Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

AP1M1 adaptor-related protein complex 1, mu 1 subunit [Homo sapiens (human)]

Gene Symbol AP1M1
Entrez Gene ID 8907
Full Name adaptor-related protein complex 1, mu 1 subunit
Synonyms AP47, CLAPM2, CLTNM, MU-1A
General protein information
Preferred Names
AP-1 complex subunit mu-1
AP-1 complex subunit mu-1
mu-adaptin 1
HA1 47 kDa subunit
clathrin adaptor protein AP47
AP-mu chain family member mu1A
golgi adaptor AP-1 47 kDa protein
clathrin coat assembly protein AP47
clathrin coat-associated protein AP47
adaptor protein complex AP-1 mu-1 subunit
golgi adaptor HA1/AP1 adaptin mu-1 subunit
adaptor-related protein complex 1 mu-1 subunit
clathrin assembly protein complex 1, medium chain
clathrin assembly protein complex AP1, mu subunit
clathrin assembly protein complex 1 medium chain 1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is the medium chain of the trans-Golgi network clathrin-associated protein complex AP-1. The other components of this complex are beta-prime-adaptin, gamma-adaptin, and the small chain AP1S1. This complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu62299 XM_011528399 PREDICTED: Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu62299 XM_011528400 PREDICTED: Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu30674 NM_032493 Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu07051 NM_001130524 Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu62299D
Sequence Information ORF Nucleotide Sequence (Length: 1194bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AP-1 complex subunit mu-1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)736..1545(+)
Misc Feature(2)775..1530(+)
Misc Feature(3)793..1515(+)
Position Chain Variation Link
53 53 a, g dbSNP:184509483
69 69 c, t dbSNP:539073355
91 91 c, t dbSNP:558790619
95 95 -, g dbSNP:141574813
99 99 a, g dbSNP:566054131
118 118 c, t dbSNP:112531448
175 175 a, c dbSNP:762854663
227 227 c, g dbSNP:143650906
275 275 c, t dbSNP:188820934
287 287 a, g dbSNP:545379307
291 291 g, t dbSNP:761406450
297 297 a, g dbSNP:372086424
328 328 a, g dbSNP:11557500
332 332 g, t dbSNP:766789996
334 334 c, t dbSNP:377502937
344 344 a, g dbSNP:534027489
348 348 c, t dbSNP:554289228
349 349 a, g dbSNP:200460904
350 350 a, g dbSNP:756722435
351 351 c, t dbSNP:117647142
352 352 a, g dbSNP:372560384
362 362 c, t dbSNP:769839602
395 395 -, aga dbSNP:765915345
403 403 a, g dbSNP:780111532
419 419 c, t dbSNP:749149339
420 420 a, g dbSNP:146062531
435 435 -, g dbSNP:753324780
435 435 c, g dbSNP:146546344
436 436 a, g dbSNP:762029617
436 436 -, g dbSNP:754685058
438 438 a, c, g, t dbSNP:141457321
441 441 a, g, t dbSNP:766957694
442 442 a, g dbSNP:781205990
448 448 c, t dbSNP:371850531
453 453 a, g dbSNP:374334160
457 457 a, c dbSNP:746086930
464 464 a, g dbSNP:201225112
469 469 a, g dbSNP:200294719
472 472 c, g dbSNP:765514475
478 478 c, t dbSNP:751224121
492 492 c, t dbSNP:11557502
495 495 a, g dbSNP:763199908
501 501 c, t dbSNP:150267214
502 502 a, g dbSNP:749998518
504 504 a, g, t dbSNP:557270397
506 506 a, g dbSNP:753840973
507 507 c, t dbSNP:755026389
508 508 a, g, t dbSNP:778991416
510 510 a, g dbSNP:200386274
513 513 a, g dbSNP:138900879
523 523 g, t dbSNP:199500241
531 531 c, t dbSNP:747130464
533 533 a, g dbSNP:771009421
543 543 a, g dbSNP:185628212
553 553 a, t dbSNP:376369808
555 555 c, t dbSNP:374109492
556 556 a, g dbSNP:371060297
560 560 a, g dbSNP:762852223
561 561 c, g, t dbSNP:780828809
566 566 a, g dbSNP:149396373
574 574 a, g dbSNP:757026191
589 589 c, t dbSNP:781418568
595 595 a, c dbSNP:77274551
600 600 c, t dbSNP:750607148
612 612 c, t dbSNP:756194794
618 618 a, g dbSNP:543903627
621 621 c, g dbSNP:143435975
624 624 c, t dbSNP:374149290
639 639 c, t dbSNP:368128882
642 642 a, c dbSNP:748543603
654 654 a, c dbSNP:772524205
657 657 c, t dbSNP:769439661
660 660 c, t dbSNP:776427192
668 668 c, t dbSNP:759206896
674 674 a, g dbSNP:769470393
678 678 a, g dbSNP:138053047
685 685 a, t dbSNP:143519787
711 711 -, agg dbSNP:749481709
711 711 -, ag dbSNP:759304514
711 711 a, g dbSNP:773057955
714 714 g, t dbSNP:11557499
716 716 c, t dbSNP:760488719
719 719 c, t dbSNP:766560881
720 720 a, g dbSNP:373845816
725 725 c, t dbSNP:755015923
735 735 c, t dbSNP:199860370
736 736 a, g dbSNP:374835622
744 744 c, t dbSNP:759036451
746 746 c, t dbSNP:369323152
747 747 a, g, t dbSNP:747379798
753 753 c, t dbSNP:560332890
770 770 c, t dbSNP:779606736
774 774 a, g dbSNP:372999997
789 789 a, g dbSNP:768068780
796 796 c, t dbSNP:773912765
801 801 c, t dbSNP:747653326
807 807 c, t dbSNP:772037968
813 813 a, t dbSNP:773112928
816 816 c, t dbSNP:140278932
822 822 c, g dbSNP:760411906
831 831 c, t dbSNP:757965926
832 832 a, g dbSNP:777141997
833 833 c, g, t dbSNP:752308670
837 837 c, t dbSNP:149668778
838 838 a, g dbSNP:150789905
842 842 a, g dbSNP:770937090
850 850 c, t dbSNP:780968690
851 851 a, g dbSNP:745679023
856 856 a, g dbSNP:769670450
861 861 c, t dbSNP:139150489
862 862 a, g dbSNP:763211790
875 875 a, g dbSNP:377436209
880 880 c, t dbSNP:774557887
894 894 a, g dbSNP:149921079
903 903 c, t dbSNP:768123276
924 924 c, t dbSNP:750850455
940 940 a, g dbSNP:761062270
948 948 a, c, g dbSNP:147795014
954 954 c, t dbSNP:199774903
955 955 a, g dbSNP:200593906
969 969 a, c, t dbSNP:61735380
1006 1006 c, t dbSNP:766864704
1007 1007 a, g dbSNP:777016904
1011 1011 a, g dbSNP:560386574
1012 1012 a, t dbSNP:763828773
1015 1015 c, t dbSNP:199959764
1017 1017 c, t dbSNP:756795435
1020 1020 c, t dbSNP:142555840
1041 1041 c, g dbSNP:749941507
1053 1053 a, c, t dbSNP:143380976
1056 1056 c, t dbSNP:146557925
1057 1057 a, g dbSNP:754683740
1065 1065 c, t dbSNP:374198455
1080 1080 c, t dbSNP:368590185
1088 1088 a, t dbSNP:748254657
1095 1095 c, t dbSNP:772322734
1116 1116 c, t dbSNP:556098749
1117 1117 a, g dbSNP:376335032
1119 1119 a, g dbSNP:753831628
1122 1122 a, g dbSNP:371478159
1128 1128 c, t dbSNP:765187857
1129 1129 a, g dbSNP:752479355
1136 1136 a, c dbSNP:758159905
1138 1138 c, t dbSNP:778001987
1139 1139 a, c dbSNP:751713363
1140 1140 c, t dbSNP:757340479
1142 1142 a, c dbSNP:199710426
1152 1152 c, t dbSNP:745957793
1158 1158 c, t dbSNP:770245780
1170 1170 c, g dbSNP:762934598
1176 1176 c, t dbSNP:764012197
1207 1207 a, g dbSNP:774173547
1210 1210 a, g dbSNP:761575577
1219 1219 a, g dbSNP:767655492
1224 1224 c, t dbSNP:141184712
1227 1227 g, t dbSNP:756157199
1231 1231 a, t dbSNP:774060620
1232 1232 a, g dbSNP:143405159
1239 1239 c, t dbSNP:755612694
1258 1258 a, g dbSNP:779538071
1259 1259 c, t dbSNP:151315587
1260 1260 a, g dbSNP:140598704
1263 1263 a, g dbSNP:780709008
1272 1272 c, t dbSNP:532714925
1273 1273 a, g dbSNP:769317734
1287 1287 c, t dbSNP:775130446
1295 1295 c, g dbSNP:748765049
1296 1296 c, t dbSNP:150468368
1299 1299 g, t dbSNP:774225467
1302 1302 c, t dbSNP:3752797
1303 1303 a, g dbSNP:767279011
1312 1312 a, g dbSNP:773324732
1317 1317 a, g dbSNP:761018019
1324 1324 a, c dbSNP:766509522
1344 1344 a, g dbSNP:759691280
1359 1359 c, g, t dbSNP:111489002
1360 1360 a, g dbSNP:145833370
1365 1365 a, g dbSNP:764477775
1374 1374 a, g dbSNP:752003842
1381 1381 a, g dbSNP:757515218
1387 1387 -, aag dbSNP:752323777
1404 1404 a, g, t dbSNP:199981304
1409 1409 c, g dbSNP:753423243
1420 1420 a, g dbSNP:754498704
1441 1441 c, t dbSNP:111434021
1443 1443 c, t dbSNP:149333439
1455 1455 a, g dbSNP:770189489
1458 1458 c, t dbSNP:201411972
1461 1461 c, t dbSNP:376948295
1473 1473 c, t dbSNP:370959225
1485 1485 a, g dbSNP:527247445
1518 1518 a, g dbSNP:34850342
1521 1521 c, g dbSNP:762285943
1533 1533 c, t dbSNP:368068984
1552 1552 a, c, g dbSNP:751077992
1555 1555 g, t dbSNP:767593182
1560 1560 c, t dbSNP:377712548
1561 1561 a, g dbSNP:755987562
1569 1569 c, t dbSNP:577475020
1571 1571 -, c dbSNP:751351568
1574 1574 c, t dbSNP:753665081
1575 1575 a, g dbSNP:375321256
1579 1579 c, g, t dbSNP:567076354
1580 1580 c, t dbSNP:546425522
1581 1581 a, g dbSNP:564803280
1590 1590 a, g dbSNP:369847063
1594 1594 a, g dbSNP:771462229
1600 1600 c, t dbSNP:527394286
1617 1617 c, t dbSNP:535215936
1654 1654 g, t dbSNP:756260692
1659 1659 c, t dbSNP:540652538
1667 1667 c, t dbSNP:554903220
1708 1708 a, t dbSNP:574898945
1711 1711 c, t dbSNP:529933933
1721 1721 c, t dbSNP:544473423
1722 1722 a, g dbSNP:180812155
1743 1743 a, g dbSNP:569623333
1750 1750 c, g dbSNP:768790096
1752 1752 a, g dbSNP:373218469
1769 1769 a, g dbSNP:142391348
1785 1785 a, t dbSNP:558181516
1818 1818 c, t dbSNP:151308579
1826 1826 a, g dbSNP:184924392
1834 1834 c, t dbSNP:771929468
1853 1853 c, t dbSNP:533953027
1885 1885 c, t dbSNP:377566718
1904 1904 a, g dbSNP:578219911
1916 1916 a, g dbSNP:537449863
1927 1927 c, t dbSNP:557638445
1950 1950 c, t dbSNP:577631677
1953 1953 c, t dbSNP:79527189
1976 1976 c, t dbSNP:553568264
1977 1977 a, g dbSNP:572026314
1980 1980 a, g dbSNP:547739004
2020 2020 c, t dbSNP:139365735
2021 2021 a, g dbSNP:560713743
2050 2050 c, g dbSNP:567447773
2063 2063 c, t dbSNP:543017807
2064 2064 a, g dbSNP:776046996
2088 2088 c, t dbSNP:563214798
2109 2109 c, t dbSNP:189731088
2127 2127 a, g dbSNP:8374
2129 2129 c, t dbSNP:73928775
2137 2137 g, t dbSNP:57217266
2141 2141 c, t dbSNP:117975943
2142 2142 a, g dbSNP:568569120
2155 2155 a, g dbSNP:58784176
2174 2174 a, g dbSNP:551007227
2175 2175 c, t dbSNP:762277925
2176 2176 a, g dbSNP:571146355
2189 2189 a, t dbSNP:540166403
2195 2195 a, g dbSNP:112012276
2201 2201 a, c dbSNP:573426256
2208 2208 c, g dbSNP:535681487
2225 2225 a, g dbSNP:554603621
2234 2234 a, g dbSNP:116526824
2260 2260 a, g dbSNP:750955126
2274 2274 -, a dbSNP:554114877
2323 2323 c, g dbSNP:760459227
2325 2325 a, c dbSNP:756724493
2340 2340 c, t dbSNP:780139207
2352 2352 a, g dbSNP:753883566
2355 2355 c, t dbSNP:755167941
2370 2370 c, t dbSNP:542980696
2381 2381 c, t dbSNP:144474462
2387 2387 c, t dbSNP:576722310
2422 2422 g, t dbSNP:536330214
2433 2433 g, t dbSNP:559396532

Target ORF information:

RefSeq Version XM_011528399
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu62299D
Sequence Information ORF Nucleotide Sequence (Length: 1194bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product AP-1 complex subunit mu-1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)567..1376(+)
Misc Feature(2)606..1361(+)
Misc Feature(3)624..1346(+)
Position Chain Variation Link
39 39 a, g dbSNP:184509483
55 55 c, t dbSNP:539073355
77 77 c, t dbSNP:558790619
81 81 -, g dbSNP:141574813
85 85 a, g dbSNP:566054131
104 104 c, t dbSNP:112531448
159 159 a, g dbSNP:11557500
163 163 g, t dbSNP:766789996
165 165 c, t dbSNP:377502937
175 175 a, g dbSNP:534027489
179 179 c, t dbSNP:554289228
180 180 a, g dbSNP:200460904
181 181 a, g dbSNP:756722435
182 182 c, t dbSNP:117647142
183 183 a, g dbSNP:372560384
193 193 c, t dbSNP:769839602
226 226 -, aga dbSNP:765915345
234 234 a, g dbSNP:780111532
250 250 c, t dbSNP:749149339
251 251 a, g dbSNP:146062531
266 266 -, g dbSNP:753324780
266 266 c, g dbSNP:146546344
267 267 a, g dbSNP:762029617
267 267 -, g dbSNP:754685058
269 269 a, c, g, t dbSNP:141457321
272 272 a, g, t dbSNP:766957694
273 273 a, g dbSNP:781205990
279 279 c, t dbSNP:371850531
284 284 a, g dbSNP:374334160
288 288 a, c dbSNP:746086930
295 295 a, g dbSNP:201225112
300 300 a, g dbSNP:200294719
303 303 c, g dbSNP:765514475
309 309 c, t dbSNP:751224121
323 323 c, t dbSNP:11557502
326 326 a, g dbSNP:763199908
332 332 c, t dbSNP:150267214
333 333 a, g dbSNP:749998518
335 335 a, g, t dbSNP:557270397
337 337 a, g dbSNP:753840973
338 338 c, t dbSNP:755026389
339 339 a, g, t dbSNP:778991416
341 341 a, g dbSNP:200386274
344 344 a, g dbSNP:138900879
354 354 g, t dbSNP:199500241
362 362 c, t dbSNP:747130464
364 364 a, g dbSNP:771009421
374 374 a, g dbSNP:185628212
384 384 a, t dbSNP:376369808
386 386 c, t dbSNP:374109492
387 387 a, g dbSNP:371060297
391 391 a, g dbSNP:762852223
392 392 c, g, t dbSNP:780828809
397 397 a, g dbSNP:149396373
405 405 a, g dbSNP:757026191
420 420 c, t dbSNP:781418568
426 426 a, c dbSNP:77274551
431 431 c, t dbSNP:750607148
443 443 c, t dbSNP:756194794
449 449 a, g dbSNP:543903627
452 452 c, g dbSNP:143435975
455 455 c, t dbSNP:374149290
470 470 c, t dbSNP:368128882
473 473 a, c dbSNP:748543603
485 485 a, c dbSNP:772524205
488 488 c, t dbSNP:769439661
491 491 c, t dbSNP:776427192
499 499 c, t dbSNP:759206896
505 505 a, g dbSNP:769470393
509 509 a, g dbSNP:138053047
516 516 a, t dbSNP:143519787
542 542 -, agg dbSNP:749481709
542 542 -, ag dbSNP:759304514
542 542 a, g dbSNP:773057955
545 545 g, t dbSNP:11557499
547 547 c, t dbSNP:760488719
550 550 c, t dbSNP:766560881
551 551 a, g dbSNP:373845816
556 556 c, t dbSNP:755015923
566 566 c, t dbSNP:199860370
567 567 a, g dbSNP:374835622
575 575 c, t dbSNP:759036451
577 577 c, t dbSNP:369323152
578 578 a, g, t dbSNP:747379798
584 584 c, t dbSNP:560332890
601 601 c, t dbSNP:779606736
605 605 a, g dbSNP:372999997
620 620 a, g dbSNP:768068780
627 627 c, t dbSNP:773912765
632 632 c, t dbSNP:747653326
638 638 c, t dbSNP:772037968
644 644 a, t dbSNP:773112928
647 647 c, t dbSNP:140278932
653 653 c, g dbSNP:760411906
662 662 c, t dbSNP:757965926
663 663 a, g dbSNP:777141997
664 664 c, g, t dbSNP:752308670
668 668 c, t dbSNP:149668778
669 669 a, g dbSNP:150789905
673 673 a, g dbSNP:770937090
681 681 c, t dbSNP:780968690
682 682 a, g dbSNP:745679023
687 687 a, g dbSNP:769670450
692 692 c, t dbSNP:139150489
693 693 a, g dbSNP:763211790
706 706 a, g dbSNP:377436209
711 711 c, t dbSNP:774557887
725 725 a, g dbSNP:149921079
734 734 c, t dbSNP:768123276
755 755 c, t dbSNP:750850455
771 771 a, g dbSNP:761062270
779 779 a, c, g dbSNP:147795014
785 785 c, t dbSNP:199774903
786 786 a, g dbSNP:200593906
800 800 a, c, t dbSNP:61735380
837 837 c, t dbSNP:766864704
838 838 a, g dbSNP:777016904
842 842 a, g dbSNP:560386574
843 843 a, t dbSNP:763828773
846 846 c, t dbSNP:199959764
848 848 c, t dbSNP:756795435
851 851 c, t dbSNP:142555840
872 872 c, g dbSNP:749941507
884 884 a, c, t dbSNP:143380976
887 887 c, t dbSNP:146557925
888 888 a, g dbSNP:754683740
896 896 c, t dbSNP:374198455
911 911 c, t dbSNP:368590185
919 919 a, t dbSNP:748254657
926 926 c, t dbSNP:772322734
947 947 c, t dbSNP:556098749
948 948 a, g dbSNP:376335032
950 950 a, g dbSNP:753831628
953 953 a, g dbSNP:371478159
959 959 c, t dbSNP:765187857
960 960 a, g dbSNP:752479355
967 967 a, c dbSNP:758159905
969 969 c, t dbSNP:778001987
970 970 a, c dbSNP:751713363
971 971 c, t dbSNP:757340479
973 973 a, c dbSNP:199710426
983 983 c, t dbSNP:745957793
989 989 c, t dbSNP:770245780
1001 1001 c, g dbSNP:762934598
1007 1007 c, t dbSNP:764012197
1038 1038 a, g dbSNP:774173547
1041 1041 a, g dbSNP:761575577
1050 1050 a, g dbSNP:767655492
1055 1055 c, t dbSNP:141184712
1058 1058 g, t dbSNP:756157199
1062 1062 a, t dbSNP:774060620
1063 1063 a, g dbSNP:143405159
1070 1070 c, t dbSNP:755612694
1089 1089 a, g dbSNP:779538071
1090 1090 c, t dbSNP:151315587
1091 1091 a, g dbSNP:140598704
1094 1094 a, g dbSNP:780709008
1103 1103 c, t dbSNP:532714925
1104 1104 a, g dbSNP:769317734
1118 1118 c, t dbSNP:775130446
1126 1126 c, g dbSNP:748765049
1127 1127 c, t dbSNP:150468368
1130 1130 g, t dbSNP:774225467
1133 1133 c, t dbSNP:3752797
1134 1134 a, g dbSNP:767279011
1143 1143 a, g dbSNP:773324732
1148 1148 a, g dbSNP:761018019
1155 1155 a, c dbSNP:766509522
1175 1175 a, g dbSNP:759691280
1190 1190 c, g, t dbSNP:111489002
1191 1191 a, g dbSNP:145833370
1196 1196 a, g dbSNP:764477775
1205 1205 a, g dbSNP:752003842
1212 1212 a, g dbSNP:757515218
1218 1218 -, aag dbSNP:752323777
1235 1235 a, g, t dbSNP:199981304
1240 1240 c, g dbSNP:753423243
1251 1251 a, g dbSNP:754498704
1272 1272 c, t dbSNP:111434021
1274 1274 c, t dbSNP:149333439
1286 1286 a, g dbSNP:770189489
1289 1289 c, t dbSNP:201411972
1292 1292 c, t dbSNP:376948295
1304 1304 c, t dbSNP:370959225
1316 1316 a, g dbSNP:527247445
1349 1349 a, g dbSNP:34850342
1352 1352 c, g dbSNP:762285943
1364 1364 c, t dbSNP:368068984
1383 1383 a, c, g dbSNP:751077992
1386 1386 g, t dbSNP:767593182
1391 1391 c, t dbSNP:377712548
1392 1392 a, g dbSNP:755987562
1400 1400 c, t dbSNP:577475020
1402 1402 -, c dbSNP:751351568
1405 1405 c, t dbSNP:753665081
1406 1406 a, g dbSNP:375321256
1410 1410 c, g, t dbSNP:567076354
1411 1411 c, t dbSNP:546425522
1412 1412 a, g dbSNP:564803280
1421 1421 a, g dbSNP:369847063
1425 1425 a, g dbSNP:771462229
1431 1431 c, t dbSNP:527394286
1448 1448 c, t dbSNP:535215936
1485 1485 g, t dbSNP:756260692
1490 1490 c, t dbSNP:540652538
1498 1498 c, t dbSNP:554903220
1539 1539 a, t dbSNP:574898945
1542 1542 c, t dbSNP:529933933
1552 1552 c, t dbSNP:544473423
1553 1553 a, g dbSNP:180812155
1574 1574 a, g dbSNP:569623333
1581 1581 c, g dbSNP:768790096
1583 1583 a, g dbSNP:373218469
1600 1600 a, g dbSNP:142391348
1616 1616 a, t dbSNP:558181516
1649 1649 c, t dbSNP:151308579
1657 1657 a, g dbSNP:184924392
1665 1665 c, t dbSNP:771929468
1684 1684 c, t dbSNP:533953027
1716 1716 c, t dbSNP:377566718
1735 1735 a, g dbSNP:578219911
1747 1747 a, g dbSNP:537449863
1758 1758 c, t dbSNP:557638445
1781 1781 c, t dbSNP:577631677
1784 1784 c, t dbSNP:79527189
1807 1807 c, t dbSNP:553568264
1808 1808 a, g dbSNP:572026314
1811 1811 a, g dbSNP:547739004
1851 1851 c, t dbSNP:139365735
1852 1852 a, g dbSNP:560713743
1881 1881 c, g dbSNP:567447773
1894 1894 c, t dbSNP:543017807
1895 1895 a, g dbSNP:776046996
1919 1919 c, t dbSNP:563214798
1940 1940 c, t dbSNP:189731088
1958 1958 a, g dbSNP:8374
1960 1960 c, t dbSNP:73928775
1968 1968 g, t dbSNP:57217266
1972 1972 c, t dbSNP:117975943
1973 1973 a, g dbSNP:568569120
1986 1986 a, g dbSNP:58784176
2005 2005 a, g dbSNP:551007227
2006 2006 c, t dbSNP:762277925
2007 2007 a, g dbSNP:571146355
2020 2020 a, t dbSNP:540166403
2026 2026 a, g dbSNP:112012276
2032 2032 a, c dbSNP:573426256
2039 2039 c, g dbSNP:535681487
2056 2056 a, g dbSNP:554603621
2065 2065 a, g dbSNP:116526824
2091 2091 a, g dbSNP:750955126
2105 2105 -, a dbSNP:554114877
2154 2154 c, g dbSNP:760459227
2156 2156 a, c dbSNP:756724493
2171 2171 c, t dbSNP:780139207
2183 2183 a, g dbSNP:753883566
2186 2186 c, t dbSNP:755167941
2201 2201 c, t dbSNP:542980696
2212 2212 c, t dbSNP:144474462
2218 2218 c, t dbSNP:576722310
2253 2253 g, t dbSNP:536330214
2264 2264 g, t dbSNP:559396532

Target ORF information:

RefSeq Version XM_011528400
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu30674D
Sequence Information ORF Nucleotide Sequence (Length: 1272bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product AP-1 complex subunit mu-1 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC386056.1, BC017469.2, AK027528.1, BU729646.1 and BQ014582.1. On Jul 26, 2008 this sequence version replaced gi:18105005. Summary: The protein encoded by this gene is the medium chain of the trans-Golgi network clathrin-associated protein complex AP-1. The other components of this complex are beta-prime-adaptin, gamma-adaptin, and the small chain AP1S1. This complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks a coding exon in the middle region, as compared to variant 1. The reading frame is not affected and the resulting isoform (2) lacks an internal segment, as compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC017469.2, AK027528.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)69..71(+)
Misc Feature(2)177..179(+)
Misc Feature(3)630..1439(+)
Misc Feature(4)669..1424(+)
Misc Feature(5)687..1409(+)
Exon (1)1..215
Gene Synonym:
Exon (2)216..372
Gene Synonym:
Exon (3)373..440
Gene Synonym:
Exon (4)441..571
Gene Synonym:
Exon (5)572..719
Gene Synonym:
Exon (6)720..846
Gene Synonym:
Exon (7)847..989
Gene Synonym:
Exon (8)990..1061
Gene Synonym:
Exon (9)1062..1220
Gene Synonym:
Exon (10)1221..1346
Gene Synonym:
Exon (11)1347..1422
Gene Synonym:
Exon (12)1423..2355
Gene Synonym:
Position Chain Variation Link
9 9 c, g dbSNP:771766134
15 15 c, t dbSNP:554881211
18 18 a, c dbSNP:776955638
26 26 a, g dbSNP:746269612
44 44 c, g dbSNP:574690978
46 46 a, g dbSNP:770295018
90 90 c, t dbSNP:373507031
114 114 c, t dbSNP:562430538
121 121 a, g dbSNP:185553755
122 122 -, cctcggc, cgctgccgccgccaccgccctcggc dbSNP:145442379
128 128 c, g dbSNP:766290016
129 129 c, g dbSNP:753640801
132 132 c, t dbSNP:759342576
136 136 a, g dbSNP:765423378
138 138 c, t dbSNP:190533719
144 144 c, g dbSNP:564852170
148 148 c, t dbSNP:777929833
150 150 c, t dbSNP:752129181
155 155 a, g dbSNP:201384618
156 156 a, c dbSNP:781722603
157 157 c, g dbSNP:746262018
158 158 c, g dbSNP:756479903
161 161 a, t dbSNP:778452872
162 162 -, ggccg dbSNP:762345944
162 162 c, t dbSNP:747761115
164 164 g, t dbSNP:771576013
167 167 a, c dbSNP:772766260
168 168 a, g dbSNP:11557501
184 184 c, g dbSNP:746516632
185 185 c, t dbSNP:770895102
190 190 c, t dbSNP:776608508
194 194 c, t dbSNP:151262762
198 198 c, t dbSNP:765038374
204 204 c, t dbSNP:775576994
207 207 a, g dbSNP:11557503
222 222 a, g dbSNP:11557500
226 226 g, t dbSNP:766789996
228 228 c, t dbSNP:377502937
238 238 a, g dbSNP:534027489
242 242 c, t dbSNP:554289228
243 243 a, g dbSNP:200460904
244 244 a, g dbSNP:756722435
245 245 c, t dbSNP:117647142
246 246 a, g dbSNP:372560384
256 256 c, t dbSNP:769839602
289 289 -, aga dbSNP:765915345
297 297 a, g dbSNP:780111532
313 313 c, t dbSNP:749149339
314 314 a, g dbSNP:146062531
329 329 -, g dbSNP:753324780
329 329 c, g dbSNP:146546344
330 330 a, g dbSNP:762029617
330 330 -, g dbSNP:754685058
332 332 a, c, g, t dbSNP:141457321
335 335 a, g, t dbSNP:766957694
336 336 a, g dbSNP:781205990
342 342 c, t dbSNP:371850531
347 347 a, g dbSNP:374334160
351 351 a, c dbSNP:746086930
358 358 a, g dbSNP:201225112
363 363 a, g dbSNP:200294719
366 366 c, g dbSNP:765514475
372 372 c, t dbSNP:751224121
386 386 c, t dbSNP:11557502
389 389 a, g dbSNP:763199908
395 395 c, t dbSNP:150267214
396 396 a, g dbSNP:749998518
398 398 a, g, t dbSNP:557270397
400 400 a, g dbSNP:753840973
401 401 c, t dbSNP:755026389
402 402 a, g, t dbSNP:778991416
404 404 a, g dbSNP:200386274
407 407 a, g dbSNP:138900879
417 417 g, t dbSNP:199500241
425 425 c, t dbSNP:747130464
427 427 a, g dbSNP:771009421
437 437 a, g dbSNP:185628212
447 447 a, t dbSNP:376369808
449 449 c, t dbSNP:374109492
450 450 a, g dbSNP:371060297
454 454 a, g dbSNP:762852223
455 455 c, g, t dbSNP:780828809
460 460 a, g dbSNP:149396373
468 468 a, g dbSNP:757026191
483 483 c, t dbSNP:781418568
489 489 a, c dbSNP:77274551
494 494 c, t dbSNP:750607148
506 506 c, t dbSNP:756194794
512 512 a, g dbSNP:543903627
515 515 c, g dbSNP:143435975
518 518 c, t dbSNP:374149290
533 533 c, t dbSNP:368128882
536 536 a, c dbSNP:748543603
548 548 a, c dbSNP:772524205
551 551 c, t dbSNP:769439661
554 554 c, t dbSNP:776427192
562 562 c, t dbSNP:759206896
568 568 a, g dbSNP:769470393
572 572 a, g dbSNP:138053047
579 579 a, t dbSNP:143519787
605 605 -, agg dbSNP:749481709
605 605 -, ag dbSNP:759304514
605 605 a, g dbSNP:773057955
608 608 g, t dbSNP:11557499
610 610 c, t dbSNP:760488719
613 613 c, t dbSNP:766560881
614 614 a, g dbSNP:373845816
619 619 c, t dbSNP:755015923
629 629 c, t dbSNP:199860370
630 630 a, g dbSNP:374835622
638 638 c, t dbSNP:759036451
640 640 c, t dbSNP:369323152
641 641 a, g, t dbSNP:747379798
647 647 c, t dbSNP:560332890
664 664 c, t dbSNP:779606736
668 668 a, g dbSNP:372999997
683 683 a, g dbSNP:768068780
690 690 c, t dbSNP:773912765
695 695 c, t dbSNP:747653326
701 701 c, t dbSNP:772037968
707 707 a, t dbSNP:773112928
710 710 c, t dbSNP:140278932
716 716 c, g dbSNP:760411906
725 725 c, t dbSNP:757965926
726 726 a, g dbSNP:777141997
727 727 c, g, t dbSNP:752308670
731 731 c, t dbSNP:149668778
732 732 a, g dbSNP:150789905
736 736 a, g dbSNP:770937090
744 744 c, t dbSNP:780968690
745 745 a, g dbSNP:745679023
750 750 a, g dbSNP:769670450
755 755 c, t dbSNP:139150489
756 756 a, g dbSNP:763211790
769 769 a, g dbSNP:377436209
774 774 c, t dbSNP:774557887
788 788 a, g dbSNP:149921079
797 797 c, t dbSNP:768123276
818 818 c, t dbSNP:750850455
834 834 a, g dbSNP:761062270
842 842 a, c, g dbSNP:147795014
848 848 c, t dbSNP:199774903
849 849 a, g dbSNP:200593906
863 863 a, c, t dbSNP:61735380
900 900 c, t dbSNP:766864704
901 901 a, g dbSNP:777016904
905 905 a, g dbSNP:560386574
906 906 a, t dbSNP:763828773
909 909 c, t dbSNP:199959764
911 911 c, t dbSNP:756795435
914 914 c, t dbSNP:142555840
935 935 c, g dbSNP:749941507
947 947 a, c, t dbSNP:143380976
950 950 c, t dbSNP:146557925
951 951 a, g dbSNP:754683740
959 959 c, t dbSNP:374198455
974 974 c, t dbSNP:368590185
982 982 a, t dbSNP:748254657
989 989 c, t dbSNP:772322734
1010 1010 c, t dbSNP:556098749
1011 1011 a, g dbSNP:376335032
1013 1013 a, g dbSNP:753831628
1016 1016 a, g dbSNP:371478159
1022 1022 c, t dbSNP:765187857
1023 1023 a, g dbSNP:752479355
1030 1030 a, c dbSNP:758159905
1032 1032 c, t dbSNP:778001987
1033 1033 a, c dbSNP:751713363
1034 1034 c, t dbSNP:757340479
1036 1036 a, c dbSNP:199710426
1046 1046 c, t dbSNP:745957793
1052 1052 c, t dbSNP:770245780
1064 1064 c, g dbSNP:762934598
1070 1070 c, t dbSNP:764012197
1101 1101 a, g dbSNP:774173547
1104 1104 a, g dbSNP:761575577
1113 1113 a, g dbSNP:767655492
1118 1118 c, t dbSNP:141184712
1121 1121 g, t dbSNP:756157199
1125 1125 a, t dbSNP:774060620
1126 1126 a, g dbSNP:143405159
1133 1133 c, t dbSNP:755612694
1152 1152 a, g dbSNP:779538071
1153 1153 c, t dbSNP:151315587
1154 1154 a, g dbSNP:140598704
1157 1157 a, g dbSNP:780709008
1166 1166 c, t dbSNP:532714925
1167 1167 a, g dbSNP:769317734
1181 1181 c, t dbSNP:775130446
1189 1189 c, g dbSNP:748765049
1190 1190 c, t dbSNP:150468368
1193 1193 g, t dbSNP:774225467
1196 1196 c, t dbSNP:3752797
1197 1197 a, g dbSNP:767279011
1206 1206 a, g dbSNP:773324732
1211 1211 a, g dbSNP:761018019
1218 1218 a, c dbSNP:766509522
1238 1238 a, g dbSNP:759691280
1253 1253 c, g, t dbSNP:111489002
1254 1254 a, g dbSNP:145833370
1259 1259 a, g dbSNP:764477775
1268 1268 a, g dbSNP:752003842
1275 1275 a, g dbSNP:757515218
1281 1281 -, aag dbSNP:752323777
1298 1298 a, g, t dbSNP:199981304
1303 1303 c, g dbSNP:753423243
1314 1314 a, g dbSNP:754498704
1335 1335 c, t dbSNP:111434021
1337 1337 c, t dbSNP:149333439
1349 1349 a, g dbSNP:770189489
1352 1352 c, t dbSNP:201411972
1355 1355 c, t dbSNP:376948295
1367 1367 c, t dbSNP:370959225
1379 1379 a, g dbSNP:527247445
1412 1412 a, g dbSNP:34850342
1415 1415 c, g dbSNP:762285943
1427 1427 c, t dbSNP:368068984
1446 1446 a, c, g dbSNP:751077992
1449 1449 g, t dbSNP:767593182
1454 1454 c, t dbSNP:377712548
1455 1455 a, g dbSNP:755987562
1463 1463 c, t dbSNP:577475020
1465 1465 -, c dbSNP:751351568
1468 1468 c, t dbSNP:753665081
1469 1469 a, g dbSNP:375321256
1473 1473 c, g, t dbSNP:567076354
1474 1474 c, t dbSNP:546425522
1475 1475 a, g dbSNP:564803280
1484 1484 a, g dbSNP:369847063
1488 1488 a, g dbSNP:771462229
1494 1494 c, t dbSNP:527394286
1511 1511 c, t dbSNP:535215936
1548 1548 g, t dbSNP:756260692
1553 1553 c, t dbSNP:540652538
1561 1561 c, t dbSNP:554903220
1602 1602 a, t dbSNP:574898945
1605 1605 c, t dbSNP:529933933
1615 1615 c, t dbSNP:544473423
1616 1616 a, g dbSNP:180812155
1637 1637 a, g dbSNP:569623333
1644 1644 c, g dbSNP:768790096
1646 1646 a, g dbSNP:373218469
1663 1663 a, g dbSNP:142391348
1679 1679 a, t dbSNP:558181516
1712 1712 c, t dbSNP:151308579
1720 1720 a, g dbSNP:184924392
1728 1728 c, t dbSNP:771929468
1747 1747 c, t dbSNP:533953027
1779 1779 c, t dbSNP:377566718
1798 1798 a, g dbSNP:578219911
1810 1810 a, g dbSNP:537449863
1821 1821 c, t dbSNP:557638445
1844 1844 c, t dbSNP:577631677
1847 1847 c, t dbSNP:79527189
1870 1870 c, t dbSNP:553568264
1871 1871 a, g dbSNP:572026314
1874 1874 a, g dbSNP:547739004
1914 1914 c, t dbSNP:139365735
1915 1915 a, g dbSNP:560713743
1944 1944 c, g dbSNP:567447773
1957 1957 c, t dbSNP:543017807
1958 1958 a, g dbSNP:776046996
1982 1982 c, t dbSNP:563214798
2003 2003 c, t dbSNP:189731088
2021 2021 a, g dbSNP:8374
2023 2023 c, t dbSNP:73928775
2031 2031 g, t dbSNP:57217266
2035 2035 c, t dbSNP:117975943
2036 2036 a, g dbSNP:568569120
2049 2049 a, g dbSNP:58784176
2068 2068 a, g dbSNP:551007227
2069 2069 c, t dbSNP:762277925
2070 2070 a, g dbSNP:571146355
2083 2083 a, t dbSNP:540166403
2089 2089 a, g dbSNP:112012276
2095 2095 a, c dbSNP:573426256
2102 2102 c, g dbSNP:535681487
2119 2119 a, g dbSNP:554603621
2128 2128 a, g dbSNP:116526824
2154 2154 a, g dbSNP:750955126
2168 2168 -, a dbSNP:554114877
2217 2217 c, g dbSNP:760459227
2219 2219 a, c dbSNP:756724493
2234 2234 c, t dbSNP:780139207
2246 2246 a, g dbSNP:753883566
2249 2249 c, t dbSNP:755167941
2264 2264 c, t dbSNP:542980696
2275 2275 c, t dbSNP:144474462
2281 2281 c, t dbSNP:576722310
2316 2316 g, t dbSNP:536330214
2327 2327 g, t dbSNP:559396532

Target ORF information:

RefSeq Version NM_032493
Organism Homo sapiens (human)
Definition Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu07051D
Sequence Information ORF Nucleotide Sequence (Length: 1308bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product AP-1 complex subunit mu-1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC386056.1, DQ059565.1, AB209808.1, BU729646.1 and BQ014582.1. Summary: The protein encoded by this gene is the medium chain of the trans-Golgi network clathrin-associated protein complex AP-1. The other components of this complex are beta-prime-adaptin, gamma-adaptin, and the small chain AP1S1. This complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB209808.1, DQ059565.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA2142853 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)69..71(+)
Misc Feature(2)630..1475(+)
Misc Feature(3)669..1460(+)
Misc Feature(4)687..1445(+)
Exon (1)1..215
Gene Synonym:
Exon (2)216..372
Gene Synonym:
Exon (3)373..440
Gene Synonym:
Exon (4)441..571
Gene Synonym:
Exon (5)572..719
Gene Synonym:
Exon (6)720..755
Gene Synonym:
Exon (7)756..882
Gene Synonym:
Exon (8)883..1025
Gene Synonym:
Exon (9)1026..1097
Gene Synonym:
Exon (10)1098..1256
Gene Synonym:
Exon (11)1257..1382
Gene Synonym:
Exon (12)1383..1458
Gene Synonym:
Exon (13)1459..2391
Gene Synonym:
Position Chain Variation Link
9 9 c, g dbSNP:771766134
15 15 c, t dbSNP:554881211
18 18 a, c dbSNP:776955638
26 26 a, g dbSNP:746269612
44 44 c, g dbSNP:574690978
46 46 a, g dbSNP:770295018
90 90 c, t dbSNP:373507031
114 114 c, t dbSNP:562430538
121 121 a, g dbSNP:185553755
122 122 -, cctcggc, cgctgccgccgccaccgccctcggc dbSNP:145442379
128 128 c, g dbSNP:766290016
129 129 c, g dbSNP:753640801
132 132 c, t dbSNP:759342576
136 136 a, g dbSNP:765423378
138 138 c, t dbSNP:190533719
144 144 c, g dbSNP:564852170
148 148 c, t dbSNP:777929833
150 150 c, t dbSNP:752129181
155 155 a, g dbSNP:201384618
156 156 a, c dbSNP:781722603
157 157 c, g dbSNP:746262018
158 158 c, g dbSNP:756479903
161 161 a, t dbSNP:778452872
162 162 -, ggccg dbSNP:762345944
162 162 c, t dbSNP:747761115
164 164 g, t dbSNP:771576013
167 167 a, c dbSNP:772766260
168 168 a, g dbSNP:11557501
184 184 c, g dbSNP:746516632
185 185 c, t dbSNP:770895102
190 190 c, t dbSNP:776608508
194 194 c, t dbSNP:151262762
198 198 c, t dbSNP:765038374
204 204 c, t dbSNP:775576994
207 207 a, g dbSNP:11557503
222 222 a, g dbSNP:11557500
226 226 g, t dbSNP:766789996
228 228 c, t dbSNP:377502937
238 238 a, g dbSNP:534027489
242 242 c, t dbSNP:554289228
243 243 a, g dbSNP:200460904
244 244 a, g dbSNP:756722435
245 245 c, t dbSNP:117647142
246 246 a, g dbSNP:372560384
256 256 c, t dbSNP:769839602
289 289 -, aga dbSNP:765915345
297 297 a, g dbSNP:780111532
313 313 c, t dbSNP:749149339
314 314 a, g dbSNP:146062531
329 329 -, g dbSNP:753324780
329 329 c, g dbSNP:146546344
330 330 a, g dbSNP:762029617
330 330 -, g dbSNP:754685058
332 332 a, c, g, t dbSNP:141457321
335 335 a, g, t dbSNP:766957694
336 336 a, g dbSNP:781205990
342 342 c, t dbSNP:371850531
347 347 a, g dbSNP:374334160
351 351 a, c dbSNP:746086930
358 358 a, g dbSNP:201225112
363 363 a, g dbSNP:200294719
366 366 c, g dbSNP:765514475
372 372 c, t dbSNP:751224121
386 386 c, t dbSNP:11557502
389 389 a, g dbSNP:763199908
395 395 c, t dbSNP:150267214
396 396 a, g dbSNP:749998518
398 398 a, g, t dbSNP:557270397
400 400 a, g dbSNP:753840973
401 401 c, t dbSNP:755026389
402 402 a, g, t dbSNP:778991416
404 404 a, g dbSNP:200386274
407 407 a, g dbSNP:138900879
417 417 g, t dbSNP:199500241
425 425 c, t dbSNP:747130464
427 427 a, g dbSNP:771009421
437 437 a, g dbSNP:185628212
447 447 a, t dbSNP:376369808
449 449 c, t dbSNP:374109492
450 450 a, g dbSNP:371060297
454 454 a, g dbSNP:762852223
455 455 c, g, t dbSNP:780828809
460 460 a, g dbSNP:149396373
468 468 a, g dbSNP:757026191
483 483 c, t dbSNP:781418568
489 489 a, c dbSNP:77274551
494 494 c, t dbSNP:750607148
506 506 c, t dbSNP:756194794
512 512 a, g dbSNP:543903627
515 515 c, g dbSNP:143435975
518 518 c, t dbSNP:374149290
533 533 c, t dbSNP:368128882
536 536 a, c dbSNP:748543603
548 548 a, c dbSNP:772524205
551 551 c, t dbSNP:769439661
554 554 c, t dbSNP:776427192
562 562 c, t dbSNP:759206896
568 568 a, g dbSNP:769470393
572 572 a, g dbSNP:138053047
579 579 a, t dbSNP:143519787
605 605 -, agg dbSNP:749481709
605 605 -, ag dbSNP:759304514
605 605 a, g dbSNP:773057955
608 608 g, t dbSNP:11557499
610 610 c, t dbSNP:760488719
613 613 c, t dbSNP:766560881
614 614 a, g dbSNP:373845816
619 619 c, t dbSNP:755015923
629 629 c, t dbSNP:199860370
630 630 a, g dbSNP:374835622
638 638 c, t dbSNP:759036451
640 640 c, t dbSNP:369323152
641 641 a, g, t dbSNP:747379798
647 647 c, t dbSNP:560332890
664 664 c, t dbSNP:779606736
668 668 a, g dbSNP:372999997
683 683 a, g dbSNP:768068780
690 690 c, t dbSNP:773912765
695 695 c, t dbSNP:747653326
701 701 c, t dbSNP:772037968
707 707 a, t dbSNP:773112928
710 710 c, t dbSNP:140278932
716 716 c, g dbSNP:760411906
735 735 a, g dbSNP:771524667
755 755 a, g dbSNP:777574723
761 761 c, t dbSNP:757965926
762 762 a, g dbSNP:777141997
763 763 c, g, t dbSNP:752308670
767 767 c, t dbSNP:149668778
768 768 a, g dbSNP:150789905
772 772 a, g dbSNP:770937090
780 780 c, t dbSNP:780968690
781 781 a, g dbSNP:745679023
786 786 a, g dbSNP:769670450
791 791 c, t dbSNP:139150489
792 792 a, g dbSNP:763211790
805 805 a, g dbSNP:377436209
810 810 c, t dbSNP:774557887
824 824 a, g dbSNP:149921079
833 833 c, t dbSNP:768123276
854 854 c, t dbSNP:750850455
870 870 a, g dbSNP:761062270
878 878 a, c, g dbSNP:147795014
884 884 c, t dbSNP:199774903
885 885 a, g dbSNP:200593906
899 899 a, c, t dbSNP:61735380
936 936 c, t dbSNP:766864704
937 937 a, g dbSNP:777016904
941 941 a, g dbSNP:560386574
942 942 a, t dbSNP:763828773
945 945 c, t dbSNP:199959764
947 947 c, t dbSNP:756795435
950 950 c, t dbSNP:142555840
971 971 c, g dbSNP:749941507
983 983 a, c, t dbSNP:143380976
986 986 c, t dbSNP:146557925
987 987 a, g dbSNP:754683740
995 995 c, t dbSNP:374198455
1010 1010 c, t dbSNP:368590185
1018 1018 a, t dbSNP:748254657
1025 1025 c, t dbSNP:772322734
1046 1046 c, t dbSNP:556098749
1047 1047 a, g dbSNP:376335032
1049 1049 a, g dbSNP:753831628
1052 1052 a, g dbSNP:371478159
1058 1058 c, t dbSNP:765187857
1059 1059 a, g dbSNP:752479355
1066 1066 a, c dbSNP:758159905
1068 1068 c, t dbSNP:778001987
1069 1069 a, c dbSNP:751713363
1070 1070 c, t dbSNP:757340479
1072 1072 a, c dbSNP:199710426
1082 1082 c, t dbSNP:745957793
1088 1088 c, t dbSNP:770245780
1100 1100 c, g dbSNP:762934598
1106 1106 c, t dbSNP:764012197
1137 1137 a, g dbSNP:774173547
1140 1140 a, g dbSNP:761575577
1149 1149 a, g dbSNP:767655492
1154 1154 c, t dbSNP:141184712
1157 1157 g, t dbSNP:756157199
1161 1161 a, t dbSNP:774060620
1162 1162 a, g dbSNP:143405159
1169 1169 c, t dbSNP:755612694
1188 1188 a, g dbSNP:779538071
1189 1189 c, t dbSNP:151315587
1190 1190 a, g dbSNP:140598704
1193 1193 a, g dbSNP:780709008
1202 1202 c, t dbSNP:532714925
1203 1203 a, g dbSNP:769317734
1217 1217 c, t dbSNP:775130446
1225 1225 c, g dbSNP:748765049
1226 1226 c, t dbSNP:150468368
1229 1229 g, t dbSNP:774225467
1232 1232 c, t dbSNP:3752797
1233 1233 a, g dbSNP:767279011
1242 1242 a, g dbSNP:773324732
1247 1247 a, g dbSNP:761018019
1254 1254 a, c dbSNP:766509522
1274 1274 a, g dbSNP:759691280
1289 1289 c, g, t dbSNP:111489002
1290 1290 a, g dbSNP:145833370
1295 1295 a, g dbSNP:764477775
1304 1304 a, g dbSNP:752003842
1311 1311 a, g dbSNP:757515218
1317 1317 -, aag dbSNP:752323777
1334 1334 a, g, t dbSNP:199981304
1339 1339 c, g dbSNP:753423243
1350 1350 a, g dbSNP:754498704
1371 1371 c, t dbSNP:111434021
1373 1373 c, t dbSNP:149333439
1385 1385 a, g dbSNP:770189489
1388 1388 c, t dbSNP:201411972
1391 1391 c, t dbSNP:376948295
1403 1403 c, t dbSNP:370959225
1415 1415 a, g dbSNP:527247445
1448 1448 a, g dbSNP:34850342
1451 1451 c, g dbSNP:762285943
1463 1463 c, t dbSNP:368068984
1482 1482 a, c, g dbSNP:751077992
1485 1485 g, t dbSNP:767593182
1490 1490 c, t dbSNP:377712548
1491 1491 a, g dbSNP:755987562
1499 1499 c, t dbSNP:577475020
1501 1501 -, c dbSNP:751351568
1504 1504 c, t dbSNP:753665081
1505 1505 a, g dbSNP:375321256
1509 1509 c, g, t dbSNP:567076354
1510 1510 c, t dbSNP:546425522
1511 1511 a, g dbSNP:564803280
1520 1520 a, g dbSNP:369847063
1524 1524 a, g dbSNP:771462229
1530 1530 c, t dbSNP:527394286
1547 1547 c, t dbSNP:535215936
1584 1584 g, t dbSNP:756260692
1589 1589 c, t dbSNP:540652538
1597 1597 c, t dbSNP:554903220
1638 1638 a, t dbSNP:574898945
1641 1641 c, t dbSNP:529933933
1651 1651 c, t dbSNP:544473423
1652 1652 a, g dbSNP:180812155
1673 1673 a, g dbSNP:569623333
1680 1680 c, g dbSNP:768790096
1682 1682 a, g dbSNP:373218469
1699 1699 a, g dbSNP:142391348
1715 1715 a, t dbSNP:558181516
1748 1748 c, t dbSNP:151308579
1756 1756 a, g dbSNP:184924392
1764 1764 c, t dbSNP:771929468
1783 1783 c, t dbSNP:533953027
1815 1815 c, t dbSNP:377566718
1834 1834 a, g dbSNP:578219911
1846 1846 a, g dbSNP:537449863
1857 1857 c, t dbSNP:557638445
1880 1880 c, t dbSNP:577631677
1883 1883 c, t dbSNP:79527189
1906 1906 c, t dbSNP:553568264
1907 1907 a, g dbSNP:572026314
1910 1910 a, g dbSNP:547739004
1950 1950 c, t dbSNP:139365735
1951 1951 a, g dbSNP:560713743
1980 1980 c, g dbSNP:567447773
1993 1993 c, t dbSNP:543017807
1994 1994 a, g dbSNP:776046996
2018 2018 c, t dbSNP:563214798
2039 2039 c, t dbSNP:189731088
2057 2057 a, g dbSNP:8374
2059 2059 c, t dbSNP:73928775
2067 2067 g, t dbSNP:57217266
2071 2071 c, t dbSNP:117975943
2072 2072 a, g dbSNP:568569120
2085 2085 a, g dbSNP:58784176
2104 2104 a, g dbSNP:551007227
2105 2105 c, t dbSNP:762277925
2106 2106 a, g dbSNP:571146355
2119 2119 a, t dbSNP:540166403
2125 2125 a, g dbSNP:112012276
2131 2131 a, c dbSNP:573426256
2138 2138 c, g dbSNP:535681487
2155 2155 a, g dbSNP:554603621
2164 2164 a, g dbSNP:116526824
2190 2190 a, g dbSNP:750955126
2204 2204 -, a dbSNP:554114877
2253 2253 c, g dbSNP:760459227
2255 2255 a, c dbSNP:756724493
2270 2270 c, t dbSNP:780139207
2282 2282 a, g dbSNP:753883566
2285 2285 c, t dbSNP:755167941
2300 2300 c, t dbSNP:542980696
2311 2311 c, t dbSNP:144474462
2317 2317 c, t dbSNP:576722310
2352 2352 g, t dbSNP:536330214
2363 2363 g, t dbSNP:559396532

Target ORF information:

RefSeq Version NM_001130524
Organism Homo sapiens (human)
Definition Homo sapiens adaptor-related protein complex 1, mu 1 subunit (AP1M1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.