Home » Species Summary » Homo sapiens » AIP cDNA ORF clone
Email to GenScript

AIP cDNA ORF clone, Homo sapiens (human)

Gene Symbol AIP
Entrez Gene ID 9049
Full Name aryl hydrocarbon receptor interacting protein
Synonyms ARA9, FKBP16, FKBP37, SMTPHN, XAP-2, XAP2
General protein information
Preferred Names
AH receptor-interacting protein
AH receptor-interacting protein
immunophilin homolog ARA9
HBV X-associated protein 2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]. lac of sum
Disorder MIM:


Disorder Html: Pituitary adenoma, growth hormone-secreting, 102200 (3);

mRNA and Protein(s)

mRNA Protein Name
NM_003977 NP_003968 AH receptor-interacting protein isoform 1
NM_001302959 NP_001289888 AH receptor-interacting protein isoform 2
NM_001302960 NP_001289889 AH receptor-interacting protein isoform 3

WP2100 AhR pathway

Homo sapiens (human) AIP NP_003968.2
Pan troglodytes (chimpanzee) AIP XP_508597.1
Macaca mulatta (Rhesus monkey) AIP XP_001105624.1
Canis lupus familiaris (dog) AIP XP_851841.1
Bos taurus (cattle) AIP NP_898905.1
Mus musculus (house mouse) Aip NP_057875.1
Rattus norvegicus (Norway rat) Aip NP_758830.2
Gallus gallus (chicken) AIP NP_989800.1
Danio rerio (zebrafish) aip NP_999877.1
Danio rerio (zebrafish) LOC100149392 XP_001922877.1
Drosophila melanogaster (fruit fly) CG1847 NP_727574.2
Caenorhabditis elegans C56C10.10 NP_495339.1
Xenopus (Silurana) tropicalis (western clawed frog) aip NP_001096219.1


ID Name Evidence
GO:0005624 membrane fraction IEA
GO:0005634 nucleus IDA
GO:0005730 nucleolus IDA
GO:0005737 cytoplasm IDA
GO:0005829 cytosol TAS
GO:0044445 cytosolic part IEA


ID Name Evidence
GO:0003713 transcription coactivator activity TAS
GO:0004871 signal transducer activity TAS
GO:0005515 protein binding IPI
GO:0008134 transcription factor binding TAS
GO:0051082 unfolded protein binding IDA


ID Name Evidence
GO:0006626 protein targeting to mitochondrion IDA
GO:0006805 xenobiotic metabolic process IEA
GO:0007165 signal transduction TAS
GO:0010738 regulation of protein kinase A signaling cascade IEA
GO:0022417 protein maturation by protein folding IDA
GO:0051344 negative regulation of cyclic-nucleotide phosphodiesterase activity IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following AIP gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the AIP cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu62408 NM_003977 Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu62409 NM_001302959 Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu62410 NM_001302960 Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu62408
Accession Version NM_003977.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 993bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product AH receptor-interacting protein isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY065637.1, U31913.1, U78521.1 and CN480874.1. On Dec 5, 2014 this sequence version replaced gi:201860299. Summary: The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U78521.1, U31913.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)32..34(+)
Misc Feature(2)215..>400(+)
Misc Feature(3)665..766(+)
Misc Feature(4)677..961(+)
Misc Feature(5)677..805(+)
Misc Feature(6)818..910(+)
Misc Feature(7)923..1024(+)
Misc Feature(8)923..1009(+)
Exon (1)1..229
Gene Synonym:
Exon (2)230..409
Gene Synonym:
Exon (3)410..598
Gene Synonym:
Exon (4)599..775
Gene Synonym:
Exon (5)776..917
Gene Synonym:
Exon (6)918..1238
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:769412895
21 21 c, t dbSNP:775105705
22 22 a, c dbSNP:528624110
45 45 a, g dbSNP:1049506
47 47 c, g dbSNP:540839310
54 54 c, g dbSNP:377565228
74 74 c, t dbSNP:369451483
83 83 c, t dbSNP:761902702
88 88 a, g, t dbSNP:772093310
92 92 a, g dbSNP:760874721
95 95 c, t dbSNP:766753697
96 96 c, g dbSNP:754271095
108 108 a, g dbSNP:200665479
111 111 c, g dbSNP:765880091
118 118 a, g dbSNP:199681649
119 119 a, c dbSNP:551077555
120 120 a, g dbSNP:777211577
125 125 a, g dbSNP:751208166
126 126 c, g dbSNP:267606562
129 129 a, g dbSNP:377710724
132 132 c, t dbSNP:267606546
133 133 -, c dbSNP:267606547
142 142 c, g dbSNP:756870384
153 153 g, t dbSNP:555159979
156 156 a, g dbSNP:139459091
164 164 a, g dbSNP:745693426
166 166 a, g dbSNP:79662690
168 168 a, t dbSNP:376913545
170 170 c, t dbSNP:104894194
176 176 c, t dbSNP:549056286
177 177 a, g dbSNP:145047094
183 183 c, t dbSNP:773224238
193 193 c, t dbSNP:199913396
194 194 c, t dbSNP:121908357
196 196 -, aggaga dbSNP:267606567
198 198 a, g dbSNP:116940576
200 200 g, t dbSNP:267606568
202 202 c, g dbSNP:201958318
203 203 c, t dbSNP:777083581
204 204 ccccgat, nnnnnnn, tcccggac dbSNP:104895074
205 205 a, c, t dbSNP:760006823
208 208 a, g dbSNP:776131484
214 214 c, t dbSNP:371423932
217 217 a, g dbSNP:763596431
218 218 -, ga dbSNP:267606584
220 220 a, c, t dbSNP:374324200
222 222 c, g dbSNP:756887504
223 223 g, t dbSNP:371636632
227 227 a, g dbSNP:750116890
229 229 a, g dbSNP:755881873
230 230 c, g, t dbSNP:760261382
234 234 c, t dbSNP:376797001
235 235 g, t dbSNP:551824427
237 237 a, t dbSNP:765126288
238 238 c, t dbSNP:752559184
242 242 c, t dbSNP:531663925
245 245 c, t dbSNP:781366620
246 246 a, g dbSNP:139947406
248 248 a, c dbSNP:756367051
249 249 c, t dbSNP:142044984
250 250 a, g dbSNP:747233720
252 252 c, t dbSNP:780109144
262 262 c, t dbSNP:11822907
263 263 a, g dbSNP:574205552
265 265 a, c, t dbSNP:181969066
266 266 a, g dbSNP:772580337
268 268 -, gggcaccgtgctggacgacagccg dbSNP:267606537
274 274 c, t dbSNP:772658134
275 275 a, g, t dbSNP:1063385
283 283 c, t dbSNP:201359503
285 285 a, g dbSNP:776120855
286 286 c, t dbSNP:759287147
289 289 c, t dbSNP:764878127
290 290 c, t dbSNP:752553438
291 291 a, g dbSNP:762938281
293 293 g, t dbSNP:764160345
296 296 a, c, t dbSNP:267606538
297 297 a, g dbSNP:756242133
304 304 c, g, t dbSNP:267606539
306 306 c, g dbSNP:755233340
318 318 a, t dbSNP:779088501
321 321 c, t dbSNP:748534114
322 322 c, t dbSNP:200426800
335 335 a, g dbSNP:141223463
344 344 c, g dbSNP:747561252
346 346 a, g dbSNP:770329704
356 356 a, g dbSNP:372657895
359 359 a, g dbSNP:199531255
371 371 c, t dbSNP:267606541
374 374 -, gaagg dbSNP:267606542
379 379 g, t dbSNP:104895072
380 380 a, g dbSNP:267606543
391 391 a, g dbSNP:767982777
392 392 c, t dbSNP:769513206
393 393 g, t dbSNP:775389208
395 395 c, t dbSNP:762814049
413 413 a, g dbSNP:374539726
415 415 a, g dbSNP:774293360
416 416 -, gt dbSNP:267606545
418 418 a, c dbSNP:761597029
421 421 a, g dbSNP:146865791
427 427 a, g dbSNP:767511957
431 431 a, g dbSNP:147931650
438 438 a, g dbSNP:267606548
445 445 c, g dbSNP:759628608
446 446 c, t dbSNP:369414668
447 447 a, g dbSNP:373950586
449 449 a, g dbSNP:758681469
454 454 c, t dbSNP:376808382
456 456 c, t dbSNP:548910485
457 457 a, g, t dbSNP:751946476
480 480 -, g dbSNP:267606549
485 485 c, t dbSNP:368933035
486 486 a, g dbSNP:746414951
487 487 a, g dbSNP:755638568
489 489 a, c dbSNP:779779725
496 496 c, t dbSNP:748883061
511 511 a, g dbSNP:768435758
512 512 c, t dbSNP:140530307
513 513 a, g dbSNP:267606550
523 523 a, c, t dbSNP:199558504
533 533 c, t dbSNP:150487522
534 534 -, a dbSNP:267606551
534 534 a, g dbSNP:769856618
536 536 g, t dbSNP:775549178
545 545 g, t dbSNP:138312605
547 547 c, t dbSNP:149570102
548 548 a, g dbSNP:751771656
549 549 c, t dbSNP:762219351
554 554 c, t dbSNP:267606552
556 556 a, g dbSNP:767830212
557 557 a, c dbSNP:750938556
559 559 a, g dbSNP:267606553
587 587 a, g dbSNP:376193405
590 590 a, g dbSNP:779653382
606 606 a, g dbSNP:536239840
609 609 c, g dbSNP:773284110
615 615 c, t dbSNP:764344774
616 616 a, g dbSNP:555078670
620 620 c, t dbSNP:104895073
622 622 a, g dbSNP:148095197
630 630 -, c dbSNP:267606557
636 636 a, c dbSNP:777136394
646 646 c, g, t dbSNP:2276020
647 647 -, gaaga dbSNP:267606558
647 647 a, g dbSNP:138902236
652 652 a, g dbSNP:776107966
662 662 a, g dbSNP:762351007
663 663 c, t dbSNP:763723045
672 672 -, t dbSNP:267606559
677 677 c, t dbSNP:757563781
680 680 a, c, t dbSNP:267606560
691 691 c, t dbSNP:142037029
692 692 c, t dbSNP:577617733
697 697 c, g dbSNP:750243392
701 701 c, t dbSNP:189861025
702 702 a, g dbSNP:141826817
703 703 c, t dbSNP:781545373
704 704 a, g dbSNP:575347930
705 705 a, g dbSNP:542237608
711 711 a, g dbSNP:747157774
714 714 c, t dbSNP:267606561
721 721 a, g dbSNP:202006716
731 731 a, t dbSNP:267606563
738 738 a, g dbSNP:746245790
739 739 c, t dbSNP:146317385
740 740 a, g dbSNP:775850708
742 742 c, t dbSNP:182746617
745 745 c, g dbSNP:763588360
761 761 a, t dbSNP:767987311
764 764 c, t dbSNP:773865566
770 770 a, c dbSNP:3210041
776 776 g, t dbSNP:267606565
779 779 c, t dbSNP:267606566
790 790 c, t dbSNP:776495655
792 792 -, c dbSNP:104895075
805 805 a, g dbSNP:759338901
806 806 c, g dbSNP:765294583
812 812 a, c dbSNP:641081
821 821 a, t dbSNP:757402330
822 822 c, t dbSNP:532170807
823 823 a, g dbSNP:141715817
825 825 c, t dbSNP:150594019
826 826 a, g dbSNP:780232812
833 833 a, c dbSNP:749695108
841 841 c, t dbSNP:530134308
843 843 a, g dbSNP:267606569
844 844 c, t dbSNP:267606570
845 845 c, t dbSNP:267606571
846 846 a, g dbSNP:748710275
850 850 c, t dbSNP:267606572
851 851 a, g, t dbSNP:267606573
854 854 c, g dbSNP:772782309
858 858 c, t dbSNP:746580873
862 862 c, g, t dbSNP:770634613
863 863 a, g dbSNP:150645662
865 865 a, g dbSNP:765184360
866 866 a, g dbSNP:775566997
868 868 a, g dbSNP:149677884
872 872 -, tac dbSNP:267606574
874 874 c, t dbSNP:767453811
877 877 a, g dbSNP:750539872
883 883 a, g dbSNP:147351993
886 886 c, t dbSNP:766594200
889 889 c, g dbSNP:754058140
898 898 c, t dbSNP:755320118
899 899 a, g dbSNP:267606575
902 902 c, t dbSNP:779315334
904 904 c, t dbSNP:200160035
910 910 c, g dbSNP:748587494
912 912 -, acg dbSNP:770434824
912 912 a, g dbSNP:780149133
913 913 c, t dbSNP:267606576
914 914 a, g dbSNP:758918509
916 916 a, c, t dbSNP:777095131
918 918 -, aca dbSNP:760690172
922 922 c, t dbSNP:780707460
923 923 a, g dbSNP:749988580
933 933 a, g dbSNP:267606577
934 934 a, c dbSNP:121908356
937 937 c, t dbSNP:139407567
941 941 c, t dbSNP:267606579
945 945 a, g dbSNP:779831121
952 952 a, c dbSNP:145142121
954 954 -, a dbSNP:267606580
955 955 -, ttcaagcggggcaaggcccac dbSNP:267606578
955 955 c, t dbSNP:556924640
956 956 a, g dbSNP:778575382
957 957 c, t dbSNP:61741147
959 959 c, g dbSNP:267606581
961 961 c, t dbSNP:531331351
962 962 a, g dbSNP:776652386
964 964 a, g dbSNP:745914221
982 982 c, g dbSNP:769907863
984 984 -, aggc dbSNP:267606582
987 987 c, t dbSNP:775673977
997 997 a, c dbSNP:763092559
1004 1004 c, g dbSNP:764465139
1008 1008 ag, gt dbSNP:267606583
1010 1010 -, ctggacccagcc dbSNP:267606585
1019 1019 a, g dbSNP:373922286
1021 1021 a, c, t dbSNP:35665586
1026 1026 c, t dbSNP:148986773
1033 1033 g, t dbSNP:554226457
1035 1035 c, t dbSNP:766055125
1036 1036 a, g dbSNP:142912418
1040 1040 c, g, t dbSNP:104894195
1041 1041 a, g dbSNP:104894190
1046 1046 c, t dbSNP:770531862
1049 1049 -, c dbSNP:267606589
1049 1049 c, t dbSNP:758248161
1050 1050 a, c, g dbSNP:4930199
1055 1055 c, t dbSNP:747004653
1064 1064 c, t dbSNP:769858610
1065 1065 a, g dbSNP:775563618
1070 1070 c, t dbSNP:375740557
1071 1071 a, g, t dbSNP:540000299
1074 1074 -, aga dbSNP:766251663
1079 1079 g, t dbSNP:145025838
1081 1081 c, t dbSNP:138814192
1094 1094 a, g dbSNP:768053422
1095 1095 c, t dbSNP:267606586
1097 1097 c, t dbSNP:188965257
1103 1103 a, c, t dbSNP:765927395
1104 1104 a, g dbSNP:754619109
1111 1111 c, t dbSNP:1049565
1116 1116 c, g dbSNP:764765680
1117 1117 c, t dbSNP:267606587
1120 1120 c, t dbSNP:752438976
1126 1126 -, g dbSNP:753775736
1137 1137 a, c dbSNP:142567224
1139 1139 c, t dbSNP:777609189
1153 1153 a, c dbSNP:746893096
1163 1163 c, g dbSNP:757211910
1169 1169 c, t dbSNP:780071736
1183 1183 c, g dbSNP:146014363
1186 1186 c, t dbSNP:562462428
1187 1187 a, g dbSNP:115346238
1194 1194 a, g dbSNP:548569469
1200 1200 a, c dbSNP:778583953
1205 1205 g, t dbSNP:774778133
1210 1210 c, t dbSNP:762342615
1237 1237 c, g dbSNP:139914545

Target ORF information:

RefSeq Version NM_003977
Organism Homo sapiens (human)
Definition Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu62409
Accession Version NM_001302959.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 816bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product AH receptor-interacting protein isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BQ054206.1, U31913.1, U78521.1 and CN480874.1. Summary: The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]. Transcript Variant: This variant (2) contains an alternate exon in place of the first exon in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ054206.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968968 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)142..144(+)
Misc Feature(2)643..927(+)
Misc Feature(3)643..771(+)
Misc Feature(4)784..876(+)
Misc Feature(5)889..975(+)
Exon (1)1..195
Gene Synonym:
Exon (2)196..375
Gene Synonym:
Exon (3)376..564
Gene Synonym:
Exon (4)565..741
Gene Synonym:
Exon (5)742..883
Gene Synonym:
Exon (6)884..1204
Gene Synonym:
Position Chain Variation Link
12 12 g, t dbSNP:563183077
36 36 -, g dbSNP:538648898
47 47 g, t dbSNP:191443582
48 48 c, t dbSNP:376184207
49 49 c, t dbSNP:12272798
95 95 a, g dbSNP:768347101
121 121 -, tt dbSNP:750965948
122 122 -, tt dbSNP:35392564
161 161 c, t dbSNP:567346854
168 168 c, g dbSNP:528379795
196 196 c, g, t dbSNP:760261382
200 200 c, t dbSNP:376797001
201 201 g, t dbSNP:551824427
203 203 a, t dbSNP:765126288
204 204 c, t dbSNP:752559184
208 208 c, t dbSNP:531663925
211 211 c, t dbSNP:781366620
212 212 a, g dbSNP:139947406
214 214 a, c dbSNP:756367051
215 215 c, t dbSNP:142044984
216 216 a, g dbSNP:747233720
218 218 c, t dbSNP:780109144
228 228 c, t dbSNP:11822907
229 229 a, g dbSNP:574205552
231 231 a, c, t dbSNP:181969066
232 232 a, g dbSNP:772580337
234 234 -, gggcaccgtgctggacgacagccg dbSNP:267606537
240 240 c, t dbSNP:772658134
241 241 a, g, t dbSNP:1063385
249 249 c, t dbSNP:201359503
251 251 a, g dbSNP:776120855
252 252 c, t dbSNP:759287147
255 255 c, t dbSNP:764878127
256 256 c, t dbSNP:752553438
257 257 a, g dbSNP:762938281
259 259 g, t dbSNP:764160345
262 262 a, c, t dbSNP:267606538
263 263 a, g dbSNP:756242133
270 270 c, g, t dbSNP:267606539
272 272 c, g dbSNP:755233340
284 284 a, t dbSNP:779088501
287 287 c, t dbSNP:748534114
288 288 c, t dbSNP:200426800
301 301 a, g dbSNP:141223463
310 310 c, g dbSNP:747561252
312 312 a, g dbSNP:770329704
322 322 a, g dbSNP:372657895
325 325 a, g dbSNP:199531255
337 337 c, t dbSNP:267606541
340 340 -, gaagg dbSNP:267606542
345 345 g, t dbSNP:104895072
346 346 a, g dbSNP:267606543
357 357 a, g dbSNP:767982777
358 358 c, t dbSNP:769513206
359 359 g, t dbSNP:775389208
361 361 c, t dbSNP:762814049
379 379 a, g dbSNP:374539726
381 381 a, g dbSNP:774293360
382 382 -, gt dbSNP:267606545
384 384 a, c dbSNP:761597029
387 387 a, g dbSNP:146865791
393 393 a, g dbSNP:767511957
397 397 a, g dbSNP:147931650
404 404 a, g dbSNP:267606548
411 411 c, g dbSNP:759628608
412 412 c, t dbSNP:369414668
413 413 a, g dbSNP:373950586
415 415 a, g dbSNP:758681469
420 420 c, t dbSNP:376808382
422 422 c, t dbSNP:548910485
423 423 a, g, t dbSNP:751946476
446 446 -, g dbSNP:267606549
451 451 c, t dbSNP:368933035
452 452 a, g dbSNP:746414951
453 453 a, g dbSNP:755638568
455 455 a, c dbSNP:779779725
462 462 c, t dbSNP:748883061
477 477 a, g dbSNP:768435758
478 478 c, t dbSNP:140530307
479 479 a, g dbSNP:267606550
489 489 a, c, t dbSNP:199558504
499 499 c, t dbSNP:150487522
500 500 -, a dbSNP:267606551
500 500 a, g dbSNP:769856618
502 502 g, t dbSNP:775549178
511 511 g, t dbSNP:138312605
513 513 c, t dbSNP:149570102
514 514 a, g dbSNP:751771656
515 515 c, t dbSNP:762219351
520 520 c, t dbSNP:267606552
522 522 a, g dbSNP:767830212
523 523 a, c dbSNP:750938556
525 525 a, g dbSNP:267606553
553 553 a, g dbSNP:376193405
556 556 a, g dbSNP:779653382
572 572 a, g dbSNP:536239840
575 575 c, g dbSNP:773284110
581 581 c, t dbSNP:764344774
582 582 a, g dbSNP:555078670
586 586 c, t dbSNP:104895073
588 588 a, g dbSNP:148095197
596 596 -, c dbSNP:267606557
602 602 a, c dbSNP:777136394
612 612 c, g, t dbSNP:2276020
613 613 -, gaaga dbSNP:267606558
613 613 a, g dbSNP:138902236
618 618 a, g dbSNP:776107966
628 628 a, g dbSNP:762351007
629 629 c, t dbSNP:763723045
638 638 -, t dbSNP:267606559
643 643 c, t dbSNP:757563781
646 646 a, c, t dbSNP:267606560
657 657 c, t dbSNP:142037029
658 658 c, t dbSNP:577617733
663 663 c, g dbSNP:750243392
667 667 c, t dbSNP:189861025
668 668 a, g dbSNP:141826817
669 669 c, t dbSNP:781545373
670 670 a, g dbSNP:575347930
671 671 a, g dbSNP:542237608
677 677 a, g dbSNP:747157774
680 680 c, t dbSNP:267606561
687 687 a, g dbSNP:202006716
697 697 a, t dbSNP:267606563
704 704 a, g dbSNP:746245790
705 705 c, t dbSNP:146317385
706 706 a, g dbSNP:775850708
708 708 c, t dbSNP:182746617
711 711 c, g dbSNP:763588360
727 727 a, t dbSNP:767987311
730 730 c, t dbSNP:773865566
736 736 a, c dbSNP:3210041
742 742 g, t dbSNP:267606565
745 745 c, t dbSNP:267606566
756 756 c, t dbSNP:776495655
758 758 -, c dbSNP:104895075
771 771 a, g dbSNP:759338901
772 772 c, g dbSNP:765294583
778 778 a, c dbSNP:641081
787 787 a, t dbSNP:757402330
788 788 c, t dbSNP:532170807
789 789 a, g dbSNP:141715817
791 791 c, t dbSNP:150594019
792 792 a, g dbSNP:780232812
799 799 a, c dbSNP:749695108
807 807 c, t dbSNP:530134308
809 809 a, g dbSNP:267606569
810 810 c, t dbSNP:267606570
811 811 c, t dbSNP:267606571
812 812 a, g dbSNP:748710275
816 816 c, t dbSNP:267606572
817 817 a, g, t dbSNP:267606573
820 820 c, g dbSNP:772782309
824 824 c, t dbSNP:746580873
828 828 c, g, t dbSNP:770634613
829 829 a, g dbSNP:150645662
831 831 a, g dbSNP:765184360
832 832 a, g dbSNP:775566997
834 834 a, g dbSNP:149677884
838 838 -, tac dbSNP:267606574
840 840 c, t dbSNP:767453811
843 843 a, g dbSNP:750539872
849 849 a, g dbSNP:147351993
852 852 c, t dbSNP:766594200
855 855 c, g dbSNP:754058140
864 864 c, t dbSNP:755320118
865 865 a, g dbSNP:267606575
868 868 c, t dbSNP:779315334
870 870 c, t dbSNP:200160035
876 876 c, g dbSNP:748587494
878 878 -, acg dbSNP:770434824
878 878 a, g dbSNP:780149133
879 879 c, t dbSNP:267606576
880 880 a, g dbSNP:758918509
882 882 a, c, t dbSNP:777095131
884 884 -, aca dbSNP:760690172
888 888 c, t dbSNP:780707460
889 889 a, g dbSNP:749988580
899 899 a, g dbSNP:267606577
900 900 a, c dbSNP:121908356
903 903 c, t dbSNP:139407567
907 907 c, t dbSNP:267606579
911 911 a, g dbSNP:779831121
918 918 a, c dbSNP:145142121
920 920 -, a dbSNP:267606580
921 921 -, ttcaagcggggcaaggcccac dbSNP:267606578
921 921 c, t dbSNP:556924640
922 922 a, g dbSNP:778575382
923 923 c, t dbSNP:61741147
925 925 c, g dbSNP:267606581
927 927 c, t dbSNP:531331351
928 928 a, g dbSNP:776652386
930 930 a, g dbSNP:745914221
948 948 c, g dbSNP:769907863
950 950 -, aggc dbSNP:267606582
953 953 c, t dbSNP:775673977
963 963 a, c dbSNP:763092559
970 970 c, g dbSNP:764465139
974 974 ag, gt dbSNP:267606583
976 976 -, ctggacccagcc dbSNP:267606585
985 985 a, g dbSNP:373922286
987 987 a, c, t dbSNP:35665586
992 992 c, t dbSNP:148986773
999 999 g, t dbSNP:554226457
1001 1001 c, t dbSNP:766055125
1002 1002 a, g dbSNP:142912418
1006 1006 c, g, t dbSNP:104894195
1007 1007 a, g dbSNP:104894190
1012 1012 c, t dbSNP:770531862
1015 1015 -, c dbSNP:267606589
1015 1015 c, t dbSNP:758248161
1016 1016 a, c, g dbSNP:4930199
1021 1021 c, t dbSNP:747004653
1030 1030 c, t dbSNP:769858610
1031 1031 a, g dbSNP:775563618
1036 1036 c, t dbSNP:375740557
1037 1037 a, g, t dbSNP:540000299
1040 1040 -, aga dbSNP:766251663
1045 1045 g, t dbSNP:145025838
1047 1047 c, t dbSNP:138814192
1060 1060 a, g dbSNP:768053422
1061 1061 c, t dbSNP:267606586
1063 1063 c, t dbSNP:188965257
1069 1069 a, c, t dbSNP:765927395
1070 1070 a, g dbSNP:754619109
1077 1077 c, t dbSNP:1049565
1082 1082 c, g dbSNP:764765680
1083 1083 c, t dbSNP:267606587
1086 1086 c, t dbSNP:752438976
1092 1092 -, g dbSNP:753775736
1103 1103 a, c dbSNP:142567224
1105 1105 c, t dbSNP:777609189
1119 1119 a, c dbSNP:746893096
1129 1129 c, g dbSNP:757211910
1135 1135 c, t dbSNP:780071736
1149 1149 c, g dbSNP:146014363
1152 1152 c, t dbSNP:562462428
1153 1153 a, g dbSNP:115346238
1160 1160 a, g dbSNP:548569469
1166 1166 a, c dbSNP:778583953
1171 1171 g, t dbSNP:774778133
1176 1176 c, t dbSNP:762342615
1203 1203 c, g dbSNP:139914545

Target ORF information:

RefSeq Version NM_001302959
Organism Homo sapiens (human)
Definition Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu62410
Accession Version NM_001302960.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 852bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product AH receptor-interacting protein isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY065637.1, U31913.1, BQ420398.1, U78521.1 and CN480874.1. Summary: The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]. Transcript Variant: This variant (3) uses an alternate splice junction in the 3' end of the coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BM547387.1, BQ668468.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)32..34(+)
Misc Feature(2)215..>400(+)
Misc Feature(3)665..766(+)
Exon (1)1..229
Gene Synonym:
Exon (2)230..409
Gene Synonym:
Exon (3)410..598
Gene Synonym:
Exon (4)599..775
Gene Synonym:
Exon (5)776..909
Gene Synonym:
Exon (6)910..1230
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:769412895
21 21 c, t dbSNP:775105705
22 22 a, c dbSNP:528624110
45 45 a, g dbSNP:1049506
47 47 c, g dbSNP:540839310
54 54 c, g dbSNP:377565228
74 74 c, t dbSNP:369451483
83 83 c, t dbSNP:761902702
88 88 a, g, t dbSNP:772093310
92 92 a, g dbSNP:760874721
95 95 c, t dbSNP:766753697
96 96 c, g dbSNP:754271095
108 108 a, g dbSNP:200665479
111 111 c, g dbSNP:765880091
118 118 a, g dbSNP:199681649
119 119 a, c dbSNP:551077555
120 120 a, g dbSNP:777211577
125 125 a, g dbSNP:751208166
126 126 c, g dbSNP:267606562
129 129 a, g dbSNP:377710724
132 132 c, t dbSNP:267606546
133 133 -, c dbSNP:267606547
142 142 c, g dbSNP:756870384
153 153 g, t dbSNP:555159979
156 156 a, g dbSNP:139459091
164 164 a, g dbSNP:745693426
166 166 a, g dbSNP:79662690
168 168 a, t dbSNP:376913545
170 170 c, t dbSNP:104894194
176 176 c, t dbSNP:549056286
177 177 a, g dbSNP:145047094
183 183 c, t dbSNP:773224238
193 193 c, t dbSNP:199913396
194 194 c, t dbSNP:121908357
196 196 -, aggaga dbSNP:267606567
198 198 a, g dbSNP:116940576
200 200 g, t dbSNP:267606568
202 202 c, g dbSNP:201958318
203 203 c, t dbSNP:777083581
204 204 ccccgat, nnnnnnn, tcccggac dbSNP:104895074
205 205 a, c, t dbSNP:760006823
208 208 a, g dbSNP:776131484
214 214 c, t dbSNP:371423932
217 217 a, g dbSNP:763596431
218 218 -, ga dbSNP:267606584
220 220 a, c, t dbSNP:374324200
222 222 c, g dbSNP:756887504
223 223 g, t dbSNP:371636632
227 227 a, g dbSNP:750116890
229 229 a, g dbSNP:755881873
230 230 c, g, t dbSNP:760261382
234 234 c, t dbSNP:376797001
235 235 g, t dbSNP:551824427
237 237 a, t dbSNP:765126288
238 238 c, t dbSNP:752559184
242 242 c, t dbSNP:531663925
245 245 c, t dbSNP:781366620
246 246 a, g dbSNP:139947406
248 248 a, c dbSNP:756367051
249 249 c, t dbSNP:142044984
250 250 a, g dbSNP:747233720
252 252 c, t dbSNP:780109144
262 262 c, t dbSNP:11822907
263 263 a, g dbSNP:574205552
265 265 a, c, t dbSNP:181969066
266 266 a, g dbSNP:772580337
268 268 -, gggcaccgtgctggacgacagccg dbSNP:267606537
274 274 c, t dbSNP:772658134
275 275 a, g, t dbSNP:1063385
283 283 c, t dbSNP:201359503
285 285 a, g dbSNP:776120855
286 286 c, t dbSNP:759287147
289 289 c, t dbSNP:764878127
290 290 c, t dbSNP:752553438
291 291 a, g dbSNP:762938281
293 293 g, t dbSNP:764160345
296 296 a, c, t dbSNP:267606538
297 297 a, g dbSNP:756242133
304 304 c, g, t dbSNP:267606539
306 306 c, g dbSNP:755233340
318 318 a, t dbSNP:779088501
321 321 c, t dbSNP:748534114
322 322 c, t dbSNP:200426800
335 335 a, g dbSNP:141223463
344 344 c, g dbSNP:747561252
346 346 a, g dbSNP:770329704
356 356 a, g dbSNP:372657895
359 359 a, g dbSNP:199531255
371 371 c, t dbSNP:267606541
374 374 -, gaagg dbSNP:267606542
379 379 g, t dbSNP:104895072
380 380 a, g dbSNP:267606543
391 391 a, g dbSNP:767982777
392 392 c, t dbSNP:769513206
393 393 g, t dbSNP:775389208
395 395 c, t dbSNP:762814049
413 413 a, g dbSNP:374539726
415 415 a, g dbSNP:774293360
416 416 -, gt dbSNP:267606545
418 418 a, c dbSNP:761597029
421 421 a, g dbSNP:146865791
427 427 a, g dbSNP:767511957
431 431 a, g dbSNP:147931650
438 438 a, g dbSNP:267606548
445 445 c, g dbSNP:759628608
446 446 c, t dbSNP:369414668
447 447 a, g dbSNP:373950586
449 449 a, g dbSNP:758681469
454 454 c, t dbSNP:376808382
456 456 c, t dbSNP:548910485
457 457 a, g, t dbSNP:751946476
480 480 -, g dbSNP:267606549
485 485 c, t dbSNP:368933035
486 486 a, g dbSNP:746414951
487 487 a, g dbSNP:755638568
489 489 a, c dbSNP:779779725
496 496 c, t dbSNP:748883061
511 511 a, g dbSNP:768435758
512 512 c, t dbSNP:140530307
513 513 a, g dbSNP:267606550
523 523 a, c, t dbSNP:199558504
533 533 c, t dbSNP:150487522
534 534 -, a dbSNP:267606551
534 534 a, g dbSNP:769856618
536 536 g, t dbSNP:775549178
545 545 g, t dbSNP:138312605
547 547 c, t dbSNP:149570102
548 548 a, g dbSNP:751771656
549 549 c, t dbSNP:762219351
554 554 c, t dbSNP:267606552
556 556 a, g dbSNP:767830212
557 557 a, c dbSNP:750938556
559 559 a, g dbSNP:267606553
587 587 a, g dbSNP:376193405
590 590 a, g dbSNP:779653382
606 606 a, g dbSNP:536239840
609 609 c, g dbSNP:773284110
615 615 c, t dbSNP:764344774
616 616 a, g dbSNP:555078670
620 620 c, t dbSNP:104895073
622 622 a, g dbSNP:148095197
630 630 -, c dbSNP:267606557
636 636 a, c dbSNP:777136394
646 646 c, g, t dbSNP:2276020
647 647 -, gaaga dbSNP:267606558
647 647 a, g dbSNP:138902236
652 652 a, g dbSNP:776107966
662 662 a, g dbSNP:762351007
663 663 c, t dbSNP:763723045
672 672 -, t dbSNP:267606559
677 677 c, t dbSNP:757563781
680 680 a, c, t dbSNP:267606560
691 691 c, t dbSNP:142037029
692 692 c, t dbSNP:577617733
697 697 c, g dbSNP:750243392
701 701 c, t dbSNP:189861025
702 702 a, g dbSNP:141826817
703 703 c, t dbSNP:781545373
704 704 a, g dbSNP:575347930
705 705 a, g dbSNP:542237608
711 711 a, g dbSNP:747157774
714 714 c, t dbSNP:267606561
721 721 a, g dbSNP:202006716
731 731 a, t dbSNP:267606563
738 738 a, g dbSNP:746245790
739 739 c, t dbSNP:146317385
740 740 a, g dbSNP:775850708
742 742 c, t dbSNP:182746617
745 745 c, g dbSNP:763588360
761 761 a, t dbSNP:767987311
764 764 c, t dbSNP:773865566
770 770 a, c dbSNP:3210041
776 776 g, t dbSNP:267606565
779 779 c, t dbSNP:267606566
790 790 c, t dbSNP:776495655
792 792 -, c dbSNP:104895075
805 805 a, g dbSNP:759338901
806 806 c, g dbSNP:765294583
812 812 a, c dbSNP:641081
821 821 a, t dbSNP:757402330
822 822 c, t dbSNP:532170807
823 823 a, g dbSNP:141715817
825 825 c, t dbSNP:150594019
826 826 a, g dbSNP:780232812
833 833 a, c dbSNP:749695108
841 841 c, t dbSNP:530134308
843 843 a, g dbSNP:267606569
844 844 c, t dbSNP:267606570
845 845 c, t dbSNP:267606571
846 846 a, g dbSNP:748710275
850 850 c, t dbSNP:267606572
851 851 a, g, t dbSNP:267606573
854 854 c, g dbSNP:772782309
858 858 c, t dbSNP:746580873
862 862 c, g, t dbSNP:770634613
863 863 a, g dbSNP:150645662
865 865 a, g dbSNP:765184360
866 866 a, g dbSNP:775566997
868 868 a, g dbSNP:149677884
872 872 -, tac dbSNP:267606574
874 874 c, t dbSNP:767453811
877 877 a, g dbSNP:750539872
883 883 a, g dbSNP:147351993
886 886 c, t dbSNP:766594200
889 889 c, g dbSNP:754058140
898 898 c, t dbSNP:755320118
899 899 a, g dbSNP:267606575
902 902 c, t dbSNP:779315334
904 904 c, t dbSNP:200160035
910 910 -, aca dbSNP:760690172
914 914 c, t dbSNP:780707460
915 915 a, g dbSNP:749988580
925 925 a, g dbSNP:267606577
926 926 a, c dbSNP:121908356
929 929 c, t dbSNP:139407567
933 933 c, t dbSNP:267606579
937 937 a, g dbSNP:779831121
944 944 a, c dbSNP:145142121
946 946 -, a dbSNP:267606580
947 947 -, ttcaagcggggcaaggcccac dbSNP:267606578
947 947 c, t dbSNP:556924640
948 948 a, g dbSNP:778575382
949 949 c, t dbSNP:61741147
951 951 c, g dbSNP:267606581
953 953 c, t dbSNP:531331351
954 954 a, g dbSNP:776652386
956 956 a, g dbSNP:745914221
974 974 c, g dbSNP:769907863
976 976 -, aggc dbSNP:267606582
979 979 c, t dbSNP:775673977
989 989 a, c dbSNP:763092559
996 996 c, g dbSNP:764465139
1000 1000 ag, gt dbSNP:267606583
1002 1002 -, ctggacccagcc dbSNP:267606585
1011 1011 a, g dbSNP:373922286
1013 1013 a, c, t dbSNP:35665586
1018 1018 c, t dbSNP:148986773
1025 1025 g, t dbSNP:554226457
1027 1027 c, t dbSNP:766055125
1028 1028 a, g dbSNP:142912418
1032 1032 c, g, t dbSNP:104894195
1033 1033 a, g dbSNP:104894190
1038 1038 c, t dbSNP:770531862
1041 1041 -, c dbSNP:267606589
1041 1041 c, t dbSNP:758248161
1042 1042 a, c, g dbSNP:4930199
1047 1047 c, t dbSNP:747004653
1056 1056 c, t dbSNP:769858610
1057 1057 a, g dbSNP:775563618
1062 1062 c, t dbSNP:375740557
1063 1063 a, g, t dbSNP:540000299
1066 1066 -, aga dbSNP:766251663
1071 1071 g, t dbSNP:145025838
1073 1073 c, t dbSNP:138814192
1086 1086 a, g dbSNP:768053422
1087 1087 c, t dbSNP:267606586
1089 1089 c, t dbSNP:188965257
1095 1095 a, c, t dbSNP:765927395
1096 1096 a, g dbSNP:754619109
1103 1103 c, t dbSNP:1049565
1108 1108 c, g dbSNP:764765680
1109 1109 c, t dbSNP:267606587
1112 1112 c, t dbSNP:752438976
1118 1118 -, g dbSNP:753775736
1129 1129 a, c dbSNP:142567224
1131 1131 c, t dbSNP:777609189
1145 1145 a, c dbSNP:746893096
1155 1155 c, g dbSNP:757211910
1161 1161 c, t dbSNP:780071736
1175 1175 c, g dbSNP:146014363
1178 1178 c, t dbSNP:562462428
1179 1179 a, g dbSNP:115346238
1186 1186 a, g dbSNP:548569469
1192 1192 a, c dbSNP:778583953
1197 1197 g, t dbSNP:774778133
1202 1202 c, t dbSNP:762342615
1229 1229 c, g dbSNP:139914545

Target ORF information:

RefSeq Version NM_001302960
Organism Homo sapiens (human)
Definition Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context
Endocr. Pathol. 24 (4), 234-238 (2013)
Garcia-Arnes,J.A., Gonzalez-Molero,I., Oriola,J., Mazuecos,N., Luque,R., Castano,J. and Arraez,M.A.


Familial pituitary apoplexy as the only presentation of a novel AIP mutation
Endocr. Relat. Cancer 20 (5), L11-L14 (2013)
Xekouki,P., Mastroyiannis,S.A., Avgeropoulos,D., de la Luz Sierra,M., Trivellin,G., Gourgari,E.A., Lyssikatos,C., Quezado,M., Patronas,N., Kanaka-Gantenbein,C., Chrousos,G.P. and Stratakis,C.A.


Aryl hydrocarbon receptor interacting protein (AIP) mutations occur rarely in sporadic parathyroid adenomas
J. Clin. Endocrinol. Metab. 98 (7), 2800-2810 (2013)
Pardi E, Marcocci C, Borsari S, Saponaro F, Torregrossa L, Tancredi M, Raspini B, Basolo F and Cetani F.


The FKBP-type domain of the human aryl hydrocarbon receptor-interacting protein reveals an unusual Hsp90 interaction
Biochemistry 52 (12), 2097-2107 (2013)
Linnert M, Lin YJ, Manns A, Haupt K, Paschke AK, Fischer G, Weiwad M and Lucke C.


Unique proline-rich domain regulates the chaperone function of AIPL1
Biochemistry 52 (12), 2089-2096 (2013)
Li J, Zoldak G, Kriehuber T, Soroka J, Schmid FX, Richter K and Buchner J.


Ligand-dependent interaction of the aryl hydrocarbon receptor with a novel immunophilin homolog in vivo
J. Biol. Chem. 272 (17), 11452-11456 (1997)
Carver LA and Bradfield CA.


A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin
J. Biol. Chem. 272 (14), 8878-8884 (1997)
Ma Q and Whitlock JP Jr.


XAP2, a novel hepatitis B virus X-associated protein that inhibits X transactivation
Nucleic Acids Res. 24 (23), 4741-4750 (1996)
Kuzhandaivelu N, Cong YS, Inouye C, Yang WM and Seto E.


Subunit composition of the heteromeric cytosolic aryl hydrocarbon receptor complex
J. Biol. Chem. 269 (44), 27554-27558 (1994)
Chen HS and Perdew GH.


AIP-Related Familial Isolated Pituitary Adenomas
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Korbonits,M. and Kumar,A.V.
