2645 a, g dbSNP:745524145
2646 2646 -, ag dbSNP:745365806
2654 2654 c, t dbSNP:771699503
2659 2659 a, g dbSNP:781433632
2660 2660 c, t dbSNP:748507473
2661 2661 a, g dbSNP:376162024
2662 2662 c, g dbSNP:773908994
2663 2663 c, t dbSNP:763544769
2670 2670 g, t dbSNP:1065154
2676 2676 c, g dbSNP:774501769
2682 2682 c, t dbSNP:759688377
2684 2684 c, t dbSNP:199862884
2697 2697 a, g dbSNP:531005543
2713 2713 -, ctgggccttgg dbSNP:758268512
2742 2742 c, t dbSNP:182968597
2765 2765 a, g dbSNP:561116387

Target ORF information:

RefSeq Version NM_001142299
Organism Homo sapiens (human)
Definition Homo sapiens sequestosome 1 (SQSTM1), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26176
Accession Version NM_003900.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1323bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-JUL-2015
Organism Homo sapiens (human)
Product sequestosome-1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC398116.1, BC000951.2, BC017222.1 and AI333228.1. On May 16, 2008 this sequence version replaced gi:46251280. Summary: This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]. Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC017222.1, U46751.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)99..245(+)
Misc Feature(2)99..101(+)
Misc Feature(3)105..401(+)
Misc Feature(4)165..167(+)
Misc Feature(5)177..179(+)
Misc Feature(6)222..416(+)
Misc Feature(7)243..335(+)
Misc Feature(8)360..362(+)
Misc Feature(9)459..767(+)
Misc Feature(10)471..599(+)
Misc Feature(11)477..584(+)
Misc Feature(12)477..557(+)
Misc Feature(13)480..542(+)
Misc Feature(14)513..599(+)
Misc Feature(15)519..584(+)
Misc Feature(16)537..539(+)
Misc Feature(17)603..755(+)
Misc Feature(18)603..605(+)
Misc Feature(19)621..623(+)
Misc Feature(20)633..635(+)
Misc Feature(21)639..641(+)
Misc Feature(22)714..716(+)
Misc Feature(23)777..794(+)
Misc Feature(24)792..794(+)
Misc Feature(25)840..842(+)
Misc Feature(26)891..893(+)
Misc Feature(27)891..893(+)
Misc Feature(28)900..1415(+)
Misc Feature(29)900..902(+)
Misc Feature(30)900..902(+)
Misc Feature(31)900..902(+)
Misc Feature(32)909..911(+)
Misc Feature(33)909..911(+)
Misc Feature(34)909..911(+)
Misc Feature(35)918..920(+)
Misc Feature(36)921..923(+)
Misc Feature(37)924..926(+)
Misc Feature(38)927..929(+)
Misc Feature(39)939..941(+)
Misc Feature(40)942..944(+)
Misc Feature(41)945..947(+)
Misc Feature(42)1011..1013(+)
Misc Feature(43)1047..1049(+)
Misc Feature(44)1056..1121(+)
Misc Feature(45)1077..1079(+)
Misc Feature(46)1077..1079(+)
Misc Feature(47)1089..1091(+)
Misc Feature(48)1089..1091(+)
Misc Feature(49)1101..1118(+)
Misc Feature(50)1110..1112(+)
Misc Feature(51)1119..1121(+)
Misc Feature(52)1122..1124(+)
Misc Feature(53)1158..1160(+)
Misc Feature(54)1176..1178(+)
Misc Feature(55)1188..1190(+)
Misc Feature(56)1191..1193(+)
Misc Feature(57)1191..1193(+)
Misc Feature(58)1203..1205(+)
Misc Feature(59)1218..1220(+)
Misc Feature(60)1272..1391(+)
Misc Feature(61)1305..1391(+)
Exon (1)1..300
Gene Synonym:
Exon (2)301..396
Gene Synonym:
Exon (3)397..626
Gene Synonym:
Exon (4)627..768
Gene Synonym:
Exon (5)769..849
Gene Synonym:
Exon (6)850..1064
Gene Synonym:
Exon (7)1065..1260
Gene Synonym:
Exon (8)1261..2903
Gene Synonym:
Position Chain Variation Link
4 4 c, t dbSNP:368244826
17 17 a, g dbSNP:368632141
18 18 a, g dbSNP:544039284
32 32 g, t dbSNP:562237609
53 53 c, g dbSNP:775932317
56 56 c, t dbSNP:760877175
57 57 a, g dbSNP:764726476
59 59 a, c dbSNP:754345060
60 60 a, c, t dbSNP:762386326
61 61 a, c, g dbSNP:189132632
65 65 a, c, t dbSNP:751278227
68 68 a, c dbSNP:754689970
69 69 a, c dbSNP:781131232
70 70 c, t dbSNP:748135610
71 71 a, g dbSNP:74523483
74 74 c, t dbSNP:777334007
76 76 c, t dbSNP:748739054
77 77 c, t dbSNP:770617947
78 78 a, g dbSNP:370874635
79 79 c, t dbSNP:761120269
80 80 c, t dbSNP:769189476
82 82 a, g dbSNP:777103572
83 83 c, t dbSNP:762476181
85 85 c, t dbSNP:372806118
86 86 g, t dbSNP:773356001
88 88 c, t dbSNP:762876294
90 90 c, t dbSNP:766657254
91 91 g, t dbSNP:751685590
94 94 c, t dbSNP:755172841
100 100 c, g, t dbSNP:377371202
101 101 a, g dbSNP:756106731
103 103 c, t dbSNP:777501273
104 104 c, g dbSNP:527309027
110 110 c, t dbSNP:756670021
111 111 c, g dbSNP:778461636
117 117 a, g dbSNP:745545107
123 123 c, t dbSNP:771845079
126 126 c, t dbSNP:777193579
129 129 c, g dbSNP:748465743
131 131 a, c dbSNP:770428754
141 141 g, t dbSNP:773552098
145 145 c, t dbSNP:141502868
164 164 c, t dbSNP:766419538
167 167 c, t dbSNP:774460525
179 179 a, c, t dbSNP:759823891
180 180 c, t dbSNP:752506754
182 182 c, t dbSNP:755859379
183 183 a, g dbSNP:764111892
186 186 c, t dbSNP:753766210
193 193 c, t dbSNP:200396166
201 201 a, g dbSNP:376158712
217 217 c, t dbSNP:745356508
224 224 c, g dbSNP:758136511
227 227 c, t dbSNP:11548639
234 234 c, g dbSNP:779786150
249 249 g, t dbSNP:748555662
251 251 c, t dbSNP:770236425
266 266 c, g dbSNP:773605598
267 267 c, t dbSNP:547257974
276 276 c, g dbSNP:749801323
278 278 c, t dbSNP:767340839
280 280 g, t dbSNP:774355338
281 281 c, t dbSNP:759558250
304 304 a, g dbSNP:754647146
308 308 c, t dbSNP:780842511
309 309 a, g dbSNP:376802604
310 310 c, g dbSNP:11548643
311 311 c, g dbSNP:757587948
317 317 a, g dbSNP:371268375
329 329 c, t dbSNP:746426826
333 333 a, g dbSNP:374178647
334 334 a, g dbSNP:780177259
335 335 c, g, t dbSNP:148366738
336 336 a, c, g dbSNP:368853286
346 346 c, t dbSNP:539682696
347 347 a, c dbSNP:752464933
355 355 c, t dbSNP:773117648
358 358 c, t dbSNP:763040103
360 360 c, t dbSNP:766411872
362 362 a, c, t dbSNP:150883783
363 363 a, g dbSNP:181263868
370 370 a, t dbSNP:752438818
375 375 a, g dbSNP:755702835
377 377 -, c dbSNP:749099216
382 382 a, g dbSNP:569811115
388 388 a, g dbSNP:750784335
390 390 a, c dbSNP:537142935
391 391 c, t dbSNP:11548641
398 398 c, g dbSNP:11548637
403 403 a, g dbSNP:748170760
407 407 a, c, g dbSNP:762547578
408 408 g, t dbSNP:749114620
410 410 c, t dbSNP:770804860
412 412 a, c, g dbSNP:778554903
414 414 c, t dbSNP:771903158
417 417 a, g dbSNP:775073015
420 420 c, t dbSNP:760122315
423 423 c, t dbSNP:139372286
427 427 c, t dbSNP:371719657
428 428 a, c dbSNP:770397751
430 430 a, c, t dbSNP:761423892
431 431 a, g, t dbSNP:144289539
436 436 c, t dbSNP:767842142
438 438 c, t dbSNP:752833104
439 439 a, g dbSNP:537503261
441 441 a, c, g dbSNP:756209668
445 445 c, t dbSNP:147810437
446 446 a, g dbSNP:376214713
447 447 c, t dbSNP:200152247
450 450 c, g, t dbSNP:548787835
451 451 a, g dbSNP:779807674
462 462 c, t dbSNP:746553762
463 463 a, g dbSNP:768195831
464 464 c, t dbSNP:776096990
467 467 a, c, t dbSNP:11548640
469 469 a, g dbSNP:769325755
473 473 a, g dbSNP:774780830
474 474 a, g dbSNP:528070897
479 479 c, t dbSNP:768088721
480 480 a, g dbSNP:753212399
488 488 c, t dbSNP:761229380
494 494 c, g dbSNP:768110162
496 496 c, t dbSNP:372480231
497 497 c, t dbSNP:375411629
500 500 a, g dbSNP:778947500
510 510 c, t dbSNP:750256905
511 511 a, g dbSNP:758090054
515 515 c, t dbSNP:779868430
521 521 -, agcgtctgcccagactacgacttgtgt dbSNP:754933881
523 523 a, g dbSNP:370096430
524 524 a, c dbSNP:374417389
525 525 a, g dbSNP:200973006
529 529 c, g dbSNP:747589923
539 539 c, t dbSNP:769497182
540 540 a, g dbSNP:772687435
551 551 c, t dbSNP:145037913
552 552 a, g dbSNP:145056421
557 557 c, t dbSNP:775988188
558 558 a, g dbSNP:767512628
560 560 a, g dbSNP:764632233
568 568 a, g dbSNP:776866832
569 569 c, g, t dbSNP:35266480
572 572 a, g dbSNP:765529281
573 573 a, c dbSNP:750652295
576 576 c, g, t dbSNP:758625124
577 577 a, g, t dbSNP:118160361
586 586 c, g dbSNP:376662069
587 587 c, t dbSNP:781049091
591 591 c, g dbSNP:368741963
593 593 c, t dbSNP:372518286
594 594 a, g dbSNP:755537361
595 595 a, c dbSNP:777302431
599 599 c, t dbSNP:748939282
601 601 c, t dbSNP:770616208
603 603 a, g dbSNP:377198490
606 606 a, c dbSNP:747322992
608 608 c, g dbSNP:199931327
612 612 a, g dbSNP:200731802
613 613 a, g dbSNP:762352281
618 618 c, t dbSNP:765281544
620 620 c, g, t dbSNP:750169565
635 635 a, g dbSNP:370203737
637 637 a, c, t dbSNP:113956324
641 641 c, t dbSNP:759721454
642 642 c, t dbSNP:567433223
643 643 a, g dbSNP:535606152
644 644 c, t dbSNP:760538532
647 647 g, t dbSNP:764039094
648 648 c, t dbSNP:753313263
651 651 c, t dbSNP:756791819
652 652 a, g dbSNP:778537429
657 657 a, g dbSNP:371832577
665 665 c, t dbSNP:758110159
666 666 a, g dbSNP:781478225
667 667 a, g dbSNP:534814879
674 674 c, t dbSNP:527602
675 675 a, g dbSNP:373585056
675 675 -, g dbSNP:773598132
676 676 a, g dbSNP:770216826
677 677 c, g dbSNP:11548634
687 687 c, t dbSNP:11548635
694 694 c, t dbSNP:578084747
700 700 c, t dbSNP:749357493
710 710 c, t dbSNP:771036207
714 714 a, c dbSNP:774388295
716 716 c, t dbSNP:545300445
719 719 a, g dbSNP:772219487
722 722 -, tcc dbSNP:747274001
727 727 c, g dbSNP:368010261
729 729 c, t dbSNP:201263163
730 730 a, g dbSNP:763972646
743 743 c, t dbSNP:753854571
745 745 a, g, t dbSNP:761822261
757 757 c, t dbSNP:199663339
758 758 a, g dbSNP:758128093
769 769 c, t dbSNP:202235745
771 771 c, t dbSNP:765200636
774 774 c, g dbSNP:772861524
777 777 c, t dbSNP:762503146
778 778 c, t dbSNP:151191977
779 779 a, g dbSNP:751263705
782 782 a, g dbSNP:140341924
785 785 a, g dbSNP:764575577
786 786 a, g dbSNP:754194273
790 790 c, t dbSNP:757778292
791 791 a, c, g dbSNP:145688323
795 795 a, g dbSNP:758549044
806 806 -, gaa dbSNP:767056938
807 807 a, g dbSNP:11548633
812 812 c, t dbSNP:747314158
813 813 a, g dbSNP:768757828
814 814 c, t dbSNP:142719499
819 819 c, g dbSNP:747892889
822 822 a, t dbSNP:769873457
824 824 a, t dbSNP:773244178
829 829 c, t dbSNP:762767720
849 849 g, t dbSNP:765959386
851 851 c, t dbSNP:769297000
853 853 c, t dbSNP:753016349
854 854 g, t dbSNP:756387572
858 858 a, c, g dbSNP:182522590
859 859 c, t dbSNP:770910704
864 864 a, g dbSNP:778679611
865 865 c, t dbSNP:745788957
866 866 c, t dbSNP:372827450
867 867 a, g dbSNP:774986849
869 869 c, t dbSNP:760388024
870 870 a, g dbSNP:768230977
878 878 c, t dbSNP:145001811
879 879 a, g dbSNP:763179729
882 882 a, g dbSNP:766939503
883 883 a, g dbSNP:774758833
884 884 a, g dbSNP:200889080
890 890 a, c dbSNP:568368794
891 891 a, c dbSNP:535756371
894 894 c, t dbSNP:138928957
895 895 a, g dbSNP:149424705
897 897 c, g dbSNP:753685955
898 898 c, t dbSNP:757045797
899 899 a, g dbSNP:778751638
900 900 a, c dbSNP:745853858
901 901 c, t dbSNP:185313167
902 902 c, g dbSNP:779544030
904 904 -, ccgtctct dbSNP:766055750
906 906 a, g dbSNP:376283809
908 908 c, g dbSNP:369606717
914 914 a, g dbSNP:200388590
916 916 a, g dbSNP:747803543
917 917 c, g dbSNP:55793208
919 919 a, g dbSNP:201923000
922 922 a, c, t dbSNP:202119215
928 928 c, t dbSNP:200445838
930 930 -, gag dbSNP:752009611
942 942 a, g dbSNP:148559402
943 943 a, g dbSNP:760785371
945 945 c, t dbSNP:764205744
952 952 c, t dbSNP:754060027
961 961 a, g dbSNP:757493001
969 969 g, t dbSNP:765011708
971 971 c, t dbSNP:4935
973 973 c, t dbSNP:758346353
982 982 -, gggtgggaatgttga dbSNP:754741710
982 982 c, t dbSNP:376459756
983 983 a, g, t dbSNP:148984239
986 986 a, t dbSNP:780729747
992 992 a, c, t dbSNP:139575774
1000 1000 a, g, t dbSNP:769482708
1001 1001 c, t dbSNP:11548642
1003 1003 c, t dbSNP:143746604
1006 1006 c, t dbSNP:150926394
1007 1007 a, g dbSNP:370970067
1014 1014 c, t dbSNP:768680051
1018 1018 a, c, t dbSNP:541356917
1019 1019 a, g dbSNP:139482113
1020 1020 a, g dbSNP:750241714
1021 1021 a, g dbSNP:762699098
1022 1022 a, g dbSNP:766129922
1023 1023 c, g dbSNP:751545372
1028 1028 a, g dbSNP:577797455
1029 1029 a, g dbSNP:545080321
1031 1031 a, g dbSNP:4797
1037 1037 c, t dbSNP:200695664
1038 1038 a, g dbSNP:777431896
1041 1041 c, t dbSNP:140315612
1049 1049 c, t dbSNP:56092424
1050 1050 a, g dbSNP:61748794
1054 1054 a, g dbSNP:747589104
1055 1055 a, g dbSNP:769143668
1056 1056 c, t dbSNP:140226523
1057 1057 a, g dbSNP:752889531
1076 1076 c, g dbSNP:760518420
1078 1078 c, t dbSNP:763767102
1079 1079 a, g dbSNP:146164139
1080 1080 c, g dbSNP:367902954
1081 1081 a, g dbSNP:148294622
1091 1091 -, agg dbSNP:778047147
1091 1091 a, g dbSNP:141436407
1093 1093 a, g dbSNP:755411592
1112 1112 c, t dbSNP:781390659
1114 1114 a, t dbSNP:748746226
1116 1116 c, g dbSNP:756607693
1126 1126 -, aag dbSNP:747073722
1133 1133 a, g dbSNP:150470670
1134 1134 a, g dbSNP:749308026
1138 1138 c, t dbSNP:772889843
1139 1139 a, g dbSNP:10058037
1140 1140 a, t dbSNP:774512680
1143 1143 -, a dbSNP:771124822
1149 1149 g, t dbSNP:765610848
1155 1155 -, ca dbSNP:781417955
1169 1169 a, g dbSNP:541743205
1170 1170 c, t dbSNP:575125039
1172 1172 a, g dbSNP:771948860
1178 1178 c, t dbSNP:201591177
1179 1179 a, g dbSNP:535932454
1183 1183 a, g dbSNP:375495050
1185 1185 c, t dbSNP:776303544
1189 1189 a, g dbSNP:761368437
1190 1190 c, t dbSNP:764810220
1199 1199 c, t dbSNP:750140541
1200 1200 c, t dbSNP:368657568
1203 1203 c, t dbSNP:143956614
1209 1209 c, g dbSNP:767990596
1211 1211 a, g dbSNP:752937017
1214 1214 a, g dbSNP:756626155
1217 1217 c, t dbSNP:778199086
1219 1219 c, g dbSNP:753946383
1223 1223 a, g dbSNP:569052431
1224 1224 c, g dbSNP:147305175
1229 1229 a, g dbSNP:778833279
1235 1235 c, t dbSNP:746170903
1237 1237 c, t dbSNP:772122047
1245 1245 c, t dbSNP:779915504
1248 1248 c, t dbSNP:746755240
1254 1254 c, g dbSNP:768745808
1255 1255 c, t dbSNP:776749939
1256 1256 a, g, t dbSNP:372271201
1258 1258 c, g dbSNP:772591130
1267 1267 a, g dbSNP:758452325
1270 1270 c, t dbSNP:104893941
1271 1271 a, g dbSNP:75700262
1272 1272 c, t dbSNP:539942101
1273 1273 a, g dbSNP:200551825
1277 1277 a, g dbSNP:747890873
1280 1280 c, t dbSNP:756095586
1282 1282 a, c dbSNP:777527845
1283 1283 a, g dbSNP:749217241
1289 1289 c, t dbSNP:770396685
1296 1296 a, c dbSNP:201795943
1301 1301 a, g dbSNP:745585269
1302 1302 a, t dbSNP:771657338
1304 1304 c, t dbSNP:777004439
1305 1305 a, g dbSNP:771966860
1310 1310 c, t dbSNP:368933511
1311 1311 g, t dbSNP:773645716
1316 1316 c, t dbSNP:763506589
1325 1325 c, t dbSNP:766437927
1326 1326 a, g dbSNP:143511494
1329 1329 a, t dbSNP:755261626
1340 1340 a, g dbSNP:148278350
1352 1352 c, t dbSNP:371720013
1359 1359 -, ta dbSNP:772772504
1362 1362 c, g dbSNP:755901084
1365 1365 a, g dbSNP:777601802
1367 1367 c, t dbSNP:374985304
1368 1368 a, g dbSNP:757212984
1372 1372 c, t dbSNP:201239306
1373 1373 a, g dbSNP:143977783
1374 1374 a, g dbSNP:771743528
1378 1378 -, g dbSNP:760169726
1379 1379 g, t dbSNP:573881131
1380 1380 c, g dbSNP:746655349
1383 1383 a, c dbSNP:770118706
1384 1384 c, t dbSNP:773625766
1394 1394 c, t dbSNP:763376504
1401 1401 c, t dbSNP:534476029
1403 1403 c, t dbSNP:774591916
1408 1408 c, t dbSNP:759646319
1409 1409 a, g dbSNP:182058393
1410 1410 a, c dbSNP:752910741
1411 1411 c, t dbSNP:199854262
1412 1412 a, g, t dbSNP:11548636
1415 1415 g, t dbSNP:753600779
1418 1418 -, acc dbSNP:765964997
1421 1421 a, c dbSNP:757166561
1425 1425 c, t dbSNP:778783549
1426 1426 -, tgcccacctcttc dbSNP:753485135
1426 1426 g, t dbSNP:750331363
1431 1431 -, cctcttctgcgtgcc dbSNP:765122407
1431 1431 a, t dbSNP:757952273
1432 1432 -, cctcttctgcgtgcc dbSNP:138527258
1435 1435 c, g dbSNP:779531319
1438 1438 a, c dbSNP:369114803
1442 1442 -, gtgcccctcttctgt dbSNP:752519655
1442 1442 -, t dbSNP:758468329
1442 1442 a, g dbSNP:768290894
1448 1448 c, t dbSNP:778010441
1450 1450 c, g, t dbSNP:760432280
1452 1452 -, tctg dbSNP:777849713
1452 1452 c, t dbSNP:775033427
1453 1453 c, g dbSNP:760096900
1456 1456 c, t dbSNP:373148815
1457 1457 c, g dbSNP:376209849
1461 1461 c, g, t dbSNP:370200075
1468 1468 -, tt dbSNP:751702490
1475 1475 g, t dbSNP:753608025
1477 1477 a, g dbSNP:577638223
1478 1478 c, t dbSNP:369609665
1479 1479 a, c, g dbSNP:750423230
1484 1484 a, c dbSNP:140407570
1485 1485 c, t dbSNP:751025643
1500 1500 c, t dbSNP:11548622
1501 1501 a, g dbSNP:155790
1501 1501 -, g dbSNP:757311547
1504 1504 c, g, t dbSNP:775814512
1514 1514 c, t dbSNP:747720686
1519 1519 c, t dbSNP:763290503
1527 1527 a, g dbSNP:771468767
1531 1531 -, ag dbSNP:781300399
1592 1592 -, tg dbSNP:575415090
1593 1593 -, tg dbSNP:386418446
1593 1593 g, t dbSNP:186996560
1594 1594 -, tg dbSNP:754001389
1602 1602 -, gt dbSNP:71714822
1606 1606 -, tg dbSNP:10688915
1608 1608 -, tga dbSNP:778634431
1610 1610 a, g dbSNP:11249660
1629 1629 a, g dbSNP:17409649
1632 1632 a, c dbSNP:17409643
1667 1667 c, t dbSNP:543706405
1670 1670 c, t dbSNP:746273783
1676 1676 c, t dbSNP:117531194
1678 1678 c, t dbSNP:529602681
1697 1697 c, g dbSNP:11548631
1707 1707 a, g dbSNP:559922612
1726 1726 c, g dbSNP:533446391
1737 1737 c, t dbSNP:11548630
1752 1752 -, ttttg dbSNP:771841908
1753 1753 c, t dbSNP:551056409
1805 1805 a, g dbSNP:188873621
1806 1806 c, t dbSNP:181341443
1814 1814 g, t dbSNP:150371553
1845 1845 -, gtgtt dbSNP:775566403
1912 1912 c, g dbSNP:764211030
1923 1923 c, t dbSNP:138055371
1924 1924 a, g dbSNP:185559724
1930 1930 g, t dbSNP:534941108
1939 1939 -, t dbSNP:768333264
1957 1957 g, t dbSNP:1060271
1959 1959 c, t dbSNP:14800
1968 1968 c, g dbSNP:746444162
1976 1976 c, g dbSNP:767960499
1978 1978 c, t dbSNP:14799
1979 1979 c, t dbSNP:776124208
2002 2002 c, t dbSNP:772638668
2009 2009 c, t dbSNP:11548623
2010 2010 a, g dbSNP:11548620
2018 2018 g, t dbSNP:775444139
2019 2019 c, t dbSNP:760769659
2020 2020 c, t dbSNP:577802143
2021 2021 c, g dbSNP:768589839
2023 2023 a, g dbSNP:776961227
2025 2025 a, c dbSNP:538337173
2026 2026 c, g dbSNP:556686676
2031 2031 c, t dbSNP:11548626
2034 2034 g, t dbSNP:772928838
2036 2036 a, c dbSNP:762893891
2038 2038 -, t dbSNP:746140288
2039 2039 c, t dbSNP:11548628
2041 2041 a, g dbSNP:766287584
2042 2042 c, g, t dbSNP:11548619
2050 2050 -, taat dbSNP:769882808
2051 2051 c, t dbSNP:10173
2060 2060 a, g dbSNP:766911366
2070 2070 a, c, t dbSNP:14801
2075 2075 -, ac dbSNP:780452209
2078 2078 -, atgacgttaaagcactttaatct dbSNP:769151251
2078 2078 -, a dbSNP:749644765
2080 2080 a, t dbSNP:112765500
2085 2085 a, t dbSNP:190193171
2109 2109 a, g dbSNP:542177571
2113 2113 a, t dbSNP:560957240
2128 2128 c, g dbSNP:149508576
2136 2136 a, g dbSNP:541743046
2141 2141 -, tctt dbSNP:144467418
2153 2153 g, t dbSNP:780421957
2168 2168 c, g, t dbSNP:752454397
2172 2172 -, cctcctaacaagtgtatctcgattaataa dbSNP:774786383
2176 2176 -, t dbSNP:760128130
2178 2178 -, acaagtgtatctcg dbSNP:770438256
2178 2178 a, t dbSNP:779423592
2180 2180 c, t dbSNP:746176027
2185 2185 -, tatc dbSNP:763592667
2186 2186 g, t dbSNP:759005945
2188 2188 a, t dbSNP:780652376
2191 2191 c, t dbSNP:559679314
2192 2192 a, g, t dbSNP:768839085
2193 2193 a, g dbSNP:748885911
2194 2194 -, taa dbSNP:775975516
2194 2194 c, t dbSNP:748378859
2200 2200 a, c dbSNP:769948339
2201 2201 c, t dbSNP:773016719
2204 2204 a, g dbSNP:73334055
2205 2205 c, t dbSNP:370269451
2208 2208 c, g dbSNP:766053650
2211 2211 c, t dbSNP:774391024
2213 2213 a, g dbSNP:759375479
2215 2215 -, atcacacatcatc dbSNP:759284983
2220 2220 a, g dbSNP:776303445
2221 2221 -, cat dbSNP:764971145
2225 2225 a, c dbSNP:754632178
2230 2230 c, t dbSNP:755839994
2231 2231 a, g dbSNP:552007127
2233 2233 a, c dbSNP:563731385
2237 2237 c, t dbSNP:758847992
2242 2242 c, t dbSNP:780269320
2247 2247 a, g dbSNP:747619918
2248 2248 c, t dbSNP:755377558
2249 2249 a, g dbSNP:781266614
2250 2250 a, g dbSNP:748178902
2251 2251 -, ag dbSNP:752607373
2251 2251 a, g dbSNP:770038029
2255 2255 a, g dbSNP:148611524
2261 2261 -, a dbSNP:762770205
2261 2261 c, t dbSNP:749485375
2265 2265 c, t dbSNP:770814240
2266 2266 a, c, g dbSNP:142061446
2271 2271 a, g dbSNP:759522250
2272 2272 -, t dbSNP:764149779
2273 2273 c, t dbSNP:771844281
2274 2274 a, c, t dbSNP:150786805
2275 2275 a, g dbSNP:763677235
2280 2280 g, t dbSNP:374714786
2288 2288 c, t dbSNP:753602551
2289 2289 a, t dbSNP:761368110
2291 2291 c, t dbSNP:139424223
2292 2292 a, g dbSNP:751816628
2299 2299 a, g dbSNP:755533137
2300 2300 a, g dbSNP:781637325
2311 2311 c, t dbSNP:753168881
2320 2320 -, agtcc dbSNP:751473908
2320 2320 g, t dbSNP:756233444
2321 2321 a, g dbSNP:777813552
2322 2322 c, g dbSNP:749587982
2329 2329 a, c, t dbSNP:531042257
2330 2330 a, g dbSNP:745599933
2336 2336 c, t dbSNP:772077418
2339 2339 a, g dbSNP:775618569
2347 2347 c, t dbSNP:772022233
2348 2348 a, g dbSNP:760679087
2355 2355 -, ct dbSNP:757109530
2358 2358 -, t dbSNP:781379450
2363 2363 c, t dbSNP:768348048
2369 2369 c, t dbSNP:776215636
2371 2371 c, g, t dbSNP:11548638
2372 2372 -, a dbSNP:750453657
2374 2374 -, c dbSNP:756422494
2374 2374 c, t dbSNP:377076809
2375 2375 a, g dbSNP:375294105
2378 2378 a, g dbSNP:144080871
2388 2388 c, t dbSNP:767842607
2389 2389 a, g dbSNP:540010749
2391 2391 a, g dbSNP:756605512
2392 2392 a, g dbSNP:777834009
2404 2404 c, t dbSNP:370481237
2405 2405 a, g dbSNP:199727564
2411 2411 c, g dbSNP:778961691
2412 2412 a, g dbSNP:746082405
2414 2414 c, t dbSNP:772051734
2415 2415 c, t dbSNP:570055949
2420 2420 a, g dbSNP:746949003
2425 2425 -, cttct dbSNP:780179500
2440 2440 a, g dbSNP:146092066
2446 2446 -, g dbSNP:749671180
2447 2447 a, g dbSNP:776230758
2458 2458 c, g dbSNP:116069534
2459 2459 c, g dbSNP:769319285
2462 2462 a, c dbSNP:772785564
2463 2463 c, g dbSNP:762650433
2470 2470 c, g dbSNP:767934309
2471 2471 c, t dbSNP:371482381
2484 2484 c, t dbSNP:761182927
2487 2487 a, g dbSNP:764533820
2488 2488 -, gtcc dbSNP:755291116
2490 2490 -, c dbSNP:779431270
2491 2491 c, t dbSNP:61746305
2495 2495 c, t dbSNP:757320769
2496 2496 c, t dbSNP:765347184
2497 2497 a, g dbSNP:750678816
2504 2504 c, g, t dbSNP:758628629
2505 2505 c, g dbSNP:746754910
2507 2507 c, t dbSNP:200300835
2508 2508 g, t dbSNP:754999782
2516 2516 a, g dbSNP:781035932
2519 2519 a, g dbSNP:61742526
2525 2525 -, at dbSNP:748732103
2525 2525 a, g dbSNP:763199567
2529 2529 c, g dbSNP:199887787
2534 2534 c, t dbSNP:748941071
2541 2541 a, g dbSNP:770512697
2543 2543 a, t dbSNP:775853768
2549 2549 a, c, g dbSNP:368323623
2556 2556 c, t dbSNP:10277
2558 2558 c, t dbSNP:774468810
2559 2559 a, g dbSNP:143664576
2561 2561 c, g dbSNP:372880666
2570 2570 a, g dbSNP:541354577
2577 2577 g, t dbSNP:766672073
2593 2593 c, t