Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

HPS4 Hermansky-Pudlak syndrome 4 [Homo sapiens (human)]

Gene Symbol HPS4
Entrez Gene ID 89781
Full Name Hermansky-Pudlak syndrome 4
Synonyms LE
General protein information
Preferred Names
Hermansky-Pudlak syndrome 4 protein
Hermansky-Pudlak syndrome 4 protein
light-ear protein homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]. lac of sum
Disorder MIM:


Disorder Html: Hermansky-Pudlak syndrome 4, 203300 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu74053 XM_011530485 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74053 XM_011530486 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74053 XM_011530487 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74053 XM_011530488 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74053 XM_011530489 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74054 XM_011530490 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu53739 XM_006724353 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu53739 XM_006724354 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X9, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74055 XM_011530491 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X10, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74056 XM_011530492 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X11, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu74057 XM_011530493 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X12, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu53746 XM_011530494 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X13, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu53744 XM_006724360 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X14, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu53744 XM_011530495 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X15, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu53746 XM_011530496 PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X16, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu21009 NM_022081 Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu20693 NM_152841 Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu74053D
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)2031..>2384(+)
Position Chain Variation Link
32 32 c, g dbSNP:56821996
35 35 g, t dbSNP:547422864
67 67 a, g dbSNP:532089191
75 75 g, t dbSNP:187762406
79 79 c, t dbSNP:184042272
94 94 c, g dbSNP:531283049
99 99 c, t dbSNP:560781291
106 106 c, t dbSNP:115916720
130 130 a, g dbSNP:3747137
170 170 c, g dbSNP:553609699
216 216 a, g dbSNP:551554467
220 220 a, g dbSNP:543525170
240 240 a, g dbSNP:532940807
258 258 a, g dbSNP:567406073
265 265 a, c dbSNP:147631281
307 307 c, t dbSNP:550575971
322 322 c, g dbSNP:763625074
324 324 a, t dbSNP:757938034
355 355 a, g dbSNP:529182573
364 364 c, t dbSNP:5761557
407 407 c, t dbSNP:3747134
419 419 c, g dbSNP:572621201
431 431 -, t dbSNP:200535558
475 475 a, g dbSNP:188205202
505 505 a, t dbSNP:545593544
567 567 c, t dbSNP:759331653
589 589 c, t dbSNP:578089748
613 613 c, g, t dbSNP:556695127
614 614 a, c, g dbSNP:187291798
615 615 -, gataccgg dbSNP:766405923
618 618 a, g dbSNP:369803062
649 649 c, g dbSNP:774733114
652 652 a, c dbSNP:768963068
654 654 c, t dbSNP:763357219
668 668 c, t dbSNP:775899708
672 672 a, g dbSNP:570371168
674 674 c, t dbSNP:144622501
679 679 c, g dbSNP:781358501
682 682 a, t dbSNP:142329133
686 686 a, t dbSNP:747194252
687 687 a, g dbSNP:141268657
697 697 c, t dbSNP:778872709
698 698 a, g dbSNP:766139027
700 700 c, g dbSNP:376524160
705 705 a, g dbSNP:745759291
706 706 -, a dbSNP:763190774
710 710 c, t dbSNP:781088233
716 716 -, t dbSNP:281865097
726 726 a, g dbSNP:756803307
737 737 a, g dbSNP:751062699
740 740 a, g dbSNP:763708665
749 749 c, t dbSNP:758006943
750 750 a, g dbSNP:369457259
753 753 -, gatc dbSNP:775635197
754 754 c, t dbSNP:753004509
756 756 a, g dbSNP:765596627
758 758 a, g dbSNP:759982764
763 763 c, t dbSNP:777324808
767 767 c, t dbSNP:146176609
776 776 c, t dbSNP:760897880
781 781 a, g dbSNP:773369379
782 782 c, t dbSNP:754498322
789 789 -, c dbSNP:765434275
790 790 a, c dbSNP:201485111
796 796 c, t dbSNP:35080023
802 802 a, g dbSNP:143189294
807 807 c, t dbSNP:372020804
809 809 a, g dbSNP:577190408
822 822 a, g dbSNP:759382209
826 826 a, g dbSNP:367800640
829 829 c, t dbSNP:770856288
843 843 c, t dbSNP:149126501
844 844 a, g dbSNP:777170572
849 849 a, g dbSNP:147680141
860 860 a, t dbSNP:747578415
865 865 a, g dbSNP:778692469
873 873 c, g, t dbSNP:374775503
878 878 g, t dbSNP:372865887
880 880 g, t dbSNP:147060589
885 885 c, t dbSNP:141684342
886 886 a, g dbSNP:756712181
888 888 a, c dbSNP:200308529
896 896 a, g dbSNP:767883055
909 909 a, g dbSNP:149830675
910 910 a, t dbSNP:560418283
915 915 a, g dbSNP:764311091
916 916 g, t dbSNP:763091759
921 921 a, g dbSNP:776438458
925 925 a, t dbSNP:551412746
927 927 a, t dbSNP:760440998
936 936 c, g dbSNP:530485818
942 942 a, g, t dbSNP:563251161
956 956 a, c, g dbSNP:748780405
960 960 c, t dbSNP:775352863
969 969 a, g dbSNP:376221426
970 970 c, g dbSNP:746260835
972 972 a, t dbSNP:781343333
974 974 c, t dbSNP:541941563
975 975 a, c dbSNP:149817614
978 978 c, t dbSNP:778229695
979 979 a, g, t dbSNP:138885334
996 996 a, g dbSNP:765499989
1002 1002 g, t dbSNP:755089668
1015 1015 a, g dbSNP:750265224
1016 1016 c, g dbSNP:767168755
1017 1017 a, c dbSNP:529743443
1029 1029 g, t dbSNP:774473329
1032 1032 -, c dbSNP:772812827
1032 1032 c, g dbSNP:180729981
1034 1034 a, g dbSNP:762612733
1036 1036 c, t dbSNP:775086150
1040 1040 c, t dbSNP:769488831
1041 1041 c, g dbSNP:745468335
1047 1047 c, t dbSNP:373900001
1058 1058 a, g dbSNP:201880600
1062 1062 c, t dbSNP:773505923
1069 1069 c, t dbSNP:150403254
1070 1070 a, g dbSNP:375462083
1071 1071 g, t dbSNP:119471024
1086 1086 a, g dbSNP:754216377
1088 1088 c, t dbSNP:151105857
1089 1089 a, g dbSNP:749385689
1091 1091 a, g dbSNP:529798826
1096 1096 c, t dbSNP:549798245
1104 1104 a, g dbSNP:140430822
1107 1107 a, g dbSNP:777668009
1108 1108 c, t dbSNP:758429460
1110 1110 a, c dbSNP:752726222
1116 1116 c, g dbSNP:765185989
1118 1118 a, g dbSNP:766805523
1120 1120 a, g dbSNP:281865098
1122 1122 a, g dbSNP:759034002
1128 1128 c, t dbSNP:753375046
1135 1135 c, t dbSNP:765958976
1140 1140 g, t dbSNP:760252953
1155 1155 a, g dbSNP:773589703
1196 1196 a, g dbSNP:146620511
1204 1204 g, t dbSNP:577410969
1206 1206 c, g dbSNP:756620904
1238 1238 a, g dbSNP:750932384
1241 1241 a, g dbSNP:754902386
1244 1244 c, g dbSNP:749296930
1245 1245 c, t dbSNP:139808091
1248 1248 c, t dbSNP:755689459
1270 1270 a, g, t dbSNP:377042228
1274 1274 g, t dbSNP:767173486
1277 1277 a, g dbSNP:756838292
1278 1278 a, c, t dbSNP:119471022
1280 1280 g, t dbSNP:200254797
1290 1290 c, t dbSNP:369104384
1291 1291 a, g dbSNP:111522254
1292 1292 c, t dbSNP:763201953
1294 1294 c, t dbSNP:61729175
1295 1295 a, g dbSNP:13054747
1300 1300 a, g dbSNP:201383753
1307 1307 c, t dbSNP:201820144
1310 1310 g, t dbSNP:771282968
1313 1313 a, c dbSNP:760910732
1319 1319 c, t dbSNP:773284328
1330 1330 a, g dbSNP:199965734
1339 1339 c, t dbSNP:562804736
1346 1346 c, g dbSNP:770511759
1354 1354 c, t dbSNP:746492833
1355 1355 a, g dbSNP:139165558
1360 1360 c, t dbSNP:2331251
1362 1362 c, g dbSNP:757926741
1364 1364 c, t dbSNP:753114322
1367 1367 c, t dbSNP:778366926
1372 1372 a, c dbSNP:779379945
1373 1373 a, g, t dbSNP:202091945
1374 1374 a, g dbSNP:766791829
1379 1379 c, g dbSNP:760867986
1381 1381 c, t dbSNP:750412869
1386 1386 c, t dbSNP:119471023
1387 1387 a, g dbSNP:146217183
1390 1390 c, t dbSNP:775289919
1395 1395 c, t dbSNP:765070016
1396 1396 c, t dbSNP:759292339
1401 1401 g, t dbSNP:119471025
1404 1404 c, g dbSNP:548442727
1410 1410 c, t dbSNP:756670349
1411 1411 a, t dbSNP:746415096
1416 1416 a, g dbSNP:781705717
1417 1417 c, t dbSNP:201806802
1418 1418 a, g dbSNP:751621468
1423 1423 a, g dbSNP:713998
1424 1424 a, g dbSNP:758547221
1432 1432 c, t dbSNP:751553768
1433 1433 a, g dbSNP:3747132
1441 1441 a, g dbSNP:150166679
1447 1447 a, g dbSNP:144912961
1457 1457 a, g dbSNP:775075683
1458 1458 c, t dbSNP:769470411
1462 1462 a, g dbSNP:759828449
1471 1471 a, g dbSNP:776910756
1473 1473 c, t dbSNP:3747129
1474 1474 a, g dbSNP:747463385
1479 1479 a, t dbSNP:778229498
1483 1483 a, c dbSNP:772178736
1490 1490 c, t dbSNP:748255618
1497 1497 a, g dbSNP:779017015
1501 1501 c, t dbSNP:77597168
1503 1503 a, g dbSNP:773773876
1505 1505 a, g dbSNP:772573640
1508 1508 a, g dbSNP:377665379
1513 1513 c, t dbSNP:748181375
1514 1514 a, g, t dbSNP:199745804
1518 1518 a, g dbSNP:749572804
1522 1522 a, g dbSNP:374044351
1531 1531 -, ct dbSNP:759733648
1532 1532 a, c, t dbSNP:35126034
1539 1539 a, g dbSNP:777862145
1542 1542 a, t dbSNP:34962745
1545 1545 a, t dbSNP:752176820
1546 1546 a, g dbSNP:141567957
1557 1557 a, g dbSNP:754422079
1560 1560 a, g dbSNP:753527423
1561 1561 a, g dbSNP:766017410
1563 1563 c, g dbSNP:761086802
1568 1568 c, t dbSNP:369227380
1569 1569 a, g dbSNP:767940026
1577 1577 a, g dbSNP:762331694
1578 1578 a, g, t dbSNP:768818454
1583 1583 a, g dbSNP:749372122
1586 1586 a, g dbSNP:200529828
1587 1587 a, g dbSNP:201290613
1590 1590 a, g dbSNP:746808353
1593 1593 a, g dbSNP:565394870
1597 1597 a, c dbSNP:747892556
1604 1604 a, g dbSNP:778968440
1608 1608 c, g dbSNP:768523581
1624 1624 a, t dbSNP:374205780
1625 1625 a, t dbSNP:139107954
1627 1627 a, g dbSNP:143294921
1630 1630 c, t dbSNP:369777121
1631 1631 a, c dbSNP:750128189
1642 1642 a, g dbSNP:780700906
1647 1647 a, g dbSNP:371311675
1651 1651 c, g dbSNP:571151621
1652 1652 c, t dbSNP:764663345
1654 1654 a, g dbSNP:763518309
1655 1655 a, g dbSNP:752850564
1659 1659 a, c dbSNP:765459737
1676 1676 a, g dbSNP:759660620
1679 1679 c, t dbSNP:138343171
1680 1680 a, g dbSNP:375477724
1685 1685 a, c, t dbSNP:773950609
1688 1688 c, t dbSNP:145373966
1694 1694 a, g dbSNP:749271201
1702 1702 c, t dbSNP:377695917
1704 1704 g, t dbSNP:769357720
1712 1712 a, c dbSNP:745353489
1713 1713 a, g dbSNP:150057646
1719 1719 c, g dbSNP:756788652
1722 1722 a, c dbSNP:140732502
1729 1729 a, c dbSNP:778237328
1730 1730 c, t dbSNP:375673570
1732 1732 c, g dbSNP:753298603
1736 1736 c, g, t dbSNP:146884025
1737 1737 a, g dbSNP:202197120
1740 1740 g, t dbSNP:753803734
1746 1746 c, t dbSNP:766628788
1747 1747 c, t dbSNP:371109134
1749 1749 c, g dbSNP:143965829
1760 1760 a, g dbSNP:773460422
1763 1763 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1766 1766 c, t dbSNP:763915803
1767 1767 a, g dbSNP:377326385
1775 1775 c, g dbSNP:548311034
1784 1784 c, t dbSNP:769658980
1785 1785 g, t dbSNP:745384564
1787 1787 c, t dbSNP:775959392
1788 1788 c, g dbSNP:770642869
1802 1802 a, g dbSNP:746693127
1805 1805 c, t dbSNP:188300485
1806 1806 g, t dbSNP:758902895
1807 1807 c, g dbSNP:748512719
1827 1827 a, g dbSNP:372970834
1831 1831 a, g, t dbSNP:113242819
1832 1832 a, t dbSNP:753983512
1848 1848 a, g dbSNP:766419128
1849 1849 c, g, t dbSNP:759075680
1851 1851 ag, tc dbSNP:386820399
1851 1851 a, t dbSNP:114685298
1852 1852 c, g dbSNP:116769827
1855 1855 c, t dbSNP:775195314
1859 1859 g, t dbSNP:765186595
1868 1868 -, a dbSNP:772691909
1874 1874 c, g dbSNP:532646940
1875 1875 c, t dbSNP:776612681
1883 1883 a, g dbSNP:369393785
1887 1887 -, gaa dbSNP:761480950
1892 1892 c, t dbSNP:765478898
1893 1893 a, g dbSNP:376253108
1899 1899 c, t dbSNP:771794197
1902 1902 a, g dbSNP:377095634
1906 1906 c, t dbSNP:372828090
1907 1907 c, t dbSNP:769041433
1909 1909 a, g dbSNP:749799140
1915 1915 c, g dbSNP:558884663
1923 1923 c, g, t dbSNP:369053765
1925 1925 a, c, g dbSNP:757426392
1929 1929 a, g dbSNP:752507059
1931 1931 a, g dbSNP:764993355
1933 1933 a, c dbSNP:759348602
1938 1938 g, t dbSNP:753787422
1939 1939 a, c dbSNP:766330282
1941 1941 c, t dbSNP:760276585
1950 1950 a, t dbSNP:200477299
1956 1956 a, t dbSNP:772783723
1968 1968 c, t dbSNP:375526010
1971 1971 a, g dbSNP:142139781
1974 1974 c, g dbSNP:774114985
1983 1983 a, c dbSNP:375655372
1988 1988 a, t dbSNP:373523675
1989 1989 c, g dbSNP:780435239
1993 1993 a, t dbSNP:770266719
2001 2001 a, g dbSNP:148662419
2003 2003 a, t dbSNP:781196776
2009 2009 c, g, t dbSNP:751823743
2012 2012 c, t dbSNP:144077166
2013 2013 a, g dbSNP:143711674
2017 2017 c, t dbSNP:753613070
2022 2022 a, g dbSNP:766233510
2023 2023 a, g dbSNP:201043011
2025 2025 c, g dbSNP:749976459
2028 2028 a, g dbSNP:370007632
2031 2031 a, c dbSNP:761403871
2035 2035 c, t dbSNP:773931864
2036 2036 a, g dbSNP:763743681
2043 2043 a, g dbSNP:763228182
2051 2051 a, g dbSNP:775881151
2052 2052 c, g dbSNP:770221086
2058 2058 a, g dbSNP:746418898
2060 2060 c, t dbSNP:746818979
2061 2061 a, c dbSNP:777094703
2067 2067 a, c dbSNP:777491163
2068 2068 a, g dbSNP:747080557
2073 2073 c, g dbSNP:777875261
2080 2080 a, c dbSNP:758581869
2083 2083 c, t dbSNP:372499859
2086 2086 a, c dbSNP:779849991
2087 2087 a, g dbSNP:755952793
2098 2098 a, g dbSNP:117114544
2104 2104 a, g dbSNP:750452419
2107 2107 c, t dbSNP:767548244
2111 2111 a, g dbSNP:756839100
2116 2116 a, t dbSNP:751013277
2118 2118 c, g dbSNP:2014410
2120 2120 c, t dbSNP:762613783
2121 2121 a, g dbSNP:774979651
2124 2124 a, g dbSNP:765633123
2142 2142 -, agc dbSNP:768468362
2147 2147 a, c dbSNP:748136926
2151 2151 a, c, t dbSNP:186173240
2161 2161 c, g dbSNP:375587915
2169 2169 a, c dbSNP:773303744
2174 2174 a, c dbSNP:772205948
2176 2176 a, c dbSNP:754066787
2178 2178 a, g dbSNP:778998363
2185 2185 a, c dbSNP:756030696
2186 2186 c, g dbSNP:372027593
2187 2187 c, t dbSNP:147435410
2188 2188 a, g dbSNP:142958812
2190 2190 a, c dbSNP:751051493
2193 2193 a, c dbSNP:763704933
2194 2194 c, g dbSNP:757812079
2202 2202 c, t dbSNP:549290787
2205 2205 c, t dbSNP:764860798
2208 2208 c, t dbSNP:759909785
2209 2209 a, g dbSNP:139039617
2233 2233 a, g dbSNP:766903925
2234 2234 a, c dbSNP:761197874
2241 2241 c, t dbSNP:773570398
2245 2245 c, t dbSNP:772234990
2246 2246 a, g dbSNP:756215705
2255 2255 a, c dbSNP:774728501
2256 2256 c, g dbSNP:768931718
2258 2258 c, t dbSNP:745687268
2263 2263 a, g dbSNP:781082499
2269 2269 a, g dbSNP:770823084
2270 2270 a, c, t dbSNP:777570870
2271 2271 a, g dbSNP:757988379
2273 2273 c, t dbSNP:752092814
2278 2278 g, t dbSNP:11545917
2279 2279 a, g dbSNP:778544549
2284 2284 a, g, t dbSNP:754224646
2293 2293 a, g dbSNP:766781092
2294 2294 a, c, t dbSNP:534067573
2295 2295 a, g dbSNP:767852159
2300 2300 a, c dbSNP:761956374
2302 2302 c, g dbSNP:774532334
2305 2305 a, g dbSNP:769017976
2311 2311 a, g dbSNP:763311479
2315 2315 c, t dbSNP:775820827
2318 2318 g, t dbSNP:770822747
2324 2324 a, c dbSNP:367810755
2326 2326 c, g, t dbSNP:150216540
2327 2327 a, t dbSNP:141008676
2329 2329 c, t dbSNP:778346173
2330 2330 a, g dbSNP:754462097
2334 2334 c, t dbSNP:148134252
2337 2337 c, t dbSNP:372833027
2345 2345 c, t dbSNP:756512740
2347 2347 g, t dbSNP:750685060
2348 2348 c, t dbSNP:768100817
2362 2362 c, g dbSNP:143747386
2372 2372 c, t dbSNP:200667267
2375 2375 a, g dbSNP:752086428
2377 2377 c, t dbSNP:764305334
2382 2382 c, t dbSNP:763117738
2387 2387 a, g dbSNP:775916508
2388 2388 a, g dbSNP:765322078
2393 2393 c, t dbSNP:760527580
2395 2395 c, g dbSNP:772846606
2397 2397 a, g dbSNP:772069598
2405 2405 c, t dbSNP:748133574
2406 2406 g, t dbSNP:116241923
2412 2412 a, g dbSNP:202104505
2416 2416 a, g dbSNP:748736760
2424 2424 a, g dbSNP:367888424
2427 2427 c, g dbSNP:751938775
2428 2428 a, g dbSNP:532246881
2431 2431 c, g dbSNP:145674158
2432 2432 c, t dbSNP:199740072
2433 2433 a, g dbSNP:182592572
2441 2441 a, g dbSNP:781455905
2445 2445 a, c, g dbSNP:5752330
2450 2450 a, g dbSNP:540157835
2457 2457 c, t dbSNP:758568345
2470 2470 c, t dbSNP:143902143
2471 2471 a, g dbSNP:527653764
2483 2483 c, t dbSNP:759632995
2485 2485 g, t dbSNP:561308139
2486 2486 c, t dbSNP:767256800
2487 2487 a, c, g dbSNP:774331295
2489 2489 a, c dbSNP:768513194
2491 2491 c, t dbSNP:140234219
2494 2494 c, t dbSNP:774813995
2498 2498 a, g dbSNP:769325136
2501 2501 a, g dbSNP:745543124
2502 2502 c, g dbSNP:780889236
2518 2518 c, t dbSNP:747411315
2520 2520 c, g dbSNP:778239048
2522 2522 c, t dbSNP:772546709
2525 2525 a, g dbSNP:748643364
2530 2530 -, a dbSNP:779927531
2530 2530 a, g dbSNP:779471156
2533 2533 a, g dbSNP:755073092
2538 2538 a, g dbSNP:145481980
2543 2543 c, t dbSNP:780284817
2547 2547 c, t dbSNP:756278524
2550 2550 a, g dbSNP:750621357
2557 2557 c, t dbSNP:763915972
2558 2558 a, g dbSNP:541601069
2560 2560 c, t dbSNP:371342669
2569 2569 a, t dbSNP:765161412
2576 2576 a, g dbSNP:758970516
2578 2578 c, t dbSNP:776169421
2579 2579 c, g dbSNP:770733264
2584 2584 c, t dbSNP:149689335
2587 2587 a, g dbSNP:565596162
2593 2593 a, c dbSNP:772632659
2599 2599 a, g dbSNP:748533902
2602 2602 g, t dbSNP:779303648
2605 2605 c, t dbSNP:368334509
2606 2606 a, g dbSNP:749347544
2607 2607 c, t dbSNP:1894706
2609 2609 -, c dbSNP:769405747
2611 2611 -, a dbSNP:745665820
2612 2612 c, t dbSNP:756155749
2616 2616 c, t dbSNP:746151193
2617 2617 a, g dbSNP:781375770
2627 2627 c, g dbSNP:758138934
2628 2628 c, t dbSNP:752467533
2632 2632 g, t dbSNP:765121677
2641 2641 a, c dbSNP:749888433
2647 2647 c, t dbSNP:374238081
2648 2648 a, g dbSNP:373421312
2652 2652 a, g dbSNP:773844011
2657 2657 -, c dbSNP:281865099
2662 2662 a, c, t dbSNP:560591308
2663 2663 a, g dbSNP:775986716
2666 2666 g, t dbSNP:1894704
2670 2670 c, t dbSNP:759641785
2671 2671 a, g dbSNP:776644648
2673 2673 c, t dbSNP:770895794
2674 2674 a, g dbSNP:78892693
2676 2676 c, t dbSNP:553852142
2679 2679 c, t dbSNP:139675793
2680 2680 g, t dbSNP:749034221
2681 2681 c, g, t dbSNP:201385335
2682 2682 c, t dbSNP:119471021
2686 2686 a, c dbSNP:750362522
2687 2687 c, t dbSNP:370795890
2688 2688 a, c, g dbSNP:202222123
2690 2690 c, t dbSNP:35993959
2693 2693 c, t dbSNP:553114134
2696 2696 g, t dbSNP:763308032
2700 2700 c, t dbSNP:753017691
2701 2701 a, g dbSNP:745559996
2705 2705 c, t dbSNP:765753447
2709 2709 c, t dbSNP:760087525
2713 2713 c, t dbSNP:776976418
2714 2714 c, g dbSNP:377050180
2722 2722 c, g dbSNP:373905924
2724 2724 a, g, t dbSNP:538187229
2725 2725 c, t dbSNP:749128912
2726 2726 a, g, t dbSNP:769678704
2732 2732 c, t dbSNP:745866776
2736 2736 a, g dbSNP:780978556
2738 2738 a, g dbSNP:146303784
2741 2741 g, t dbSNP:750963690
2745 2745 a, g dbSNP:777509970
2750 2750 c, t dbSNP:202120615
2751 2751 a, g dbSNP:201206642
2753 2753 c, t dbSNP:9625029
2757 2757 a, t dbSNP:148294572
2758 2758 -, ac dbSNP:752827715
2758 2758 c, t dbSNP:767769111
2759 2759 a, g dbSNP:761967529
2768 2768 c, t dbSNP:144248515
2769 2769 a, g dbSNP:530118832
2771 2771 c, t dbSNP:764344335
2778 2778 a, c dbSNP:759405900
2779 2779 a, g dbSNP:776239550
2791 2791 a, g dbSNP:368602340
2795 2795 a, g dbSNP:746961193
2801 2801 a, c dbSNP:773131180
2803 2803 a, g dbSNP:374200129
2806 2806 a, g dbSNP:747600132
2807 2807 a, g dbSNP:778546132
2812 2812 c, t dbSNP:754550717
2815 2815 c, g dbSNP:749689033
2816 2816 c, g, t dbSNP:756494145
2819 2819 a, g dbSNP:750947119
2823 2823 c, t dbSNP:768075866
2824 2824 a, g dbSNP:757412572
2827 2827 a, g dbSNP:761057923
2828 2828 c, g, t dbSNP:370493873
2831 2831 c, t dbSNP:752931351
2832 2832 a, g dbSNP:149568178
2837 2837 c, t dbSNP:760506995
2841 2841 a, c dbSNP:768058057
2844 2844 c, g dbSNP:771929646
2847 2847 c, g dbSNP:761348469
2852 2852 g, t dbSNP:773804490
2856 2856 a, g dbSNP:768192969
2870 2870 c, t dbSNP:138189133
2871 2871 a, g dbSNP:779739799
2880 2880 a, g dbSNP:770063857
2882 2882 a, g dbSNP:145698999
2884 2884 -, aagca dbSNP:281865100
2900 2900 c, t dbSNP:781772371
2901 2901 a, g dbSNP:367897224
2909 2909 c, t dbSNP:567467720
2920 2920 a, c dbSNP:558103922
2923 2923 c, t dbSNP:373741660
2929 2929 c, g dbSNP:751436667
2933 2933 a, g dbSNP:773877528
2939 2939 a, g dbSNP:752920923
2942 2942 a, g dbSNP:765442752
2957 2957 a, g dbSNP:199986587
2963 2963 a, t dbSNP:750182459
2964 2964 a, g dbSNP:767468102
2965 2965 a, c dbSNP:761791971
2969 2969 a, g dbSNP:774243369
2991 2991 c, t dbSNP:780124968
3085 3085 a, g dbSNP:561924147
3086 3086 c, g dbSNP:368326097
3093 3093 a, g dbSNP:557703645
3115 3115 g, t dbSNP:550753111
3117 3117 c, t dbSNP:536115151
3146 3146 a, c dbSNP:182700538
3176 3176 a, g dbSNP:763552637
3177 3177 a, g dbSNP:531146121
3212 3212 a, t dbSNP:762469062
3221 3221 a, g dbSNP:568066326
3340 3340 -, c dbSNP:36046278
3341 3341 a, g dbSNP:552928725
3355 3355 -, g dbSNP:773328400
3365 3365 a, g dbSNP:758700168
3381 3381 c, g dbSNP:775062349
3395 3395 c, t dbSNP:76496430
3398 3398 c, t dbSNP:570509591
3411 3411 c, t dbSNP:552113955
3437 3437 c, t dbSNP:745672037
3438 3438 a, g dbSNP:776345185
3446 3446 c, g dbSNP:536866354
3480 3480 a, g dbSNP:565394140
3518 3518 a, g dbSNP:746883110
3536 3536 a, g dbSNP:548085200
3636 3636 c, g dbSNP:777878254
3644 3644 c, t dbSNP:755051224
3645 3645 a, g dbSNP:749384453
3651 3651 c, t dbSNP:529938159
3666 3666 g, t dbSNP:561983395
3668 3668 c, t dbSNP:546959109
3669 3669 a, g dbSNP:190837977
3678 3678 c, g dbSNP:756466974
3687 3687 a, g dbSNP:187297219
3692 3692 a, c dbSNP:762464617
3712 3712 g, t dbSNP:200099628
3718 3718 a, g dbSNP:546286332
3739 3739 a, g dbSNP:746258061
3759 3759 c, t dbSNP:575920373
3780 3780 c, g dbSNP:767814877
3790 3790 c, g dbSNP:143369347
3799 3799 g, t dbSNP:62225811
3801 3801 a, g dbSNP:752453853
3802 3802 c, t dbSNP:200772835
3813 3813 a, t dbSNP:181998459
3822 3822 a, c dbSNP:747584684
3832 3832 -, a dbSNP:779719192
3842 3842 a, t dbSNP:778332651
3854 3854 a, g dbSNP:758423479
3862 3862 c, t dbSNP:770969523
3887 3887 c, t dbSNP:752755928
3891 3891 a, c dbSNP:779035400
3894 3894 g, t dbSNP:755148260
3898 3898 -, ctgaa dbSNP:750142480
3937 3937 a, g dbSNP:752723057
4015 4015 a, t dbSNP:575200307
4107 4107 a, t dbSNP:2157585
4108 4108 -, gt dbSNP:134978
4125 4125 c, t dbSNP:534698074
4127 4127 c, t dbSNP:749313648
4133 4133 -, tgtgtgtgtgtgtgcgcgcgcgcg dbSNP:759852277
4139 4139 -, tgtgtgtgcgcg dbSNP:780541209
4142 4142 -, gtgtgcgcgcgcgc dbSNP:555707534
4143 4143 -, tgtgcgcgcgcgcgcg dbSNP:780251218
4144 4144 -, gtgcgcgcgcgc dbSNP:750870441
4144 4144 -, gtgcgc dbSNP:56832260
4145 4145 -, tgcgcgcgcgcgcg dbSNP:760776804
4145 4145 -, tgcgcgcgcgcg dbSNP:375136975
4145 4145 -, tgcgcgcgcg dbSNP:755364858
4145 4145 c, t dbSNP:7293228
4146 4146 -, gcgcgcgcgc dbSNP:61249065
4147 4147 c, t dbSNP:6147576
4149 4149 c, t dbSNP:56271395
4150 4150 -, gcgcgcgcg dbSNP:751966332
4151 4151 c, t dbSNP:770072939
4153 4153 -, cgcgcgcgcgcg dbSNP:773550229
4153 4153 -, cgcgcgcgcg dbSNP:758987964
4153 4153 -, cgcgcgcg dbSNP:770635497
4155 4155 -, cgcgcgcgcg dbSNP:67796216
4156 4156 -, tgtgcgcgcgcgcg dbSNP:753115022
4159 4159 -, cgcgcg dbSNP:10573454
4168 4168 c, t dbSNP:7291576
4171 4171 a, g dbSNP:534586940
4183 4183 c, g dbSNP:139977960
4194 4194 c, t dbSNP:190614395
4204 4204 c, t dbSNP:767355031
4305 4305 a, t dbSNP:3752590
4382 4382 c, t dbSNP:41277335
4407 4407 c, t dbSNP:775047856
4427 4427 a, g dbSNP:573277089
4446 4446 g, t dbSNP:7292764
4467 4467 a, g dbSNP:565943356
4486 4486 a, g dbSNP:142285409
4495 4495 a, g dbSNP:148725091
4507 4507 a, c dbSNP:117397456
4531 4531 a, c dbSNP:3752589
4593 4593 c, t dbSNP:776454348
4599 4599 a, g dbSNP:41277333
4605 4605 a, g dbSNP:3752588
4608 4608 c, t dbSNP:563911164
4658 4658 a, g dbSNP:542425849

Target ORF information:

RefSeq Version XM_011530485
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu74053D
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1936..>2289(+)
Position Chain Variation Link
28 28 c, g dbSNP:56821996
31 31 g, t dbSNP:547422864
63 63 a, g dbSNP:532089191
71 71 g, t dbSNP:187762406
75 75 c, t dbSNP:184042272
121 121 a, g dbSNP:551554467
125 125 a, g dbSNP:543525170
145 145 a, g dbSNP:532940807
163 163 a, g dbSNP:567406073
170 170 a, c dbSNP:147631281
212 212 c, t dbSNP:550575971
227 227 c, g dbSNP:763625074
229 229 a, t dbSNP:757938034
260 260 a, g dbSNP:529182573
269 269 c, t dbSNP:5761557
312 312 c, t dbSNP:3747134
324 324 c, g dbSNP:572621201
336 336 -, t dbSNP:200535558
380 380 a, g dbSNP:188205202
410 410 a, t dbSNP:545593544
472 472 c, t dbSNP:759331653
494 494 c, t dbSNP:578089748
518 518 c, g, t dbSNP:556695127
519 519 a, c, g dbSNP:187291798
520 520 -, gataccgg dbSNP:766405923
523 523 a, g dbSNP:369803062
554 554 c, g dbSNP:774733114
557 557 a, c dbSNP:768963068
559 559 c, t dbSNP:763357219
573 573 c, t dbSNP:775899708
577 577 a, g dbSNP:570371168
579 579 c, t dbSNP:144622501
584 584 c, g dbSNP:781358501
587 587 a, t dbSNP:142329133
591 591 a, t dbSNP:747194252
592 592 a, g dbSNP:141268657
602 602 c, t dbSNP:778872709
603 603 a, g dbSNP:766139027
605 605 c, g dbSNP:376524160
610 610 a, g dbSNP:745759291
611 611 -, a dbSNP:763190774
615 615 c, t dbSNP:781088233
621 621 -, t dbSNP:281865097
631 631 a, g dbSNP:756803307
642 642 a, g dbSNP:751062699
645 645 a, g dbSNP:763708665
654 654 c, t dbSNP:758006943
655 655 a, g dbSNP:369457259
658 658 -, gatc dbSNP:775635197
659 659 c, t dbSNP:753004509
661 661 a, g dbSNP:765596627
663 663 a, g dbSNP:759982764
668 668 c, t dbSNP:777324808
672 672 c, t dbSNP:146176609
681 681 c, t dbSNP:760897880
686 686 a, g dbSNP:773369379
687 687 c, t dbSNP:754498322
694 694 -, c dbSNP:765434275
695 695 a, c dbSNP:201485111
701 701 c, t dbSNP:35080023
707 707 a, g dbSNP:143189294
712 712 c, t dbSNP:372020804
714 714 a, g dbSNP:577190408
727 727 a, g dbSNP:759382209
731 731 a, g dbSNP:367800640
734 734 c, t dbSNP:770856288
748 748 c, t dbSNP:149126501
749 749 a, g dbSNP:777170572
754 754 a, g dbSNP:147680141
765 765 a, t dbSNP:747578415
770 770 a, g dbSNP:778692469
778 778 c, g, t dbSNP:374775503
783 783 g, t dbSNP:372865887
785 785 g, t dbSNP:147060589
790 790 c, t dbSNP:141684342
791 791 a, g dbSNP:756712181
793 793 a, c dbSNP:200308529
801 801 a, g dbSNP:767883055
814 814 a, g dbSNP:149830675
815 815 a, t dbSNP:560418283
820 820 a, g dbSNP:764311091
821 821 g, t dbSNP:763091759
826 826 a, g dbSNP:776438458
830 830 a, t dbSNP:551412746
832 832 a, t dbSNP:760440998
841 841 c, g dbSNP:530485818
847 847 a, g, t dbSNP:563251161
861 861 a, c, g dbSNP:748780405
865 865 c, t dbSNP:775352863
874 874 a, g dbSNP:376221426
875 875 c, g dbSNP:746260835
877 877 a, t dbSNP:781343333
879 879 c, t dbSNP:541941563
880 880 a, c dbSNP:149817614
883 883 c, t dbSNP:778229695
884 884 a, g, t dbSNP:138885334
901 901 a, g dbSNP:765499989
907 907 g, t dbSNP:755089668
920 920 a, g dbSNP:750265224
921 921 c, g dbSNP:767168755
922 922 a, c dbSNP:529743443
934 934 g, t dbSNP:774473329
937 937 -, c dbSNP:772812827
937 937 c, g dbSNP:180729981
939 939 a, g dbSNP:762612733
941 941 c, t dbSNP:775086150
945 945 c, t dbSNP:769488831
946 946 c, g dbSNP:745468335
952 952 c, t dbSNP:373900001
963 963 a, g dbSNP:201880600
967 967 c, t dbSNP:773505923
974 974 c, t dbSNP:150403254
975 975 a, g dbSNP:375462083
976 976 g, t dbSNP:119471024
991 991 a, g dbSNP:754216377
993 993 c, t dbSNP:151105857
994 994 a, g dbSNP:749385689
996 996 a, g dbSNP:529798826
1001 1001 c, t dbSNP:549798245
1009 1009 a, g dbSNP:140430822
1012 1012 a, g dbSNP:777668009
1013 1013 c, t dbSNP:758429460
1015 1015 a, c dbSNP:752726222
1021 1021 c, g dbSNP:765185989
1023 1023 a, g dbSNP:766805523
1025 1025 a, g dbSNP:281865098
1027 1027 a, g dbSNP:759034002
1033 1033 c, t dbSNP:753375046
1040 1040 c, t dbSNP:765958976
1045 1045 g, t dbSNP:760252953
1060 1060 a, g dbSNP:773589703
1101 1101 a, g dbSNP:146620511
1109 1109 g, t dbSNP:577410969
1111 1111 c, g dbSNP:756620904
1143 1143 a, g dbSNP:750932384
1146 1146 a, g dbSNP:754902386
1149 1149 c, g dbSNP:749296930
1150 1150 c, t dbSNP:139808091
1153 1153 c, t dbSNP:755689459
1175 1175 a, g, t dbSNP:377042228
1179 1179 g, t dbSNP:767173486
1182 1182 a, g dbSNP:756838292
1183 1183 a, c, t dbSNP:119471022
1185 1185 g, t dbSNP:200254797
1195 1195 c, t dbSNP:369104384
1196 1196 a, g dbSNP:111522254
1197 1197 c, t dbSNP:763201953
1199 1199 c, t dbSNP:61729175
1200 1200 a, g dbSNP:13054747
1205 1205 a, g dbSNP:201383753
1212 1212 c, t dbSNP:201820144
1215 1215 g, t dbSNP:771282968
1218 1218 a, c dbSNP:760910732
1224 1224 c, t dbSNP:773284328
1235 1235 a, g dbSNP:199965734
1244 1244 c, t dbSNP:562804736
1251 1251 c, g dbSNP:770511759
1259 1259 c, t dbSNP:746492833
1260 1260 a, g dbSNP:139165558
1265 1265 c, t dbSNP:2331251
1267 1267 c, g dbSNP:757926741
1269 1269 c, t dbSNP:753114322
1272 1272 c, t dbSNP:778366926
1277 1277 a, c dbSNP:779379945
1278 1278 a, g, t dbSNP:202091945
1279 1279 a, g dbSNP:766791829
1284 1284 c, g dbSNP:760867986
1286 1286 c, t dbSNP:750412869
1291 1291 c, t dbSNP:119471023
1292 1292 a, g dbSNP:146217183
1295 1295 c, t dbSNP:775289919
1300 1300 c, t dbSNP:765070016
1301 1301 c, t dbSNP:759292339
1306 1306 g, t dbSNP:119471025
1309 1309 c, g dbSNP:548442727
1315 1315 c, t dbSNP:756670349
1316 1316 a, t dbSNP:746415096
1321 1321 a, g dbSNP:781705717
1322 1322 c, t dbSNP:201806802
1323 1323 a, g dbSNP:751621468
1328 1328 a, g dbSNP:713998
1329 1329 a, g dbSNP:758547221
1337 1337 c, t dbSNP:751553768
1338 1338 a, g dbSNP:3747132
1346 1346 a, g dbSNP:150166679
1352 1352 a, g dbSNP:144912961
1362 1362 a, g dbSNP:775075683
1363 1363 c, t dbSNP:769470411
1367 1367 a, g dbSNP:759828449
1376 1376 a, g dbSNP:776910756
1378 1378 c, t dbSNP:3747129
1379 1379 a, g dbSNP:747463385
1384 1384 a, t dbSNP:778229498
1388 1388 a, c dbSNP:772178736
1395 1395 c, t dbSNP:748255618
1402 1402 a, g dbSNP:779017015
1406 1406 c, t dbSNP:77597168
1408 1408 a, g dbSNP:773773876
1410 1410 a, g dbSNP:772573640
1413 1413 a, g dbSNP:377665379
1418 1418 c, t dbSNP:748181375
1419 1419 a, g, t dbSNP:199745804
1423 1423 a, g dbSNP:749572804
1427 1427 a, g dbSNP:374044351
1436 1436 -, ct dbSNP:759733648
1437 1437 a, c, t dbSNP:35126034
1444 1444 a, g dbSNP:777862145
1447 1447 a, t dbSNP:34962745
1450 1450 a, t dbSNP:752176820
1451 1451 a, g dbSNP:141567957
1462 1462 a, g dbSNP:754422079
1465 1465 a, g dbSNP:753527423
1466 1466 a, g dbSNP:766017410
1468 1468 c, g dbSNP:761086802
1473 1473 c, t dbSNP:369227380
1474 1474 a, g dbSNP:767940026
1482 1482 a, g dbSNP:762331694
1483 1483 a, g, t dbSNP:768818454
1488 1488 a, g dbSNP:749372122
1491 1491 a, g dbSNP:200529828
1492 1492 a, g dbSNP:201290613
1495 1495 a, g dbSNP:746808353
1498 1498 a, g dbSNP:565394870
1502 1502 a, c dbSNP:747892556
1509 1509 a, g dbSNP:778968440
1513 1513 c, g dbSNP:768523581
1529 1529 a, t dbSNP:374205780
1530 1530 a, t dbSNP:139107954
1532 1532 a, g dbSNP:143294921
1535 1535 c, t dbSNP:369777121
1536 1536 a, c dbSNP:750128189
1547 1547 a, g dbSNP:780700906
1552 1552 a, g dbSNP:371311675
1556 1556 c, g dbSNP:571151621
1557 1557 c, t dbSNP:764663345
1559 1559 a, g dbSNP:763518309
1560 1560 a, g dbSNP:752850564
1564 1564 a, c dbSNP:765459737
1581 1581 a, g dbSNP:759660620
1584 1584 c, t dbSNP:138343171
1585 1585 a, g dbSNP:375477724
1590 1590 a, c, t dbSNP:773950609
1593 1593 c, t dbSNP:145373966
1599 1599 a, g dbSNP:749271201
1607 1607 c, t dbSNP:377695917
1609 1609 g, t dbSNP:769357720
1617 1617 a, c dbSNP:745353489
1618 1618 a, g dbSNP:150057646
1624 1624 c, g dbSNP:756788652
1627 1627 a, c dbSNP:140732502
1634 1634 a, c dbSNP:778237328
1635 1635 c, t dbSNP:375673570
1637 1637 c, g dbSNP:753298603
1641 1641 c, g, t dbSNP:146884025
1642 1642 a, g dbSNP:202197120
1645 1645 g, t dbSNP:753803734
1651 1651 c, t dbSNP:766628788
1652 1652 c, t dbSNP:371109134
1654 1654 c, g dbSNP:143965829
1665 1665 a, g dbSNP:773460422
1668 1668 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1671 1671 c, t dbSNP:763915803
1672 1672 a, g dbSNP:377326385
1680 1680 c, g dbSNP:548311034
1689 1689 c, t dbSNP:769658980
1690 1690 g, t dbSNP:745384564
1692 1692 c, t dbSNP:775959392
1693 1693 c, g dbSNP:770642869
1707 1707 a, g dbSNP:746693127
1710 1710 c, t dbSNP:188300485
1711 1711 g, t dbSNP:758902895
1712 1712 c, g dbSNP:748512719
1732 1732 a, g dbSNP:372970834
1736 1736 a, g, t dbSNP:113242819
1737 1737 a, t dbSNP:753983512
1753 1753 a, g dbSNP:766419128
1754 1754 c, g, t dbSNP:759075680
1756 1756 ag, tc dbSNP:386820399
1756 1756 a, t dbSNP:114685298
1757 1757 c, g dbSNP:116769827
1760 1760 c, t dbSNP:775195314
1764 1764 g, t dbSNP:765186595
1773 1773 -, a dbSNP:772691909
1779 1779 c, g dbSNP:532646940
1780 1780 c, t dbSNP:776612681
1788 1788 a, g dbSNP:369393785
1792 1792 -, gaa dbSNP:761480950
1797 1797 c, t dbSNP:765478898
1798 1798 a, g dbSNP:376253108
1804 1804 c, t dbSNP:771794197
1807 1807 a, g dbSNP:377095634
1811 1811 c, t dbSNP:372828090
1812 1812 c, t dbSNP:769041433
1814 1814 a, g dbSNP:749799140
1820 1820 c, g dbSNP:558884663
1828 1828 c, g, t dbSNP:369053765
1830 1830 a, c, g dbSNP:757426392
1834 1834 a, g dbSNP:752507059
1836 1836 a, g dbSNP:764993355
1838 1838 a, c dbSNP:759348602
1843 1843 g, t dbSNP:753787422
1844 1844 a, c dbSNP:766330282
1846 1846 c, t dbSNP:760276585
1855 1855 a, t dbSNP:200477299
1861 1861 a, t dbSNP:772783723
1873 1873 c, t dbSNP:375526010
1876 1876 a, g dbSNP:142139781
1879 1879 c, g dbSNP:774114985
1888 1888 a, c dbSNP:375655372
1893 1893 a, t dbSNP:373523675
1894 1894 c, g dbSNP:780435239
1898 1898 a, t dbSNP:770266719
1906 1906 a, g dbSNP:148662419
1908 1908 a, t dbSNP:781196776
1914 1914 c, g, t dbSNP:751823743
1917 1917 c, t dbSNP:144077166
1918 1918 a, g dbSNP:143711674
1922 1922 c, t dbSNP:753613070
1927 1927 a, g dbSNP:766233510
1928 1928 a, g dbSNP:201043011
1930 1930 c, g dbSNP:749976459
1933 1933 a, g dbSNP:370007632
1936 1936 a, c dbSNP:761403871
1940 1940 c, t dbSNP:773931864
1941 1941 a, g dbSNP:763743681
1948 1948 a, g dbSNP:763228182
1956 1956 a, g dbSNP:775881151
1957 1957 c, g dbSNP:770221086
1963 1963 a, g dbSNP:746418898
1965 1965 c, t dbSNP:746818979
1966 1966 a, c dbSNP:777094703
1972 1972 a, c dbSNP:777491163
1973 1973 a, g dbSNP:747080557
1978 1978 c, g dbSNP:777875261
1985 1985 a, c dbSNP:758581869
1988 1988 c, t dbSNP:372499859
1991 1991 a, c dbSNP:779849991
1992 1992 a, g dbSNP:755952793
2003 2003 a, g dbSNP:117114544
2009 2009 a, g dbSNP:750452419
2012 2012 c, t dbSNP:767548244
2016 2016 a, g dbSNP:756839100
2021 2021 a, t dbSNP:751013277
2023 2023 c, g dbSNP:2014410
2025 2025 c, t dbSNP:762613783
2026 2026 a, g dbSNP:774979651
2029 2029 a, g dbSNP:765633123
2047 2047 -, agc dbSNP:768468362
2052 2052 a, c dbSNP:748136926
2056 2056 a, c, t dbSNP:186173240
2066 2066 c, g dbSNP:375587915
2074 2074 a, c dbSNP:773303744
2079 2079 a, c dbSNP:772205948
2081 2081 a, c dbSNP:754066787
2083 2083 a, g dbSNP:778998363
2090 2090 a, c dbSNP:756030696
2091 2091 c, g dbSNP:372027593
2092 2092 c, t dbSNP:147435410
2093 2093 a, g dbSNP:142958812
2095 2095 a, c dbSNP:751051493
2098 2098 a, c dbSNP:763704933
2099 2099 c, g dbSNP:757812079
2107 2107 c, t dbSNP:549290787
2110 2110 c, t dbSNP:764860798
2113 2113 c, t dbSNP:759909785
2114 2114 a, g dbSNP:139039617
2138 2138 a, g dbSNP:766903925
2139 2139 a, c dbSNP:761197874
2146 2146 c, t dbSNP:773570398
2150 2150 c, t dbSNP:772234990
2151 2151 a, g dbSNP:756215705
2160 2160 a, c dbSNP:774728501
2161 2161 c, g dbSNP:768931718
2163 2163 c, t dbSNP:745687268
2168 2168 a, g dbSNP:781082499
2174 2174 a, g dbSNP:770823084
2175 2175 a, c, t dbSNP:777570870
2176 2176 a, g dbSNP:757988379
2178 2178 c, t dbSNP:752092814
2183 2183 g, t dbSNP:11545917
2184 2184 a, g dbSNP:778544549
2189 2189 a, g, t dbSNP:754224646
2198 2198 a, g dbSNP:766781092
2199 2199 a, c, t dbSNP:534067573
2200 2200 a, g dbSNP:767852159
2205 2205 a, c dbSNP:761956374
2207 2207 c, g dbSNP:774532334
2210 2210 a, g dbSNP:769017976
2216 2216 a, g dbSNP:763311479
2220 2220 c, t dbSNP:775820827
2223 2223 g, t dbSNP:770822747
2229 2229 a, c dbSNP:367810755
2231 2231 c, g, t dbSNP:150216540
2232 2232 a, t dbSNP:141008676
2234 2234 c, t dbSNP:778346173
2235 2235 a, g dbSNP:754462097
2239 2239 c, t dbSNP:148134252
2242 2242 c, t dbSNP:372833027
2250 2250 c, t dbSNP:756512740
2252 2252 g, t dbSNP:750685060
2253 2253 c, t dbSNP:768100817
2267 2267 c, g dbSNP:143747386
2277 2277 c, t dbSNP:200667267
2280 2280 a, g dbSNP:752086428
2282 2282 c, t dbSNP:764305334
2287 2287 c, t dbSNP:763117738
2292 2292 a, g dbSNP:775916508
2293 2293 a, g dbSNP:765322078
2298 2298 c, t dbSNP:760527580
2300 2300 c, g dbSNP:772846606
2302 2302 a, g dbSNP:772069598
2310 2310 c, t dbSNP:748133574
2311 2311 g, t dbSNP:116241923
2317 2317 a, g dbSNP:202104505
2321 2321 a, g dbSNP:748736760
2329 2329 a, g dbSNP:367888424
2332 2332 c, g dbSNP:751938775
2333 2333 a, g dbSNP:532246881
2336 2336 c, g dbSNP:145674158
2337 2337 c, t dbSNP:199740072
2338 2338 a, g dbSNP:182592572
2346 2346 a, g dbSNP:781455905
2350 2350 a, c, g dbSNP:5752330
2355 2355 a, g dbSNP:540157835
2362 2362 c, t dbSNP:758568345
2375 2375 c, t dbSNP:143902143
2376 2376 a, g dbSNP:527653764
2388 2388 c, t dbSNP:759632995
2390 2390 g, t dbSNP:561308139
2391 2391 c, t dbSNP:767256800
2392 2392 a, c, g dbSNP:774331295
2394 2394 a, c dbSNP:768513194
2396 2396 c, t dbSNP:140234219
2399 2399 c, t dbSNP:774813995
2403 2403 a, g dbSNP:769325136
2406 2406 a, g dbSNP:745543124
2407 2407 c, g dbSNP:780889236
2423 2423 c, t dbSNP:747411315
2425 2425 c, g dbSNP:778239048
2427 2427 c, t dbSNP:772546709
2430 2430 a, g dbSNP:748643364
2435 2435 -, a dbSNP:779927531
2435 2435 a, g dbSNP:779471156
2438 2438 a, g dbSNP:755073092
2443 2443 a, g dbSNP:145481980
2448 2448 c, t dbSNP:780284817
2452 2452 c, t dbSNP:756278524
2455 2455 a, g dbSNP:750621357
2462 2462 c, t dbSNP:763915972
2463 2463 a, g dbSNP:541601069
2465 2465 c, t dbSNP:371342669
2474 2474 a, t dbSNP:765161412
2481 2481 a, g dbSNP:758970516
2483 2483 c, t dbSNP:776169421
2484 2484 c, g dbSNP:770733264
2489 2489 c, t dbSNP:149689335
2492 2492 a, g dbSNP:565596162
2498 2498 a, c dbSNP:772632659
2504 2504 a, g dbSNP:748533902
2507 2507 g, t dbSNP:779303648
2510 2510 c, t dbSNP:368334509
2511 2511 a, g dbSNP:749347544
2512 2512 c, t dbSNP:1894706
2514 2514 -, c dbSNP:769405747
2516 2516 -, a dbSNP:745665820
2517 2517 c, t dbSNP:756155749
2521 2521 c, t dbSNP:746151193
2522 2522 a, g dbSNP:781375770
2532 2532 c, g dbSNP:758138934
2533 2533 c, t dbSNP:752467533
2537 2537 g, t dbSNP:765121677
2546 2546 a, c dbSNP:749888433
2552 2552 c, t dbSNP:374238081
2553 2553 a, g dbSNP:373421312
2557 2557 a, g dbSNP:773844011
2562 2562 -, c dbSNP:281865099
2567 2567 a, c, t dbSNP:560591308
2568 2568 a, g dbSNP:775986716
2571 2571 g, t dbSNP:1894704
2575 2575 c, t dbSNP:759641785
2576 2576 a, g dbSNP:776644648
2578 2578 c, t dbSNP:770895794
2579 2579 a, g dbSNP:78892693
2581 2581 c, t dbSNP:553852142
2584 2584 c, t dbSNP:139675793
2585 2585 g, t dbSNP:749034221
2586 2586 c, g, t dbSNP:201385335
2587 2587 c, t dbSNP:119471021
2591 2591 a, c dbSNP:750362522
2592 2592 c, t dbSNP:370795890
2593 2593 a, c, g dbSNP:202222123
2595 2595 c, t dbSNP:35993959
2598 2598 c, t dbSNP:553114134
2601 2601 g, t dbSNP:763308032
2605 2605 c, t dbSNP:753017691
2606 2606 a, g dbSNP:745559996
2610 2610 c, t dbSNP:765753447
2614 2614 c, t dbSNP:760087525
2618 2618 c, t dbSNP:776976418
2619 2619 c, g dbSNP:377050180
2627 2627 c, g dbSNP:373905924
2629 2629 a, g, t dbSNP:538187229
2630 2630 c, t dbSNP:749128912
2631 2631 a, g, t dbSNP:769678704
2637 2637 c, t dbSNP:745866776
2641 2641 a, g dbSNP:780978556
2643 2643 a, g dbSNP:146303784
2646 2646 g, t dbSNP:750963690
2650 2650 a, g dbSNP:777509970
2655 2655 c, t dbSNP:202120615
2656 2656 a, g dbSNP:201206642
2658 2658 c, t dbSNP:9625029
2662 2662 a, t dbSNP:148294572
2663 2663 -, ac dbSNP:752827715
2663 2663 c, t dbSNP:767769111
2664 2664 a, g dbSNP:761967529
2673 2673 c, t dbSNP:144248515
2674 2674 a, g dbSNP:530118832
2676 2676 c, t dbSNP:764344335
2683 2683 a, c dbSNP:759405900
2684 2684 a, g dbSNP:776239550
2696 2696 a, g dbSNP:368602340
2700 2700 a, g dbSNP:746961193
2706 2706 a, c dbSNP:773131180
2708 2708 a, g dbSNP:374200129
2711 2711 a, g dbSNP:747600132
2712 2712 a, g dbSNP:778546132
2717 2717 c, t dbSNP:754550717
2720 2720 c, g dbSNP:749689033
2721 2721 c, g, t dbSNP:756494145
2724 2724 a, g dbSNP:750947119
2728 2728 c, t dbSNP:768075866
2729 2729 a, g dbSNP:757412572
2732 2732 a, g dbSNP:761057923
2733 2733 c, g, t dbSNP:370493873
2736 2736 c, t dbSNP:752931351
2737 2737 a, g dbSNP:149568178
2742 2742 c, t dbSNP:760506995
2746 2746 a, c dbSNP:768058057
2749 2749 c, g dbSNP:771929646
2752 2752 c, g dbSNP:761348469
2757 2757 g, t dbSNP:773804490
2761 2761 a, g dbSNP:768192969
2775 2775 c, t dbSNP:138189133
2776 2776 a, g dbSNP:779739799
2785 2785 a, g dbSNP:770063857
2787 2787 a, g dbSNP:145698999
2789 2789 -, aagca dbSNP:281865100
2805 2805 c, t dbSNP:781772371
2806 2806 a, g dbSNP:367897224
2814 2814 c, t dbSNP:567467720
2825 2825 a, c dbSNP:558103922
2828 2828 c, t dbSNP:373741660
2834 2834 c, g dbSNP:751436667
2838 2838 a, g dbSNP:773877528
2844 2844 a, g dbSNP:752920923
2847 2847 a, g dbSNP:765442752
2862 2862 a, g dbSNP:199986587
2868 2868 a, t dbSNP:750182459
2869 2869 a, g dbSNP:767468102
2870 2870 a, c dbSNP:761791971
2874 2874 a, g dbSNP:774243369
2896 2896 c, t dbSNP:780124968
2990 2990 a, g dbSNP:561924147
2991 2991 c, g dbSNP:368326097
2998 2998 a, g dbSNP:557703645
3020 3020 g, t dbSNP:550753111
3022 3022 c, t dbSNP:536115151
3051 3051 a, c dbSNP:182700538
3081 3081 a, g dbSNP:763552637
3082 3082 a, g dbSNP:531146121
3117 3117 a, t dbSNP:762469062
3126 3126 a, g dbSNP:568066326
3245 3245 -, c dbSNP:36046278
3246 3246 a, g dbSNP:552928725
3260 3260 -, g dbSNP:773328400
3270 3270 a, g dbSNP:758700168
3286 3286 c, g dbSNP:775062349
3300 3300 c, t dbSNP:76496430
3303 3303 c, t dbSNP:570509591
3316 3316 c, t dbSNP:552113955
3342 3342 c, t dbSNP:745672037
3343 3343 a, g dbSNP:776345185
3351 3351 c, g dbSNP:536866354
3385 3385 a, g dbSNP:565394140
3423 3423 a, g dbSNP:746883110
3441 3441 a, g dbSNP:548085200
3541 3541 c, g dbSNP:777878254
3549 3549 c, t dbSNP:755051224
3550 3550 a, g dbSNP:749384453
3556 3556 c, t dbSNP:529938159
3571 3571 g, t dbSNP:561983395
3573 3573 c, t dbSNP:546959109
3574 3574 a, g dbSNP:190837977
3583 3583 c, g dbSNP:756466974
3592 3592 a, g dbSNP:187297219
3597 3597 a, c dbSNP:762464617
3617 3617 g, t dbSNP:200099628
3623 3623 a, g dbSNP:546286332
3644 3644 a, g dbSNP:746258061
3664 3664 c, t dbSNP:575920373
3685 3685 c, g dbSNP:767814877
3695 3695 c, g dbSNP:143369347
3704 3704 g, t dbSNP:62225811
3706 3706 a, g dbSNP:752453853
3707 3707 c, t dbSNP:200772835
3718 3718 a, t dbSNP:181998459
3727 3727 a, c dbSNP:747584684
3737 3737 -, a dbSNP:779719192
3747 3747 a, t dbSNP:778332651
3759 3759 a, g dbSNP:758423479
3767 3767 c, t dbSNP:770969523
3792 3792 c, t dbSNP:752755928
3796 3796 a, c dbSNP:779035400
3799 3799 g, t dbSNP:755148260
3803 3803 -, ctgaa dbSNP:750142480
3842 3842 a, g dbSNP:752723057
3920 3920 a, t dbSNP:575200307
4012 4012 a, t dbSNP:2157585
4013 4013 -, gt dbSNP:134978
4030 4030 c, t dbSNP:534698074
4032 4032 c, t dbSNP:749313648
4038 4038 -, tgtgtgtgtgtgtgcgcgcgcgcg dbSNP:759852277
4044 4044 -, tgtgtgtgcgcg dbSNP:780541209
4047 4047 -, gtgtgcgcgcgcgc dbSNP:555707534
4048 4048 -, tgtgcgcgcgcgcgcg dbSNP:780251218
4049 4049 -, gtgcgcgcgcgc dbSNP:750870441
4049 4049 -, gtgcgc dbSNP:56832260
4050 4050 -, tgcgcgcgcgcgcg dbSNP:760776804
4050 4050 -, tgcgcgcgcgcg dbSNP:375136975
4050 4050 -, tgcgcgcgcg dbSNP:755364858
4050 4050 c, t dbSNP:7293228
4051 4051 -, gcgcgcgcgc dbSNP:61249065
4052 4052 c, t dbSNP:6147576
4054 4054 c, t dbSNP:56271395
4055 4055 -, gcgcgcgcg dbSNP:751966332
4056 4056 c, t dbSNP:770072939
4058 4058 -, cgcgcgcgcgcg dbSNP:773550229
4058 4058 -, cgcgcgcgcg dbSNP:758987964
4058 4058 -, cgcgcgcg dbSNP:770635497
4060 4060 -, cgcgcgcgcg dbSNP:67796216
4061 4061 -, tgtgcgcgcgcgcg dbSNP:753115022
4064 4064 -, cgcgcg dbSNP:10573454
4073 4073 c, t dbSNP:7291576
4076 4076 a, g dbSNP:534586940
4088 4088 c, g dbSNP:139977960
4099 4099 c, t dbSNP:190614395
4109 4109 c, t dbSNP:767355031
4210 4210 a, t dbSNP:3752590
4287 4287 c, t dbSNP:41277335
4312 4312 c, t dbSNP:775047856
4332 4332 a, g dbSNP:573277089
4351 4351 g, t dbSNP:7292764
4372 4372 a, g dbSNP:565943356
4391 4391 a, g dbSNP:142285409
4400 4400 a, g dbSNP:148725091
4412 4412 a, c dbSNP:117397456
4436 4436 a, c dbSNP:3752589
4498 4498 c, t dbSNP:776454348
4504 4504 a, g dbSNP:41277333
4510 4510 a, g dbSNP:3752588
4513 4513 c, t dbSNP:563911164
4563 4563 a, g dbSNP:542425849

Target ORF information:

RefSeq Version XM_011530486
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu74053D
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)2141..>2494(+)
Position Chain Variation Link
14 14 c, g dbSNP:56821996
17 17 g, t dbSNP:547422864
49 49 a, g dbSNP:532089191
57 57 g, t dbSNP:187762406
61 61 c, t dbSNP:184042272
76 76 c, g dbSNP:531283049
81 81 c, t dbSNP:560781291
88 88 c, t dbSNP:115916720
112 112 a, g dbSNP:3747137
152 152 c, g dbSNP:553609699
165 165 a, g dbSNP:776574588
167 167 a, g dbSNP:543806596
183 183 a, g dbSNP:572753435
197 197 a, g dbSNP:375890803
200 200 a, c dbSNP:746979158
211 211 a, g dbSNP:561393009
238 238 a, g dbSNP:774468555
243 243 a, g dbSNP:553004302
326 326 a, g dbSNP:551554467
330 330 a, g dbSNP:543525170
350 350 a, g dbSNP:532940807
368 368 a, g dbSNP:567406073
375 375 a, c dbSNP:147631281
417 417 c, t dbSNP:550575971
432 432 c, g dbSNP:763625074
434 434 a, t dbSNP:757938034
465 465 a, g dbSNP:529182573
474 474 c, t dbSNP:5761557
517 517 c, t dbSNP:3747134
529 529 c, g dbSNP:572621201
541 541 -, t dbSNP:200535558
585 585 a, g dbSNP:188205202
615 615 a, t dbSNP:545593544
677 677 c, t dbSNP:759331653
699 699 c, t dbSNP:578089748
723 723 c, g, t dbSNP:556695127
724 724 a, c, g dbSNP:187291798
725 725 -, gataccgg dbSNP:766405923
728 728 a, g dbSNP:369803062
759 759 c, g dbSNP:774733114
762 762 a, c dbSNP:768963068
764 764 c, t dbSNP:763357219
778 778 c, t dbSNP:775899708
782 782 a, g dbSNP:570371168
784 784 c, t dbSNP:144622501
789 789 c, g dbSNP:781358501
792 792 a, t dbSNP:142329133
796 796 a, t dbSNP:747194252
797 797 a, g dbSNP:141268657
807 807 c, t dbSNP:778872709
808 808 a, g dbSNP:766139027
810 810 c, g dbSNP:376524160
815 815 a, g dbSNP:745759291
816 816 -, a dbSNP:763190774
820 820 c, t dbSNP:781088233
826 826 -, t dbSNP:281865097
836 836 a, g dbSNP:756803307
847 847 a, g dbSNP:751062699
850 850 a, g dbSNP:763708665
859 859 c, t dbSNP:758006943
860 860 a, g dbSNP:369457259
863 863 -, gatc dbSNP:775635197
864 864 c, t dbSNP:753004509
866 866 a, g dbSNP:765596627
868 868 a, g dbSNP:759982764
873 873 c, t dbSNP:777324808
877 877 c, t dbSNP:146176609
886 886 c, t dbSNP:760897880
891 891 a, g dbSNP:773369379
892 892 c, t dbSNP:754498322
899 899 -, c dbSNP:765434275
900 900 a, c dbSNP:201485111
906 906 c, t dbSNP:35080023
912 912 a, g dbSNP:143189294
917 917 c, t dbSNP:372020804
919 919 a, g dbSNP:577190408
932 932 a, g dbSNP:759382209
936 936 a, g dbSNP:367800640
939 939 c, t dbSNP:770856288
953 953 c, t dbSNP:149126501
954 954 a, g dbSNP:777170572
959 959 a, g dbSNP:147680141
970 970 a, t dbSNP:747578415
975 975 a, g dbSNP:778692469
983 983 c, g, t dbSNP:374775503
988 988 g, t dbSNP:372865887
990 990 g, t dbSNP:147060589
995 995 c, t dbSNP:141684342
996 996 a, g dbSNP:756712181
998 998 a, c dbSNP:200308529
1006 1006 a, g dbSNP:767883055
1019 1019 a, g dbSNP:149830675
1020 1020 a, t dbSNP:560418283
1025 1025 a, g dbSNP:764311091
1026 1026 g, t dbSNP:763091759
1031 1031 a, g dbSNP:776438458
1035 1035 a, t dbSNP:551412746
1037 1037 a, t dbSNP:760440998
1046 1046 c, g dbSNP:530485818
1052 1052 a, g, t dbSNP:563251161
1066 1066 a, c, g dbSNP:748780405
1070 1070 c, t dbSNP:775352863
1079 1079 a, g dbSNP:376221426
1080 1080 c, g dbSNP:746260835
1082 1082 a, t dbSNP:781343333
1084 1084 c, t dbSNP:541941563
1085 1085 a, c dbSNP:149817614
1088 1088 c, t dbSNP:778229695
1089 1089 a, g, t dbSNP:138885334
1106 1106 a, g dbSNP:765499989
1112 1112 g, t dbSNP:755089668
1125 1125 a, g dbSNP:750265224
1126 1126 c, g dbSNP:767168755
1127 1127 a, c dbSNP:529743443
1139 1139 g, t dbSNP:774473329
1142 1142 -, c dbSNP:772812827
1142 1142 c, g dbSNP:180729981
1144 1144 a, g dbSNP:762612733
1146 1146 c, t dbSNP:775086150
1150 1150 c, t dbSNP:769488831
1151 1151 c, g dbSNP:745468335
1157 1157 c, t dbSNP:373900001
1168 1168 a, g dbSNP:201880600
1172 1172 c, t dbSNP:773505923
1179 1179 c, t dbSNP:150403254
1180 1180 a, g dbSNP:375462083
1181 1181 g, t dbSNP:119471024
1196 1196 a, g dbSNP:754216377
1198 1198 c, t dbSNP:151105857
1199 1199 a, g dbSNP:749385689
1201 1201 a, g dbSNP:529798826
1206 1206 c, t dbSNP:549798245
1214 1214 a, g dbSNP:140430822
1217 1217 a, g dbSNP:777668009
1218 1218 c, t dbSNP:758429460
1220 1220 a, c dbSNP:752726222
1226 1226 c, g dbSNP:765185989
1228 1228 a, g dbSNP:766805523
1230 1230 a, g dbSNP:281865098
1232 1232 a, g dbSNP:759034002
1238 1238 c, t dbSNP:753375046
1245 1245 c, t dbSNP:765958976
1250 1250 g, t dbSNP:760252953
1265 1265 a, g dbSNP:773589703
1306 1306 a, g dbSNP:146620511
1314 1314 g, t dbSNP:577410969
1316 1316 c, g dbSNP:756620904
1348 1348 a, g dbSNP:750932384
1351 1351 a, g dbSNP:754902386
1354 1354 c, g dbSNP:749296930
1355 1355 c, t dbSNP:139808091
1358 1358 c, t dbSNP:755689459
1380 1380 a, g, t dbSNP:377042228
1384 1384 g, t dbSNP:767173486
1387 1387 a, g dbSNP:756838292
1388 1388 a, c, t dbSNP:119471022
1390 1390 g, t dbSNP:200254797
1400 1400 c, t dbSNP:369104384
1401 1401 a, g dbSNP:111522254
1402 1402 c, t dbSNP:763201953
1404 1404 c, t dbSNP:61729175
1405 1405 a, g dbSNP:13054747
1410 1410 a, g dbSNP:201383753
1417 1417 c, t dbSNP:201820144
1420 1420 g, t dbSNP:771282968
1423 1423 a, c dbSNP:760910732
1429 1429 c, t dbSNP:773284328
1440 1440 a, g dbSNP:199965734
1449 1449 c, t dbSNP:562804736
1456 1456 c, g dbSNP:770511759
1464 1464 c, t dbSNP:746492833
1465 1465 a, g dbSNP:139165558
1470 1470 c, t dbSNP:2331251
1472 1472 c, g dbSNP:757926741
1474 1474 c, t dbSNP:753114322
1477 1477 c, t dbSNP:778366926
1482 1482 a, c dbSNP:779379945
1483 1483 a, g, t dbSNP:202091945
1484 1484 a, g dbSNP:766791829
1489 1489 c, g dbSNP:760867986
1491 1491 c, t dbSNP:750412869
1496 1496 c, t dbSNP:119471023
1497 1497 a, g dbSNP:146217183
1500 1500 c, t dbSNP:775289919
1505 1505 c, t dbSNP:765070016
1506 1506 c, t dbSNP:759292339
1511 1511 g, t dbSNP:119471025
1514 1514 c, g dbSNP:548442727
1520 1520 c, t dbSNP:756670349
1521 1521 a, t dbSNP:746415096
1526 1526 a, g dbSNP:781705717
1527 1527 c, t dbSNP:201806802
1528 1528 a, g dbSNP:751621468
1533 1533 a, g dbSNP:713998
1534 1534 a, g dbSNP:758547221
1542 1542 c, t dbSNP:751553768
1543 1543 a, g dbSNP:3747132
1551 1551 a, g dbSNP:150166679
1557 1557 a, g dbSNP:144912961
1567 1567 a, g dbSNP:775075683
1568 1568 c, t dbSNP:769470411
1572 1572 a, g dbSNP:759828449
1581 1581 a, g dbSNP:776910756
1583 1583 c, t dbSNP:3747129
1584 1584 a, g dbSNP:747463385
1589 1589 a, t dbSNP:778229498
1593 1593 a, c dbSNP:772178736
1600 1600 c, t dbSNP:748255618
1607 1607 a, g dbSNP:779017015
1611 1611 c, t dbSNP:77597168
1613 1613 a, g dbSNP:773773876
1615 1615 a, g dbSNP:772573640
1618 1618 a, g dbSNP:377665379
1623 1623 c, t dbSNP:748181375
1624 1624 a, g, t dbSNP:199745804
1628 1628 a, g dbSNP:749572804
1632 1632 a, g dbSNP:374044351
1641 1641 -, ct dbSNP:759733648
1642 1642 a, c, t dbSNP:35126034
1649 1649 a, g dbSNP:777862145
1652 1652 a, t dbSNP:34962745
1655 1655 a, t dbSNP:752176820
1656 1656 a, g dbSNP:141567957
1667 1667 a, g dbSNP:754422079
1670 1670 a, g dbSNP:753527423
1671 1671 a, g dbSNP:766017410
1673 1673 c, g dbSNP:761086802
1678 1678 c, t dbSNP:369227380
1679 1679 a, g dbSNP:767940026
1687 1687 a, g dbSNP:762331694
1688 1688 a, g, t dbSNP:768818454
1693 1693 a, g dbSNP:749372122
1696 1696 a, g dbSNP:200529828
1697 1697 a, g dbSNP:201290613
1700 1700 a, g dbSNP:746808353
1703 1703 a, g dbSNP:565394870
1707 1707 a, c dbSNP:747892556
1714 1714 a, g dbSNP:778968440
1718 1718 c, g dbSNP:768523581
1734 1734 a, t dbSNP:374205780
1735 1735 a, t dbSNP:139107954
1737 1737 a, g dbSNP:143294921
1740 1740 c, t dbSNP:369777121
1741 1741 a, c dbSNP:750128189
1752 1752 a, g dbSNP:780700906
1757 1757 a, g dbSNP:371311675
1761 1761 c, g dbSNP:571151621
1762 1762 c, t dbSNP:764663345
1764 1764 a, g dbSNP:763518309
1765 1765 a, g dbSNP:752850564
1769 1769 a, c dbSNP:765459737
1786 1786 a, g dbSNP:759660620
1789 1789 c, t dbSNP:138343171
1790 1790 a, g dbSNP:375477724
1795 1795 a, c, t dbSNP:773950609
1798 1798 c, t dbSNP:145373966
1804 1804 a, g dbSNP:749271201
1812 1812 c, t dbSNP:377695917
1814 1814 g, t dbSNP:769357720
1822 1822 a, c dbSNP:745353489
1823 1823 a, g dbSNP:150057646
1829 1829 c, g dbSNP:756788652
1832 1832 a, c dbSNP:140732502
1839 1839 a, c dbSNP:778237328
1840 1840 c, t dbSNP:375673570
1842 1842 c, g dbSNP:753298603
1846 1846 c, g, t dbSNP:146884025
1847 1847 a, g dbSNP:202197120
1850 1850 g, t dbSNP:753803734
1856 1856 c, t dbSNP:766628788
1857 1857 c, t dbSNP:371109134
1859 1859 c, g dbSNP:143965829
1870 1870 a, g dbSNP:773460422
1873 1873 -, gcttgtccagatggcaggaaggag dbSNP:281865164
1876 1876 c, t dbSNP:763915803
1877 1877 a, g dbSNP:377326385
1885 1885 c, g dbSNP:548311034
1894 1894 c, t dbSNP:769658980
1895 1895 g, t dbSNP:745384564
1897 1897 c, t dbSNP:775959392
1898 1898 c, g dbSNP:770642869
1912 1912 a, g dbSNP:746693127
1915 1915 c, t dbSNP:188300485
1916 1916 g, t dbSNP:758902895
1917 1917 c, g dbSNP:748512719
1937 1937 a, g dbSNP:372970834
1941 1941 a, g, t dbSNP:113242819
1942 1942 a, t dbSNP:753983512
1958 1958 a, g dbSNP:766419128
1959 1959 c, g, t dbSNP:759075680
1961 1961 ag, tc dbSNP:386820399
1961 1961 a, t dbSNP:114685298
1962 1962 c, g dbSNP:116769827
1965 1965 c, t dbSNP:775195314
1969 1969 g, t dbSNP:765186595
1978 1978 -, a dbSNP:772691909
1984 1984 c, g dbSNP:532646940
1985 1985 c, t dbSNP:776612681
1993 1993 a, g dbSNP:369393785
1997 1997 -, gaa dbSNP:761480950
2002 2002 c, t dbSNP:765478898
2003 2003 a, g dbSNP:376253108
2009 2009 c, t dbSNP:771794197
2012 2012 a, g dbSNP:377095634
2016 2016 c, t dbSNP:372828090
2017 2017 c, t dbSNP:769041433
2019 2019 a, g dbSNP:749799140
2025 2025 c, g dbSNP:558884663
2033 2033 c, g, t dbSNP:369053765
2035 2035 a, c, g dbSNP:757426392
2039 2039 a, g dbSNP:752507059
2041 2041 a, g dbSNP:764993355
2043 2043 a, c dbSNP:759348602
2048 2048 g, t dbSNP:753787422
2049 2049 a, c dbSNP:766330282
2051 2051 c, t dbSNP:760276585
2060 2060 a, t dbSNP:200477299
2066 2066 a, t dbSNP:772783723
2078 2078 c, t dbSNP:375526010
2081 2081 a, g dbSNP:142139781
2084 2084 c, g dbSNP:774114985
2093 2093 a, c dbSNP:375655372
2098 2098 a, t dbSNP:373523675
2099 2099 c, g dbSNP:780435239
2103 2103 a, t dbSNP:770266719
2111 2111 a, g dbSNP:148662419
2113 2113 a, t dbSNP:781196776
2119 2119 c, g, t dbSNP:751823743
2122 2122 c, t dbSNP:144077166
2123 2123 a, g dbSNP:143711674
2127 2127 c, t dbSNP:753613070
2132 2132 a, g dbSNP:766233510
2133 2133 a, g dbSNP:201043011
2135 2135 c, g dbSNP:749976459
2138 2138 a, g dbSNP:370007632
2141 2141 a, c dbSNP:761403871
2145 2145 c, t dbSNP:773931864
2146 2146 a, g dbSNP:763743681
2153 2153 a, g dbSNP:763228182
2161 2161 a, g dbSNP:775881151
2162 2162 c, g dbSNP:770221086
2168 2168 a, g dbSNP:746418898
2170 2170 c, t dbSNP:746818979
2171 2171 a, c dbSNP:777094703
2177 2177 a, c dbSNP:777491163
2178 2178 a, g dbSNP:747080557
2183 2183 c, g dbSNP:777875261
2190 2190 a, c dbSNP:758581869
2193 2193 c, t dbSNP:372499859
2196 2196 a, c dbSNP:779849991
2197 2197 a, g dbSNP:755952793
2208 2208 a, g dbSNP:117114544
2214 2214 a, g dbSNP:750452419
2217 2217 c, t dbSNP:767548244
2221 2221 a, g dbSNP:756839100
2226 2226 a, t dbSNP:751013277
2228 2228 c, g dbSNP:2014410
2230 2230 c, t dbSNP:762613783
2231 2231 a, g dbSNP:774979651
2234 2234 a, g dbSNP:765633123
2252 2252 -, agc dbSNP:768468362
2257 2257 a, c dbSNP:748136926
2261 2261 a, c, t dbSNP:186173240
2271 2271 c, g dbSNP:375587915
2279 2279 a, c dbSNP:773303744
2284 2284 a, c dbSNP:772205948
2286 2286 a, c dbSNP:754066787
2288 2288 a, g dbSNP:778998363
2295 2295 a, c dbSNP:756030696
2296 2296 c, g dbSNP:372027593
2297 2297 c, t dbSNP:147435410
2298 2298 a, g dbSNP:142958812
2300 2300 a, c dbSNP:751051493
2303 2303 a, c dbSNP:763704933
2304 2304 c, g dbSNP:757812079
2312 2312 c, t dbSNP:549290787
2315 2315 c, t dbSNP:764860798
2318 2318 c, t dbSNP:759909785
2319 2319 a, g dbSNP:139039617
2343 2343 a, g dbSNP:766903925
2344 2344 a, c dbSNP:761197874
2351 2351 c, t dbSNP:773570398
2355 2355 c, t dbSNP:772234990
2356 2356 a, g dbSNP:756215705
2365 2365 a, c dbSNP:774728501
2366 2366 c, g dbSNP:768931718
2368 2368 c, t dbSNP:745687268
2373 2373 a, g dbSNP:781082499
2379 2379 a, g dbSNP:770823084
2380 2380 a, c, t dbSNP:777570870
2381 2381 a, g dbSNP:757988379
2383 2383 c, t dbSNP:752092814
2388 2388 g, t dbSNP:11545917
2389 2389 a, g dbSNP:778544549
2394 2394 a, g, t dbSNP:754224646
2403 2403 a, g dbSNP:766781092
2404 2404 a, c, t dbSNP:534067573
2405 2405 a, g dbSNP:767852159
2410 2410 a, c dbSNP:761956374
2412 2412 c, g dbSNP:774532334
2415 2415 a, g dbSNP:769017976
2421 2421 a, g dbSNP:763311479
2425 2425 c, t dbSNP:775820827
2428 2428 g, t dbSNP:770822747
2434 2434 a, c dbSNP:367810755
2436 2436 c, g, t dbSNP:150216540
2437 2437 a, t dbSNP:141008676
2439 2439 c, t dbSNP:778346173
2440 2440 a, g dbSNP:754462097
2444 2444 c, t dbSNP:148134252
2447 2447 c, t dbSNP:372833027
2455 2455 c, t dbSNP:756512740
2457 2457 g, t dbSNP:750685060
2458 2458 c, t dbSNP:768100817
2472 2472 c, g dbSNP:143747386
2482 2482 c, t dbSNP:200667267
2485 2485 a, g dbSNP:752086428
2487 2487 c, t dbSNP:764305334
2492 2492 c, t dbSNP:763117738
2497 2497 a, g dbSNP:775916508
2498 2498 a, g dbSNP:765322078
2503 2503 c, t dbSNP:760527580
2505 2505 c, g dbSNP:772846606
2507 2507 a, g dbSNP:772069598
2515 2515 c, t dbSNP:748133574
2516 2516 g, t dbSNP:116241923
2522 2522 a, g dbSNP:202104505
2526 2526 a, g dbSNP:748736760
2534 2534 a, g dbSNP:367888424
2537 2537 c, g dbSNP:751938775
2538 2538 a, g dbSNP:532246881
2541 2541 c, g dbSNP:145674158
2542 2542 c, t dbSNP:199740072
2543 2543 a, g dbSNP:182592572
2551 2551 a, g dbSNP:781455905
2555 2555 a, c, g dbSNP:5752330
2560 2560 a, g dbSNP:540157835
2567 2567 c, t dbSNP:758568345
2580 2580 c, t dbSNP:143902143
2581 2581 a, g dbSNP:527653764
2593 2593 c, t dbSNP:759632995
2595 2595 g, t dbSNP:561308139
2596 2596 c, t dbSNP:767256800
2597 2597 a, c, g dbSNP:774331295
2599 2599 a, c dbSNP:768513194
2601 2601 c, t dbSNP:140234219
2604 2604 c, t dbSNP:774813995
2608 2608 a, g dbSNP:769325136
2611 2611 a, g dbSNP:745543124
2612 2612 c, g dbSNP:780889236
2628 2628 c, t dbSNP:747411315
2630 2630 c, g dbSNP:778239048
2632 2632 c, t dbSNP:772546709
2635 2635 a, g dbSNP:748643364
2640 2640 -, a dbSNP:779927531
2640 2640 a, g dbSNP:779471156
2643 2643 a, g dbSNP:755073092
2648 2648 a, g dbSNP:145481980
2653 2653 c, t dbSNP:780284817
2657 2657 c, t dbSNP:756278524
2660 2660 a, g dbSNP:750621357
2667 2667 c, t dbSNP:763915972
2668 2668 a, g dbSNP:541601069
2670 2670 c, t dbSNP:371342669
2679 2679 a, t dbSNP:765161412
2686 2686 a, g dbSNP:758970516
2688 2688 c, t dbSNP:776169421
2689 2689 c, g dbSNP:770733264
2694 2694 c, t dbSNP:149689335
2697 2697 a, g dbSNP:565596162
2703 2703 a, c dbSNP:772632659
2709 2709 a, g dbSNP:748533902
2712 2712 g, t dbSNP:779303648
2715 2715 c, t dbSNP:368334509
2716 2716 a, g dbSNP:749347544
2717 2717 c, t dbSNP:1894706
2719 2719 -, c dbSNP:769405747
2721 2721 -, a dbSNP:745665820
2722 2722 c, t dbSNP:756155749
2726 2726 c, t dbSNP:746151193
2727 2727 a, g dbSNP:781375770
2737 2737 c, g dbSNP:758138934
2738 2738 c, t dbSNP:752467533
2742 2742 g, t dbSNP:765121677
2751 2751 a, c dbSNP:749888433
2757 2757 c, t dbSNP:374238081
2758 2758 a, g dbSNP:373421312
2762 2762 a, g dbSNP:773844011
2767 2767 -, c dbSNP:281865099
2772 2772 a, c, t dbSNP:560591308
2773 2773 a, g dbSNP:775986716
2776 2776 g, t dbSNP:1894704
2780 2780 c, t dbSNP:759641785
2781 2781 a, g dbSNP:776644648
2783 2783 c, t dbSNP:770895794
2784 2784 a, g dbSNP:78892693
2786 2786 c, t dbSNP:553852142
2789 2789 c, t dbSNP:139675793
2790 2790 g, t dbSNP:749034221
2791 2791 c, g, t dbSNP:201385335
2792 2792 c, t dbSNP:119471021
2796 2796 a, c dbSNP:750362522
2797 2797 c, t dbSNP:370795890
2798 2798 a, c, g dbSNP:202222123
2800 2800 c, t dbSNP:35993959
2803 2803 c, t dbSNP:553114134
2806 2806 g, t dbSNP:763308032
2810 2810 c, t dbSNP:753017691
2811 2811 a, g dbSNP:745559996
2815 2815 c, t dbSNP:765753447
2819 2819 c, t dbSNP:760087525
2823 2823 c, t dbSNP:776976418
2824 2824 c, g dbSNP:377050180
2832 2832 c, g dbSNP:373905924
2834 2834 a, g, t dbSNP:538187229
2835 2835 c, t dbSNP:749128912
2836 2836 a, g, t dbSNP:769678704
2842 2842 c, t dbSNP:745866776
2846 2846 a, g dbSNP:780978556
2848 2848 a, g dbSNP:146303784
2851 2851 g, t dbSNP:750963690
2855 2855 a, g dbSNP:777509970
2860 2860 c, t dbSNP:202120615
2861 2861 a, g dbSNP:201206642
2863 2863 c, t dbSNP:9625029
2867 2867 a, t dbSNP:148294572
2868 2868 -, ac dbSNP:752827715
2868 2868 c, t dbSNP:767769111
2869 2869 a, g dbSNP:761967529
2878 2878 c, t dbSNP:144248515
2879 2879 a, g dbSNP:530118832
2881 2881 c, t dbSNP:764344335
2888 2888 a, c dbSNP:759405900
2889 2889 a, g dbSNP:776239550
2901 2901 a, g dbSNP:368602340
2905 2905 a, g dbSNP:746961193
2911 2911 a, c dbSNP:773131180
2913 2913 a, g dbSNP:374200129
2916 2916 a, g dbSNP:747600132
2917 2917 a, g dbSNP:778546132
2922 2922 c, t dbSNP:754550717
2925 2925 c, g dbSNP:749689033
2926 2926 c, g, t dbSNP:756494145
2929 2929 a, g dbSNP:750947119
2933 2933 c, t dbSNP:768075866
2934 2934 a, g dbSNP:757412572
2937 2937 a, g dbSNP:761057923
2938 2938 c, g, t dbSNP:370493873
2941 2941 c, t dbSNP:752931351
2942 2942 a, g dbSNP:149568178
2947 2947 c, t dbSNP:760506995
2951 2951 a, c dbSNP:768058057
2954 2954 c, g dbSNP:771929646
2957 2957 c, g dbSNP:761348469
2962 2962 g, t dbSNP:773804490
2966 2966 a, g dbSNP:768192969
2980 2980 c, t dbSNP:138189133
2981 2981 a, g dbSNP:779739799
2990 2990 a, g dbSNP:770063857
2992 2992 a, g dbSNP:145698999
2994 2994 -, aagca dbSNP:281865100
3010 3010 c, t dbSNP:781772371
3011 3011 a, g dbSNP:367897224
3019 3019 c, t dbSNP:567467720
3030 3030 a, c dbSNP:558103922
3033 3033 c, t dbSNP:373741660
3039 3039 c, g dbSNP:751436667
3043 3043 a, g dbSNP:773877528
3049 3049 a, g dbSNP:752920923
3052 3052 a, g dbSNP:765442752
3067 3067 a, g dbSNP:199986587
3073 3073 a, t dbSNP:750182459
3074 3074 a, g dbSNP:767468102
3075 3075 a, c dbSNP:761791971
3079 3079 a, g dbSNP:774243369
3101 3101 c, t dbSNP:780124968
3195 3195 a, g dbSNP:561924147
3196 3196 c, g dbSNP:368326097
3203 3203 a, g dbSNP:557703645
3225 3225 g, t dbSNP:550753111
3227 3227 c, t dbSNP:536115151
3256 3256 a, c dbSNP:182700538
3286 3286 a, g dbSNP:763552637
3287 3287 a, g dbSNP:531146121
3322 3322 a, t dbSNP:762469062
3331 3331 a, g dbSNP:568066326
3450 3450 -, c dbSNP:36046278
3451 3451 a, g dbSNP:552928725
3465 3465 -, g dbSNP:773328400
3475 3475 a, g dbSNP:758700168
3491 3491 c, g dbSNP:775062349
3505 3505 c, t dbSNP:76496430
3508 3508 c, t dbSNP:570509591
3521 3521 c, t dbSNP:552113955
3547 3547 c, t dbSNP:745672037
3548 3548 a, g dbSNP:776345185
3556 3556 c, g dbSNP:536866354
3590 3590 a, g dbSNP:565394140
3628 3628 a, g dbSNP:746883110
3646 3646 a, g dbSNP:548085200
3746 3746 c, g dbSNP:777878254
3754 3754 c, t dbSNP:755051224
3755 3755 a, g dbSNP:749384453
3761 3761 c, t dbSNP:529938159
3776 3776 g, t dbSNP:561983395
3778 3778 c, t dbSNP:546959109
3779 3779 a, g dbSNP:190837977
3788 3788 c, g dbSNP:756466974
3797 3797 a, g dbSNP:187297219
3802 3802 a, c dbSNP:762464617
3822 3822 g, t dbSNP:200099628
3828 3828 a, g dbSNP:546286332
3849 3849 a, g dbSNP:746258061
3869 3869 c, t dbSNP:575920373
3890 3890 c, g dbSNP:767814877
3900 3900 c, g dbSNP:143369347
3909 3909 g, t dbSNP:62225811
3911 3911 a, g dbSNP:752453853
3912 3912 c, t dbSNP:200772835
3923 3923 a, t dbSNP:181998459
3932 3932 a, c dbSNP:747584684
3942 3942 -, a dbSNP:779719192
3952 3952 a, t dbSNP:778332651
3964 3964 a, g dbSNP:758423479
3972 3972 c, t dbSNP:770969523
3997 3997 c, t dbSNP:752755928
4001 4001 a, c dbSNP:779035400
4004 4004 g, t dbSNP:755148260
4008 4008 -, ctgaa dbSNP:750142480
4047 4047 a, g dbSNP:752723057
4125 4125 a, t dbSNP:575200307
4217 4217 a, t dbSNP:2157585
4218 4218 -, gt dbSNP:134978
4235 4235 c, t dbSNP:534698074
4237 4237 c, t dbSNP:749313648
4243 4243 -, tgtgtgtgtgtgtgcgcgcgcgcg dbSNP:759852277
4249 4249 -, tgtgtgtgcgcg dbSNP:780541209
4252 4252 -, gtgtgcgcgcgcgc dbSNP:555707534
4253 4253 -, tgtgcgcgcgcgcgcg dbSNP:780251218
4254 4254 -, gtgcgcgcgcgc dbSNP:750870441
4254 4254 -, gtgcgc dbSNP:56832260
4255 4255 -, tgcgcgcgcgcgcg dbSNP:760776804
4255 4255 -, tgcgcgcgcgcg dbSNP:375136975
4255 4255 -, tgcgcgcgcg dbSNP:755364858
4255 4255 c, t dbSNP:7293228
4256 4256 -, gcgcgcgcgc dbSNP:61249065
4257 4257 c, t dbSNP:6147576
4259 4259 c, t dbSNP:56271395
4260 4260 -, gcgcgcgcg dbSNP:751966332
4261 4261 c, t dbSNP:770072939
4263 4263 -, cgcgcgcgcgcg dbSNP:773550229
4263 4263 -, cgcgcgcgcg dbSNP:758987964
4263 4263 -, cgcgcgcg dbSNP:770635497
4265 4265 -, cgcgcgcgcg dbSNP:67796216
4266 4266 -, tgtgcgcgcgcgcg dbSNP:753115022
4269 4269 -, cgcgcg dbSNP:10573454
4278 4278 c, t dbSNP:7291576
4281 4281 a, g dbSNP:534586940
4293 4293 c, g dbSNP:139977960
4304 4304 c, t dbSNP:190614395
4314 4314 c, t dbSNP:767355031
4415 4415 a, t dbSNP:3752590
4492 4492 c, t dbSNP:41277335
4517 4517 c, t dbSNP:775047856
4537 4537 a, g dbSNP:573277089
4556 4556 g, t dbSNP:7292764
4577 4577 a, g dbSNP:565943356
4596 4596 a, g dbSNP:142285409
4605 4605 a, g dbSNP:148725091
4617 4617 a, c dbSNP:117397456
4641 4641 a, c dbSNP:3752589
4703 4703 c, t dbSNP:776454348
4709 4709 a, g dbSNP:41277333
4715 4715 a, g dbSNP:3752588
4718 4718 c, t dbSNP:563911164
4768 4768 a, g dbSNP:542425849

Target ORF information:

RefSeq Version XM_011530487
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Hermansky-Pudlak syndrome 4 (HPS4), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu74053D
Sequence Information ORF Nucleotide Sequence (Length: 2259bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Hermansky-Pudlak syndrome 4 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011520.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1939..>2292(+)
Position Chain Variation Link
11 11 c, g dbSNP:56821996
14 14 g, t dbSNP:547422864
46 46 a, g dbSNP:532089191
54 54 g, t dbSNP:187762406
58 58 c, t dbSNP:184042272
73 73 c, g dbSNP:531283049
78 78 c, t dbSNP:560781291
85 85 c, t dbSNP:115916720
124 124 a, g dbSNP:551554467
128 128 a, g dbSNP:543525170
148 148 a, g dbSNP:532940807
166 166 a, g dbSNP:567406073
173 173 a, c dbSNP:147631281
215 215 c, t dbSNP:550575971
230 230 c, g dbSNP:763625074
232 232 a, t dbSNP:757938034
263 263 a, g dbSNP:529182573
272 272 c, t dbSNP:5761557
315 315 c, t dbSNP:3747134
327 327 c, g dbSNP:572621201
339 339 -, t dbSNP:200535558
383 383 a, g dbSNP:188205202
413 413 a, t dbSNP:545593544
475 475 c, t dbSNP:759331653
497 497 c, t dbSNP:578089748
521 521 c, g, t dbSNP:556695127
522 522 a, c, g dbSNP:187291798
523 523 -, gataccgg dbSNP:766405923
526 526 a, g dbSNP:369803062
557 557 c, g dbSNP:774733114
560 560 a, c dbSNP:768963068
562 562 c, t dbSNP:763357219
576 576 c, t dbSNP:775899708
580 580 a, g dbSNP:570371168
582 582 c, t dbSNP:144622501
587 587 c, g dbSNP:781358501
590 590 a, t dbSNP:142329133
594 594 a, t dbSNP:747194252
595 595 a, g dbSNP:141268657
605 605 c, t dbSNP:778872709
606 606 a, g dbSNP:766139027
608 608 c, g dbSNP:376524160
613 613 a, g dbSNP:745759291
614 614 -, a dbSNP:763190774
618 618 c, t dbSNP:781088233
624 624 -, t dbSNP:281865097
634 634 a, g dbSNP:756803307
645 645 a, g dbSNP:751062699
648 648 a, g dbSNP:763708665
657 657 c, t dbSNP:758006943
658 658 a, g dbSNP:369457259
661 661 -, gatc dbSNP:775635197
662 662 c, t dbSNP:753004509
664 664 a, g dbSNP:765596627
666 666 a, g dbSNP:759982764
671 671 c, t dbSNP:777324808
675 675 c, t dbSNP:146176609
684 684 c, t dbSNP:760897880
689 689 a, g dbSNP:773369379
690 690 c, t dbSNP:754498322
697 697 -, c dbSNP:765434275
698 698 a, c dbSNP:201485111
704 704 c, t dbSNP:35080023
710 710 a, g dbSNP:143189294
715 715 c, t dbSNP:372020804
717 717 a, g dbSNP:577190408
730 730 a, g dbSNP:759382209
734 734 a, g dbSNP:367800640
737 737 c, t dbSNP:770856288
751 751 c, t dbSNP:149126501
752 752 a, g dbSNP:777170572
757 757 a, g dbSNP:147680141
768 768 a, t dbSNP:747578415
773 773 a, g dbSNP:778692469
781 781 c, g, t dbSNP:374775503
786 786 g, t dbSNP:372865887
788 788 g, t dbSNP:147060589
793 793 c, t dbSNP:141684342
794 794 a, g dbSNP:756712181
796 796 a, c dbSNP:200308529
804 804 a, g dbSNP:767883055
817 817 a, g dbSNP:149830675
818 818 a, t dbSNP:560418283
823 823 a, g dbSNP:764311091
824 824 g, t dbSNP:763091759
829 829 a, g dbSNP:776438458
833 833 a, t dbSNP:551412746
835 835 a, t dbSNP:760440998
844 844 c, g dbSNP:530485818
850 850 a, g, t dbSNP:563251161
864 864 a, c, g dbSNP:748780405
868 868 c, t dbSNP:775352863
877 877 a, g dbSNP:376221426
878 878 c, g dbSNP:746260835
880 880 a, t