Home » Species Summary » Homo sapiens » HPS4 cDNA ORF clone
Email to GenScript

HPS4 cDNA ORF clone, Homo sapiens (human)

Gene Symbol HPS4
Entrez Gene ID 89781
Full Name Hermansky-Pudlak syndrome 4
Synonyms LE
General protein information
Preferred Names
Hermansky-Pudlak syndrome 4 protein
Hermansky-Pudlak syndrome 4 protein
light-ear protein homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]. lac of sum
Disorder MIM:


Disorder Html: Hermansky-Pudlak syndrome 4, 203300 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011530485 XP_011528787 Hermansky-Pudlak syndrome 4 protein isoform X1
XM_011530486 XP_011528788 Hermansky-Pudlak syndrome 4 protein isoform X1
XM_011530487 XP_011528789 Hermansky-Pudlak syndrome 4 protein isoform X1
XM_011530488 XP_011528790 Hermansky-Pudlak syndrome 4 protein isoform X1
XM_011530489 XP_011528791 Hermansky-Pudlak syndrome 4 protein isoform X1
XM_011530490 XP_011528792 Hermansky-Pudlak syndrome 4 protein isoform X2
XM_006724353 XP_006724416 Hermansky-Pudlak syndrome 4 protein isoform X3
XM_006724354 XP_006724417 Hermansky-Pudlak syndrome 4 protein isoform X3
XM_011530491 XP_011528793 Hermansky-Pudlak syndrome 4 protein isoform X4
XM_011530492 XP_011528794 Hermansky-Pudlak syndrome 4 protein isoform X5
XM_011530493 XP_011528795 Hermansky-Pudlak syndrome 4 protein isoform X6
XM_011530494 XP_011528796 Hermansky-Pudlak syndrome 4 protein isoform X7
XM_006724360 XP_006724423 Hermansky-Pudlak syndrome 4 protein isoform X8
XM_011530495 XP_011528797 Hermansky-Pudlak syndrome 4 protein isoform X8
XM_011530496 XP_011528798 Hermansky-Pudlak syndrome 4 protein isoform X7
NM_022081 NP_071364 Hermansky-Pudlak syndrome 4 protein isoform a
NM_152841 NP_690054 Hermansky-Pudlak syndrome 4 protein isoform b

Homo sapiens (human) HPS4 NP_071364.4
Pan troglodytes (chimpanzee) HPS4 XP_001172017.1
Macaca mulatta (Rhesus monkey) HPS4 XP_001099509.1
Canis lupus familiaris (dog) HPS4 XP_543456.2
Bos taurus (cattle) HPS4 NP_001069836.2
Mus musculus (house mouse) Hps4 NP_619587.3
Rattus norvegicus (Norway rat) Hps4 NP_001100618.1
Gallus gallus (chicken) HPS4 XP_415198.3
Xenopus (Silurana) tropicalis (western clawed frog) hps4 NP_001072472.1


ID Name Evidence
GO:0005624 membrane fraction IDA
GO:0005737 cytoplasm IDA
GO:0005764 lysosome IDA
GO:0016023 cytoplasmic membrane-bounded vesicle IEA
GO:0042470 melanosome IDA
GO:0042827 platelet dense granule IDA


ID Name Evidence
GO:0005515 protein binding IPI
GO:0042803 protein homodimerization activity IPI
GO:0046983 protein dimerization activity IPI


ID Name Evidence
GO:0006605 protein targeting IDA
GO:0006996 organelle organization IEA
GO:0007040 lysosome organization IDA
GO:0007596 blood coagulation IEA
GO:0007599 hemostasis TAS
GO:0030318 melanocyte differentiation IEA
GO:0048075 positive regulation of eye pigmentation TAS
GO:0050821 protein stabilization IPI

Related articles in PubMed

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following HPS4 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HPS4 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu74053 XM_011530485 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74053 XM_011530486 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74053 XM_011530487 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74053 XM_011530488 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74053 XM_011530489 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74054 XM_011530490 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu53739 XM_006724353 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu53739 XM_006724354 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74055 XM_011530491 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74056 XM_011530492 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu74057 XM_011530493 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu53746 XM_011530494 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu53744 XM_006724360 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X14, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu53744 XM_011530495 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X15, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu53746 XM_011530496 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X16, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu21009 NM_022081 Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 $379.00
OHu20693 NM_152841 Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu74053
Accession Version XM_011530485.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)2031..>2384(+)
Position Chain Variation Link
32 32 c, g dbSNP:56821996
35 35 g, t dbSNP:547422864
67 67 a, g dbSNP:532089191
75 75 g, t dbSNP:187762406
79 79 c, t dbSNP:184042272
94 94 c, g dbSNP:531283049
99 99 c, t dbSNP:560781291
106 106 c, t dbSNP:115916720
130 130 a, g dbSNP:3747137
170 170 c, g dbSNP:553609699
216 216 a, g dbSNP:551554467
220 220 a, g dbSNP:543525170
240 240 a, g dbSNP:532940807
258 258 a, g dbSNP:567406073
265 265 a, c dbSNP:147631281
307 307 c, t dbSNP:550575971
322 322 c, g dbSNP:763625074
324 324 a, t dbSNP:757938034
355 355 a, g dbSNP:529182573
364 364 c, t dbSNP:5761557
407 407 c, t dbSNP:3747134
419 419 c, g dbSNP:572621201
431 431 -, t dbSNP:200535558
475 475 a, g dbSNP:188205202
505 505 a, t dbSNP:545593544
567 567 c, t dbSNP:759331653
589 589 c, t dbSNP:578089748
613 613 c, g, t dbSNP:556695127
614 614 a, c, g dbSNP:187291798
615 615 -, gataccgg dbSNP:766405923
618 618 a, g dbSNP:369803062
649 649 c, g dbSNP:774733114
652 652 a, c dbSNP:768963068
654 654 c, t dbSNP:763357219
668 668 c, t dbSNP:775899708
672 672 a, g dbSNP:570371168
674 674 c, t dbSNP:144622501
679 679 c, g dbSNP:781358501
682 682 a, t dbSNP:142329133
686 686 a, t dbSNP:747194252
687 687 a, g dbSNP:141268657
697 697 c, t dbSNP:778872709
698 698 a, g dbSNP:766139027
700 700 c, g dbSNP:376524160
705 705 a, g dbSNP:745759291
706 706 -, a dbSNP:763190774
710 710 c, t dbSNP:781088233
716 716 -, t dbSNP:281865097
726 726 a, g dbSNP:756803307
737 737 a, g dbSNP:751062699
740 740 a, g dbSNP:763708665
749 749 c, t dbSNP:758006943
750 750 a, g dbSNP:369457259
753 753 -, gatc dbSNP:775635197
754 754 c, t dbSNP:753004509
756 756 a, g dbSNP:765596627
758 758 a, g dbSNP:759982764
763 763 c, t dbSNP:777324808
767 767 c, t dbSNP:146176609
776 776 c, t dbSNP:760897880
781 781 a, g dbSNP:773369379
782 782 c, t dbSNP:754498322
789 789 -, c dbSNP:765434275
790 790 a, c dbSNP:201485111
796 796 c, t dbSNP:35080023
802 802 a, g dbSNP:143189294
807 807 c, t dbSNP:372020804
809 809 a, g dbSNP:577190408
822 822 a, g dbSNP:759382209
826 826 a, g dbSNP:367800640
829 829 c, t dbSNP:770856288
843 843 c, t dbSNP:149126501
844 844 a, g dbSNP:777170572
849 849 a, g dbSNP:147680141
860 860 a, t dbSNP:747578415
865 865 a, g dbSNP:778692469
873 873 c, g, t dbSNP:374775503
878 878 g, t dbSNP:372865887
880 880 g, t dbSNP:147060589
885 885 c, t dbSNP:141684342
886 886 a, g dbSNP:756712181
888 888 a, c dbSNP:200308529
896 896 a, g dbSNP:767883055
909 909 a, g dbSNP:149830675
910 910 a, t dbSNP:560418283
915 915 a, g dbSNP:764311091
916 916 g, t dbSNP:763091759
921 921 a, g dbSNP:776438458
925 925 a, t dbSNP:551412746
927 927 a, t dbSNP:760440998
936 936 c, g dbSNP:530485818
942 942 a, g, t dbSNP:563251161
956 956 a, c, g dbSNP:748780405
960 960 c, t dbSNP:775352863
969 969 a, g dbSNP:376221426
970 970 c, g dbSNP:746260835
972 972 a, t dbSNP:781343333
974 974 c, t dbSNP:541941563
975 975 a, c dbSNP:149817614
978 978 c, t dbSNP:778229695
979 979 a, g, t dbSNP:138885334
996 996 a, g dbSNP:765499989
1002 1002 g, t dbSNP:755089668
1015 1015 a, g dbSNP:750265224
1016 1016 c, g dbSNP:767168755
1017 1017 a, c dbSNP:529743443
1029 1029 g, t dbSNP:774473329
1032 1032 -, c dbSNP:772812827
1032 1032 c, g dbSNP:180729981
1034 1034 a, g dbSNP:762612733
1036 1036 c, t dbSNP:775086150
1040 1040 c, t dbSNP:769488831
1041 1041 c, g dbSNP:745468335
1047 1047 c, t dbSNP:373900001
1058 1058 a, g dbSNP:201880600
1062 1062 c, t dbSNP:773505923
1069 1069 c, t dbSNP:150403254
1070 1070 a, g dbSNP:375462083
1071 1071 g, t dbSNP:119471024
1086 1086 a, g dbSNP:754216377
1088 1088 c, t dbSNP:151105857
1089 1089 a, g dbSNP:749385689
1091 1091 a, g dbSNP:529798826
1096 1096 c, t dbSNP:549798245
1104 1104 a, g dbSNP:140430822
1107 1107 a, g dbSNP:777668009
1108 1108 c, t dbSNP:758429460
1110 1110 a, c dbSNP:752726222
1116 1116 c, g dbSNP:765185989
1118 1118 a, g dbSNP:766805523
1120 1120 a, g dbSNP:281865098
1122 1122 a, g dbSNP:759034002
1128 1128 c, t dbSNP:753375046
1135 1135 c, t dbSNP:765958976
1140 1140 g, t dbSNP:760252953
1155 1155 a, g dbSNP:773589703
1196 1196 a, g dbSNP:146620511
1204 1204 g, t dbSNP:577410969
1206 1206 c, g dbSNP:756620904
1238 1238 a, g dbSNP:750932384
1241 1241 a, g dbSNP:754902386
1244 1244 c, g dbSNP:749296930
1245 1245 c, t dbSNP:139808091
1248 1248 c, t dbSNP:755689459
1270 1270 a, g, t dbSNP:377042228
1274 1274 g, t dbSNP:767173486
1277 1277 a, g dbSNP:756838292
1278 1278 a, c, t dbSNP:119471022
1280 1280 g, t dbSNP:200254797
1290 1290 c, t dbSNP:369104384
1291 1291 a, g dbSNP:111522254
1292 1292 c, t dbSNP:763201953
1294 1294 c, t dbSNP:61729175
1295 1295 a, g dbSNP:13054747
1300 1300 a, g dbSNP:201383753
1307 1307 c, t dbSNP:201820144
1310 1310 g, t dbSNP:771282968
1313 1313 a, c dbSNP:760910732
1319 1319 c, t dbSNP:773284328
1330 1330 a, g dbSNP:199965734
1339 1339 c, t dbSNP:562804736
1346 1346 c, g dbSNP:770511759
1354 1354 c, t dbSNP:746492833
1355 1355 a, g dbSNP:139165558
1360 1360 c, t dbSNP:2331251
1362 1362 c, g dbSNP:757926741
1364 1364 c, t dbSNP:753114322
1367 1367 c, t dbSNP:778366926
1372 1372 a, c dbSNP:779379945
1373 1373 a, g, t dbSNP:202091945
1374 1374 a, g dbSNP:766791829
1379 1379 c, g dbSNP:760867986
1381 1381 c, t dbSNP:750412869
1386 1386 c, t dbSNP:119471023
1387 1387 a, g dbSNP:146217183
1390 1390 c, t dbSNP:775289919
1395 1395 c, t dbSNP:765070016
1396 1396 c, t dbSNP:759292339
1401 1401 g, t dbSNP:119471025
1404 1404 c, g dbSNP:548442727
1410 1410 c, t dbSNP:756670349
1411 1411 a, t dbSNP:746415096
1416 1416 a, g dbSNP:781705717
1417 1417 c, t dbSNP:201806802
1418 1418 a, g dbSNP:751621468
1423 1423 a, g dbSNP:713998
1424 1424 a, g dbSNP:758547221
1432 1432 c, t dbSNP:751553768
1433 1433 a, g dbSNP:3747132
1441 1441 a, g dbSNP:150166679
1447 1447 a, g dbSNP:144912961
1457 1457 a, g dbSNP:775075683
1458 1458 c, t dbSNP:769470411
1462 1462 a, g dbSNP:759828449
1471 1471 a, g dbSNP:776910756
1473 1473 c, t dbSNP:3747129
1474 1474 a, g dbSNP:747463385
1479 1479 a, t dbSNP:778229498
1483 1483 a, c dbSNP:772178736
1490 1490 c, t dbSNP:748255618
1497 1497 a, g dbSNP:779017015
1501 1501 c, t dbSNP:77597168
1503 1503 a, g dbSNP:773773876
1505 1505 a, g dbSNP:772573640
1508 1508 a, g dbSNP:377665379
1513 1513 c, t dbSNP:748181375
1514 1514 a, g, t dbSNP:199745804
1518 1518 a, g dbSNP:749572804
1522 1522 a, g dbSNP:374044351
1531 1531 -, ct dbSNP:759733648
1532 1532 a, c, t dbSNP:35126034
1539 1539 a, g dbSNP:777862145
1542 1542 a, t dbSNP:34962745
1545 1545 a, t dbSNP:752176820
1546 1546 a, g dbSNP:141567957
1557 1557 a, g dbSNP:754422079
1560 1560 a, g dbSNP:753527423
1561 1561 a, g dbSNP:766017410
1563 1563 c, g dbSNP:761086802
1568 1568 c, t dbSNP:369227380
1569 1569 a, g dbSNP:767940026
1577 1577 a, g dbSNP:762331694
1578 1578 a, g, t dbSNP:768818454
1583 1583 a, g dbSNP:749372122
1586 1586 a, g dbSNP:200529828
1587 1587 a, g dbSNP:201290613
1590 1590 a, g dbSNP:746808353
1593 1593 a, g dbSNP:565394870
1597 1597 a, c dbSNP:747892556
1604 1604 a, g dbSNP:778968440
1608 1608 c, g dbSNP:768523581
1624 1624 a, t dbSNP:374205780
1625 1625 a, t dbSNP:139107954
1627 1627 a, g dbSNP:143294921
1630 1630 c, t dbSNP:369777121
1631 1631 a, c dbSNP:750128189
1642 1642 a, g dbSNP:780700906
1647 1647 a, g dbSNP:371311675
1651 1651 c, g dbSNP:571151621
1652 1652 c, t dbSNP:764663345
1654 1654 a, g dbSNP:763518309
1655 1655 a, g dbSNP:752850564
1659 1659 a, c dbSNP:765459737
1676 1676 a, g dbSNP:759660620
1679 1679 c, t dbSNP:138343171
1680 1680 a, g dbSNP:375477724
1685 1685 a, c, t dbSNP:773950609
1688 1688 c, t dbSNP:145373966
1694 1694 a, g dbSNP:749271201
1702 1702 c, t dbSNP:377695917
1704 1704 g, t dbSNP:769357720
1712 1712 a, c dbSNP:745353489
1713 1713 a, g dbSNP:150057646
1719 1719 c, g dbSNP:756788652
1722 1722 a, c dbSNP:140732502
1729 1729 a, c dbSNP:778237328
1730 1730 c, t dbSNP:375673570
1732 1732 c, g dbSNP:753298603
1736 1736 c, g, t dbSNP:146884025
1737 1737 a, g dbSNP:202197120
1740 1740 g, t dbSNP:753803734
1746 1746 c, t dbSNP:766628788
1747 1747 c, t dbSNP:371109134
1749 1749 c, g dbSNP:143965829
1760 1760 a, g dbSNP:773460422
1763 1763 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1766 1766 c, t dbSNP:763915803
1767 1767 a, g dbSNP:377326385
1775 1775 c, g dbSNP:548311034
1784 1784 c, t dbSNP:769658980
1785 1785 g, t dbSNP:745384564
1787 1787 c, t dbSNP:775959392
1788 1788 c, g dbSNP:770642869
1802 1802 a, g dbSNP:746693127
1805 1805 c, t dbSNP:188300485
1806 1806 g, t dbSNP:758902895
1807 1807 c, g dbSNP:748512719
1827 1827 a, g dbSNP:372970834
1831 1831 a, g, t dbSNP:113242819
1832 1832 a, t dbSNP:753983512
1848 1848 a, g dbSNP:766419128
1849 1849 c, g, t dbSNP:759075680
1851 1851 ag, tc dbSNP:386820399
1851 1851 a, t dbSNP:114685298
1852 1852 c, g dbSNP:116769827
1855 1855 c, t dbSNP:775195314
1859 1859 g, t dbSNP:765186595
1868 1868 -, a dbSNP:772691909
1874 1874 c, g dbSNP:532646940
1875 1875 c, t dbSNP:776612681
1883 1883 a, g dbSNP:369393785
1887 1887 -, gaa dbSNP:761480950
1892 1892 c, t dbSNP:765478898
1893 1893 a, g dbSNP:376253108
1899 1899 c, t dbSNP:771794197
1902 1902 a, g dbSNP:377095634
1906 1906 c, t dbSNP:372828090
1907 1907 c, t dbSNP:769041433
1909 1909 a, g dbSNP:749799140
1915 1915 c, g dbSNP:558884663
1923 1923 c, g, t dbSNP:369053765
1925 1925 a, c, g dbSNP:757426392
1929 1929 a, g dbSNP:752507059
1931 1931 a, g dbSNP:764993355
1933 1933 a, c dbSNP:759348602
1938 1938 g, t dbSNP:753787422
1939 1939 a, c dbSNP:766330282
1941 1941 c, t dbSNP:760276585
1950 1950 a, t dbSNP:200477299
1956 1956 a, t dbSNP:772783723
1968 1968 c, t dbSNP:375526010
1971 1971 a, g dbSNP:142139781
1974 1974 c, g dbSNP:774114985
1983 1983 a, c dbSNP:375655372
1988 1988 a, t dbSNP:373523675
1989 1989 c, g dbSNP:780435239
1993 1993 a, t dbSNP:770266719
2001 2001 a, g dbSNP:148662419
2003 2003 a, t dbSNP:781196776
2009 2009 c, g, t dbSNP:751823743
2012 2012 c, t dbSNP:144077166
2013 2013 a, g dbSNP:143711674
2017 2017 c, t dbSNP:753613070
2022 2022 a, g dbSNP:766233510
2023 2023 a, g dbSNP:201043011
2025 2025 c, g dbSNP:749976459
2028 2028 a, g dbSNP:370007632
2031 2031 a, c dbSNP:761403871
2035 2035 c, t dbSNP:773931864
2036 2036 a, g dbSNP:763743681
2043 2043 a, g dbSNP:763228182
2051 2051 a, g dbSNP:775881151
2052 2052 c, g dbSNP:770221086
2058 2058 a, g dbSNP:746418898
2060 2060 c, t dbSNP:746818979
2061 2061 a, c dbSNP:777094703
2067 2067 a, c dbSNP:777491163
2068 2068 a, g dbSNP:747080557
2073 2073 c, g dbSNP:777875261
2080 2080 a, c dbSNP:758581869
2083 2083 c, t dbSNP:372499859
2086 2086 a, c dbSNP:779849991
2087 2087 a, g dbSNP:755952793
2098 2098 a, g dbSNP:117114544
2104 2104 a, g dbSNP:750452419
2107 2107 c, t dbSNP:767548244
2111 2111 a, g dbSNP:756839100
2116 2116 a, t dbSNP:751013277
2118 2118 c, g dbSNP:2014410
2120 2120 c, t dbSNP:762613783
2121 2121 a, g dbSNP:774979651
2124 2124 a, g dbSNP:765633123
2142 2142 -, agc dbSNP:768468362
2147 2147 a, c dbSNP:748136926
2151 2151 a, c, t dbSNP:186173240
2161 2161 c, g dbSNP:375587915
2169 2169 a, c dbSNP:773303744
2174 2174 a, c dbSNP:772205948
2176 2176 a, c dbSNP:754066787
2178 2178 a, g dbSNP:778998363
2185 2185 a, c dbSNP:756030696
2186 2186 c, g dbSNP:372027593
2187 2187 c, t dbSNP:147435410
2188 2188 a, g dbSNP:142958812
2190 2190 a, c dbSNP:751051493
2193 2193 a, c dbSNP:763704933
2194 2194 c, g dbSNP:757812079
2202 2202 c, t dbSNP:549290787
2205 2205 c, t dbSNP:764860798
2208 2208 c, t dbSNP:759909785
2209 2209 a, g dbSNP:139039617
2233 2233 a, g dbSNP:766903925
2234 2234 a, c dbSNP:761197874
2241 2241 c, t dbSNP:773570398
2245 2245 c, t dbSNP:772234990
2246 2246 a, g dbSNP:756215705
2255 2255 a, c dbSNP:774728501
2256 2256 c, g dbSNP:768931718
2258 2258 c, t dbSNP:745687268
2263 2263 a, g dbSNP:781082499
2269 2269 a, g dbSNP:770823084
2270 2270 a, c, t dbSNP:777570870
2271 2271 a, g dbSNP:757988379
2273 2273 c, t dbSNP:752092814
2278 2278 g, t dbSNP:11545917
2279 2279 a, g dbSNP:778544549
2284 2284 a, g, t dbSNP:754224646
2293 2293 a, g dbSNP:766781092
2294 2294 a, c, t dbSNP:534067573
2295 2295 a, g dbSNP:767852159
2300 2300 a, c dbSNP:761956374
2302 2302 c, g dbSNP:774532334
2305 2305 a, g dbSNP:769017976
2311 2311 a, g dbSNP:763311479
2315 2315 c, t dbSNP:775820827
2318 2318 g, t dbSNP:770822747
2324 2324 a, c dbSNP:367810755
2326 2326 c, g, t dbSNP:150216540
2327 2327 a, t dbSNP:141008676
2329 2329 c, t dbSNP:778346173
2330 2330 a, g dbSNP:754462097
2334 2334 c, t dbSNP:148134252
2337 2337 c, t dbSNP:372833027
2345 2345 c, t dbSNP:756512740
2347 2347 g, t dbSNP:750685060
2348 2348 c, t dbSNP:768100817
2362 2362 c, g dbSNP:143747386
2372 2372 c, t dbSNP:200667267
2375 2375 a, g dbSNP:752086428
2377 2377 c, t dbSNP:764305334
2382 2382 c, t dbSNP:763117738
2387 2387 a, g dbSNP:775916508
2388 2388 a, g dbSNP:765322078
2393 2393 c, t dbSNP:760527580
2395 2395 c, g dbSNP:772846606
2397 2397 a, g dbSNP:772069598
2405 2405 c, t dbSNP:748133574
2406 2406 g, t dbSNP:116241923
2412 2412 a, g dbSNP:202104505
2416 2416 a, g dbSNP:748736760
2424 2424 a, g dbSNP:367888424
2427 2427 c, g dbSNP:751938775
2428 2428 a, g dbSNP:532246881
2431 2431 c, g dbSNP:145674158
2432 2432 c, t dbSNP:199740072
2433 2433 a, g dbSNP:182592572
2441 2441 a, g dbSNP:781455905
2445 2445 a, c, g dbSNP:5752330
2450 2450 a, g dbSNP:540157835
2457 2457 c, t dbSNP:758568345
2470 2470 c, t dbSNP:143902143
2471 2471 a, g dbSNP:527653764
2483 2483 c, t dbSNP:759632995
2485 2485 g, t dbSNP:561308139
2486 2486 c, t dbSNP:767256800
2487 2487 a, c, g dbSNP:774331295
2489 2489 a, c dbSNP:768513194
2491 2491 c, t dbSNP:140234219
2494 2494 c, t dbSNP:774813995
2498 2498 a, g dbSNP:769325136
2501 2501 a, g dbSNP:745543124
2502 2502 c, g dbSNP:780889236
2518 2518 c, t dbSNP:747411315
2520 2520 c, g dbSNP:778239048
2522 2522 c, t dbSNP:772546709
2525 2525 a, g dbSNP:748643364
2530 2530 -, a dbSNP:779927531
2530 2530 a, g dbSNP:779471156
2533 2533 a, g dbSNP:755073092
2538 2538 a, g dbSNP:145481980
2543 2543 c, t dbSNP:780284817
2547 2547 c, t dbSNP:756278524
2550 2550 a, g dbSNP:750621357
2557 2557 c, t dbSNP:763915972
2558 2558 a, g dbSNP:541601069
2560 2560 c, t dbSNP:371342669
2569 2569 a, t dbSNP:765161412
2576 2576 a, g dbSNP:758970516
2578 2578 c, t dbSNP:776169421
2579 2579 c, g dbSNP:770733264
2584 2584 c, t dbSNP:149689335
2587 2587 a, g dbSNP:565596162
2593 2593 a, c dbSNP:772632659
2599 2599 a, g dbSNP:748533902
2602 2602 g, t dbSNP:779303648
2605 2605 c, t dbSNP:368334509
2606 2606 a, g dbSNP:749347544
2607 2607 c, t dbSNP:1894706
2609 2609 -, c dbSNP:769405747
2611 2611 -, a dbSNP:745665820
2612 2612 c, t dbSNP:756155749
2616 2616 c, t dbSNP:746151193
2617 2617 a, g dbSNP:781375770
2627 2627 c, g dbSNP:758138934
2628 2628 c, t dbSNP:752467533
2632 2632 g, t dbSNP:765121677
2641 2641 a, c dbSNP:749888433
2647 2647 c, t dbSNP:374238081
2648 2648 a, g dbSNP:373421312
2652 2652 a, g dbSNP:773844011
2657 2657 -, c dbSNP:281865099
2662 2662 a, c, t dbSNP:560591308
2663 2663 a, g dbSNP:775986716
2666 2666 g, t dbSNP:1894704
2670 2670 c, t dbSNP:759641785
2671 2671 a, g dbSNP:776644648
2673 2673 c, t dbSNP:770895794
2674 2674 a, g dbSNP:78892693
2676 2676 c, t dbSNP:553852142
2679 2679 c, t dbSNP:139675793
2680 2680 g, t dbSNP:749034221
2681 2681 c, g, t dbSNP:201385335
2682 2682 c, t dbSNP:119471021
2686 2686 a, c dbSNP:750362522
2687 2687 c, t dbSNP:370795890
2688 2688 a, c, g dbSNP:202222123
2690 2690 c, t dbSNP:35993959
2693 2693 c, t dbSNP:553114134
2696 2696 g, t dbSNP:763308032
2700 2700 c, t dbSNP:753017691
2701 2701 a, g dbSNP:745559996
2705 2705 c, t dbSNP:765753447
2709 2709 c, t dbSNP:760087525
2713 2713 c, t dbSNP:776976418
2714 2714 c, g dbSNP:377050180
2722 2722 c, g dbSNP:373905924
2724 2724 a, g, t dbSNP:538187229
2725 2725 c, t dbSNP:749128912
2726 2726 a, g, t dbSNP:769678704
2732 2732 c, t dbSNP:745866776
2736 2736 a, g dbSNP:780978556
2738 2738 a, g dbSNP:146303784
2741 2741 g, t dbSNP:750963690
2745 2745 a, g dbSNP:777509970
2750 2750 c, t dbSNP:202120615
2751 2751 a, g dbSNP:201206642
2753 2753 c, t dbSNP:9625029
2757 2757 a, t dbSNP:148294572
2758 2758 -, ac dbSNP:752827715
2758 2758 c, t dbSNP:767769111
2759 2759 a, g dbSNP:761967529
2768 2768 c, t dbSNP:144248515
2769 2769 a, g dbSNP:530118832
2771 2771 c, t dbSNP:764344335
2778 2778 a, c dbSNP:759405900
2779 2779 a, g dbSNP:776239550
2791 2791 a, g dbSNP:368602340
2795 2795 a, g dbSNP:746961193
2801 2801 a, c dbSNP:773131180
2803 2803 a, g dbSNP:374200129
2806 2806 a, g dbSNP:747600132
2807 2807 a, g dbSNP:778546132
2812 2812 c, t dbSNP:754550717
2815 2815 c, g dbSNP:749689033
2816 2816 c, g, t dbSNP:756494145
2819 2819 a, g dbSNP:750947119
2823 2823 c, t dbSNP:768075866
2824 2824 a, g dbSNP:757412572
2827 2827 a, g dbSNP:761057923
2828 2828 c, g, t dbSNP:370493873
2831 2831 c, t dbSNP:752931351
2832 2832 a, g dbSNP:149568178
2837 2837 c, t dbSNP:760506995
2841 2841 a, c dbSNP:768058057
2844 2844 c, g dbSNP:771929646
2847 2847 c, g dbSNP:761348469
2852 2852 g, t dbSNP:773804490
2856 2856 a, g dbSNP:768192969
2870 2870 c, t dbSNP:138189133
2871 2871 a, g dbSNP:779739799
2880 2880 a, g dbSNP:770063857
2882 2882 a, g dbSNP:145698999
2884 2884 -, aagca dbSNP:281865100
2900 2900 c, t dbSNP:781772371
2901 2901 a, g dbSNP:367897224
2909 2909 c, t dbSNP:567467720
2920 2920 a, c dbSNP:558103922
2923 2923 c, t dbSNP:373741660
2929 2929 c, g dbSNP:751436667
2933 2933 a, g dbSNP:773877528
2939 2939 a, g dbSNP:752920923
2942 2942 a, g dbSNP:765442752
2957 2957 a, g dbSNP:199986587
2963 2963 a, t dbSNP:750182459
2964 2964 a, g dbSNP:767468102
2965 2965 a, c dbSNP:761791971
2969 2969 a, g dbSNP:774243369
2991 2991 c, t dbSNP:780124968
3085 3085 a, g dbSNP:561924147
3086 3086 c, g dbSNP:368326097
3093 3093 a, g dbSNP:557703645
3115 3115 g, t dbSNP:550753111
3117 3117 c, t dbSNP:536115151
3146 3146 a, c dbSNP:182700538
3176 3176 a, g dbSNP:763552637
3177 3177 a, g dbSNP:531146121
3212 3212 a, t dbSNP:762469062
3221 3221 a, g dbSNP:568066326
3340 3340 -, c dbSNP:36046278
3341 3341 a, g dbSNP:552928725
3355 3355 -, g dbSNP:773328400
3365 3365 a, g dbSNP:758700168
3381 3381 c, g dbSNP:775062349
3395 3395 c, t dbSNP:76496430
3398 3398 c, t dbSNP:570509591
3411 3411 c, t dbSNP:552113955
3437 3437 c, t dbSNP:745672037
3438 3438 a, g dbSNP:776345185
3446 3446 c, g dbSNP:536866354
3480 3480 a, g dbSNP:565394140
3518 3518 a, g dbSNP:746883110
3536 3536 a, g dbSNP:548085200
3636 3636 c, g dbSNP:777878254
3644 3644 c, t dbSNP:755051224
3645 3645 a, g dbSNP:749384453
3651 3651 c, t dbSNP:529938159
3666 3666 g, t dbSNP:561983395
3668 3668 c, t dbSNP:546959109
3669 3669 a, g dbSNP:190837977
3678 3678 c, g dbSNP:756466974
3687 3687 a, g dbSNP:187297219
3692 3692 a, c dbSNP:762464617
3712 3712 g, t dbSNP:200099628
3718 3718 a, g dbSNP:546286332
3739 3739 a, g dbSNP:746258061
3759 3759 c, t dbSNP:575920373
3780 3780 c, g dbSNP:767814877
3790 3790 c, g dbSNP:143369347
3799 3799 g, t dbSNP:62225811
3801 3801 a, g dbSNP:752453853
3802 3802 c, t dbSNP:200772835
3813 3813 a, t dbSNP:181998459
3822 3822 a, c dbSNP:747584684
3832 3832 -, a dbSNP:779719192
3842 3842 a, t dbSNP:778332651
3854 3854 a, g dbSNP:758423479
3862 3862 c, t dbSNP:770969523
3887 3887 c, t dbSNP:752755928
3891 3891 a, c dbSNP:779035400
3894 3894 g, t dbSNP:755148260
3898 3898 -, ctgaa dbSNP:750142480
3937 3937 a, g dbSNP:752723057
4015 4015 a, t dbSNP:575200307
4107 4107 a, t dbSNP:2157585
4108 4108 -, gt dbSNP:134978
4125 4125 c, t dbSNP:534698074
4127 4127 c, t dbSNP:749313648
4133 4133 -, tgtgtgtgtgtgtgcgcgcgcgcg dbSNP:759852277
4139 4139 -, tgtgtgtgcgcg dbSNP:780541209
4142 4142 -, gtgtgcgcgcgcgc dbSNP:555707534
4143 4143 -, tgtgcgcgcgcgcgcg dbSNP:780251218
4144 4144 -, gtgcgcgcgcgc dbSNP:750870441
4144 4144 -, gtgcgc dbSNP:56832260
4145 4145 -, tgcgcgcgcgcgcg dbSNP:760776804
4145 4145 -, tgcgcgcgcgcg dbSNP:375136975
4145 4145 -, tgcgcgcgcg dbSNP:755364858
4145 4145 c, t dbSNP:7293228
4146 4146 -, gcgcgcgcgc dbSNP:61249065
4147 4147 c, t dbSNP:6147576
4149 4149 c, t dbSNP:56271395
4150 4150 -, gcgcgcgcg dbSNP:751966332
4151 4151 c, t dbSNP:770072939
4153 4153 -, cgcgcgcgcgcg dbSNP:773550229
4153 4153 -, cgcgcgcgcg dbSNP:758987964
4153 4153 -, cgcgcgcg dbSNP:770635497
4155 4155 -, cgcgcgcgcg dbSNP:67796216
4156 4156 -, tgtgcgcgcgcgcg dbSNP:753115022
4159 4159 -, cgcgcg dbSNP:10573454
4168 4168 c, t dbSNP:7291576
4171 4171 a, g dbSNP:534586940
4183 4183 c, g dbSNP:139977960
4194 4194 c, t dbSNP:190614395
4204 4204 c, t dbSNP:767355031
4305 4305 a, t dbSNP:3752590
4382 4382 c, t dbSNP:41277335
4407 4407 c, t dbSNP:775047856
4427 4427 a, g dbSNP:573277089
4446 4446 g, t dbSNP:7292764
4467 4467 a, g dbSNP:565943356
4486 4486 a, g dbSNP:142285409
4495 4495 a, g dbSNP:148725091
4507 4507 a, c dbSNP:117397456
4531 4531 a, c dbSNP:3752589
4593 4593 c, t dbSNP:776454348
4599 4599 a, g dbSNP:41277333
4605 4605 a, g dbSNP:3752588
4608 4608 c, t dbSNP:563911164
4658 4658 a, g dbSNP:542425849

Target ORF information:

RefSeq Version XM_011530485
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu74053
Accession Version XM_011530486.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1936..>2289(+)
Position Chain Variation Link
28 28 c, g dbSNP:56821996
31 31 g, t dbSNP:547422864
63 63 a, g dbSNP:532089191
71 71 g, t dbSNP:187762406
75 75 c, t dbSNP:184042272
121 121 a, g dbSNP:551554467
125 125 a, g dbSNP:543525170
145 145 a, g dbSNP:532940807
163 163 a, g dbSNP:567406073
170 170 a, c dbSNP:147631281
212 212 c, t dbSNP:550575971
227 227 c, g dbSNP:763625074
229 229 a, t dbSNP:757938034
260 260 a, g dbSNP:529182573
269 269 c, t dbSNP:5761557
312 312 c, t dbSNP:3747134
324 324 c, g dbSNP:572621201
336 336 -, t dbSNP:200535558
380 380 a, g dbSNP:188205202
410 410 a, t dbSNP:545593544
472 472 c, t dbSNP:759331653
494 494 c, t dbSNP:578089748
518 518 c, g, t dbSNP:556695127
519 519 a, c, g dbSNP:187291798
520 520 -, gataccgg dbSNP:766405923
523 523 a, g dbSNP:369803062
554 554 c, g dbSNP:774733114
557 557 a, c dbSNP:768963068
559 559 c, t dbSNP:763357219
573 573 c, t dbSNP:775899708
577 577 a, g dbSNP:570371168
579 579 c, t dbSNP:144622501
584 584 c, g dbSNP:781358501
587 587 a, t dbSNP:142329133
591 591 a, t dbSNP:747194252
592 592 a, g dbSNP:141268657
602 602 c, t dbSNP:778872709
603 603 a, g dbSNP:766139027
605 605 c, g dbSNP:376524160
610 610 a, g dbSNP:745759291
611 611 -, a dbSNP:763190774
615 615 c, t dbSNP:781088233
621 621 -, t dbSNP:281865097
631 631 a, g dbSNP:756803307
642 642 a, g dbSNP:751062699
645 645 a, g dbSNP:763708665
654 654 c, t dbSNP:758006943
655 655 a, g dbSNP:369457259
658 658 -, gatc dbSNP:775635197
659 659 c, t dbSNP:753004509
661 661 a, g dbSNP:765596627
663 663 a, g dbSNP:759982764
668 668 c, t dbSNP:777324808
672 672 c, t dbSNP:146176609
681 681 c, t dbSNP:760897880
686 686 a, g dbSNP:773369379
687 687 c, t dbSNP:754498322
694 694 -, c dbSNP:765434275
695 695 a, c dbSNP:201485111
701 701 c, t dbSNP:35080023
707 707 a, g dbSNP:143189294
712 712 c, t dbSNP:372020804
714 714 a, g dbSNP:577190408
727 727 a, g dbSNP:759382209
731 731 a, g dbSNP:367800640
734 734 c, t dbSNP:770856288
748 748 c, t dbSNP:149126501
749 749 a, g dbSNP:777170572
754 754 a, g dbSNP:147680141
765 765 a, t dbSNP:747578415
770 770 a, g dbSNP:778692469
778 778 c, g, t dbSNP:374775503
783 783 g, t dbSNP:372865887
785 785 g, t dbSNP:147060589
790 790 c, t dbSNP:141684342
791 791 a, g dbSNP:756712181
793 793 a, c dbSNP:200308529
801 801 a, g dbSNP:767883055
814 814 a, g dbSNP:149830675
815 815 a, t dbSNP:560418283
820 820 a, g dbSNP:764311091
821 821 g, t dbSNP:763091759
826 826 a, g dbSNP:776438458
830 830 a, t dbSNP:551412746
832 832 a, t dbSNP:760440998
841 841 c, g dbSNP:530485818
847 847 a, g, t dbSNP:563251161
861 861 a, c, g dbSNP:748780405
865 865 c, t dbSNP:775352863
874 874 a, g dbSNP:376221426
875 875 c, g dbSNP:746260835
877 877 a, t dbSNP:781343333
879 879 c, t dbSNP:541941563
880 880 a, c dbSNP:149817614
883 883 c, t dbSNP:778229695
884 884 a, g, t dbSNP:138885334
901 901 a, g dbSNP:765499989
907 907 g, t dbSNP:755089668
920 920 a, g dbSNP:750265224
921 921 c, g dbSNP:767168755
922 922 a, c dbSNP:529743443
934 934 g, t dbSNP:774473329
937 937 -, c dbSNP:772812827
937 937 c, g dbSNP:180729981
939 939 a, g dbSNP:762612733
941 941 c, t dbSNP:775086150
945 945 c, t dbSNP:769488831
946 946 c, g dbSNP:745468335
952 952 c, t dbSNP:373900001
963 963 a, g dbSNP:201880600
967 967 c, t dbSNP:773505923
974 974 c, t dbSNP:150403254
975 975 a, g dbSNP:375462083
976 976 g, t dbSNP:119471024
991 991 a, g dbSNP:754216377
993 993 c, t dbSNP:151105857
994 994 a, g dbSNP:749385689
996 996 a, g dbSNP:529798826
1001 1001 c, t dbSNP:549798245
1009 1009 a, g dbSNP:140430822
1012 1012 a, g dbSNP:777668009
1013 1013 c, t dbSNP:758429460
1015 1015 a, c dbSNP:752726222
1021 1021 c, g dbSNP:765185989
1023 1023 a, g dbSNP:766805523
1025 1025 a, g dbSNP:281865098
1027 1027 a, g dbSNP:759034002
1033 1033 c, t dbSNP:753375046
1040 1040 c, t dbSNP:765958976
1045 1045 g, t dbSNP:760252953
1060 1060 a, g dbSNP:773589703
1101 1101 a, g dbSNP:146620511
1109 1109 g, t dbSNP:577410969
1111 1111 c, g dbSNP:756620904
1143 1143 a, g dbSNP:750932384
1146 1146 a, g dbSNP:754902386
1149 1149 c, g dbSNP:749296930
1150 1150 c, t dbSNP:139808091
1153 1153 c, t dbSNP:755689459
1175 1175 a, g, t dbSNP:377042228
1179 1179 g, t dbSNP:767173486
1182 1182 a, g dbSNP:756838292
1183 1183 a, c, t dbSNP:119471022
1185 1185 g, t dbSNP:200254797
1195 1195 c, t dbSNP:369104384
1196 1196 a, g dbSNP:111522254
1197 1197 c, t dbSNP:763201953
1199 1199 c, t dbSNP:61729175
1200 1200 a, g dbSNP:13054747
1205 1205 a, g dbSNP:201383753
1212 1212 c, t dbSNP:201820144
1215 1215 g, t dbSNP:771282968
1218 1218 a, c dbSNP:760910732
1224 1224 c, t dbSNP:773284328
1235 1235 a, g dbSNP:199965734
1244 1244 c, t dbSNP:562804736
1251 1251 c, g dbSNP:770511759
1259 1259 c, t dbSNP:746492833
1260 1260 a, g dbSNP:139165558
1265 1265 c, t dbSNP:2331251
1267 1267 c, g dbSNP:757926741
1269 1269 c, t dbSNP:753114322
1272 1272 c, t dbSNP:778366926
1277 1277 a, c dbSNP:779379945
1278 1278 a, g, t dbSNP:202091945
1279 1279 a, g dbSNP:766791829
1284 1284 c, g dbSNP:760867986
1286 1286 c, t dbSNP:750412869
1291 1291 c, t dbSNP:119471023
1292 1292 a, g dbSNP:146217183
1295 1295 c, t dbSNP:775289919
1300 1300 c, t dbSNP:765070016
1301 1301 c, t dbSNP:759292339
1306 1306 g, t dbSNP:119471025
1309 1309 c, g dbSNP:548442727
1315 1315 c, t dbSNP:756670349
1316 1316 a, t dbSNP:746415096
1321 1321 a, g dbSNP:781705717
1322 1322 c, t dbSNP:201806802
1323 1323 a, g dbSNP:751621468
1328 1328 a, g dbSNP:713998
1329 1329 a, g dbSNP:758547221
1337 1337 c, t dbSNP:751553768
1338 1338 a, g dbSNP:3747132
1346 1346 a, g dbSNP:150166679
1352 1352 a, g dbSNP:144912961
1362 1362 a, g dbSNP:775075683
1363 1363 c, t dbSNP:769470411
1367 1367 a, g dbSNP:759828449
1376 1376 a, g dbSNP:776910756
1378 1378 c, t dbSNP:3747129
1379 1379 a, g dbSNP:747463385
1384 1384 a, t dbSNP:778229498
1388 1388 a, c dbSNP:772178736
1395 1395 c, t dbSNP:748255618
1402 1402 a, g dbSNP:779017015
1406 1406 c, t dbSNP:77597168
1408 1408 a, g dbSNP:773773876
1410 1410 a, g dbSNP:772573640
1413 1413 a, g dbSNP:377665379
1418 1418 c, t dbSNP:748181375
1419 1419 a, g, t dbSNP:199745804
1423 1423 a, g dbSNP:749572804
1427 1427 a, g dbSNP:374044351
1436 1436 -, ct dbSNP:759733648
1437 1437 a, c, t dbSNP:35126034
1444 1444 a, g dbSNP:777862145
1447 1447 a, t dbSNP:34962745
1450 1450 a, t dbSNP:752176820
1451 1451 a, g dbSNP:141567957
1462 1462 a, g dbSNP:754422079
1465 1465 a, g dbSNP:753527423
1466 1466 a, g dbSNP:766017410
1468 1468 c, g dbSNP:761086802
1473 1473 c, t dbSNP:369227380
1474 1474 a, g dbSNP:767940026
1482 1482 a, g dbSNP:762331694
1483 1483 a, g, t dbSNP:768818454
1488 1488 a, g dbSNP:749372122
1491 1491 a, g dbSNP:200529828
1492 1492 a, g dbSNP:201290613
1495 1495 a, g dbSNP:746808353
1498 1498 a, g dbSNP:565394870
1502 1502 a, c dbSNP:747892556
1509 1509 a, g dbSNP:778968440
1513 1513 c, g dbSNP:768523581
1529 1529 a, t dbSNP:374205780
1530 1530 a, t dbSNP:139107954
1532 1532 a, g dbSNP:143294921
1535 1535 c, t dbSNP:369777121
1536 1536 a, c dbSNP:750128189
1547 1547 a, g dbSNP:780700906
1552 1552 a, g dbSNP:371311675
1556 1556 c, g dbSNP:571151621
1557 1557 c, t dbSNP:764663345
1559 1559 a, g dbSNP:763518309
1560 1560 a, g dbSNP:752850564
1564 1564 a, c dbSNP:765459737
1581 1581 a, g dbSNP:759660620
1584 1584 c, t dbSNP:138343171
1585 1585 a, g dbSNP:375477724
1590 1590 a, c, t dbSNP:773950609
1593 1593 c, t dbSNP:145373966
1599 1599 a, g dbSNP:749271201
1607 1607 c, t dbSNP:377695917
1609 1609 g, t dbSNP:769357720
1617 1617 a, c dbSNP:745353489
1618 1618 a, g dbSNP:150057646
1624 1624 c, g dbSNP:756788652
1627 1627 a, c dbSNP:140732502
1634 1634 a, c dbSNP:778237328
1635 1635 c, t dbSNP:375673570
1637 1637 c, g dbSNP:753298603
1641 1641 c, g, t dbSNP:146884025
1642 1642 a, g dbSNP:202197120
1645 1645 g, t dbSNP:753803734
1651 1651 c, t dbSNP:766628788
1652 1652 c, t dbSNP:371109134
1654 1654 c, g dbSNP:143965829
1665 1665 a, g dbSNP:773460422
1668 1668 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1671 1671 c, t dbSNP:763915803
1672 1672 a, g dbSNP:377326385
1680 1680 c, g dbSNP:548311034
1689 1689 c, t dbSNP:769658980
1690 1690 g, t dbSNP:745384564
1692 1692 c, t dbSNP:775959392
1693 1693 c, g dbSNP:770642869
1707 1707 a, g dbSNP:746693127
1710 1710 c, t dbSNP:188300485
1711 1711 g, t dbSNP:758902895
1712 1712 c, g dbSNP:748512719
1732 1732 a, g dbSNP:372970834
1736 1736 a, g, t dbSNP:113242819
1737 1737 a, t dbSNP:753983512
1753 1753 a, g dbSNP:766419128
1754 1754 c, g, t dbSNP:759075680
1756 1756 ag, tc dbSNP:386820399
1756 1756 a, t dbSNP:114685298
1757 1757 c, g dbSNP:116769827
1760 1760 c, t dbSNP:775195314
1764 1764 g, t dbSNP:765186595
1773 1773 -, a dbSNP:772691909
1779 1779 c, g dbSNP:532646940
1780 1780 c, t dbSNP:776612681
1788 1788 a, g dbSNP:369393785
1792 1792 -, gaa dbSNP:761480950
1797 1797 c, t dbSNP:765478898
1798 1798 a, g dbSNP:376253108
1804 1804 c, t dbSNP:771794197
1807 1807 a, g dbSNP:377095634
1811 1811 c, t dbSNP:372828090
1812 1812 c, t dbSNP:769041433
1814 1814 a, g dbSNP:749799140
1820 1820 c, g dbSNP:558884663
1828 1828 c, g, t dbSNP:369053765
1830 1830 a, c, g dbSNP:757426392
1834 1834 a, g dbSNP:752507059
1836 1836 a, g dbSNP:764993355
1838 1838 a, c dbSNP:759348602
1843 1843 g, t dbSNP:753787422
1844 1844 a, c dbSNP:766330282
1846 1846 c, t dbSNP:760276585
1855 1855 a, t dbSNP:200477299
1861 1861 a, t dbSNP:772783723
1873 1873 c, t dbSNP:375526010
1876 1876 a, g dbSNP:142139781
1879 1879 c, g dbSNP:774114985
1888 1888 a, c dbSNP:375655372
1893 1893 a, t dbSNP:373523675
1894 1894 c, g dbSNP:780435239
1898 1898 a, t dbSNP:770266719
1906 1906 a, g dbSNP:148662419
1908 1908 a, t dbSNP:781196776
1914 1914 c, g, t dbSNP:751823743
1917 1917 c, t dbSNP:144077166
1918 1918 a, g dbSNP:143711674
1922 1922 c, t dbSNP:753613070
1927 1927 a, g dbSNP:766233510
1928 1928 a, g dbSNP:201043011
1930 1930 c, g dbSNP:749976459
1933 1933 a, g dbSNP:370007632
1936 1936 a, c dbSNP:761403871
1940 1940 c, t dbSNP:773931864
1941 1941 a, g dbSNP:763743681
1948 1948 a, g dbSNP:763228182
1956 1956 a, g dbSNP:775881151
1957 1957 c, g dbSNP:770221086
1963 1963 a, g dbSNP:746418898
1965 1965 c, t dbSNP:746818979
1966 1966 a, c dbSNP:777094703
1972 1972 a, c dbSNP:777491163
1973 1973 a, g dbSNP:747080557
1978 1978 c, g dbSNP:777875261
1985 1985 a, c dbSNP:758581869
1988 1988 c, t dbSNP:372499859
1991 1991 a, c dbSNP:779849991
1992 1992 a, g dbSNP:755952793
2003 2003 a, g dbSNP:117114544
2009 2009 a, g dbSNP:750452419
2012 2012 c, t dbSNP:767548244
2016 2016 a, g dbSNP:756839100
2021 2021 a, t dbSNP:751013277
2023 2023 c, g dbSNP:2014410
2025 2025 c, t dbSNP:762613783
2026 2026 a, g dbSNP:774979651
2029 2029 a, g dbSNP:765633123
2047 2047 -, agc dbSNP:768468362
2052 2052 a, c dbSNP:748136926
2056 2056 a, c, t dbSNP:186173240
2066 2066 c, g dbSNP:375587915
2074 2074 a, c dbSNP:773303744
2079 2079 a, c dbSNP:772205948
2081 2081 a, c dbSNP:754066787
2083 2083 a, g dbSNP:778998363
2090 2090 a, c dbSNP:756030696
2091 2091 c, g dbSNP:372027593
2092 2092 c, t dbSNP:147435410
2093 2093 a, g dbSNP:142958812
2095 2095 a, c dbSNP:751051493
2098 2098 a, c dbSNP:763704933
2099 2099 c, g dbSNP:757812079
2107 2107 c, t dbSNP:549290787
2110 2110 c, t dbSNP:764860798
2113 2113 c, t dbSNP:759909785
2114 2114 a, g dbSNP:139039617
2138 2138 a, g dbSNP:766903925
2139 2139 a, c dbSNP:761197874
2146 2146 c, t dbSNP:773570398
2150 2150 c, t dbSNP:772234990
2151 2151 a, g dbSNP:756215705
2160 2160 a, c dbSNP:774728501
2161 2161 c, g dbSNP:768931718
2163 2163 c, t dbSNP:745687268
2168 2168 a, g dbSNP:781082499
2174 2174 a, g dbSNP:770823084
2175 2175 a, c, t dbSNP:777570870
2176 2176 a, g dbSNP:757988379
2178 2178 c, t dbSNP:752092814
2183 2183 g, t dbSNP:11545917
2184 2184 a, g dbSNP:778544549
2189 2189 a, g, t dbSNP:754224646
2198 2198 a, g dbSNP:766781092
2199 2199 a, c, t dbSNP:534067573
2200 2200 a, g dbSNP:767852159
2205 2205 a, c dbSNP:761956374
2207 2207 c, g dbSNP:774532334
2210 2210 a, g dbSNP:769017976
2216 2216 a, g dbSNP:763311479
2220 2220 c, t dbSNP:775820827
2223 2223 g, t dbSNP:770822747
2229 2229 a, c dbSNP:367810755
2231 2231 c, g, t dbSNP:150216540
2232 2232 a, t dbSNP:141008676
2234 2234 c, t dbSNP:778346173
2235 2235 a, g dbSNP:754462097
2239 2239 c, t dbSNP:148134252
2242 2242 c, t dbSNP:372833027
2250 2250 c, t dbSNP:756512740
2252 2252 g, t dbSNP:750685060
2253 2253 c, t dbSNP:768100817
2267 2267 c, g dbSNP:143747386
2277 2277 c, t dbSNP:200667267
2280 2280 a, g dbSNP:752086428
2282 2282 c, t dbSNP:764305334
2287 2287 c, t dbSNP:763117738
2292 2292 a, g dbSNP:775916508
2293 2293 a, g dbSNP:765322078
2298 2298 c, t dbSNP:760527580
2300 2300 c, g dbSNP:772846606
2302 2302 a, g dbSNP:772069598
2310 2310 c, t dbSNP:748133574
2311 2311 g, t dbSNP:116241923
2317 2317 a, g dbSNP:202104505
2321 2321 a, g dbSNP:748736760
2329 2329 a, g dbSNP:367888424
2332 2332 c, g dbSNP:751938775
2333 2333 a, g dbSNP:532246881
2336 2336 c, g dbSNP:145674158
2337 2337 c, t dbSNP:199740072
2338 2338 a, g dbSNP:182592572
2346 2346 a, g dbSNP:781455905
2350 2350 a, c, g dbSNP:5752330
2355 2355 a, g dbSNP:540157835
2362 2362 c, t dbSNP:758568345
2375 2375 c, t dbSNP:143902143
2376 2376 a, g dbSNP:527653764
2388 2388 c, t dbSNP:759632995
2390 2390 g, t dbSNP:561308139
2391 2391 c, t dbSNP:767256800
2392 2392 a, c, g dbSNP:774331295
2394 2394 a, c dbSNP:768513194
2396 2396 c, t dbSNP:140234219
2399 2399 c, t dbSNP:774813995
2403 2403 a, g dbSNP:769325136
2406 2406 a, g dbSNP:745543124
2407 2407 c, g dbSNP:780889236
2423 2423 c, t dbSNP:747411315
2425 2425 c, g dbSNP:778239048
2427 2427 c, t dbSNP:772546709
2430 2430 a, g dbSNP:748643364
2435 2435 -, a dbSNP:779927531
2435 2435 a, g dbSNP:779471156
2438 2438 a, g dbSNP:755073092
2443 2443 a, g dbSNP:145481980
2448 2448 c, t dbSNP:780284817
2452 2452 c, t dbSNP:756278524
2455 2455 a, g dbSNP:750621357
2462 2462 c, t dbSNP:763915972
2463 2463 a, g dbSNP:541601069
2465 2465 c, t dbSNP:371342669
2474 2474 a, t dbSNP:765161412
2481 2481 a, g dbSNP:758970516
2483 2483 c, t dbSNP:776169421
2484 2484 c, g dbSNP:770733264
2489 2489 c, t dbSNP:149689335
2492 2492 a, g dbSNP:565596162
2498 2498 a, c dbSNP:772632659
2504 2504 a, g dbSNP:748533902
2507 2507 g, t dbSNP:779303648
2510 2510 c, t dbSNP:368334509
2511 2511 a, g dbSNP:749347544
2512 2512 c, t dbSNP:1894706
2514 2514 -, c dbSNP:769405747
2516 2516 -, a dbSNP:745665820
2517 2517 c, t dbSNP:756155749
2521 2521 c, t dbSNP:746151193
2522 2522 a, g dbSNP:781375770
2532 2532 c, g dbSNP:758138934
2533 2533 c, t dbSNP:752467533
2537 2537 g, t dbSNP:765121677
2546 2546 a, c dbSNP:749888433
2552 2552 c, t dbSNP:374238081
2553 2553 a, g dbSNP:373421312
2557 2557 a, g dbSNP:773844011
2562 2562 -, c dbSNP:281865099
2567 2567 a, c, t dbSNP:560591308
2568 2568 a, g dbSNP:775986716
2571 2571 g, t dbSNP:1894704
2575 2575 c, t dbSNP:759641785
2576 2576 a, g dbSNP:776644648
2578 2578 c, t dbSNP:770895794
2579 2579 a, g dbSNP:78892693
2581 2581 c, t dbSNP:553852142
2584 2584 c, t dbSNP:139675793
2585 2585 g, t dbSNP:749034221
2586 2586 c, g, t dbSNP:201385335
2587 2587 c, t dbSNP:119471021
2591 2591 a, c dbSNP:750362522
2592 2592 c, t dbSNP:370795890
2593 2593 a, c, g dbSNP:202222123
2595 2595 c, t dbSNP:35993959
2598 2598 c, t dbSNP:553114134
2601 2601 g, t dbSNP:763308032
2605 2605 c, t dbSNP:753017691
2606 2606 a, g dbSNP:745559996
2610 2610 c, t dbSNP:765753447
2614 2614 c, t dbSNP:760087525
2618 2618 c, t dbSNP:776976418
2619 2619 c, g dbSNP:377050180
2627 2627 c, g dbSNP:373905924
2629 2629 a, g, t dbSNP:538187229
2630 2630 c, t dbSNP:749128912
2631 2631 a, g, t dbSNP:769678704
2637 2637 c, t dbSNP:745866776
2641 2641 a, g dbSNP:780978556
2643 2643 a, g dbSNP:146303784
2646 2646 g, t dbSNP:750963690
2650 2650 a, g dbSNP:777509970
2655 2655 c, t dbSNP:202120615
2656 2656 a, g dbSNP:201206642
2658 2658 c, t dbSNP:9625029
2662 2662 a, t dbSNP:148294572
2663 2663 -, ac dbSNP:752827715
2663 2663 c, t dbSNP:767769111
2664 2664 a, g dbSNP:761967529
2673 2673 c, t dbSNP:144248515
2674 2674 a, g dbSNP:530118832
2676 2676 c, t dbSNP:764344335
2683 2683 a, c dbSNP:759405900
2684 2684 a, g dbSNP:776239550
2696 2696 a, g dbSNP:368602340
2700 2700 a, g dbSNP:746961193
2706 2706 a, c dbSNP:773131180
2708 2708 a, g dbSNP:374200129
2711 2711 a, g dbSNP:747600132
2712 2712 a, g dbSNP:778546132
2717 2717 c, t dbSNP:754550717
2720 2720 c, g dbSNP:749689033
2721 2721 c, g, t dbSNP:756494145
2724 2724 a, g dbSNP:750947119
2728 2728 c, t dbSNP:768075866
2729 2729 a, g dbSNP:757412572
2732 2732 a, g dbSNP:761057923
2733 2733 c, g, t dbSNP:370493873
2736 2736 c, t dbSNP:752931351
2737 2737 a, g dbSNP:149568178
2742 2742 c, t dbSNP:760506995
2746 2746 a, c dbSNP:768058057
2749 2749 c, g dbSNP:771929646
2752 2752 c, g dbSNP:761348469
2757 2757 g, t dbSNP:773804490
2761 2761 a, g dbSNP:768192969
2775 2775 c, t dbSNP:138189133
2776 2776 a, g dbSNP:779739799
2785 2785 a, g dbSNP:770063857
2787 2787 a, g dbSNP:145698999
2789 2789 -, aagca dbSNP:281865100
2805 2805 c, t dbSNP:781772371
2806 2806 a, g dbSNP:367897224
2814 2814 c, t dbSNP:567467720
2825 2825 a, c dbSNP:558103922
2828 2828 c, t dbSNP:373741660
2834 2834 c, g dbSNP:751436667
2838 2838 a, g dbSNP:773877528
2844 2844 a, g dbSNP:752920923
2847 2847 a, g dbSNP:765442752
2862 2862 a, g dbSNP:199986587
2868 2868 a, t dbSNP:750182459
2869 2869 a, g dbSNP:767468102
2870 2870 a, c dbSNP:761791971
2874 2874 a, g dbSNP:774243369
2896 2896 c, t dbSNP:780124968
2990 2990 a, g dbSNP:561924147
2991 2991 c, g dbSNP:368326097
2998 2998 a, g dbSNP:557703645
3020 3020 g, t dbSNP:550753111
3022 3022 c, t dbSNP:536115151
3051 3051 a, c dbSNP:182700538
3081 3081 a, g dbSNP:763552637
3082 3082 a, g dbSNP:531146121
3117 3117 a, t dbSNP:762469062
3126 3126 a, g dbSNP:568066326
3245 3245 -, c dbSNP:36046278
3246 3246 a, g dbSNP:552928725
3260 3260 -, g dbSNP:773328400
3270 3270 a, g dbSNP:758700168
3286 3286 c, g dbSNP:775062349
3300 3300 c, t dbSNP:76496430
3303 3303 c, t dbSNP:570509591
3316 3316 c, t dbSNP:552113955
3342 3342 c, t dbSNP:745672037
3343 3343 a, g dbSNP:776345185
3351 3351 c, g dbSNP:536866354
3385 3385 a, g dbSNP:565394140
3423 3423 a, g dbSNP:746883110
3441 3441 a, g dbSNP:548085200
3541 3541 c, g dbSNP:777878254
3549 3549 c, t dbSNP:755051224
3550 3550 a, g dbSNP:749384453
3556 3556 c, t dbSNP:529938159
3571 3571 g, t dbSNP:561983395
3573 3573 c, t dbSNP:546959109
3574 3574 a, g dbSNP:190837977
3583 3583 c, g dbSNP:756466974
3592 3592 a, g dbSNP:187297219
3597 3597 a, c dbSNP:762464617
3617 3617 g, t dbSNP:200099628
3623 3623 a, g dbSNP:546286332
3644 3644 a, g dbSNP:746258061
3664 3664 c, t dbSNP:575920373
3685 3685 c, g dbSNP:767814877
3695 3695 c, g dbSNP:143369347
3704 3704 g, t dbSNP:62225811
3706 3706 a, g dbSNP:752453853
3707 3707 c, t dbSNP:200772835
3718 3718 a, t dbSNP:181998459
3727 3727 a, c dbSNP:747584684
3737 3737 -, a dbSNP:779719192
3747 3747 a, t dbSNP:778332651
3759 3759 a, g dbSNP:758423479
3767 3767 c, t dbSNP:770969523
3792 3792 c, t dbSNP:752755928
3796 3796 a, c dbSNP:779035400
3799 3799 g, t dbSNP:755148260
3803 3803 -, ctgaa dbSNP:750142480
3842 3842 a, g dbSNP:752723057
3920 3920 a, t dbSNP:575200307
4012 4012 a, t dbSNP:2157585
4013 4013 -, gt dbSNP:134978
4030 4030 c, t dbSNP:534698074
4032 4032 c, t dbSNP:749313648
4038 4038 -, tgtgtgtgtgtgtgcgcgcgcgcg dbSNP:759852277
4044 4044 -, tgtgtgtgcgcg dbSNP:780541209
4047 4047 -, gtgtgcgcgcgcgc dbSNP:555707534
4048 4048 -, tgtgcgcgcgcgcgcg dbSNP:780251218
4049 4049 -, gtgcgcgcgcgc dbSNP:750870441
4049 4049 -, gtgcgc dbSNP:56832260
4050 4050 -, tgcgcgcgcgcgcg dbSNP:760776804
4050 4050 -, tgcgcgcgcgcg dbSNP:375136975
4050 4050 -, tgcgcgcgcg dbSNP:755364858
4050 4050 c, t dbSNP:7293228
4051 4051 -, gcgcgcgcgc dbSNP:61249065
4052 4052 c, t dbSNP:6147576
4054 4054 c, t dbSNP:56271395
4055 4055 -, gcgcgcgcg dbSNP:751966332
4056 4056 c, t dbSNP:770072939
4058 4058 -, cgcgcgcgcgcg dbSNP:773550229
4058 4058 -, cgcgcgcgcg dbSNP:758987964
4058 4058 -, cgcgcgcg dbSNP:770635497
4060 4060 -, cgcgcgcgcg dbSNP:67796216
4061 4061 -, tgtgcgcgcgcgcg dbSNP:753115022
4064 4064 -, cgcgcg dbSNP:10573454
4073 4073 c, t dbSNP:7291576
4076 4076 a, g dbSNP:534586940
4088 4088 c, g dbSNP:139977960
4099 4099 c, t dbSNP:190614395
4109 4109 c, t dbSNP:767355031
4210 4210 a, t dbSNP:3752590
4287 4287 c, t dbSNP:41277335
4312 4312 c, t dbSNP:775047856
4332 4332 a, g dbSNP:573277089
4351 4351 g, t dbSNP:7292764
4372 4372 a, g dbSNP:565943356
4391 4391 a, g dbSNP:142285409
4400 4400 a, g dbSNP:148725091
4412 4412 a, c dbSNP:117397456
4436 4436 a, c dbSNP:3752589
4498 4498 c, t dbSNP:776454348
4504 4504 a, g dbSNP:41277333
4510 4510 a, g dbSNP:3752588
4513 4513 c, t dbSNP:563911164
4563 4563 a, g dbSNP:542425849

Target ORF information:

RefSeq Version XM_011530486
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu74053
Accession Version XM_011530487.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)2141..>2494(+)
Position Chain Variation Link
14 14 c, g dbSNP:56821996
17 17 g, t dbSNP:547422864
49 49 a, g dbSNP:532089191
57 57 g, t dbSNP:187762406
61 61 c, t dbSNP:184042272
76 76 c, g dbSNP:531283049
81 81 c, t dbSNP:560781291
88 88 c, t dbSNP:115916720
112 112 a, g dbSNP:3747137
152 152 c, g dbSNP:553609699
165 165 a, g dbSNP:776574588
167 167 a, g dbSNP:543806596
183 183 a, g dbSNP:572753435
197 197 a, g dbSNP:375890803
200 200 a, c dbSNP:746979158
211 211 a, g dbSNP:561393009
238 238 a, g dbSNP:774468555
243 243 a, g dbSNP:553004302
326 326 a, g dbSNP:551554467
330 330 a, g dbSNP:543525170
350 350 a, g dbSNP:532940807
368 368 a, g dbSNP:567406073
375 375 a, c dbSNP:147631281
417 417 c, t dbSNP:550575971
432 432 c, g dbSNP:763625074
434 434 a, t dbSNP:757938034
465 465 a, g dbSNP:529182573
474 474 c, t dbSNP:5761557
517 517 c, t dbSNP:3747134
529 529 c, g dbSNP:572621201
541 541 -, t dbSNP:200535558
585 585 a, g dbSNP:188205202
615 615 a, t dbSNP:545593544
677 677 c, t dbSNP:759331653
699 699 c, t dbSNP:578089748
723 723 c, g, t dbSNP:556695127
724 724 a, c, g dbSNP:187291798
725 725 -, gataccgg dbSNP:766405923
728 728 a, g dbSNP:369803062
759 759 c, g dbSNP:774733114
762 762 a, c dbSNP:768963068
764 764 c, t dbSNP:763357219
778 778 c, t dbSNP:775899708
782 782 a, g dbSNP:570371168
784 784 c, t dbSNP:144622501
789 789 c, g dbSNP:781358501
792 792 a, t dbSNP:142329133
796 796 a, t dbSNP:747194252
797 797 a, g dbSNP:141268657
807 807 c, t dbSNP:778872709
808 808 a, g dbSNP:766139027
810 810 c, g dbSNP:376524160
815 815 a, g dbSNP:745759291
816 816 -, a dbSNP:763190774
820 820 c, t dbSNP:781088233
826 826 -, t dbSNP:281865097
836 836 a, g dbSNP:756803307
847 847 a, g dbSNP:751062699
850 850 a, g dbSNP:763708665
859 859 c, t dbSNP:758006943
860 860 a, g dbSNP:369457259
863 863 -, gatc dbSNP:775635197
864 864 c, t dbSNP:753004509
866 866 a, g dbSNP:765596627
868 868 a, g dbSNP:759982764
873 873 c, t dbSNP:777324808
877 877 c, t dbSNP:146176609
886 886 c, t dbSNP:760897880
891 891 a, g dbSNP:773369379
892 892 c, t dbSNP:754498322
899 899 -, c dbSNP:765434275
900 900 a, c dbSNP:201485111
906 906 c, t dbSNP:35080023
912 912 a, g dbSNP:143189294
917 917 c, t dbSNP:372020804
919 919 a, g dbSNP:577190408
932 932 a, g dbSNP:759382209
936 936 a, g dbSNP:367800640
939 939 c, t dbSNP:770856288
953 953 c, t dbSNP:149126501
954 954 a, g dbSNP:777170572
959 959 a, g dbSNP:147680141
970 970 a, t dbSNP:747578415
975 975 a, g dbSNP:778692469
983 983 c, g, t dbSNP:374775503
988 988 g, t dbSNP:372865887
990 990 g, t dbSNP:147060589
995 995 c, t dbSNP:141684342
996 996 a, g dbSNP:756712181
998 998 a, c dbSNP:200308529
1006 1006 a, g dbSNP:767883055
1019 1019 a, g dbSNP:149830675
1020 1020 a, t dbSNP:560418283
1025 1025 a, g dbSNP:764311091
1026 1026 g, t dbSNP:763091759
1031 1031 a, g dbSNP:776438458
1035 1035 a, t dbSNP:551412746
1037 1037 a, t dbSNP:760440998
1046 1046 c, g dbSNP:530485818
1052 1052 a, g, t dbSNP:563251161
1066 1066 a, c, g dbSNP:748780405
1070 1070 c, t dbSNP:775352863
1079 1079 a, g dbSNP:376221426
1080 1080 c, g dbSNP:746260835
1082 1082 a, t dbSNP:781343333
1084 1084 c, t dbSNP:541941563
1085 1085 a, c dbSNP:149817614
1088 1088 c, t dbSNP:778229695
1089 1089 a, g, t dbSNP:138885334
1106 1106 a, g dbSNP:765499989
1112 1112 g, t dbSNP:755089668
1125 1125 a, g dbSNP:750265224
1126 1126 c, g dbSNP:767168755
1127 1127 a, c dbSNP:529743443
1139 1139 g, t dbSNP:774473329
1142 1142 -, c dbSNP:772812827
1142 1142 c, g dbSNP:180729981
1144 1144 a, g dbSNP:762612733
1146 1146 c, t dbSNP:775086150
1150 1150 c, t dbSNP:769488831
1151 1151 c, g dbSNP:745468335
1157 1157 c, t dbSNP:373900001
1168 1168 a, g dbSNP:201880600
1172 1172 c, t dbSNP:773505923
1179 1179 c, t dbSNP:150403254
1180 1180 a, g dbSNP:375462083
1181 1181 g, t dbSNP:119471024
1196 1196 a, g dbSNP:754216377
1198 1198 c, t dbSNP:151105857
1199 1199 a, g dbSNP:749385689
1201 1201 a, g dbSNP:529798826
1206 1206 c, t dbSNP:549798245
1214 1214 a, g dbSNP:140430822
1217 1217 a, g dbSNP:777668009
1218 1218 c, t dbSNP:758429460
1220 1220 a, c dbSNP:752726222
1226 1226 c, g dbSNP:765185989
1228 1228 a, g dbSNP:766805523
1230 1230 a, g dbSNP:281865098
1232 1232 a, g dbSNP:759034002
1238 1238 c, t dbSNP:753375046
1245 1245 c, t dbSNP:765958976
1250 1250 g, t dbSNP:760252953
1265 1265 a, g dbSNP:773589703
1306 1306 a, g dbSNP:146620511
1314 1314 g, t dbSNP:577410969
1316 1316 c, g dbSNP:756620904
1348 1348 a, g dbSNP:750932384
1351 1351 a, g dbSNP:754902386
1354 1354 c, g dbSNP:749296930
1355 1355 c, t dbSNP:139808091
1358 1358 c, t dbSNP:755689459
1380 1380 a, g, t dbSNP:377042228
1384 1384 g, t dbSNP:767173486
1387 1387 a, g dbSNP:756838292
1388 1388 a, c, t dbSNP:119471022
1390 1390 g, t dbSNP:200254797
1400 1400 c, t dbSNP:369104384
1401 1401 a, g dbSNP:111522254
1402 1402 c, t dbSNP:763201953
1404 1404 c, t dbSNP:61729175
1405 1405 a, g dbSNP:13054747
1410 1410 a, g dbSNP:201383753
1417 1417 c, t dbSNP:201820144
1420 1420 g, t dbSNP:771282968
1423 1423 a, c dbSNP:760910732
1429 1429 c, t dbSNP:773284328
1440 1440 a, g dbSNP:199965734
1449 1449 c, t dbSNP:562804736
1456 1456 c, g dbSNP:770511759
1464 1464 c, t dbSNP:746492833
1465 1465 a, g dbSNP:139165558
1470 1470 c, t dbSNP:2331251
1472 1472 c, g dbSNP:757926741
1474 1474 c, t dbSNP:753114322
1477 1477 c, t dbSNP:778366926
1482 1482 a, c dbSNP:779379945
1483 1483 a, g, t dbSNP:202091945
1484 1484 a, g dbSNP:766791829
1489 1489 c, g dbSNP:760867986
1491 1491 c, t dbSNP:750412869
1496 1496 c, t dbSNP:119471023
1497 1497 a, g dbSNP:146217183
1500 1500 c, t dbSNP:775289919
1505 1505 c, t dbSNP:765070016
1506 1506 c, t dbSNP:759292339
1511 1511 g, t dbSNP:119471025
1514 1514 c, g dbSNP:548442727
1520 1520 c, t dbSNP:756670349
1521 1521 a, t dbSNP:746415096
1526 1526 a, g dbSNP:781705717
1527 1527 c, t dbSNP:201806802
1528 1528 a, g dbSNP:751621468
1533 1533 a, g dbSNP:713998
1534 1534 a, g dbSNP:758547221
1542 1542 c, t dbSNP:751553768
1543 1543 a, g dbSNP:3747132
1551 1551 a, g dbSNP:150166679
1557 1557 a, g dbSNP:144912961
1567 1567 a, g dbSNP:775075683
1568 1568 c, t dbSNP:769470411
1572 1572 a, g dbSNP:759828449
1581 1581 a, g dbSNP:776910756
1583 1583 c, t dbSNP:3747129
1584 1584 a, g dbSNP:747463385
1589 1589 a, t dbSNP:778229498
1593 1593 a, c dbSNP:772178736
1600 1600 c, t dbSNP:748255618
1607 1607 a, g dbSNP:779017015
1611 1611 c, t dbSNP:77597168
1613 1613 a, g dbSNP:773773876
1615 1615 a, g dbSNP:772573640
1618 1618 a, g dbSNP:377665379
1623 1623 c, t dbSNP:748181375
1624 1624 a, g, t dbSNP:199745804
1628 1628 a, g dbSNP:749572804
1632 1632 a, g dbSNP:374044351
1641 1641 -, ct dbSNP:759733648
1642 1642 a, c, t dbSNP:35126034
1649 1649 a, g dbSNP:777862145
1652 1652 a, t dbSNP:34962745
1655 1655 a, t dbSNP:752176820
1656 1656 a, g dbSNP:141567957
1667 1667 a, g dbSNP:754422079
1670 1670 a, g dbSNP:753527423
1671 1671 a, g dbSNP:766017410
1673 1673 c, g dbSNP:761086802
1678 1678 c, t dbSNP:369227380
1679 1679 a, g dbSNP:767940026
1687 1687 a, g dbSNP:762331694
1688 1688 a, g, t dbSNP:768818454
1693 1693 a, g dbSNP:749372122
1696 1696 a, g dbSNP:200529828
1697 1697 a, g dbSNP:201290613
1700 1700 a, g dbSNP:746808353
1703 1703 a, g dbSNP:565394870
1707 1707 a, c dbSNP:747892556
1714 1714 a, g dbSNP:778968440
1718 1718 c, g dbSNP:768523581
1734 1734 a, t dbSNP:374205780
1735 1735 a, t dbSNP:139107954
1737 1737 a, g dbSNP:143294921
1740 1740 c, t dbSNP:369777121
1741 1741 a, c dbSNP:750128189
1752 1752 a, g dbSNP:780700906
1757 1757 a, g dbSNP:371311675
1761 1761 c, g dbSNP:571151621
1762 1762 c, t dbSNP:764663345
1764 1764 a, g dbSNP:763518309
1765 1765 a, g dbSNP:752850564
1769 1769 a, c dbSNP:765459737
1786 1786 a, g dbSNP:759660620
1789 1789 c, t dbSNP:138343171
1790 1790 a, g dbSNP:375477724
1795 1795 a, c, t dbSNP:773950609
1798 1798 c, t dbSNP:145373966
1804 1804 a, g dbSNP:749271201
1812 1812 c, t dbSNP:377695917
1814 1814 g, t dbSNP:769357720
1822 1822 a, c dbSNP:745353489
1823 1823 a, g dbSNP:150057646
1829 1829 c, g dbSNP:756788652
1832 1832 a, c dbSNP:140732502
1839 1839 a, c dbSNP:778237328
1840 1840 c, t dbSNP:375673570
1842 1842 c, g dbSNP:753298603
1846 1846 c, g, t dbSNP:146884025
1847 1847 a, g dbSNP:202197120
1850 1850 g, t dbSNP:753803734
1856 1856 c, t dbSNP:766628788
1857 1857 c, t dbSNP:371109134
1859 1859 c, g dbSNP:143965829
1870 1870 a, g dbSNP:773460422
1873 1873 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1876 1876 c, t dbSNP:763915803
1877 1877 a, g dbSNP:377326385
1885 1885 c, g dbSNP:548311034
1894 1894 c, t dbSNP:769658980
1895 1895 g, t dbSNP:745384564
1897 1897 c, t dbSNP:775959392
1898 1898 c, g dbSNP:770642869
1912 1912 a, g dbSNP:746693127
1915 1915 c, t dbSNP:188300485
1916 1916 g, t dbSNP:758902895
1917 1917 c, g dbSNP:748512719
1937 1937 a, g dbSNP:372970834
1941 1941 a, g, t dbSNP:113242819
1942 1942 a, t dbSNP:753983512
1958 1958 a, g dbSNP:766419128
1959 1959 c, g, t dbSNP:759075680
1961 1961 ag, tc dbSNP:386820399
1961 1961 a, t dbSNP:114685298
1962 1962 c, g dbSNP:116769827
1965 1965 c, t dbSNP:775195314
1969 1969 g, t dbSNP:765186595
1978 1978 -, a dbSNP:772691909
1984 1984 c, g dbSNP:532646940
1985 1985 c, t dbSNP:776612681
1993 1993 a, g dbSNP:369393785
1997 1997 -, gaa dbSNP:761480950
2002 2002 c, t dbSNP:765478898
2003 2003 a, g dbSNP:376253108
2009 2009 c, t dbSNP:771794197
2012 2012 a, g dbSNP:377095634
2016 2016 c, t dbSNP:372828090
2017 2017 c, t dbSNP:769041433
2019 2019 a, g dbSNP:749799140
2025 2025 c, g dbSNP:558884663
2033 2033 c, g, t dbSNP:369053765
2035 2035 a, c, g dbSNP:757426392
2039 2039 a, g dbSNP:752507059
2041 2041 a, g dbSNP:764993355
2043 2043 a, c dbSNP:759348602
2048 2048 g, t dbSNP:753787422
2049 2049 a, c dbSNP:766330282
2051 2051 c, t dbSNP:760276585
2060 2060 a, t dbSNP:200477299
2066 2066 a, t dbSNP:772783723
2078 2078 c, t dbSNP:375526010
2081 2081 a, g dbSNP:142139781
2084 2084 c, g dbSNP:774114985
2093 2093 a, c dbSNP:375655372
2098 2098 a, t dbSNP:373523675
2099 2099 c, g dbSNP:780435239
2103 2103 a, t dbSNP:770266719
2111 2111 a, g dbSNP:148662419
2113 2113 a, t dbSNP:781196776
2119 2119 c, g, t dbSNP:751823743
2122 2122 c, t dbSNP:144077166
2123 2123 a, g dbSNP:143711674
2127 2127 c, t dbSNP:753613070
2132 2132 a, g dbSNP:766233510
2133 2133 a, g dbSNP:201043011
2135 2135 c, g dbSNP:749976459
2138 2138 a, g dbSNP:370007632
2141 2141 a, c dbSNP:761403871
2145 2145 c, t dbSNP:773931864
2146 2146 a, g dbSNP:763743681
2153 2153 a, g dbSNP:763228182
2161 2161 a, g dbSNP:775881151
2162 2162 c, g dbSNP:770221086
2168 2168 a, g dbSNP:746418898
2170 2170 c, t dbSNP:746818979
2171 2171 a, c dbSNP:777094703
2177 2177 a, c dbSNP:777491163
2178 2178 a, g dbSNP:747080557
2183 2183 c, g dbSNP:777875261
2190 2190 a, c dbSNP:758581869
2193 2193 c, t dbSNP:372499859
2196 2196 a, c dbSNP:779849991
2197 2197 a, g dbSNP:755952793
2208 2208 a, g dbSNP:117114544
2214 2214 a, g dbSNP:750452419
2217 2217 c, t dbSNP:767548244
2221 2221 a, g dbSNP:756839100
2226 2226 a, t dbSNP:751013277
2228 2228 c, g dbSNP:2014410
2230 2230 c, t dbSNP:762613783
2231 2231 a, g dbSNP:774979651
2234 2234 a, g dbSNP:765633123
2252 2252 -, agc dbSNP:768468362
2257 2257 a, c dbSNP:748136926
2261 2261 a, c, t dbSNP:186173240
2271 2271 c, g dbSNP:375587915
2279 2279 a, c dbSNP:773303744
2284 2284 a, c dbSNP:772205948
2286 2286 a, c dbSNP:754066787
2288 2288 a, g dbSNP:778998363
2295 2295 a, c dbSNP:756030696
2296 2296 c, g dbSNP:372027593
2297 2297 c, t dbSNP:147435410
2298 2298 a, g dbSNP:142958812
2300 2300 a, c dbSNP:751051493
2303 2303 a, c dbSNP:763704933
2304 2304 c, g dbSNP:757812079
2312 2312 c, t dbSNP:549290787
2315 2315 c, t dbSNP:764860798
2318 2318 c, t dbSNP:759909785
2319 2319 a, g dbSNP:139039617
2343 2343 a, g dbSNP:766903925
2344 2344 a, c dbSNP:761197874
2351 2351 c, t dbSNP:773570398
2355 2355 c, t dbSNP:772234990
2356 2356 a, g dbSNP:756215705
2365 2365 a, c dbSNP:774728501
2366 2366 c, g dbSNP:768931718
2368 2368 c, t dbSNP:745687268
2373 2373 a, g dbSNP:781082499
2379 2379 a, g dbSNP:770823084
2380 2380 a, c, t dbSNP:777570870
2381 2381 a, g dbSNP:757988379
2383 2383 c, t dbSNP:752092814
2388 2388 g, t dbSNP:11545917
2389 2389 a, g dbSNP:778544549
2394 2394 a, g, t dbSNP:754224646
2403 2403 a, g dbSNP:766781092
2404 2404 a, c, t dbSNP:534067573
2405 2405 a, g dbSNP:767852159
2410 2410 a, c dbSNP:761956374
2412 2412 c, g dbSNP:774532334
2415 2415 a, g dbSNP:769017976
2421 2421 a, g dbSNP:763311479
2425 2425 c, t dbSNP:775820827
2428 2428 g, t dbSNP:770822747
2434 2434 a, c dbSNP:367810755
2436 2436 c, g, t dbSNP:150216540
2437 2437 a, t dbSNP:141008676
2439 2439 c, t dbSNP:778346173
2440 2440 a, g dbSNP:754462097
2444 2444 c, t dbSNP:148134252
2447 2447 c, t dbSNP:372833027
2455 2455 c, t dbSNP:756512740
2457 2457 g, t dbSNP:750685060
2458 2458 c, t dbSNP:768100817
2472 2472 c, g dbSNP:143747386
2482 2482 c, t dbSNP:200667267
2485 2485 a, g dbSNP:752086428
2487 2487 c, t dbSNP:764305334
2492 2492 c, t dbSNP:763117738
2497 2497 a, g dbSNP:775916508
2498 2498 a, g dbSNP:765322078
2503 2503 c, t dbSNP:760527580
2505 2505 c, g dbSNP:772846606
2507 2507 a, g dbSNP:772069598
2515 2515 c, t dbSNP:748133574
2516 2516 g, t dbSNP:116241923
2522 2522 a, g dbSNP:202104505
2526 2526 a, g dbSNP:748736760
2534 2534 a, g dbSNP:367888424
2537 2537 c, g dbSNP:751938775
2538 2538 a, g dbSNP:532246881
2541 2541 c, g dbSNP:145674158
2542 2542 c, t dbSNP:199740072
2543 2543 a, g dbSNP:182592572
2551 2551 a, g dbSNP:781455905
2555 2555 a, c, g dbSNP:5752330
2560 2560 a, g dbSNP:540157835
2567 2567 c, t dbSNP:758568345
2580 2580 c, t dbSNP:143902143
2581 2581 a, g dbSNP:527653764
2593 2593 c, t dbSNP:759632995
2595 2595 g, t dbSNP:561308139
2596 2596 c, t dbSNP:767256800
2597 2597 a, c, g dbSNP:774331295
2599 2599 a, c dbSNP:768513194
2601 2601 c, t dbSNP:140234219
2604 2604 c, t dbSNP:774813995
2608 2608 a, g dbSNP:769325136
2611 2611 a, g dbSNP:745543124
2612 2612 c, g dbSNP:780889236
2628 2628 c, t dbSNP:747411315
2630 2630 c, g dbSNP:778239048
2632 2632 c, t dbSNP:772546709
2635 2635 a, g dbSNP:748643364
2640 2640 -, a dbSNP:779927531
2640 2640 a, g dbSNP:779471156
2643 2643 a, g dbSNP:755073092
2648 2648 a, g dbSNP:145481980
2653 2653 c, t dbSNP:780284817
2657 2657 c, t dbSNP:756278524
2660 2660 a, g dbSNP:750621357
2667 2667 c, t dbSNP:763915972
2668 2668 a, g dbSNP:541601069
2670 2670 c, t dbSNP:371342669
2679 2679 a, t dbSNP:765161412
2686 2686 a, g dbSNP:758970516
2688 2688 c, t dbSNP:776169421
2689 2689 c, g dbSNP:770733264
2694 2694 c, t dbSNP:149689335
2697 2697 a, g dbSNP:565596162
2703 2703 a, c dbSNP:772632659
2709 2709 a, g dbSNP:748533902
2712 2712 g, t dbSNP:779303648
2715 2715 c, t dbSNP:368334509
2716 2716 a, g dbSNP:749347544
2717 2717 c, t dbSNP:1894706
2719 2719 -, c dbSNP:769405747
2721 2721 -, a dbSNP:745665820
2722 2722 c, t dbSNP:756155749
2726 2726 c, t dbSNP:746151193
2727 2727 a, g dbSNP:781375770
2737 2737 c, g dbSNP:758138934
2738 2738 c, t dbSNP:752467533
2742 2742 g, t dbSNP:765121677
2751 2751 a, c dbSNP:749888433
2757 2757 c, t dbSNP:374238081
2758 2758 a, g dbSNP:373421312
2762 2762 a, g dbSNP:773844011
2767 2767 -, c dbSNP:281865099
2772 2772 a, c, t dbSNP:560591308
2773 2773 a, g dbSNP:775986716
2776 2776 g, t dbSNP:1894704
2780 2780 c, t dbSNP:759641785
2781 2781 a, g dbSNP:776644648
2783 2783 c, t dbSNP:770895794
2784 2784 a, g dbSNP:78892693
2786 2786 c, t dbSNP:553852142
2789 2789 c, t dbSNP:139675793
2790 2790 g, t dbSNP:749034221
2791 2791 c, g, t dbSNP:201385335
2792 2792 c, t dbSNP:119471021
2796 2796 a, c dbSNP:750362522
2797 2797 c, t dbSNP:370795890
2798 2798 a, c, g dbSNP:202222123
2800 2800 c, t dbSNP:35993959
2803 2803 c, t dbSNP:553114134
2806 2806 g, t dbSNP:763308032
2810 2810 c, t dbSNP:753017691
2811 2811 a, g dbSNP:745559996
2815 2815 c, t dbSNP:765753447
2819 2819 c, t dbSNP:760087525
2823 2823 c, t dbSNP:776976418
2824 2824 c, g dbSNP:377050180
2832 2832 c, g dbSNP:373905924
2834 2834 a, g, t dbSNP:538187229
2835 2835 c, t dbSNP:749128912
2836 2836 a, g, t dbSNP:769678704
2842 2842 c, t dbSNP:745866776
2846 2846 a, g dbSNP:780978556
2848 2848 a, g dbSNP:146303784
2851 2851 g, t dbSNP:750963690
2855 2855 a, g dbSNP:777509970
2860 2860 c, t dbSNP:202120615
2861 2861 a, g dbSNP:201206642
2863 2863 c, t dbSNP:9625029
2867 2867 a, t dbSNP:148294572
2868 2868 -, ac dbSNP:752827715<