Email to GenScript

PHOX2B paired-like homeobox 2b [Homo sapiens (human)]

Gene Symbol PHOX2B
Entrez Gene ID 8929
Full Name paired-like homeobox 2b
Synonyms NBLST2, NBPhox, PMX2B
General protein information
Preferred Names
paired mesoderm homeobox protein 2B
paired mesoderm homeobox protein 2B
neuroblastoma Phox
PHOX2B homeodomain protein
paired mesoderm homeobox 2b
neuroblastoma paired-type homeobox protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Central hypoventilation syndrome, congenital, 209880 (3);

The following PHOX2B gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PHOX2B gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26329 NM_003924 Homo sapiens paired-like homeobox 2b (PHOX2B), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $309

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26329
Accession Version NM_003924.3
Sequence Information ORF Nucleotide Sequence (Length: 945bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product paired mesoderm homeobox protein 2B
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from D82344.1, BC017199.2, AC105389.3 and AI266171.1. This sequence is a reference standard in the RefSeqGene project. On Apr 4, 2008 this sequence version replaced gi:12707579. Summary: The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: D82344.1, BC017199.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA2145544 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)268..270(+)
Misc Feature(2)655..831(+)
Misc Feature(3)655..825(+)
Misc Feature(4)661..813(+)
Exon (1)1..601
Gene Synonym:
Exon (2)602..789
Gene Synonym:
Exon (3)790..3030
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:749179519
23 23 g, t dbSNP:746727700
55 55 g, t dbSNP:536875066
121 121 a, g dbSNP:532079003
166 166 a, g dbSNP:775569375
171 171 a, g, t dbSNP:567911121
240 240 a, g dbSNP:769914584
256 256 a, g dbSNP:538445545
323 323 c, t dbSNP:759671110
324 324 a, t dbSNP:754017596
333 333 c, t dbSNP:373063040
335 335 c, t dbSNP:111690228
336 336 c, g dbSNP:761275637
344 344 c, t dbSNP:554684781
354 354 a, c, t dbSNP:534756790
393 393 c, t dbSNP:773982008
394 394 c, t dbSNP:577333579
399 399 a, c, t dbSNP:748767112
402 402 c, t dbSNP:775101470
405 405 a, g dbSNP:769573717
417 417 c, t dbSNP:745833730
419 419 c, g dbSNP:587778605
421 421 a, c dbSNP:780786684
430 430 c, t dbSNP:200971068
438 438 a, g dbSNP:746854983
450 450 c, t dbSNP:200038327
459 459 c, g dbSNP:779251110
465 465 c, t dbSNP:755290304
471 471 c, t dbSNP:374160638
474 474 a, g dbSNP:766500239
480 480 c, t dbSNP:756519209
486 486 c, t dbSNP:750938350
506 506 a, c dbSNP:559227588
525 525 c, t dbSNP:762144117
532 532 c, t dbSNP:774739194
546 546 a, g dbSNP:763699416
587 587 c, g dbSNP:532711949
591 591 a, g, t dbSNP:376060053
594 594 c, t dbSNP:73810366
598 598 g, t dbSNP:550472167
604 604 c, t dbSNP:551983206
609 609 c, t dbSNP:753545181
613 613 c, g dbSNP:766200980
625 625 c, t dbSNP:755664325
627 627 c, t dbSNP:749994532
628 628 g, t dbSNP:528408156
648 648 c, g dbSNP:201892150
659 659 g, t dbSNP:104893855
666 666 c, g dbSNP:140002346
669 669 c, g dbSNP:199611260
675 675 c, t dbSNP:763804374
679 679 a, t dbSNP:762806075
682 682 a, g dbSNP:776824229
702 702 a, c dbSNP:112718633
705 705 a, g, t dbSNP:747055965
733 733 a, g dbSNP:560843362
737 737 a, g dbSNP:773193688
741 741 c, t dbSNP:772579725
751 751 c, g dbSNP:748614674
753 753 c, g dbSNP:779269711
765 765 a, c, t dbSNP:147497096
771 771 c, t dbSNP:749727192
781 781 c, g dbSNP:28939716
810 810 c, g dbSNP:17881486
825 825 a, g dbSNP:758358906
840 840 c, g dbSNP:752437432
841 841 c, g dbSNP:534384164
843 843 a, c dbSNP:765027210
846 846 a, c, t dbSNP:547677836
847 847 a, g dbSNP:767837376
852 852 a, g dbSNP:761776635
857 857 c, t dbSNP:774521395
858 858 g, t dbSNP:769236699
863 863 a, g dbSNP:763569681
868 868 c, g dbSNP:775931264
874 874 c, t dbSNP:770281540
891 891 c, t dbSNP:746303997
903 903 c, t dbSNP:780690330
909 909 a, g dbSNP:770661130
912 912 c, t dbSNP:17885216
950 950 a, g dbSNP:104893856
951 951 c, g dbSNP:144414806
965 965 c, g, t dbSNP:752633393
968 968 a, g dbSNP:778887680
976 976 c, t dbSNP:754754489
977 977 -, c dbSNP:587776626
977 977 c, g dbSNP:587778606
978 978 -, c dbSNP:776781430
990 990 g, t dbSNP:370087972
997 997 a, g dbSNP:762119056
998 998 -, agg dbSNP:764345783
999 999 a, c, g, t dbSNP:17879258
1000 1000 a, g dbSNP:776131193
1002 1002 c, t dbSNP:190973308
1008 1008 -, cgg dbSNP:760638643
1009 1009 a, g dbSNP:759792321
1011 1011 g, t dbSNP:777081672
1014 1014 a, c dbSNP:770437869
1021 1021 a, g dbSNP:746684161
1022 1022 c, t dbSNP:777194995
1025 1025 c, g dbSNP:771563787
1027 1027 g, t dbSNP:747713899
1033 1033 a, g dbSNP:112987541
1039 1039 g, t dbSNP:778799670
1040 1040 a, c, g, t dbSNP:779913205
1086 1086 a, g dbSNP:757355779
1089 1089 a, g dbSNP:751829128
1092 1092 -, c dbSNP:528100239
1098 1098 -, ggccgcggcagcggcggcggcggcagcggcagcggcggc dbSNP:757020181
1101 1101 a, c dbSNP:764470906
1104 1104 a, g dbSNP:758533453
1106 1106 c, t dbSNP:752867315
1109 1109 c, g dbSNP:765803171
1110 1110 a, g dbSNP:17882335
1113 1113 a, g dbSNP:776800047
1116 1116 -, ggcggcagcggcagcggcggc dbSNP:17879189
1120 1120 a, g dbSNP:766767855
1122 1122 -, agcggcagc dbSNP:750315370
1122 1122 a, c dbSNP:17884724
1125 1125 a, g dbSNP:543135182
1126 1126 a, g dbSNP:761010146
1128 1128 a, g dbSNP:574093401
1131 1131 -, ggcggcagc dbSNP:764220516
1131 1131 g, t dbSNP:772835924
1132 1132 a, g dbSNP:771759878
1133 1133 a, c dbSNP:747626591
1135 1135 a, g dbSNP:773873721
1136 1136 -, ggccgcggcagcggcggcggcggcagcggcagcggcggc dbSNP:17886470
1145 1145 g, t dbSNP:768420488
1147 1147 c, g dbSNP:749254001
1151 1151 c, g dbSNP:779924196
1152 1152 c, t dbSNP:755927299
1157 1157 c, t dbSNP:745709595
1161 1161 c, g dbSNP:778114366
1162 1162 g, t dbSNP:758728895
1163 1163 a, g, t dbSNP:765369462
1167 1167 c, t dbSNP:755371263
1185 1185 c, g dbSNP:754362364
1186 1186 a, g dbSNP:587778607
1188 1188 a, c, t dbSNP:761077266
1191 1191 c, g dbSNP:773606043
1192 1192 a, g dbSNP:138545772
1194 1194 c, t dbSNP:761468808
1197 1197 -, ggcccc dbSNP:752879767
1212 1212 c, g dbSNP:773785668
1213 1213 c, g dbSNP:372671435
1219 1219 c, t dbSNP:748808912
1220 1220 c, t dbSNP:775478414
1225 1225 a, g dbSNP:769663483
1230 1230 a, c, t dbSNP:17885864
1240 1240 a, g dbSNP:772358257
1245 1245 a, g dbSNP:748382088
1265 1265 a, g dbSNP:779068107
1276 1276 g, t dbSNP:755070000
1278 1278 c, t dbSNP:753912150
1279 1279 g, t dbSNP:780578509
1285 1285 c, g dbSNP:756644504
1287 1287 a, g dbSNP:750728938
1289 1289 a, g dbSNP:767873201
1292 1292 a, g dbSNP:762234006
1302 1302 c, t dbSNP:751212535
1310 1310 a, g dbSNP:763704619
1311 1311 a, t dbSNP:762497253
1314 1314 c, t dbSNP:774897796
1319 1319 a, g dbSNP:769726959
1322 1322 c, g dbSNP:759556353
1323 1323 a, g dbSNP:776498322
1324 1324 a, c dbSNP:770841700
1325 1325 a, g, t dbSNP:779171868
1328 1328 a, g dbSNP:768798757
1329 1329 -, gcggcggcg dbSNP:771616235
1333 1333 a, c dbSNP:749346904
1335 1335 -, gcg dbSNP:763380864
1337 1337 -, gcg, gcggcg, gcggcggcg dbSNP:774951337
1343 1343 g, t dbSNP:754671744
1346 1346 a, c dbSNP:780019991
1347 1347 a, g dbSNP:756546457
1359 1359 c, g dbSNP:578163582
1365 1365 a, g dbSNP:558416040
1379 1379 a, g dbSNP:538080267
1385 1385 a, g dbSNP:75913938
1466 1466 a, g dbSNP:114290493
1499 1499 a, c, t dbSNP:186778106
1509 1509 c, t dbSNP:547049342
1570 1570 c, g, t dbSNP:112714631
1583 1583 a, t dbSNP:73810341
1594 1594 g, t dbSNP:763708823
1632 1632 a, g dbSNP:551679079
1668 1668 c, g dbSNP:577899103
1674 1674 c, t dbSNP:760365271
1678 1678 a, t dbSNP:562632456
1691 1691 a, c dbSNP:543147656
1743 1743 -, a dbSNP:371928986
1745 1745 a, c dbSNP:772688984
1797 1797 c, g dbSNP:181743762
1808 1808 a, g dbSNP:560552240
1814 1814 a, c dbSNP:750862525
1847 1847 a, g dbSNP:540304746
1854 1854 -, a dbSNP:201654270
1855 1855 a, g dbSNP:577950819
1867 1867 a, g dbSNP:756881848
1905 1905 g, t dbSNP:73139116
1943 1943 c, g dbSNP:544491872
1978 1978 -, t dbSNP:397840867
1978 1978 a, g dbSNP:575439255
1979 1979 -, t dbSNP:3833622
1992 1992 c, t dbSNP:555491813
1998 1998 c, t dbSNP:535962589
2040 2040 a, g dbSNP:573620274
2042 2042 c, t dbSNP:745503233
2085 2085 a, c dbSNP:553814892
2124 2124 c, t dbSNP:189797897
2137 2137 c, t dbSNP:371402086
2143 2143 a, g dbSNP:367652707
2164 2164 a, g dbSNP:752221055
2177 2177 c, g dbSNP:551710234
2178 2178 g, t dbSNP:764865376
2204 2204 a, g dbSNP:759491335
2223 2223 c, g dbSNP:571701837
2234 2234 a, g dbSNP:776441235
2240 2240 g, t dbSNP:538092014
2320 2320 c, t dbSNP:770971831
2347 2347 g, t dbSNP:184952230
2353 2353 a, g dbSNP:549166447
2390 2390 a, c, g dbSNP:772252596
2431 2431 c, g dbSNP:118046131
2461 2461 a, c dbSNP:560413438
2471 2471 a, g dbSNP:778914258
2487 2487 a, g dbSNP:537473339
2615 2615 g, t dbSNP:180795407
2629 2629 a, g dbSNP:560506613
2648 2648 c, t dbSNP:564096488
2649 2649 c, t dbSNP:544504353
2652 2652 a, g dbSNP:62412180
2669 2669 a, g dbSNP:6826373
2677 2677 c, t dbSNP:756699047
2686 2686 c, t dbSNP:59260453
2692 2692 c, t dbSNP:11723860
2706 2706 c, g dbSNP:781647693
2709 2709 g, t dbSNP:35350459
2728 2728 g, t dbSNP:548833276
2757 2757 a, g dbSNP:553632399
2760 2760 g, t dbSNP:35977299
2766 2766 c, g dbSNP:758077435
2791 2791 c, t dbSNP:530550940
2835 2835 g, t dbSNP:577570301
2916 2916 a, g dbSNP:557759101
2967 2967 a, t dbSNP:1063611
2984 2984 a, t dbSNP:759116131
2985 2985 a, g dbSNP:569211044
2990 2990 a, g dbSNP:549279025
3017 3017 a, c dbSNP:1063612
3030 3030 a, g dbSNP:535339736

Target ORF information:

RefSeq Version NM_003924
Organism Homo sapiens (human)
Definition Homo sapiens paired-like homeobox 2b (PHOX2B), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.