Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 [Homo sapiens (human)]

Gene Symbol MAGI1
Entrez Gene ID 9223
Full Name membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms AIP-3, AIP3, BAIAP1, BAP-1, BAP1, MAGI-1, Magi1d, TNRC19, WWP3
General protein information
Preferred Names
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1
Names
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1
BAI1-associated protein 1
WW domain-containing protein 3
atrophin-1-interacting protein 3
membrane-associated guanylate kinase inverted 1
trinucleotide repeat-containing gene 19 protein
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

3

3p14.1

Summary The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

602625

Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu37583 XM_006713407 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37584 XM_006713408 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37585 XM_006713409 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37586 XM_005265563 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37587 XM_005265564 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37588 XM_005265565 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62631 XM_011534236 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37589 XM_005265566 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37590 XM_006713410 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X9, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37591 XM_005265568 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X10, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62632 XM_011534237 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X11, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37592 XM_006713411 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X12, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37593 XM_006713412 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X13, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37594 XM_005265570 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X14, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37595 XM_005265571 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X15, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62633 XM_006713413 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X16, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37597 XM_006713414 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X17, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu37598 XM_005265574 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X18, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62634 XM_011534238 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X19, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62635 XM_011534239 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X20, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62636 XM_011534240 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X21, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu62637 XM_011534241 PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X22, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu24845 NM_004742 Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu24816 NM_015520 Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu24988 NM_001033057 Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu37583D
Sequence Information ORF Nucleotide Sequence (Length: 4482bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
ATGTCCAAAG TGATCCAGAA GAAGAACCAC TGGACTAGCA GGGTTCACGA ATGCACCGTG 
AAGCGGGGAC CCCAGGGCGA GCTGGGGGTG ACGGTGCTGG GAGGCGCGGA GCACGGGGAG
TTTCCGTACG TCGGAGCGGT GGCGGCGGTC GAGGCAGCGG GGCTTCCCGG CGGCGGCGAG
GGCCCGAGGC TGGGCGAAGG GGAGCTGCTT CTGGAGGTGC AGGGGGTCCG GGTGTCCGGC
TTGCCCCGCT ATGACGTGCT GGGGGTCATC GACAGCTGCA AGGAGGCCGT CACCTTCAAG
GCCGTCAGAC AAGGAGGAAG GCTGAACAAG GACCTGCGAC ATTTTCTCAA TCAGCGATTC
CAGAAGGGGT CTCCTGATCA TGAGCTCCAG CAGACCATAA GGGATAACCT TTACCGCCAT
GCTGTGCCTT GCACAACCCG ATCTCCCAGA GAAGGAGAAG TGCCTGGCGT GGACTATAAC
TTTCTGACTG TGAAGGAGTT CTTGGACCTC GAGCAGAGTG GGACTCTTCT GGAAGTCGGC
ACCTATGAAG GAAACTATTA TGGGACACCC AAGCCTCCTA GCCAGCCAGT CAGTGGGAAA
GTGATCACGA CGGATGCCTT GCACAGCCTT CAGTCTGGCT CTAAGCAGTC GACCCCGAAG
CGAACCAAGT CCTACAATGA TATGCAAAAT GCTGGCATAG TCCACGCGGA GAATGAGGAG
GAGGATGACG TTCCTGAAAT GAACAGCAGC TTTACAGCAG CCGATTCTGG TGAACAAGAG
GAGCACACTC TCCAAGAAAC AGCATTACCA CCTGTGAATA GTAGCATCAT CGCTGCTCCC
ATCACGGACC CTTCTCAGAA GTTCCCTCAA TACCTACCTC TTTCTGCAGA GGATAATTTA
GGTCCTCTAC CTGAAAACTG GGAGATGGCC TATACTGAAA ATGGAGAAGT CTATTTTATA
GACCATAACA CGAAAACAAC ATCTTGGTTA GACCCTCGGT GCCTAAACAA GCAGCAGAAG
CCACTGGAAG AGTGTGAAGA TGATGAAGAA GGGGTACACA CCGAGGAGCT GGACAGTGAA
CTAGAACTGC CTGCTGGTTG GGAAAAGATT GAAGACCCTG TCTATGGTAT CTACTATGTA
GACCACATCA ACAGGAAGAC ACAATATGAG AACCCGGTTC TAGAAGCCAA ACGGAAGAAG
CAGCTTGAGC AGCAGCAGCA GCAGCAACAG CAGCAGCAAC AGCAGCAGCA GCAGCAGCAG
CAGCAGCAGA CAGAAGAATG GACAGAAGAT CACTCAGCCC TTGTGCCTCC TGTTATTCCA
AACCACCCTC CAAGCAATCC AGAGCCAGCC AGAGAAGTTC CACTTCAGGG CAAACCCTTT
TTTACACGAA ACCCTTCTGA GTTGAAAGGC AAGTTCATTC ACACAAAGCT GCGGAAAAGC
AGTCGTGGCT TTGGCTTCAC GGTGGTTGGA GGGGATGAAC CTGATGAGTT TCTCCAGATC
AAGAGCTTGG TCCTAGATGG TCCTGCTGCA TTGGATGGCA AGATGGAAAC AGGGGATGTG
ATTGTAAGTG TGAATGACAC CTGTGTTTTG GGACACACAC ATGCTCAAGT TGTGAAGATC
TTCCAGTCCA TCCCCATTGG TGCCAGCGTG GACCTTGAAC TCTGCCGAGG TTATCCATTG
CCTTTTGATC CAGATGACCC CAATACAAGT TTAGTGACCT CGGTAGCCAT TTTGGATAAA
GAACCAATTA TTGTGAATGG GCAAGAGACC TATGATTCAC CAGCTAGCCA CAGTAGTAAA
ACAGGCAAAG TCAATGGCAT GAAGGATGCC AGGCCAAGCA GCCCAGCGGA CGTGGCTTCA
AATAGTTCTC ATGGTTATCC TAATGACACT GTTTCTTTGG CTTCCTCCAT AGCCACTCAG
CCAGAACTCA TAACTGTTCA TATTGTCAAA GGGCCAATGG GCTTTGGTTT TACTATCGCA
GACAGTCCTG GTGGGGGTGG CCAAAGAGTG AAACAGATTG TTGACAGCCC AAGGTGCCGA
GGCCTGAAAG AAGGGGATCT CATAGTGGAA GTTAATAAGA AGAACGTGCA GGCCCTAACT
CACAACCAAG TGGTGGATAT GCTGGTTGAG TGTCCTAAGG GAAGTGAGGT CACATTGTTG
GTGCAACGAG GAGGGCTGCC AGTTCCCAAG AAGAGCCCAA AGTCGCAACC ACTGGAAAGG
AAAGACAGCC AGAATAGTTC TCAGCACAGT GTTTCCAGCC ACCGAAGCCT GCACACAGCA
TCCCCAAGCC ACAGCACACA GGTGCTCCCC GAGTTCCCAC CTGCAGAGGC CCAAGCTCCA
GATCAAACTG ACAGCTCTGG CCAGAAAAAA CCAGATCCTT TTAAAATCTG GGCCCAGTCC
AGGAGCATGT ATGAAAACCG ACCTATGTCA CCTTCACCTG CGTCGGGATT GAGCAAGGGT
GAGAGAGAGA GAGAAATCAA TTCCACGAAT TTTGGAGAAT GTCCGATTCC AGATTACCAG
GAACAGGACA TCTTCCTCTG GAGAAAAGAG ACTGGATTTG GATTTAGGAT TCTGGGTGGA
AATGAACCAG GGGAACCTAT TTATATTGGT CACATCGTAC CACTGGGTGC TGCTGATACT
GACGGCCGCC TGAGGTCTGG AGATGAATTA ATCTGTGTGG ATGGGACGCC AGTAATTGGA
AAATCACACC AGCTTGTGGT CCAGCTTATG CAACAAGCTG CCAAGCAAGG CCACGTCAAT
CTCACGGTGC GGCGTAAAGT GGTTTTTGCG GTGCCCAAAA CCGAGAACGA GGTGCCCTCG
CCAGCCTCCT CTCATCACAG TAGCAACCAG CCGGCCTCGC TGACAGAAGA GAAGCGCACT
CCGCAGGGCA GCCAGAACTC GCTGAACACG GTGAGCTCGG GCAGCGGCAG CACCAGCGGC
ATCGGCAGTG GCGGCGGCGG GGGCAGCGGC GTGGTCAGCA CCGTGGTGCA GCCCTACGAC
GTGGAGATCC GGCGCGGGGA GAACGAGGGC TTCGGCTTCG TCATCGTGTC CTCGGTGAGC
AGGCCCGAAG CAGGCACGAC CTTTGCAGGC AATGCATGTG TGGCTATGCC TCACAAAATA
GGTCGGATTA TTGAGGGGAG CCCTGCTGAC CGCTGTGGCA AGCTGAAAGT AGGAGACCGG
ATCTTGGCAG TAAATGGATG TTCCATCACC AACAAATCCC ATTCAGACAT TGTGAACCTA
ATCAAGGAAG CGGGAAACAC AGTTACCCTC CGCATCATTC CTGGGGATGA GTCCTCGAAT
GCCACCTTGC TGACCAATGC AGAGAAGATT GCCACCATCA CCACCACACA CACCCCTTCT
CAGCAAGGGA CCCAGGAGAC AAGGAATACC ACCAAACCAA AGCAGGAATC TCAATTTGAG
TTCAAAGCAC CCCAAGCAAC ACAGGAGCAA GATTTTTACA CTGTGGAACT GGAAAGAGGA
GCCAAGGGAT TTGGCTTTAG CCTTCGAGGA GGCCGAGAGT ATAACATGGA CCTCTATGTT
CTGCGCTTAG CAGAGGACGG TCCTGCGGAG AGGTGTGGAA AGATGAGGAT TGGTGATGAA
ATTTTAGAGA TCAATGGTGA GACCACCAAA AACATGAAGC ATTCTCGAGC TATAGAACTG
ATTAAGAATG GTGGCCGCAG AGTTCGTCTG TTTCTGAAGC GGGGAGACGG CTCAGTACCA
GAATATGACC CCAGCAGCGA CCGCCACGGC CCCGCCACCG GTCCACAAGG TGTTCCGGAA
GTGAGGGCCG GGCCCGACCG CCGGCAGCAT CCGTCATTGG AGTCCAGTTA CCCACCCGAT
CTTCACAAAT CATCACCACA TGGGGAAAAG CGGGCACACG CAAGGGATCC GAAAGGCAGC
AGAGAGTATA GCAGACAACC CAATGAACAC CACACCTGGA ATGGGACTTC GAGGAAACCC
GACAGCGGGG CATGCCGACC CAAGGACCGG GCGCCGGAGG GACGGAGGGA CGCGCAGGCC
GAGCGCGCGG CAGCCGCCAA CGGCCCCAAG AGGCGGTCCC CAGAGAAGCG GAGGGAGGGC
ACCCGCAGCG CCGACAACAC TTTGGAGAGG AGGGAGAAGC ACGAGAAGAG ACGAGACGTC
TCTCCGGAGC GGAGGCGAGA GCGGTCACCC ACCCGCAGGA GAGACGGCTC CCCCAGCCGG
CGGAGACGGT CTCTGGAGAG ACTCCTGGAG CAGAGGAGGT CCCCCGAGCG CAGGAGAGGG
GGCTCGCCCG AGCGCAGGGC CAAGTCCACC GACCGGAGGC GCGCACGCTC CCCCGAGCGC
AGGAGAGAGC GGTCCCTGGA CAAAAGGAAC AGAGAGGACA GAGCCAGCCA CCGAGAAAGG
GAAGAGGCGA ATCTGAAACA GGATGCCGGC AGAAGTTCCA GACATCCCCC GGAGCAGAGA
AGGCGACCTT ACAAAGAATG TAGCACCGAC CTCAGTATCTT GA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_006713470.1
CDS529..5010
Misc Feature(1)571..828(+)
Misc Feature(2)607..801(+)
Misc Feature(3)892..1410(+)
Misc Feature(4)892..900(+)
Misc Feature(5)1438..1527(+)
Misc Feature(6)1480..1515(+)
Misc Feature(7)1618..1710(+)
Misc Feature(8)1660..1695(+)
Misc Feature(9)1960..2163(+)
Misc Feature(10)1975..2154(+)
Misc Feature(11)2455..2694(+)
Misc Feature(12)2488..2655(+)
Misc Feature(13)3073..3300(+)
Misc Feature(14)3082..3261(+)
Misc Feature(15)3520..3807(+)
Misc Feature(16)3556..3774(+)
Misc Feature(17)3985..4218(+)
Misc Feature(18)4015..4194(+)
Translation
Position Chain Variation Link
1 1 c, g dbSNP:191461182
40 40 c, g dbSNP:537661092
45 45 a, c dbSNP:575545299
127 127 a, g dbSNP:148037229
128 128 c, g dbSNP:571740212
156 156 a, t dbSNP:566646268
161 161 a, g dbSNP:552704079
204 204 -, a dbSNP:143358407
212 212 -, a, aaaaa dbSNP:201326846
261 261 -, g dbSNP:750221530
311 311 c, t dbSNP:758818669
314 314 c, t dbSNP:536067694
379 379 g, t dbSNP:773829656
399 399 a, c dbSNP:567495200
422 422 g, t dbSNP:550600182
426 426 a, g dbSNP:530864567
433 433 a, g dbSNP:187698573
459 459 c, g dbSNP:769956721
476 476 -, t dbSNP:759370405
477 477 g, t dbSNP:746810590
492 492 c, g dbSNP:779053891
495 495 c, g dbSNP:753172573
497 497 g, t dbSNP:749403510
500 500 a, g dbSNP:183466656
502 502 c, t dbSNP:756617602
507 507 -, t dbSNP:774394987
511 511 a, g dbSNP:746427352
517 517 g, t dbSNP:781714885
519 519 a, g dbSNP:757607646
534 534 a, c dbSNP:751916285
536 536 a, g dbSNP:763867872
543 543 c, t dbSNP:758071328
549 549 g, t dbSNP:752272115
552 552 -, ga dbSNP:770758853
552 552 c, g dbSNP:764775560
553 553 a, c dbSNP:759086365
556 556 a, c dbSNP:141809711
556 556 -, c dbSNP:748893574
563 563 c, g, t dbSNP:760428342
571 571 g, t dbSNP:528163276
577 577 a, g dbSNP:768891304
583 583 a, c dbSNP:749444314
586 586 a, g dbSNP:142399417
590 590 a, g dbSNP:769918348
600 600 c, g dbSNP:745938049
604 604 a, g dbSNP:540778067
616 616 c, g dbSNP:145502430
619 619 a, t dbSNP:747353373
620 620 a, c, t dbSNP:139524567
621 621 g, t dbSNP:142360191
622 622 c, g dbSNP:758130481
645 645 g, t dbSNP:371444849
648 648 c, g dbSNP:764972732
651 651 g, t dbSNP:544555927
661 661 a, g dbSNP:753358460
671 671 c, g dbSNP:766259685
678 678 c, t dbSNP:760613323
682 682 a, g dbSNP:772546225
685 685 a, g dbSNP:767365461
701 701 a, g dbSNP:761581552
707 707 a, t dbSNP:775737376
709 709 a, g dbSNP:770023258
710 710 a, g, t dbSNP:776721424
717 717 c, g dbSNP:771353388
739 739 c, t dbSNP:201211209
741 741 c, g dbSNP:778423242
753 753 g, t dbSNP:772626492
754 754 a, g dbSNP:748504917
755 755 c, t dbSNP:778748357
757 757 a, c dbSNP:754621113
758 758 a, g dbSNP:201711185
761 761 g, t dbSNP:779561114
773 773 c, g dbSNP:755574147
775 775 c, t dbSNP:750417362
778 778 c, t dbSNP:146286104
779 779 a, g dbSNP:148255740
781 781 a, g dbSNP:751310288
788 788 g, t dbSNP:765395986
803 803 a, g dbSNP:759742640
808 808 a, g dbSNP:776575429
815 815 c, g dbSNP:771111029
820 820 a, g dbSNP:760826615
822 822 c, t dbSNP:773908957
829 829 a, g dbSNP:367695439
831 831 c, t dbSNP:748555567
838 838 c, g dbSNP:779288471
845 845 a, g dbSNP:143048518
848 848 a, g dbSNP:575258704
866 866 a, g, t dbSNP:775050181
869 869 a, g dbSNP:143139340
878 878 a, g dbSNP:570595605
879 879 c, t dbSNP:539997368
880 880 c, g dbSNP:766659472
882 882 a, g dbSNP:756356569
883 883 a, c dbSNP:750544831
884 884 a, g dbSNP:374973001
895 895 a, g dbSNP:371758468
901 901 c, t dbSNP:774969090
923 923 a, c dbSNP:138398367
925 925 a, c, g dbSNP:775668792
926 926 c, t dbSNP:769445617
929 929 a, g dbSNP:368021145
931 931 a, g dbSNP:745454095
934 934 a, c dbSNP:776259426
937 937 c, g dbSNP:770488406
941 941 a, c dbSNP:77489551
943 943 -, c dbSNP:377246802
943 943 c, t dbSNP:141586740
944 944 a, g, t dbSNP:368884916
948 948 c, t dbSNP:748002247
967 967 c, t dbSNP:563469250
968 968 a, g dbSNP:775563326
969 969 a, g dbSNP:769534382
985 985 a, g dbSNP:745651959
990 990 a, g dbSNP:776582325
991 991 c, t dbSNP:370122762
993 993 a, g, t dbSNP:200807086
996 996 c, t dbSNP:778906272
997 997 a, g dbSNP:755485203
1001 1001 a, g dbSNP:749863070
1008 1008 c, g dbSNP:780601000
1017 1017 c, t dbSNP:377507377
1023 1023 a, g dbSNP:750757958
1025 1025 a, t dbSNP:767095377
1037 1037 g, t dbSNP:756908565
1038 1038 c, t dbSNP:751115237
1039 1039 a, g dbSNP:763763262
1044 1044 c, g dbSNP:773800207
1052 1052 c, g dbSNP:150279108
1060 1060 a, g dbSNP:775337669
1065 1065 c, t dbSNP:190884285
1068 1068 c, t dbSNP:759283551
1070 1070 c, t dbSNP:776439947
1071 1071 c, t dbSNP:564130566
1073 1073 a, g, t dbSNP:61742800
1078 1078 g, t dbSNP:139843075
1085 1085 a, c, g dbSNP:61746260
1089 1089 c, t dbSNP:754442577
1092 1092 c, g dbSNP:753874810
1096 1096 c, t dbSNP:766285924
1098 1098 c, t dbSNP:781416983
1109 1109 a, g dbSNP:760506334
1112 1112 a, g dbSNP:750182240
1113 1113 c, g dbSNP:764310808
1115 1115 a, c, t dbSNP:368189937
1122 1122 c, t dbSNP:769970433
1123 1123 a, g dbSNP:559812737
1124 1124 c, g dbSNP:777318234
1125 1125 a, g dbSNP:771522290
1128 1128 a, g dbSNP:747398888
1136 1136 c, t dbSNP:149314563
1137 1137 a, g dbSNP:771693536
1140 1140 a, g dbSNP:139638476
1145 1145 c, t dbSNP:747901875
1162 1162 c, t dbSNP:78610875
1169 1169 c, g dbSNP:201752505
1171 1171 a, g dbSNP:140125221
1179 1179 a, g, t dbSNP:562279477
1181 1181 c, t dbSNP:755984353
1184 1184 c, g, t dbSNP:750221140
1185 1185 a, g dbSNP:767363482
1190 1190 a, g dbSNP:756986553
1193 1193 c, t dbSNP:753011416
1194 1194 c, g dbSNP:765346622
1195 1195 a, g dbSNP:759691772
1201 1201 c, t dbSNP:776802575
1202 1202 a, g dbSNP:767008377
1203 1203 c, t dbSNP:761198936
1205 1205 a, c, g dbSNP:772547083
1216 1216 a, g dbSNP:138385635
1217 1217 a, g dbSNP:61742506
1220 1220 c, t dbSNP:768156669
1223 1223 a, g dbSNP:748822385
1230 1230 c, g dbSNP:779470078
1233 1233 c, t dbSNP:755613904
1234 1234 a, g dbSNP:183105608
1235 1235 c, t dbSNP:143246754
1236 1236 a, g dbSNP:112374307
1241 1241 a, g dbSNP:199930661
1248 1248 a, g dbSNP:577440048
1249 1249 a, g dbSNP:765516871
1251 1251 -, gga dbSNP:779526201
1257 1257 c, t dbSNP:146167545
1260 1260 c, t dbSNP:753972545
1261 1261 c, g dbSNP:766635354
1262 1262 c, t dbSNP:760824531
1285 1285 a, g dbSNP:200095160
1288 1288 a, g dbSNP:777753211
1289 1289 c, g dbSNP:772043382
1290 1290 c, t dbSNP:747923821
1291 1291 a, g dbSNP:149211419
1292 1292 a, t dbSNP:62255275
1294 1294 a, t dbSNP:62255274
1297 1297 c, g dbSNP:781192018
1302 1302 a, g dbSNP:757343709
1313 1313 a, g dbSNP:113860090
1314 1314 c, g dbSNP:764628695
1315 1315 -, ac dbSNP:777952312
1329 1329 a, c dbSNP:763338326
1332 1332 a, c dbSNP:753009484
1337 1337 a, c, t dbSNP:759120883
1346 1346 a, t dbSNP:776343084
1349 1349 g, t dbSNP:770405336
1350 1350 c, t dbSNP:760212640
1356 1356 a, c dbSNP:773064855
1359 1359 c, t dbSNP:367935350
1360 1360 a, g dbSNP:754035480
1364 1364 a, c dbSNP:778797183
1366 1366 c, g, t dbSNP:766571470
1367 1367 c, t dbSNP:746131400
1368 1368 c, t dbSNP:781449058
1372 1372 a, g dbSNP:551839860
1373 1373 c, g, t dbSNP:144187343
1374 1374 a, g dbSNP:778274312
1375 1375 c, g dbSNP:758842788
1388 1388 a, c dbSNP:532649444
1392 1392 c, g dbSNP:765655565
1404 1404 a, g dbSNP:755358043
1405 1405 c, t dbSNP:753482867
1408 1408 c, t dbSNP:766025451
1420 1420 c, g dbSNP:760136006
1425 1425 c, t dbSNP:772731335
1433 1433 c, g dbSNP:764443081
1434 1434 g, t dbSNP:139693944
1435 1435 c, t dbSNP:761779432
1438 1438 a, c, t dbSNP:768617095
1452 1452 c, g dbSNP:373784095
1460 1460 a, g dbSNP:749076951
1462 1462 a, t dbSNP:370045288
1463 1463 c, t dbSNP:771135103
1472 1472 a, g dbSNP:747071272
1474 1474 a, g dbSNP:777762657
1487 1487 c, t dbSNP:758467633
1499 1499 c, g, t dbSNP:554948124
1500 1500 a, g dbSNP:267599924
1506 1506 a, g dbSNP:780402959
1509 1509 a, g dbSNP:147479917
1519 1519 g, t dbSNP:750145909
1522 1522 c, g dbSNP:780955981
1543 1543 a, c dbSNP:75366414
1545 1545 a, g dbSNP:751062081
1545 1545 -, g dbSNP:771577175
1548 1548 a, g dbSNP:139168216
1549 1549 c, t dbSNP:762879969
1557 1557 a, t dbSNP:201638232
1558 1558 a, g dbSNP:752573026
1570 1570 c, g dbSNP:765136787
1587 1587 c, t dbSNP:770373306
1590 1590 a, c dbSNP:746246071
1591 1591 a, g dbSNP:373310025
1596 1596 g, t dbSNP:562464347
1597 1597 a, c dbSNP:746716247
1601 1601 a, t dbSNP:763041850
1609 1609 a, c dbSNP:757966074
1611 1611 a, g dbSNP:747572076
1614 1614 a, g dbSNP:779948920
1616 1616 c, t dbSNP:755930868
1619 1619 c, t dbSNP:750132743
1620 1620 g, t dbSNP:764387561
1622 1622 a, c dbSNP:758480890
1633 1633 a, g dbSNP:752957965
1636 1636 a, g dbSNP:765463916
1657 1657 a, g dbSNP:141859891
1658 1658 c, t dbSNP:754436739
1659 1659 a, c dbSNP:766953209
1662 1662 c, t dbSNP:200052209
1667 1667 c, t dbSNP:761124349
1675 1675 a, g dbSNP:770670822
1685 1685 a, g dbSNP:536268252
1686 1686 c, g dbSNP:371147983
1688 1688 c, t dbSNP:755194226
1689 1689 a, c dbSNP:71306764
1701 1701 c, t dbSNP:753972519
1705 1705 a, g dbSNP:371020345
1715 1715 c, t dbSNP:756207965
1720 1720 c, t dbSNP:750943411
1721 1721 a, g dbSNP:376567111
1722 1722 a, g dbSNP:768041548
1731 1731 a, g dbSNP:757597540
1733 1733 -, ttg dbSNP:755165852
1737 1737 a, g dbSNP:751860252
1740 1740 -, gc dbSNP:750235390
1740 1740 a, g dbSNP:763737873
1743 1743 -, gcagcagcagca dbSNP:764065719
1743 1743 a, g dbSNP:762658149
1743 1743 -, g dbSNP:778632457
1745 1745 -, aca dbSNP:757214305
1746 1746 -, gcagcagca dbSNP:760160586
1746 1746 a, g dbSNP:567255206
1747 1747 -, agc dbSNP:113562374
1749 1749 a, g dbSNP:373485504
1750 1750 c, t dbSNP:764696072
1751 1751 a, c dbSNP:759065901
1752 1752 -, gca dbSNP:752246689
1752 1752 a, g dbSNP:536744103
1754 1754 -, gca dbSNP:753810856
1755 1755 a, g dbSNP:62642828
1758 1758 c, g dbSNP:770861590
1761 1761 a, g dbSNP:571281009
1762 1762 c, t dbSNP:773082777
1764 1764 a, g dbSNP:552500635
1767 1767 -, acagcagcagcagcagcagca dbSNP:752160270
1767 1767 -, acagcagcagcagca dbSNP:749065626
1767 1767 -, acagcagcagca dbSNP:747189565
1767 1767 -, acagcagca dbSNP:770334052
1767 1767 -, acagca dbSNP:374381483
1767 1767 -, aca dbSNP:759014969
1767 1767 a, g dbSNP:79701778
1770 1770 a, g dbSNP:139785185
1771 1771 a, g dbSNP:62637700
1773 1773 -, gagcag dbSNP:773650078
1778 1778 -, aca, acagcagcagcagca dbSNP:768891436
1778 1778 a, t dbSNP:756194119
1779 1779 a, g dbSNP:148523603
1780 1780 -, ggc dbSNP:780215714
1781 1781 -, tca dbSNP:757089424
1787 1787 a, g dbSNP:745907451
1789 1789 -, cagcagcag dbSNP:773562577
1793 1793 -, aca dbSNP:754508342
1794 1794 -, cag dbSNP:773463513
1795 1795 -, cag dbSNP:754983379
1795 1795 -, cgc dbSNP:766116391
1797 1797 -, cag, cagcag, cagcagcag, cagcagcagcagcag dbSNP:142043619
1798 1798 -, a dbSNP:113903140
1814 1814 a, g dbSNP:758785638
1816 1816 g, t dbSNP:144417292
1828 1828 c, g dbSNP:148740667
1829 1829 c, t dbSNP:778434612
1830 1830 c, t dbSNP:369631356
1831 1831 a, g dbSNP:754600873
1839 1839 a, t dbSNP:753419226
1840 1840 c, g dbSNP:544009720
1844 1844 a, t dbSNP:760229586
1845 1845 -, c dbSNP:35870506
1856 1856 c, t dbSNP:546485283
1863 1863 c, g dbSNP:374965219
1868 1868 c, g dbSNP:761728260
1879 1879 a, g dbSNP:774125461
1888 1888 c, g dbSNP:768326556
1898 1898 a, g, t dbSNP:374712093
1899 1899 c, t dbSNP:763992234
1900 1900 a, c dbSNP:762636765
1905 1905 c, g dbSNP:368660739
1907 1907 c, t dbSNP:771103644
1919 1919 a, g dbSNP:113401632
1921 1921 a, c dbSNP:763905797
1929 1929 a, g, t dbSNP:531375857
1935 1935 a, g dbSNP:772125695
1941 1941 a, g dbSNP:201982289
1951 1951 a, g dbSNP:779256461
1954 1954 a, g dbSNP:769112594
1955 1955 a, g dbSNP:749564086
1960 1960 c, t dbSNP:779881861
1961 1961 a, g dbSNP:375653415
1971 1971 c, t dbSNP:762742605
1972 1972 c, t dbSNP:745380892
1973 1973 a, g dbSNP:201982358
1977 1977 c, g dbSNP:780920935
1988 1988 c, t dbSNP:756694536
1989 1989 a, g dbSNP:61743171
1993 1993 -, g dbSNP:139731079
1998 1998 a, g dbSNP:199600521
2010 2010 c, t dbSNP:200070294
2015 2015 a, g dbSNP:111361698
2026 2026 a, c dbSNP:758245838
2030 2030 a, g dbSNP:377531675
2038 2038 a, g dbSNP:752423135
2043 2043 a, g dbSNP:55922341
2044 2044 -, t dbSNP:35212095
2048 2048 g, t dbSNP:760945768
2058 2058 a, g dbSNP:773417905
2070 2070 a, g dbSNP:767673510
2084 2084 a, t dbSNP:764671209
2087 2087 g, t dbSNP:763609622
2088 2088 a, c, g dbSNP:770334832
2092 2092 a, g dbSNP:746188828
2105 2105 a, t dbSNP:776381036
2107 2107 a, g dbSNP:770425564
2108 2108 c, g dbSNP:746542949
2111 2111 a, g dbSNP:777207513
2112 2112 c, t dbSNP:146306962
2126 2126 c, g dbSNP:748123559
2127 2127 a, g dbSNP:139017628
2129 2129 a, g dbSNP:148219481
2133 2133 g, t dbSNP:754789266
2148 2148 a, c dbSNP:753587094
2149 2149 c, t dbSNP:149029305
2153 2153 a, g dbSNP:757359782
2159 2159 c, t dbSNP:751789399
2175 2175 c, t dbSNP:764124302
2176 2176 a, g dbSNP:763107470
2178 2178 a, g dbSNP:753281889
2185 2185 c, g dbSNP:765802964
2186 2186 a, g dbSNP:541538402
2190 2190 c, g dbSNP:759984526
2195 2195 a, g dbSNP:776804460
2210 2210 c, g dbSNP:771313266
2211 2211 c, t dbSNP:529538780
2217 2217 c, t dbSNP:772888608
2231 2231 a, g dbSNP:200287562
2236 2236 a, g dbSNP:747606279
2237 2237 a, g dbSNP:778851077
2245 2245 a, g dbSNP:779140386
2247 2247 c, t dbSNP:768511167
2249 2249 c, t dbSNP:373058271
2250 2250 a, g dbSNP:779766712
2261 2261 -, t dbSNP:777565108
2274 2274 a, g dbSNP:755929470
2281 2281 a, g dbSNP:751781676
2283 2283 g, t dbSNP:778007666
2290 2290 c, g dbSNP:199909322
2298 2298 c, t dbSNP:752760877
2302 2302 a, g dbSNP:765854246
2303 2303 a, t dbSNP:369326360
2311 2311 g, t dbSNP:760178542
2321 2321 a, g dbSNP:754366310
2322 2322 g, t dbSNP:766693602
2330 2330 c, t dbSNP:761079131
2331 2331 a, g dbSNP:772759022
2333 2333 a, g dbSNP:116889308
2336 2336 a, c dbSNP:747607313
2342 2342 a, g dbSNP:146937131
2343 2343 c, t dbSNP:768136777
2346 2346 c, t dbSNP:749247938
2350 2350 a, g dbSNP:775480118
2353 2353 g, t dbSNP:769503539
2354 2354 a, t dbSNP:745637611
2356 2356 a, g dbSNP:141393129
2365 2365 a, c dbSNP:758636836
2367 2367 c, t dbSNP:201190085
2369 2369 a, g dbSNP:144404010
2375 2375 c, t dbSNP:755079504
2376 2376 a, g dbSNP:374829436
2379 2379 c, t dbSNP:766859969
2380 2380 a, g dbSNP:151058544
2383 2383 a, g dbSNP:146288848
2393 2393 g, t dbSNP:767167390
2399 2399 a, g dbSNP:761508333
2401 2401 g, t dbSNP:773984298
2405 2405 a, g dbSNP:200229876
2406 2406 c, t dbSNP:762480795
2418 2418 a, t dbSNP:775325477
2419 2419 c, g dbSNP:769707840
2436 2436 c, t dbSNP:745667443
2449 2449 a, c dbSNP:776627583
2458 2458 a, g dbSNP:770847623
2464 2464 a, g dbSNP:748421084
2475 2475 c, g dbSNP:774387985
2477 2477 a, g dbSNP:779253317
2482 2482 c, t dbSNP:368984076
2485 2485 a, g, t dbSNP:558455871
2487 2487 a, g dbSNP:140177021
2503 2503 a, g dbSNP:750913226
2505 2505 c, t dbSNP:767932318
2506 2506 a, g, t dbSNP:751238481
2511 2511 c, t dbSNP:763699163
2513 2513 a, g dbSNP:762378009
2515 2515 c, t dbSNP:775011550
2525 2525 a, g dbSNP:764641378
2529 2529 c, t dbSNP:146167183
2541 2541 a, t dbSNP:375879494
2542 2542 c, g dbSNP:372931447
2562 2562 a, g dbSNP:150460861
2565 2565 c, g dbSNP:141668371
2567 2567 a, g dbSNP:376397867
2572 2572 c, t dbSNP:572325988
2583 2583 a, g dbSNP:112604755
2595 2595 a, g dbSNP:749340270
2598 2598 a, g dbSNP:780235099
2599 2599 a, g dbSNP:769754175
2603 2603 a, g dbSNP:746412433
2604 2604 g, t dbSNP:781646475
2613 2613 c, t dbSNP:181012033
2614 2614 a, g, t dbSNP:777307822
2615 2615 c, t dbSNP:535566803
2620 2620 a, g dbSNP:751502191
2628 2628 c, t dbSNP:764843699
2633 2633 a, g dbSNP:758948172
2643 2643 a, g dbSNP:61754217
2645 2645 a, c dbSNP:766377026
2646 2646 c, t dbSNP:555946241
2655 2655 g, t dbSNP:773082850
2658 2658 g, t dbSNP:771747868
2665 2665 a, c, g dbSNP:775542045
2674 2674 c, g dbSNP:375975939
2676 2676 a, g dbSNP:745912189
2691 2691 a, g dbSNP:373238688
2694 2694 a, g dbSNP:78696431
2696 2696 a, g, t dbSNP:570431400
2703 2703 g, t dbSNP:377199908
2706 2706 a, g dbSNP:144985354
2722 2722 a, g dbSNP:772391343
2723 2723 a, g dbSNP:748558147
2725 2725 c, t dbSNP:774636249
2738 2738 c, t dbSNP:762292211
2739 2739 a, g dbSNP:774963838
2756 2756 a, g dbSNP:769187520
2773 2773 c, t dbSNP:763358402
2775 2775 c, t dbSNP:775311588
2776 2776 a, g dbSNP:769516378
2784 2784 c, t dbSNP:375524346
2790 2790 c, t dbSNP:564591215
2791 2791 c, t dbSNP:780637413
2792 2792 a, g dbSNP:770448480
2805 2805 a, g dbSNP:367984135
2808 2808 a, g dbSNP:746969064
2823 2823 c, t dbSNP:777639807
2824 2824 a, c dbSNP:61740330
2825 2825 c, g dbSNP:752424969
2826 2826 a, g dbSNP:780266409
2829 2829 a, g dbSNP:756347559
2831 2831 g, t dbSNP:201132775
2832 2832 g, t dbSNP:558577754
2838 2838 c, t dbSNP:538890441
2847 2847 a, g dbSNP:752131188
2855 2855 a, g dbSNP:374454357
2870 2870 a, g dbSNP:572527250
2892 2892 c, g dbSNP:776057848
2899 2899 a, c dbSNP:770193154
2900 2900 a, c dbSNP:759154568
2905 2905 a, c dbSNP:746590380
2922 2922 c, g dbSNP:776328637
2925 2925 c, g dbSNP:770370338
2928 2928 c, t dbSNP:746483958
2939 2939 a, g dbSNP:777693118
2948 2948 a, g, t dbSNP:180991722
2950 2950 c, t dbSNP:778744814
2952 2952 c, t dbSNP:768353148
2953 2953 a, g dbSNP:749067256
2955 2955 a, g dbSNP:781271761
2961 2961 a, t dbSNP:143586931
2969 2969 c, t dbSNP:747233154
2970 2970 a, g, t dbSNP:770992534
2972 2972 a, c, t dbSNP:141982446
2973 2973 a, g dbSNP:189599108
2975 2975 a, g dbSNP:148592085
2977 2977 c, t dbSNP:766642379
2979 2979 g, t dbSNP:760385793
2986 2986 g, t dbSNP:201645519
2993 2993 c, g dbSNP:767062949
2995 2995 c, g dbSNP:761260561
3001 3001 -, ga dbSNP:139764373
3007 3007 a, t dbSNP:774183335
3008 3008 a, c dbSNP:768568989
3014 3014 c, t dbSNP:370772572
3015 3015 a, g dbSNP:200026736
3021 3021 c, t dbSNP:769684424
3032 3032 c, t dbSNP:747286701
3033 3033 a, c, g dbSNP:574583271
3037 3037 c, g dbSNP:377256709
3046 3046 c, t dbSNP:201912749
3060 3060 c, t dbSNP:780489292
3069 3069 a, g dbSNP:756501564
3078 3078 g, t dbSNP:750716620
3114 3114 a, g dbSNP:780834760
3115 3115 c, t dbSNP:756990030
3121 3121 a, g dbSNP:751143382
3145 3145 a, g dbSNP:376560565
3147 3147 a, g dbSNP:764830580
3162 3162 c, t dbSNP:755036583
3164 3164 a, t dbSNP:753798139
3165 3165 c, t dbSNP:766323717
3168 3168 c, t dbSNP:760336137
3171 3171 c, t dbSNP:147385291
3172 3172 a, g dbSNP:764151093
3175 3175 c, t dbSNP:371939525
3176 3176 a, g dbSNP:375197593
3178 3178 c, t dbSNP:200690850
3180 3180 a, g dbSNP:150093034
3182 3182 c, g dbSNP:201936743
3186 3186 c, t dbSNP:771359940
3202 3202 c, t dbSNP:557781972
3215 3215 c, t dbSNP:541514140
3224 3224 c, t dbSNP:375183927
3242 3242 c, t dbSNP:747801179
3249 3249 a, c dbSNP:778609250
3257 3257 g, t dbSNP:754512219
3264 3264 a, g dbSNP:753846981
3282 3282 c, t dbSNP:534515783
3292 3292 a, g dbSNP:755937804
3293 3293 c, t dbSNP:750128468
3294 3294 a, g dbSNP:565704580
3296 3296 c, t dbSNP:763226685
3299 3299 a, g dbSNP:140857612
3301 3301 c, t dbSNP:765325696
3310 3310 g, t dbSNP:759574344
3317 3317 c, t dbSNP:200362587
3318 3318 a, g dbSNP:771285835
3321 3321 g, t dbSNP:571060062
3322 3322 c, g dbSNP:768361954
3326 3326 a, g dbSNP:748935727
3330 3330 c, t dbSNP:779496276
3336 3336 a, c, t dbSNP:370716808
3337 3337 a, g dbSNP:143546019
3340 3340 a, g dbSNP:757052038
3347 3347 c, t dbSNP:202069482
3352 3352 a, g dbSNP:777531492
3353 3353 c, t dbSNP:560981424
3354 3354 c, t dbSNP:755264631
3359 3359 c, g dbSNP:754063810
3367 3367 a, g dbSNP:766421426
3368 3368 a, g dbSNP:143734705
3373 3373 a, g dbSNP:527701578
3376 3376 a, c dbSNP:768067706
3380 3380 c, t dbSNP:141306692
3382 3382 a, g dbSNP:774910493
3383 3383 c, t dbSNP:764548432
3384 3384 c, t dbSNP:201017105
3387 3387 a, g dbSNP:764500887
3388 3388 c, t dbSNP:769219782
3397 3397 c, g dbSNP:745320055
3402 3402 a, g dbSNP:531832718
3403 3403 c, t dbSNP:770913746
3404 3404 a, g dbSNP:368569997
3405 3405 c, t dbSNP:149984668
3406 3406 a, c dbSNP:758170584
3407 3407 c, t dbSNP:763320183
3410 3410 c, g, t dbSNP:201945322
3411 3411 g, t dbSNP:756151040
3415 3415 a, g dbSNP:750455235
3417 3417 c, g dbSNP:200157567
3429 3429 a, g dbSNP:553795607
3437 3437 c, t dbSNP:757905500
3438 3438 a, c, g, t dbSNP:763326793
3446 3446 c, t dbSNP:775012081
3450 3450 c, t dbSNP:764888683
3453 3453 c, t dbSNP:748055573
3457 3457 a, g dbSNP:759097317
3465 3465 c, t dbSNP:776191948
3471 3471 c, t dbSNP:150916367
3483 3483 c, t dbSNP:747001044
3486 3486 c, t dbSNP:773086494
3488 3488 c, g dbSNP:140952372
3489 3489 a, g dbSNP:540491557
3495 3495 c, t dbSNP:370681942
3499 3499 a, g dbSNP:756412481
3504 3504 -, cagcaccgtggt dbSNP:746051828
3514 3514 c, g dbSNP:138724998
3518 3518 a, g dbSNP:746069792
3524 3524 a, g dbSNP:781460712
3525 3525 c, t dbSNP:574379618
3528 3528 c, t dbSNP:752133128
3529 3529 a, g dbSNP:149468264
3532 3532 a, g dbSNP:199554026
3538 3538 c, t dbSNP:150383800
3539 3539 a, g dbSNP:140787779
3543 3543 c, t dbSNP:377474846
3561 3561 c, t dbSNP:370394890
3568 3568 a, g dbSNP:753471850
3576 3576 a, g dbSNP:765899118
3579 3579 -, gtgtcc dbSNP:772909693
3589 3589 a, g dbSNP:760140821
3594 3594 c, t dbSNP:373125823
3599 3599 a, c dbSNP:771985580
3605 3605 a, c dbSNP:761639684
3609 3609 c, t dbSNP:144800395
3625 3625 c, t dbSNP:756672225
3627 3627 c, t dbSNP:369447858
3632 3632 c, t dbSNP:763870274
3634 3634 a, g dbSNP:762972419
3648 3648 a, t dbSNP:756817148
3653 3653 a, g dbSNP:765094156
3654 3654 g, t dbSNP:761027431
3668 3668 c, g dbSNP:773262025
3673 3673 a, g dbSNP:772228910
3678 3678 c, t dbSNP:748111931
3679 3679 c, t dbSNP:774938423
3680 3680 a, g dbSNP:142788987
3694 3694 a, c dbSNP:749789614
3706 3706 c, t dbSNP:201650657
3713 3713 g, t dbSNP:780434014
3715 3715 c, g dbSNP:756445885
3716 3716 a, c dbSNP:745555624
3720 3720 a, c dbSNP:780666116
3728 3728 a, g dbSNP:756795614
3731 3731 c, g dbSNP:376161036
3740 3740 a, g dbSNP:774033144
3762 3762 a, g dbSNP:763656004
3765 3765 c, t dbSNP:758449858
3772 3772 a, g dbSNP:371746914
3773 3773 a, g dbSNP:145856320
3774 3774 a, g dbSNP:752660776
3778 3778 a, g dbSNP:765149482
3779 3779 c, t dbSNP:554050964
3780 3780 a, g dbSNP:773492897
3787 3787 a, g dbSNP:767581703
3795 3795 c, t dbSNP:762078815
3799 3799 c, t dbSNP:774357236
3800 3800 a, g dbSNP:768689132
3811 3811 a, g dbSNP:749840027
3814 3814 g, t dbSNP:775925540
3824 3824 c, t dbSNP:574932979
3825 3825 a, g dbSNP:149841839
3827 3827 a, t dbSNP:147286102
3829 3829 a, g dbSNP:768079102
3846 3846 c, t dbSNP:748764569
3852 3852 a, g dbSNP:561570190
3853 3853 a, g dbSNP:769827275
3856 3856 a, t dbSNP:745800026
3862 3862 a, t dbSNP:781014591
3865 3865 a, g dbSNP:756997508
3867 3867 c, t dbSNP:748403286
3874 3874 -, aca dbSNP:746906102
3877 3877 c, t dbSNP:779125903
3879 3879 c, t dbSNP:755030000
3884 3884 c, t dbSNP:754010597
3887 3887 c, t dbSNP:77560728
3897 3897 a, g dbSNP:756728787
3899 3899 a, c, t dbSNP:768012585
3908 3908 c, t dbSNP:755667537
3914 3914 a, g dbSNP:781735668
3931 3931 c, g dbSNP:757707422
3950 3950 a, t dbSNP:752017880
3953 3953 a, t dbSNP:764361449
3955 3955 g, t dbSNP:762706081
3963 3963 a, g dbSNP:752243923
3964 3964 g, t dbSNP:764759916
3973 3973 a, c, g dbSNP:201532034
3974 3974 a, g dbSNP:764813698
3975 3975 a, g dbSNP:759177851
3999 3999 a, g dbSNP:140391670
4035 4035 a, c dbSNP:765847458
4043 4043 a, g dbSNP:572896098
4047 4047 a, g dbSNP:772970636
4064 4064 a, g dbSNP:767372794
4072 4072 c, t dbSNP:141617754
4073 4073 a, g dbSNP:775865692
4079 4079 c, g dbSNP:770197511
4083 4083 a, g dbSNP:746081738
4086 4086 c, t dbSNP:200297547
4087 4087 a, g dbSNP:770893503
4095 4095 a, c, g dbSNP:778076526
4098 4098 a, g dbSNP:758804981
4102 4102 c, g, t dbSNP:779247838
4124 4124 a, g dbSNP:113893379
4133 4133 c, t dbSNP:755291131
4136 4136 a, t dbSNP:748965783
4143 4143 c, t dbSNP:144745135
4146 4146 g, t dbSNP:200416805
4152 4152 c, t dbSNP:144451025
4172 4172 c, t dbSNP:749957286
4175 4175 a, g dbSNP:767047773
4181 4181 a, c, t dbSNP:370182220
4183 4183 c, g dbSNP:764002832
4188 4188 g, t dbSNP:762770187
4191 4191 g, t dbSNP:754126405
4196 4196 a, g dbSNP:766569102
4200 4200 c, t dbSNP:760949455
4204 4204 c, t dbSNP:760886450
4205 4205 a, g dbSNP:144736804
4207 4207 a, g dbSNP:773296837
4213 4213 c, t dbSNP:201117026
4220 4220 c, t dbSNP:138217245
4229 4229 a, c, g dbSNP:202003931
4236 4236 c, t dbSNP:61751923
4241 4241 c, t dbSNP:769401664
4245 4245 a, g dbSNP:745504590
4259 4259 a, c dbSNP:115182995
4262 4262 a, g dbSNP:748064535
4270 4270 c, g dbSNP:778839760
4273 4273 c, t dbSNP:778997395
4274 4274 a, g dbSNP:368993221
4275 4275 a, c, t dbSNP:199590961
4276 4276 a, c, g dbSNP:755039176
4278 4278 c, g dbSNP:764182268
4280 4280 c, g dbSNP:758465109
4282 4282 a, g dbSNP:149895880
4283 4283 c, t dbSNP:765830224
4288 4288 a, g, t dbSNP:372252686
4289 4289 a, g dbSNP:766826512
4304 4304 c, t dbSNP:760423671
4316 4316 c, g dbSNP:772956114
4317 4317 c, g dbSNP:771709988
4324 4324 c, g dbSNP:747632332
4325 4325 a, t dbSNP:773725399
4327 4327 -, c dbSNP:148202277
4327 4327 c, t dbSNP:768709936
4329 4329 c, t dbSNP:749153064
4330 4330 c, t dbSNP:779875559
4331 4331 c, g dbSNP:755857207
4341 4341 c, g dbSNP:747264518
4343 4343 c, t dbSNP:139105394
4344 4344 a, g, t dbSNP:752888572
4345 4345 c, t dbSNP:373087043
4350 4350 a, g dbSNP:755557334
4363 4363 c, t dbSNP:754346795
4366 4366 a, g dbSNP:766879624
4375 4375 a, c dbSNP:761051639
4380 4380 a, g dbSNP:142535854
4383 4383 a, c dbSNP:767254242
4385 4385 -, cac dbSNP:745355125
4385 4385 c, t dbSNP:752671181
4390 4390 a, g dbSNP:369284216
4394 4394 a, g dbSNP:773955229
4398 4398 a, g dbSNP:768031873
4407 4407 c, t dbSNP:762972100
4413 4413 a, g dbSNP:775367508
4421 4421 a, g dbSNP:769581565
4435 4435 a, t dbSNP:192423645
4436 4436 a, g dbSNP:780961185
4437 4437 c, t dbSNP:374891335
4449 4449 c, t dbSNP:748295432
4451 4451 a, g dbSNP:779070587
4452 4452 g, t dbSNP:754970655
4453 4453 a, g dbSNP:754398016
4470 4470 c, t dbSNP:201291352
4476 4476 g, t dbSNP:780645225
4477 4477 c, t dbSNP:756673268
4479 4479 a, g dbSNP:750888080
4484 4484 a, g dbSNP:765843799
4486 4486 c, g dbSNP:767747158
4488 4488 c, t dbSNP:200863149
4491 4491 c, g dbSNP:751127040
4498 4498 a, g dbSNP:763692539
4499 4499 c, t dbSNP:780292530
4518 4518 a, g dbSNP:775420448
4531 4531 c, g dbSNP:371334183
4534 4534 a, g dbSNP:544348166
4535 4535 a, g dbSNP:759437474
4542 4542 a, g dbSNP:776538913
4548 4548 c, g, t dbSNP:748431740
4555 4555 a, g dbSNP:778933016
4558 4558 a, g dbSNP:768791893
4561 4561 a, g dbSNP:760080102
4563 4563 c, t dbSNP:141542625
4568 4568 a, g dbSNP:780273082
4570 4570 a, g dbSNP:558561010
4575 4575 c, t dbSNP:368890215
4577 4577 a, g dbSNP:199909203
4588 4588 c, t dbSNP:757523874
4597 4597 c, t dbSNP:146045041
4607 4607 a, g dbSNP:763596169
4610 4610 c, g, t dbSNP:148072697
4611 4611 c, t dbSNP:201975771
4612 4612 c, t dbSNP:759490528
4618 4618 a, g dbSNP:142375705
4620 4620 c, t dbSNP:776391815
4621 4621 a, c, g, t dbSNP:773042890
4623 4623 c, t dbSNP:147123131
4624 4624 a, c dbSNP:749494789
4627 4627 a, g, t dbSNP:536453395
4630 4630 g, t dbSNP:140619230
4631 4631 c, t dbSNP:142406539
4635 4635 a, g dbSNP:757655358
4639 4639 a, t dbSNP:747390339
4644 4644 a, g dbSNP:201918063
4646 4646 a, g dbSNP:537179465
4650 4650 a, c dbSNP:750777961
4651 4651 a, g dbSNP:764756034
4653 4653 a, g dbSNP:754416898
4654 4654 a, g dbSNP:753823882
4657 4657 a, g dbSNP:766282453
4658 4658 a, g dbSNP:760652364
4660 4660 c, t dbSNP:772917639
4661 4661 a, g dbSNP:767401164
4667 4667 c, t dbSNP:763294631
4670 4670 c, t dbSNP:571243906
4687 4687 c, g dbSNP:770002282
4690 4690 c, t dbSNP:745880197
4700 4700 a, c dbSNP:776758597
4702 4702 -, c dbSNP:778690306
4716 4716 c, t dbSNP:771408778
4717 4717 c, t dbSNP:79971348
4718 4718 c, t dbSNP:747528094
4720 4720 c, t dbSNP:778133321
4722 4722 a, c dbSNP:772384564
4727 4727 g, t dbSNP:747802043
4736 4736 g, t dbSNP:778476779
4740 4740 c, t dbSNP:754609491
4750 4750 c, t dbSNP:753351918
4752 4752 c, g dbSNP:779581641
4761 4761 c, g dbSNP:756058727
4766 4766 a, g dbSNP:750330382
4769 4769 a, c, t dbSNP:761636491
4770 4770 c, t dbSNP:752983335
4772 4772 c, t dbSNP:199689289
4773 4773 a, c, g, t dbSNP:538884768
4776 4776 a, g dbSNP:770994040
4780 4780 a, c dbSNP:146708091
4781 4781 a, g dbSNP:368712377
4784 4784 a, g dbSNP:772437991
4785 4785 a, g dbSNP:199866884
4786 4786 g, t dbSNP:779242047
4788 4788 a, g dbSNP:201236076
4790 4790 -, gg dbSNP:756790346
4794 4794 c, g dbSNP:200637894
4797 4797 c, t dbSNP:200685812
4802 4802 c, g dbSNP:748944757
4803 4803 c, t dbSNP:375043389
4806 4806 c, g dbSNP:755614336
4807 4807 a, g dbSNP:766083821
4811 4811 a, g dbSNP:762533994
4817 4817 c, t dbSNP:567163793
4819 4819 c, g, t dbSNP:370430462
4829 4829 a, g, t dbSNP:763951532
4831 4831 c, g dbSNP:759698655
4836 4836 c, g dbSNP:754051443
4839 4839 c, t dbSNP:766372209
4840 4840 c, t dbSNP:376310060
4842 4842 -, cgagc dbSNP:778062138
4843 4843 a, g dbSNP:760749180
4857 4857 g, t dbSNP:773263998
4859 4859 a, g dbSNP:772629631
4863 4863 c, t dbSNP:762274991
4879 4879 a, g dbSNP:774743568
4880 4880 a, g, t dbSNP:748927229
4896 4896 c, t dbSNP:775146505
4900 4900 c, g dbSNP:769205130
4903 4903 c, g dbSNP:745429984
4907 4907 a, g dbSNP:757626815
4909 4909 a, g dbSNP:780845400
4914 4914 a, g dbSNP:757302518
4921 4921 c, g dbSNP:746922593
4922 4922 c, t dbSNP:777458552
4928 4928 a, g dbSNP:201195412
4933 4933 c, g dbSNP:139829422
4935 4935 c, t dbSNP:376367437
4936 4936 a, g dbSNP:769748546
4937 4937 a, g, t dbSNP:144133607
4945 4945 g, t dbSNP:750537588
4954 4954 c, t dbSNP:767559877
4959 4959 a, g dbSNP:762326391
4965 4965 c, g dbSNP:373197382
4974 4974 a, c dbSNP:774802749
4990 4990 a, g dbSNP:764373595
4994 4994 a, c dbSNP:763322801
4996 4996 g, t dbSNP:752024318
4998 4998 a, c dbSNP:775707857
5000 5000 a, g, t dbSNP:745485618
5014 5014 g, t dbSNP:745857251
5017 5017 a, g dbSNP:201086171
5022 5022 a, g dbSNP:746945278
5024 5024 a, g dbSNP:777708263
5026 5026 a, t dbSNP:758253746
5039 5039 a, g dbSNP:369386292
5040 5040 c, t dbSNP:566838271
5042 5042 g, t dbSNP:756374693
5043 5043 c, t dbSNP:750592552
5044 5044 a, g dbSNP:767619035
5051 5051 c, g dbSNP:757263313
5055 5055 a, g dbSNP:752025303
5058 5058 g, t dbSNP:200190351
5093 5093 c, t dbSNP:143597514
5101 5101 a, g dbSNP:530939706
5155 5155 a, c dbSNP:370683168
5179 5179 a, g dbSNP:564906908
5251 5251 c, t dbSNP:553874761
5281 5281 c, g dbSNP:770780706
5283 5283 g, t dbSNP:746768666
5314 5314 a, g dbSNP:573010357
5324 5324 g, t dbSNP:559599770
5328 5328 a, g dbSNP:759061789
5371 5371 a, t dbSNP:542601484
5392 5392 c, t dbSNP:188877308
5419 5419 a, t dbSNP:557222591
5454 5454 a, g dbSNP:537118218
5583 5583 c, t dbSNP:577831072
5617 5617 a, g dbSNP:766579184
5648 5648 a, g dbSNP:145472641
5659 5659 c, t dbSNP:145732685
5679 5679 c, t dbSNP:76436325
5694 5694 c, g dbSNP:778070911
5704 5704 g, t dbSNP:776041030
5712 5712 -, t dbSNP:372250601
5715 5715 -, t dbSNP:566284593
5736 5736 a, c dbSNP:1045730
5751 5751 a, g dbSNP:565587633
5762 5762 c, t dbSNP:533784348
5776 5776 a, c dbSNP:536576679
5783 5783 c, t dbSNP:760462328
5791 5791 a, g dbSNP:147583412
5798 5798 c, t dbSNP:144875664
5807 5807 a, g dbSNP:779085497
5812 5812 a, g dbSNP:530879181
5820 5820 a, g dbSNP:565045055
5850 5850 g, t dbSNP:551311964
5855 5855 c, g dbSNP:528480984
5889 5889 a, g dbSNP:559523706
5916 5916 c, t dbSNP:542887398
5940 5940 a, g dbSNP:773011249
5951 5951 a, c dbSNP:573876686
5986 5986 a, g dbSNP:141040288
6005 6005 a, g dbSNP:574446665
6094 6094 a, c dbSNP:185766757
6125 6125 a, g dbSNP:192830991
6128 6128 a, g dbSNP:151078305
6155 6155 a, g dbSNP:2061937
6169 6169 a, c dbSNP:555790520
6269 6269 a, g dbSNP:142975084
6279 6279 g, t dbSNP:536923391
6282 6282 c, t dbSNP:536192155
6283 6283 a, g dbSNP:567635477
6287 6287 a, g dbSNP:3796146
6294 6294 c, t dbSNP:182513824
6311 6311 c, g dbSNP:762467755
6351 6351 g, t dbSNP:775105136
6354 6354 c, g dbSNP:571553807
6372 6372 a, g dbSNP:191953095
6397 6397 c, t dbSNP:528277215
6450 6450 a, g dbSNP:528607575
6463 6463 g, t dbSNP:186767017
6504 6504 -, a dbSNP:559634584
6515 6515 c, t dbSNP:549126832
6521 6521 c, t dbSNP:556754224
6525 6525 a, g dbSNP:529148356
6544 6544 g, t dbSNP:563577490
6556 6556 a, g dbSNP:543787230
6582 6582 a, c dbSNP:749383467
6636 6636 a, g dbSNP:769336941
6656 6656 a, g dbSNP:182421493
6674 6674 a, g dbSNP:148578144
6696 6696 a, t dbSNP:368329278
6698 6698 a, g dbSNP:58844841
6718 6718 c, t dbSNP:572067003
6740 6740 a, c dbSNP:146306183
6789 6789 c, t dbSNP:375738388
6804 6804 a, g dbSNP:762097448
6843 6843 c, g dbSNP:545164123
6869 6869 c, t dbSNP:541470679
6904 6904 a, g dbSNP:547454135
6908 6908 a, g dbSNP:573947244
6931 6931 a, g dbSNP:373356165
6949 6949 a, t dbSNP:557226097
6964 6964 c, t dbSNP:537386960
6982 6982 g, t dbSNP:9831035
7019 7019 a, g dbSNP:558093485
7023 7023 a, g dbSNP:114100933
7058 7058 a, g dbSNP:746825011
7059 7059 -, c dbSNP:142195850
7067 7067 a, g dbSNP:140091543
7071 7071 a, g dbSNP:549313012
7073 7073 a, c, g dbSNP:369936028
7078 7078 a, g dbSNP:777391442
7089 7089 a, g dbSNP:772359808
7105 7105 a, g dbSNP:146090545
7106 7106 a, g dbSNP:550085814
7118 7118 a, g dbSNP:748428827
7138 7138 a, c dbSNP:149520750
7154 7154 c, t dbSNP:138036732
7166 7166 a, g dbSNP:540882905
7180 7180 c, g dbSNP:527340075
7244 7244 c, t dbSNP:561628886
7289 7289 c, t dbSNP:541953560
7304 7304 a, g dbSNP:192198128
7307 7307 c, t dbSNP:150764234
7311 7311 a, g dbSNP:543682802
7312 7312 a, t dbSNP:755171939
7322 7322 g, t dbSNP:577934744
7368 7368 c, g dbSNP:141365463
7387 7387 c, t dbSNP:578075238
7412 7412 a, g dbSNP:534912504
7543 7543 c, t dbSNP:138913167
7547 7547 a, g dbSNP:566310118
7551 7551 g, t dbSNP:187083945
7554 7554 a, g dbSNP:746025985
7555 7555 -, ta dbSNP:780101889
7555 7555 c, t dbSNP:145800109
7655 7655 c, t dbSNP:372725755
7704 7704 a, t dbSNP:527680829
7724 7724 a, g dbSNP:770699419
7751 7751 c, t dbSNP:184112846
7754 7754 c, g dbSNP:780716433
7772 7772 c, t dbSNP:377315480
7849 7849 a, g dbSNP:570045922

Target ORF information:

RefSeq Version XM_006713407
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
XM_006713407

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
ATGTCCAAAG TGATCCAGAA GAAGAACCAC TGGACTAGCA GGGTTCACGA ATGCACCGTG 
AAGCGGGGAC CCCAGGGCGA GCTGGGGGTG ACGGTGCTGG GAGGCGCGGA GCACGGGGAG
TTTCCGTACG TCGGAGCGGT GGCGGCGGTC GAGGCAGCGG GGCTTCCCGG CGGCGGCGAG
GGCCCGAGGC TGGGCGAAGG GGAGCTGCTT CTGGAGGTGC AGGGGGTCCG GGTGTCCGGC
TTGCCCCGCT ATGACGTGCT GGGGGTCATC GACAGCTGCA AGGAGGCCGT CACCTTCAAG
GCCGTCAGAC AAGGAGGAAG GCTGAACAAG GACCTGCGAC ATTTTCTCAA TCAGCGATTC
CAGAAGGGGT CTCCTGATCA TGAGCTCCAG CAGACCATAA GGGATAACCT TTACCGCCAT
GCTGTGCCTT GCACAACCCG ATCTCCCAGA GAAGGAGAAG TGCCTGGCGT GGACTATAAC
TTTCTGACTG TGAAGGAGTT CTTGGACCTC GAGCAGAGTG GGACTCTTCT GGAAGTCGGC
ACCTATGAAG GAAACTATTA TGGGACACCC AAGCCTCCTA GCCAGCCAGT CAGTGGGAAA
GTGATCACGA CGGATGCCTT GCACAGCCTT CAGTCTGGCT CTAAGCAGTC GACCCCGAAG
CGAACCAAGT CCTACAATGA TATGCAAAAT GCTGGCATAG TCCACGCGGA GAATGAGGAG
GAGGATGACG TTCCTGAAAT GAACAGCAGC TTTACAGCAG CCGATTCTGG TGAACAAGAG
GAGCACACTC TCCAAGAAAC AGCATTACCA CCTGTGAATA GTAGCATCAT CGCTGCTCCC
ATCACGGACC CTTCTCAGAA GTTCCCTCAA TACCTACCTC TTTCTGCAGA GGATAATTTA
GGTCCTCTAC CTGAAAACTG GGAGATGGCC TATACTGAAA ATGGAGAAGT CTATTTTATA
GACCATAACA CGAAAACAAC ATCTTGGTTA GACCCTCGGT GCCTAAACAA GCAGCAGAAG
CCACTGGAAG AGTGTGAAGA TGATGAAGAA GGGGTACACA CCGAGGAGCT GGACAGTGAA
CTAGAACTGC CTGCTGGTTG GGAAAAGATT GAAGACCCTG TCTATGGTAT CTACTATGTA
GACCACATCA ACAGGAAGAC ACAATATGAG AACCCGGTTC TAGAAGCCAA ACGGAAGAAG
CAGCTTGAGC AGCAGCAGCA GCAGCAACAG CAGCAGCAAC AGCAGCAGCA GCAGCAGCAG
CAGCAGCAGA CAGAAGAATG GACAGAAGAT CACTCAGCCC TTGTGCCTCC TGTTATTCCA
AACCACCCTC CAAGCAATCC AGAGCCAGCC AGAGAAGTTC CACTTCAGGG CAAACCCTTT
TTTACACGAA ACCCTTCTGA GTTGAAAGGC AAGTTCATTC ACACAAAGCT GCGGAAAAGC
AGTCGTGGCT TTGGCTTCAC GGTGGTTGGA GGGGATGAAC CTGATGAGTT TCTCCAGATC
AAGAGCTTGG TCCTAGATGG TCCTGCTGCA TTGGATGGCA AGATGGAAAC AGGGGATGTG
ATTGTAAGTG TGAATGACAC CTGTGTTTTG GGACACACAC ATGCTCAAGT TGTGAAGATC
TTCCAGTCCA TCCCCATTGG TGCCAGCGTG GACCTTGAAC TCTGCCGAGG TTATCCATTG
CCTTTTGATC CAGATGACCC CAATACAAGT TTAGTGACCT CGGTAGCCAT TTTGGATAAA
GAACCAATTA TTGTGAATGG GCAAGAGACC TATGATTCAC CAGCTAGCCA CAGTAGTAAA
ACAGGCAAAG TCAATGGCAT GAAGGATGCC AGGCCAAGCA GCCCAGCGGA CGTGGCTTCA
AATAGTTCTC ATGGTTATCC TAATGACACT GTTTCTTTGG CTTCCTCCAT AGCCACTCAG
CCAGAACTCA TAACTGTTCA TATTGTCAAA GGGCCAATGG GCTTTGGTTT TACTATCGCA
GACAGTCCTG GTGGGGGTGG CCAAAGAGTG AAACAGATTG TTGACAGCCC AAGGTGCCGA
GGCCTGAAAG AAGGGGATCT CATAGTGGAA GTTAATAAGA AGAACGTGCA GGCCCTAACT
CACAACCAAG TGGTGGATAT GCTGGTTGAG TGTCCTAAGG GAAGTGAGGT CACATTGTTG
GTGCAACGAG GAGGGCTGCC AGTTCCCAAG AAGAGCCCAA AGTCGCAACC ACTGGAAAGG
AAAGACAGCC AGAATAGTTC TCAGCACAGT GTTTCCAGCC ACCGAAGCCT GCACACAGCA
TCCCCAAGCC ACAGCACACA GGTGCTCCCC GAGTTCCCAC CTGCAGAGGC CCAAGCTCCA
GATCAAACTG ACAGCTCTGG CCAGAAAAAA CCAGATCCTT TTAAAATCTG GGCCCAGTCC
AGGAGCATGT ATGAAAACCG ACCTATGTCA CCTTCACCTG CGTCGGGATT GAGCAAGGGT
GAGAGAGAGA GAGAAATCAA TTCCACGAAT TTTGGAGAAT GTCCGATTCC AGATTACCAG
GAACAGGACA TCTTCCTCTG GAGAAAAGAG ACTGGATTTG GATTTAGGAT TCTGGGTGGA
AATGAACCAG GGGAACCTAT TTATATTGGT CACATCGTAC CACTGGGTGC TGCTGATACT
GACGGCCGCC TGAGGTCTGG AGATGAATTA ATCTGTGTGG ATGGGACGCC AGTAATTGGA
AAATCACACC AGCTTGTGGT CCAGCTTATG CAACAAGCTG CCAAGCAAGG CCACGTCAAT
CTCACGGTGC GGCGTAAAGT GGTTTTTGCG GTGCCCAAAA CCGAGAACGA GGTGCCCTCG
CCAGCCTCCT CTCATCACAG TAGCAACCAG CCGGCCTCGC TGACAGAAGA GAAGCGCACT
CCGCAGGGCA GCCAGAACTC GCTGAACACG GTGAGCTCGG GCAGCGGCAG CACCAGCGGC
ATCGGCAGTG GCGGCGGCGG GGGCAGCGGC GTGGTCAGCA CCGTGGTGCA GCCCTACGAC
GTGGAGATCC GGCGCGGGGA GAACGAGGGC TTCGGCTTCG TCATCGTGTC CTCGGTGAGC
AGGCCCGAAG CAGGCACGAC CTTTGCAGGC AATGCATGTG TGGCTATGCC TCACAAAATA
GGTCGGATTA TTGAGGGGAG CCCTGCTGAC CGCTGTGGCA AGCTGAAAGT AGGAGACCGG
ATCTTGGCAG TAAATGGATG TTCCATCACC AACAAATCCC ATTCAGACAT TGTGAACCTA
ATCAAGGAAG CGGGAAACAC AGTTACCCTC CGCATCATTC CTGGGGATGA GTCCTCGAAT
GCCACCTTGC TGACCAATGC AGAGAAGATT GCCACCATCA CCACCACACA CACCCCTTCT
CAGCAAGGGA CCCAGGAGAC AAGGAATACC ACCAAACCAA AGCAGGAATC TCAATTTGAG
TTCAAAGCAC CCCAAGCAAC ACAGGAGCAA GATTTTTACA CTGTGGAACT GGAAAGAGGA
GCCAAGGGAT TTGGCTTTAG CCTTCGAGGA GGCCGAGAGT ATAACATGGA CCTCTATGTT
CTGCGCTTAG CAGAGGACGG TCCTGCGGAG AGGTGTGGAA AGATGAGGAT TGGTGATGAA
ATTTTAGAGA TCAATGGTGA GACCACCAAA AACATGAAGC ATTCTCGAGC TATAGAACTG
ATTAAGAATG GTGGCCGCAG AGTTCGTCTG TTTCTGAAGC GGGGAGACGG CTCAGTACCA
GAATATGACC CCAGCAGCGA CCGCCACGGC CCCGCCACCG GTCCACAAGG TGTTCCGGAA
GTGAGGGCCG GGCCCGACCG CCGGCAGCAT CCGTCATTGG AGTCCAGTTA CCCACCCGAT
CTTCACAAAT CATCACCACA TGGGGAAAAG CGGGCACACG CAAGGGATCC GAAAGGCAGC
AGAGAGTATA GCAGACAACC CAATGAACAC CACACCTGGA ATGGGACTTC GAGGAAACCC
GACAGCGGGG CATGCCGACC CAAGGACCGG GCGCCGGAGG GACGGAGGGA CGCGCAGGCC
GAGCGCGCGG CAGCCGCCAA CGGCCCCAAG AGGCGGTCCC CAGAGAAGCG GAGGGAGGGC
ACCCGCAGCG CCGACAACAC TTTGGAGAGG AGGGAGAAGC ACGAGAAGAG ACGAGACGTC
TCTCCGGAGC GGAGGCGAGA GCGGTCACCC ACCCGCAGGA GAGACGGCTC CCCCAGCCGG
CGGAGACGGT CTCTGGAGAG ACTCCTGGAG CAGAGGAGGT CCCCCGAGCG CAGGAGAGGG
GGCTCGCCCG AGCGCAGGGC CAAGTCCACC GACCGGAGGC GCGCACGCTC CCCCGAGCGC
AGGAGAGAGC GGTCCCTGGA CAAAAGGAAC AGAGAGGACA GAGCCAGCCA CCGAGAAAGG
GAAGAGGCGA ATCTGAAACA GGATGCCGGC AGAAGTTCCA GACATCCCCC GGAGCAGAGA
AGGCGACCTT ACAAAGAATG TAGCACCGAC CTCAGTATCTT GA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu37584D
Sequence Information ORF Nucleotide Sequence (Length: 4479bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
ATGTCCAAAG TGATCCAGAA GAAGAACCAC TGGACTAGCA GGGTTCACGA ATGCACCGTG 
AAGCGGGGAC CCCAGGGCGA GCTGGGGGTG ACGGTGCTGG GAGGCGCGGA GCACGGGGAG
TTTCCGTACG TCGGAGCGGT GGCGGCGGTC GAGGCAGCGG GGCTTCCCGG CGGCGGCGAG
GGCCCGAGGC TGGGCGAAGG GGAGCTGCTT CTGGAGGTGC AGGGGGTCCG GGTGTCCGGC
TTGCCCCGCT ATGACGTGCT GGGGGTCATC GACAGCTGCA AGGAGGCCGT CACCTTCAAG
GCCGTCAGAC AAGGAGGAAG GCTGAACAAG GACCTGCGAC ATTTTCTCAA TCAGCGATTC
CAGAAGGGGT CTCCTGATCA TGAGCTCCAG CAGACCATAA GGGATAACCT TTACCGCCAT
GCTGTGCCTT GCACAACCCG ATCTCCCAGA GAAGGAGAAG TGCCTGGCGT GGACTATAAC
TTTCTGACTG TGAAGGAGTT CTTGGACCTC GAGCAGAGTG GGACTCTTCT GGAAGTCGGC
ACCTATGAAG GAAACTATTA TGGGACACCC AAGCCTCCTA GCCAGCCAGT CAGTGGGAAA
GTGATCACGA CGGATGCCTT GCACAGCCTT CAGTCTGGCT CTAAGCAGTC GACCCCGAAG
CGAACCAAGT CCTACAATGA TATGCAAAAT GCTGGCATAG TCCACGCGGA GAATGAGGAG
GAGGATGACG TTCCTGAAAT GAACAGCAGC TTTACAGCCG ATTCTGGTGA ACAAGAGGAG
CACACTCTCC AAGAAACAGC ATTACCACCT GTGAATAGTA GCATCATCGC TGCTCCCATC
ACGGACCCTT CTCAGAAGTT CCCTCAATAC CTACCTCTTT CTGCAGAGGA TAATTTAGGT
CCTCTACCTG AAAACTGGGA GATGGCCTAT ACTGAAAATG GAGAAGTCTA TTTTATAGAC
CATAACACGA AAACAACATC TTGGTTAGAC CCTCGGTGCC TAAACAAGCA GCAGAAGCCA
CTGGAAGAGT GTGAAGATGA TGAAGAAGGG GTACACACCG AGGAGCTGGA CAGTGAACTA
GAACTGCCTG CTGGTTGGGA AAAGATTGAA GACCCTGTCT ATGGTATCTA CTATGTAGAC
CACATCAACA GGAAGACACA ATATGAGAAC CCGGTTCTAG AAGCCAAACG GAAGAAGCAG
CTTGAGCAGC AGCAGCAGCA GCAACAGCAG CAGCAACAGC AGCAGCAGCA GCAGCAGCAG
CAGCAGACAG AAGAATGGAC AGAAGATCAC TCAGCCCTTG TGCCTCCTGT TATTCCAAAC
CACCCTCCAA GCAATCCAGA GCCAGCCAGA GAAGTTCCAC TTCAGGGCAA ACCCTTTTTT
ACACGAAACC CTTCTGAGTT GAAAGGCAAG TTCATTCACA CAAAGCTGCG GAAAAGCAGT
CGTGGCTTTG GCTTCACGGT GGTTGGAGGG GATGAACCTG ATGAGTTTCT CCAGATCAAG
AGCTTGGTCC TAGATGGTCC TGCTGCATTG GATGGCAAGA TGGAAACAGG GGATGTGATT
GTAAGTGTGA ATGACACCTG TGTTTTGGGA CACACACATG CTCAAGTTGT GAAGATCTTC
CAGTCCATCC CCATTGGTGC CAGCGTGGAC CTTGAACTCT GCCGAGGTTA TCCATTGCCT
TTTGATCCAG ATGACCCCAA TACAAGTTTA GTGACCTCGG TAGCCATTTT GGATAAAGAA
CCAATTATTG TGAATGGGCA AGAGACCTAT GATTCACCAG CTAGCCACAG TAGTAAAACA
GGCAAAGTCA ATGGCATGAA GGATGCCAGG CCAAGCAGCC CAGCGGACGT GGCTTCAAAT
AGTTCTCATG GTTATCCTAA TGACACTGTT TCTTTGGCTT CCTCCATAGC CACTCAGCCA
GAACTCATAA CTGTTCATAT TGTCAAAGGG CCAATGGGCT TTGGTTTTAC TATCGCAGAC
AGTCCTGGTG GGGGTGGCCA AAGAGTGAAA CAGATTGTTG ACAGCCCAAG GTGCCGAGGC
CTGAAAGAAG GGGATCTCAT AGTGGAAGTT AATAAGAAGA ACGTGCAGGC CCTAACTCAC
AACCAAGTGG TGGATATGCT GGTTGAGTGT CCTAAGGGAA GTGAGGTCAC ATTGTTGGTG
CAACGAGGAG GGCTGCCAGT TCCCAAGAAG AGCCCAAAGT CGCAACCACT GGAAAGGAAA
GACAGCCAGA ATAGTTCTCA GCACAGTGTT TCCAGCCACC GAAGCCTGCA CACAGCATCC
CCAAGCCACA GCACACAGGT GCTCCCCGAG TTCCCACCTG CAGAGGCCCA AGCTCCAGAT
CAAACTGACA GCTCTGGCCA GAAAAAACCA GATCCTTTTA AAATCTGGGC CCAGTCCAGG
AGCATGTATG AAAACCGACC TATGTCACCT TCACCTGCGT CGGGATTGAG CAAGGGTGAG
AGAGAGAGAG AAATCAATTC CACGAATTTT GGAGAATGTC CGATTCCAGA TTACCAGGAA
CAGGACATCT TCCTCTGGAG AAAAGAGACT GGATTTGGAT TTAGGATTCT GGGTGGAAAT
GAACCAGGGG AACCTATTTA TATTGGTCAC ATCGTACCAC TGGGTGCTGC TGATACTGAC
GGCCGCCTGA GGTCTGGAGA TGAATTAATC TGTGTGGATG GGACGCCAGT AATTGGAAAA
TCACACCAGC TTGTGGTCCA GCTTATGCAA CAAGCTGCCA AGCAAGGCCA CGTCAATCTC
ACGGTGCGGC GTAAAGTGGT TTTTGCGGTG CCCAAAACCG AGAACGAGGT GCCCTCGCCA
GCCTCCTCTC ATCACAGTAG CAACCAGCCG GCCTCGCTGA CAGAAGAGAA GCGCACTCCG
CAGGGCAGCC AGAACTCGCT GAACACGGTG AGCTCGGGCA GCGGCAGCAC CAGCGGCATC
GGCAGTGGCG GCGGCGGGGG CAGCGGCGTG GTCAGCACCG TGGTGCAGCC CTACGACGTG
GAGATCCGGC GCGGGGAGAA CGAGGGCTTC GGCTTCGTCA TCGTGTCCTC GGTGAGCAGG
CCCGAAGCAG GCACGACCTT TGCAGGCAAT GCATGTGTGG CTATGCCTCA CAAAATAGGT
CGGATTATTG AGGGGAGCCC TGCTGACCGC TGTGGCAAGC TGAAAGTAGG AGACCGGATC
TTGGCAGTAA ATGGATGTTC CATCACCAAC AAATCCCATT CAGACATTGT GAACCTAATC
AAGGAAGCGG GAAACACAGT TACCCTCCGC ATCATTCCTG GGGATGAGTC CTCGAATGCC
ACCTTGCTGA CCAATGCAGA GAAGATTGCC ACCATCACCA CCACACACAC CCCTTCTCAG
CAAGGGACCC AGGAGACAAG GAATACCACC AAACCAAAGC AGGAATCTCA ATTTGAGTTC
AAAGCACCCC AAGCAACACA GGAGCAAGAT TTTTACACTG TGGAACTGGA AAGAGGAGCC
AAGGGATTTG GCTTTAGCCT TCGAGGAGGC CGAGAGTATA ACATGGACCT CTATGTTCTG
CGCTTAGCAG AGGACGGTCC TGCGGAGAGG TGTGGAAAGA TGAGGATTGG TGATGAAATT
TTAGAGATCA ATGGTGAGAC CACCAAAAAC ATGAAGCATT CTCGAGCTAT AGAACTGATT
AAGAATGGTG GCCGCAGAGT TCGTCTGTTT CTGAAGCGGG GAGACGGCTC AGTACCAGAA
TATGACCCCA GCAGCGACCG CCACGGCCCC GCCACCGGTC CACAAGGTGT TCCGGAAGTG
AGGGCCGGGC CCGACCGCCG GCAGCATCCG TCATTGGAGT CCAGTTACCC ACCCGATCTT
CACAAATCAT CACCACATGG GGAAAAGCGG GCACACGCAA GGGATCCGAA AGGCAGCAGA
GAGTATAGCA GACAACCCAA TGAACACCAC ACCTGGAATG GGACTTCGAG GAAACCCGAC
AGCGGGGCAT GCCGACCCAA GGACCGGGCG CCGGAGGGAC GGAGGGACGC GCAGGCCGAG
CGCGCGGCAG CCGCCAACGG CCCCAAGAGG CGGTCCCCAG AGAAGCGGAG GGAGGGCACC
CGCAGCGCCG ACAACACTTT GGAGAGGAGG GAGAAGCACG AGAAGAGACG AGACGTCTCT
CCGGAGCGGA GGCGAGAGCG GTCACCCACC CGCAGGAGAG ACGGCTCCCC CAGCCGGCGG
AGACGGTCTC TGGAGAGACT CCTGGAGCAG AGGAGGTCCC CCGAGCGCAG GAGAGGGGGC
TCGCCCGAGC GCAGGGCCAA GTCCACCGAC CGGAGGCGCG CACGCTCCCC CGAGCGCAGG
AGAGAGCGGT CCCTGGACAA AAGGAACAGA GAGGACAGAG CCAGCCACCG AGAAAGGGAA
GAGGCGAATC TGAAACAGGA TGCCGGCAGA AGTTCCAGAC ATCCCCCGGA GCAGAGAAGG
CGACCTTACA AAGAATGTAG CACCGACCTC AGTATCTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_006713471.1
CDS529..5007
Misc Feature(1)571..828(+)
Misc Feature(2)607..801(+)
Misc Feature(3)892..1407(+)
Misc Feature(4)892..900(+)
Misc Feature(5)1435..1524(+)
Misc Feature(6)1477..1512(+)
Misc Feature(7)1615..1707(+)
Misc Feature(8)1657..1692(+)
Misc Feature(9)1957..2160(+)
Misc Feature(10)1972..2151(+)
Misc Feature(11)2452..2691(+)
Misc Feature(12)2485..2652(+)
Misc Feature(13)3070..3297(+)
Misc Feature(14)3079..3258(+)
Misc Feature(15)3517..3804(+)
Misc Feature(16)3553..3771(+)
Misc Feature(17)3982..4215(+)
Misc Feature(18)4012..4191(+)
Translation
Position Chain Variation Link
1 1 c, g dbSNP:191461182
40 40 c, g dbSNP:537661092
45 45 a, c dbSNP:575545299
127 127 a, g dbSNP:148037229
128 128 c, g dbSNP:571740212
156 156 a, t dbSNP:566646268
161 161 a, g dbSNP:552704079
204 204 -, a dbSNP:143358407
212 212 -, a, aaaaa dbSNP:201326846
261 261 -, g dbSNP:750221530
311 311 c, t dbSNP:758818669
314 314 c, t dbSNP:536067694
379 379 g, t dbSNP:773829656
399 399 a, c dbSNP:567495200
422 422 g, t dbSNP:550600182
426 426 a, g dbSNP:530864567
433 433 a, g dbSNP:187698573
459 459 c, g dbSNP:769956721
476 476 -, t dbSNP:759370405
477 477 g, t dbSNP:746810590
492 492 c, g dbSNP:779053891
495 495 c, g dbSNP:753172573
497 497 g, t dbSNP:749403510
500 500 a, g dbSNP:183466656
502 502 c, t dbSNP:756617602
507 507 -, t dbSNP:774394987
511 511 a, g dbSNP:746427352
517 517 g, t dbSNP:781714885
519 519 a, g dbSNP:757607646
534 534 a, c dbSNP:751916285
536 536 a, g dbSNP:763867872
543 543 c, t dbSNP:758071328
549 549 g, t dbSNP:752272115
552 552 -, ga dbSNP:770758853
552 552 c, g dbSNP:764775560
553 553 a, c dbSNP:759086365
556 556 a, c dbSNP:141809711
556 556 -, c dbSNP:748893574
563 563 c, g, t dbSNP:760428342
571 571 g, t dbSNP:528163276
577 577 a, g dbSNP:768891304
583 583 a, c dbSNP:749444314
586 586 a, g dbSNP:142399417
590 590 a, g dbSNP:769918348
600 600 c, g dbSNP:745938049
604 604 a, g dbSNP:540778067
616 616 c, g dbSNP:145502430
619 619 a, t dbSNP:747353373
620 620 a, c, t dbSNP:139524567
621 621 g, t dbSNP:142360191
622 622 c, g dbSNP:758130481
645 645 g, t dbSNP:371444849
648 648 c, g dbSNP:764972732
651 651 g, t dbSNP:544555927
661 661 a, g dbSNP:753358460
671 671 c, g dbSNP:766259685
678 678 c, t dbSNP:760613323
682 682 a, g dbSNP:772546225
685 685 a, g dbSNP:767365461
701 701 a, g dbSNP:761581552
707 707 a, t dbSNP:775737376
709 709 a, g dbSNP:770023258
710 710 a, g, t dbSNP:776721424
717 717 c, g dbSNP:771353388
739 739 c, t dbSNP:201211209
741 741 c, g dbSNP:778423242
753 753 g, t dbSNP:772626492
754 754 a, g dbSNP:748504917
755 755 c, t dbSNP:778748357
757 757 a, c dbSNP:754621113
758 758 a, g dbSNP:201711185
761 761 g, t dbSNP:779561114
773 773 c, g dbSNP:755574147
775 775 c, t dbSNP:750417362
778 778 c, t dbSNP:146286104
779 779 a, g dbSNP:148255740
781 781 a, g dbSNP:751310288
788 788 g, t dbSNP:765395986
803 803 a, g dbSNP:759742640
808 808 a, g dbSNP:776575429
815 815 c, g dbSNP:771111029
820 820 a, g dbSNP:760826615
822 822 c, t dbSNP:773908957
829 829 a, g dbSNP:367695439
831 831 c, t dbSNP:748555567
838 838 c, g dbSNP:779288471
845 845 a, g dbSNP:143048518
848 848 a, g dbSNP:575258704
866 866 a, g, t dbSNP:775050181
869 869 a, g dbSNP:143139340
878 878 a, g dbSNP:570595605
879 879 c, t dbSNP:539997368
880 880 c, g dbSNP:766659472
882 882 a, g dbSNP:756356569
883 883 a, c dbSNP:750544831
884 884 a, g dbSNP:374973001
895 895 a, g dbSNP:371758468
901 901 c, t dbSNP:774969090
923 923 a, c dbSNP:138398367
925 925 a, c, g dbSNP:775668792
926 926 c, t dbSNP:769445617
929 929 a, g dbSNP:368021145
931 931 a, g dbSNP:745454095
934 934 a, c dbSNP:776259426
937 937 c, g dbSNP:770488406
941 941 a, c dbSNP:77489551
943 943 -, c dbSNP:377246802
943 943 c, t dbSNP:141586740
944 944 a, g, t dbSNP:368884916
948 948 c, t dbSNP:748002247
967 967 c, t dbSNP:563469250
968 968 a, g dbSNP:775563326
969 969 a, g dbSNP:769534382
985 985 a, g dbSNP:745651959
990 990 a, g dbSNP:776582325
991 991 c, t dbSNP:370122762
993 993 a, g, t dbSNP:200807086
996 996 c, t dbSNP:778906272
997 997 a, g dbSNP:755485203
1001 1001 a, g dbSNP:749863070
1008 1008 c, g dbSNP:780601000
1017 1017 c, t dbSNP:377507377
1023 1023 a, g dbSNP:750757958
1025 1025 a, t dbSNP:767095377
1037 1037 g, t dbSNP:756908565
1038 1038 c, t dbSNP:751115237
1039 1039 a, g dbSNP:763763262
1044 1044 c, g dbSNP:773800207
1052 1052 c, g dbSNP:150279108
1060 1060 a, g dbSNP:775337669
1065 1065 c, t dbSNP:190884285
1068 1068 c, t dbSNP:759283551
1070 1070 c, t dbSNP:776439947
1071 1071 c, t dbSNP:564130566
1073 1073 a, g, t dbSNP:61742800
1078 1078 g, t dbSNP:139843075
1085 1085 a, c, g dbSNP:61746260
1089 1089 c, t dbSNP:754442577
1092 1092 c, g dbSNP:753874810
1096 1096 c, t dbSNP:766285924
1098 1098 c, t dbSNP:781416983
1109 1109 a, g dbSNP:760506334
1112 1112 a, g dbSNP:750182240
1113 1113 c, g dbSNP:764310808
1115 1115 a, c, t dbSNP:368189937
1122 1122 c, t dbSNP:769970433
1123 1123 a, g dbSNP:559812737
1124 1124 c, g dbSNP:777318234
1125 1125 a, g dbSNP:771522290
1128 1128 a, g dbSNP:747398888
1136 1136 c, t dbSNP:149314563
1137 1137 a, g dbSNP:771693536
1140 1140 a, g dbSNP:139638476
1145 1145 c, t dbSNP:747901875
1162 1162 c, t dbSNP:78610875
1169 1169 c, g dbSNP:201752505
1171 1171 a, g dbSNP:140125221
1179 1179 a, g, t dbSNP:562279477
1181 1181 c, t dbSNP:755984353
1184 1184 c, g, t dbSNP:750221140
1185 1185 a, g dbSNP:767363482
1190 1190 a, g dbSNP:756986553
1193 1193 c, t dbSNP:753011416
1194 1194 c, g dbSNP:765346622
1195 1195 a, g dbSNP:759691772
1201 1201 c, t dbSNP:776802575
1202 1202 a, g dbSNP:767008377
1203 1203 c, t dbSNP:761198936
1205 1205 a, c, g dbSNP:772547083
1216 1216 a, g dbSNP:138385635
1217 1217 a, g dbSNP:61742506
1220 1220 c, t dbSNP:768156669
1223 1223 a, g dbSNP:748822385
1230 1230 c, g dbSNP:779470078
1233 1233 c, t dbSNP:755613904
1234 1234 a, g dbSNP:183105608
1235 1235 c, t dbSNP:143246754
1236 1236 a, g dbSNP:112374307
1241 1241 a, g dbSNP:199930661
1248 1248 a, g dbSNP:577440048
1249 1249 a, g dbSNP:765516871
1251 1251 -, gga dbSNP:779526201
1257 1257 c, t dbSNP:146167545
1260 1260 c, t dbSNP:753972545
1261 1261 c, g dbSNP:766635354
1262 1262 c, t dbSNP:760824531
1285 1285 a, g dbSNP:200095160
1286 1286 c, g dbSNP:772043382
1287 1287 c, t dbSNP:747923821
1288 1288 a, g dbSNP:149211419
1289 1289 a, t dbSNP:62255275
1291 1291 a, t dbSNP:62255274
1294 1294 c, g dbSNP:781192018
1299 1299 a, g dbSNP:757343709
1310 1310 a, g dbSNP:113860090
1311 1311 c, g dbSNP:764628695
1312 1312 -, ac dbSNP:777952312
1326 1326 a, c dbSNP:763338326
1329 1329 a, c dbSNP:753009484
1334 1334 a, c, t dbSNP:759120883
1343 1343 a, t dbSNP:776343084
1346 1346 g, t dbSNP:770405336
1347 1347 c, t dbSNP:760212640
1353 1353 a, c dbSNP:773064855
1356 1356 c, t dbSNP:367935350
1357 1357 a, g dbSNP:754035480
1361 1361 a, c dbSNP:778797183
1363 1363 c, g, t dbSNP:766571470
1364 1364 c, t dbSNP:746131400
1365 1365 c, t dbSNP:781449058
1369 1369 a, g dbSNP:551839860
1370 1370 c, g, t dbSNP:144187343
1371 1371 a, g dbSNP:778274312
1372 1372 c, g dbSNP:758842788
1385 1385 a, c dbSNP:532649444
1389 1389 c, g dbSNP:765655565
1401 1401 a, g dbSNP:755358043
1402 1402 c, t dbSNP:753482867
1405 1405 c, t dbSNP:766025451
1417 1417 c, g dbSNP:760136006
1422 1422 c, t dbSNP:772731335
1430 1430 c, g dbSNP:764443081
1431 1431 g, t dbSNP:139693944
1432 1432 c, t dbSNP:761779432
1435 1435 a, c, t dbSNP:768617095
1449 1449 c, g dbSNP:373784095
1457 1457 a, g dbSNP:749076951
1459 1459 a, t dbSNP:370045288
1460 1460 c, t dbSNP:771135103
1469 1469 a, g dbSNP:747071272
1471 1471 a, g dbSNP:777762657
1484 1484 c, t dbSNP:758467633
1496 1496 c, g, t dbSNP:554948124
1497 1497 a, g dbSNP:267599924
1503 1503 a, g dbSNP:780402959
1506 1506 a, g dbSNP:147479917
1516 1516 g, t dbSNP:750145909
1519 1519 c, g dbSNP:780955981
1540 1540 a, c dbSNP:75366414
1542 1542 a, g dbSNP:751062081
1542 1542 -, g dbSNP:771577175
1545 1545 a, g dbSNP:139168216
1546 1546 c, t dbSNP:762879969
1554 1554 a, t dbSNP:201638232
1555 1555 a, g dbSNP:752573026
1567 1567 c, g dbSNP:765136787
1584 1584 c, t dbSNP:770373306
1587 1587 a, c dbSNP:746246071
1588 1588 a, g dbSNP:373310025
1593 1593 g, t dbSNP:562464347
1594 1594 a, c dbSNP:746716247
1598 1598 a, t dbSNP:763041850
1606 1606 a, c dbSNP:757966074
1608 1608 a, g dbSNP:747572076
1611 1611 a, g dbSNP:779948920
1613 1613 c, t dbSNP:755930868
1616 1616 c, t dbSNP:750132743
1617 1617 g, t dbSNP:764387561
1619 1619 a, c dbSNP:758480890
1630 1630 a, g dbSNP:752957965
1633 1633 a, g dbSNP:765463916
1654 1654 a, g dbSNP:141859891
1655 1655 c, t dbSNP:754436739
1656 1656 a, c dbSNP:766953209
1659 1659 c, t dbSNP:200052209
1664 1664 c, t dbSNP:761124349
1672 1672 a, g dbSNP:770670822
1682 1682 a, g dbSNP:536268252
1683 1683 c, g dbSNP:371147983
1685 1685 c, t dbSNP:755194226
1686 1686 a, c dbSNP:71306764
1698 1698 c, t dbSNP:753972519
1702 1702 a, g dbSNP:371020345
1712 1712 c, t dbSNP:756207965
1717 1717 c, t dbSNP:750943411
1718 1718 a, g dbSNP:376567111
1719 1719 a, g dbSNP:768041548
1728 1728 a, g dbSNP:757597540
1730 1730 -, ttg dbSNP:755165852
1734 1734 a, g dbSNP:751860252
1737 1737 -, gc dbSNP:750235390
1737 1737 a, g dbSNP:763737873
1740 1740 -, gcagcagcagca dbSNP:764065719
1740 1740 a, g dbSNP:762658149
1740 1740 -, g dbSNP:778632457
1742 1742 -, aca dbSNP:757214305
1743 1743 -, gcagcagca dbSNP:760160586
1743 1743 a, g dbSNP:567255206
1744 1744 -, agc dbSNP:113562374
1746 1746 a, g dbSNP:373485504
1747 1747 c, t dbSNP:764696072
1748 1748 a, c dbSNP:759065901
1749 1749 -, gca dbSNP:752246689
1749 1749 a, g dbSNP:536744103
1751 1751 -, gca dbSNP:753810856
1752 1752 a, g dbSNP:62642828
1755 1755 c, g dbSNP:770861590
1758 1758 a, g dbSNP:571281009
1759 1759 c, t dbSNP:773082777
1761 1761 a, g dbSNP:552500635
1764 1764 -, acagcagcagcagcagcagca dbSNP:752160270
1764 1764 -, acagcagcagcagca dbSNP:749065626
1764 1764 -, acagcagcagca dbSNP:747189565
1764 1764 -, acagcagca dbSNP:770334052
1764 1764 -, acagca dbSNP:374381483
1764 1764 -, aca dbSNP:759014969
1764 1764 a, g dbSNP:79701778
1767 1767 a, g dbSNP:139785185
1768 1768 a, g dbSNP:62637700
1770 1770 -, gagcag dbSNP:773650078
1775 1775 -, aca, acagcagcagcagca dbSNP:768891436
1775 1775 a, t dbSNP:756194119
1776 1776 a, g dbSNP:148523603
1777 1777 -, ggc dbSNP:780215714
1778 1778 -, tca dbSNP:757089424
1784 1784 a, g dbSNP:745907451
1786 1786 -, cagcagcag dbSNP:773562577
1790 1790 -, aca dbSNP:754508342
1791 1791 -, cag dbSNP:773463513
1792 1792 -, cag dbSNP:754983379
1792 1792 -, cgc dbSNP:766116391
1794 1794 -, cag, cagcag, cagcagcag, cagcagcagcagcag dbSNP:142043619
1795 1795 -, a dbSNP:113903140
1811 1811 a, g dbSNP:758785638
1813 1813 g, t dbSNP:144417292
1825 1825 c, g dbSNP:148740667
1826 1826 c, t dbSNP:778434612
1827 1827 c, t dbSNP:369631356
1828 1828 a, g dbSNP:754600873
1836 1836 a, t dbSNP:753419226
1837 1837 c, g dbSNP:544009720
1841 1841 a, t dbSNP:760229586
1842 1842 -, c dbSNP:35870506
1853 1853 c, t dbSNP:546485283
1860 1860 c, g dbSNP:374965219
1865 1865 c, g dbSNP:761728260
1876 1876 a, g dbSNP:774125461
1885 1885 c, g dbSNP:768326556
1895 1895 a, g, t dbSNP:374712093
1896 1896 c, t dbSNP:763992234
1897 1897 a, c dbSNP:762636765
1902 1902 c, g dbSNP:368660739
1904 1904 c, t dbSNP:771103644
1916 1916 a, g dbSNP:113401632
1918 1918 a, c dbSNP:763905797
1926 1926 a, g, t dbSNP:531375857
1932 1932 a, g dbSNP:772125695
1938 1938 a, g dbSNP:201982289
1948 1948 a, g dbSNP:779256461
1951 1951 a, g dbSNP:769112594
1952 1952 a, g dbSNP:749564086
1957 1957 c, t dbSNP:779881861
1958 1958 a, g dbSNP:375653415
1968 1968 c, t dbSNP:762742605
1969 1969 c, t dbSNP:745380892
1970 1970 a, g dbSNP:201982358
1974 1974 c, g dbSNP:780920935
1985 1985 c, t dbSNP:756694536
1986 1986 a, g dbSNP:61743171
1990 1990 -, g dbSNP:139731079
1995 1995 a, g dbSNP:199600521
2007 2007 c, t dbSNP:200070294
2012 2012 a, g dbSNP:111361698
2023 2023 a, c dbSNP:758245838
2027 2027 a, g dbSNP:377531675
2035 2035 a, g dbSNP:752423135
2040 2040 a, g dbSNP:55922341
2041 2041 -, t dbSNP:35212095
2045 2045 g, t dbSNP:760945768
2055 2055 a, g dbSNP:773417905
2067 2067 a, g dbSNP:767673510
2081 2081 a, t dbSNP:764671209
2084 2084 g, t dbSNP:763609622
2085 2085 a, c, g dbSNP:770334832
2089 2089 a, g dbSNP:746188828
2102 2102 a, t dbSNP:776381036
2104 2104 a, g dbSNP:770425564
2105 2105 c, g dbSNP:746542949
2108 2108 a, g dbSNP:777207513
2109 2109 c, t dbSNP:146306962
2123 2123 c, g dbSNP:748123559
2124 2124 a, g dbSNP:139017628
2126 2126 a, g dbSNP:148219481
2130 2130 g, t dbSNP:754789266
2145 2145 a, c dbSNP:753587094
2146 2146 c, t dbSNP:149029305
2150 2150 a, g dbSNP:757359782
2156 2156 c, t dbSNP:751789399
2172 2172 c, t dbSNP:764124302
2173 2173 a, g dbSNP:763107470
2175 2175 a, g dbSNP:753281889
2182 2182 c, g dbSNP:765802964
2183 2183 a, g dbSNP:541538402
2187 2187 c, g dbSNP:759984526
2192 2192 a, g dbSNP:776804460
2207 2207 c, g dbSNP:771313266
2208 2208 c, t dbSNP:529538780
2214 2214 c, t dbSNP:772888608
2228 2228 a, g dbSNP:200287562
2233 2233 a, g dbSNP:747606279
2234 2234 a, g dbSNP:778851077
2242 2242 a, g dbSNP:779140386
2244 2244 c, t dbSNP:768511167
2246 2246 c, t dbSNP:373058271
2247 2247 a, g dbSNP:779766712
2258 2258 -, t dbSNP:777565108
2271 2271 a, g dbSNP:755929470
2278 2278 a, g dbSNP:751781676
2280 2280 g, t dbSNP:778007666
2287 2287 c, g dbSNP:199909322
2295 2295 c, t dbSNP:752760877
2299 2299 a, g dbSNP:765854246
2300 2300 a, t dbSNP:369326360
2308 2308 g, t dbSNP:760178542
2318 2318 a, g dbSNP:754366310
2319 2319 g, t dbSNP:766693602
2327 2327 c, t dbSNP:761079131
2328 2328 a, g dbSNP:772759022
2330 2330 a, g dbSNP:116889308
2333 2333 a, c dbSNP:747607313
2339 2339 a, g dbSNP:146937131
2340 2340 c, t dbSNP:768136777
2343 2343 c, t dbSNP:749247938
2347 2347 a, g dbSNP:775480118
2350 2350 g, t dbSNP:769503539
2351 2351 a, t dbSNP:745637611
2353 2353 a, g dbSNP:141393129
2362 2362 a, c dbSNP:758636836
2364 2364 c, t dbSNP:201190085
2366 2366 a, g dbSNP:144404010
2372 2372 c, t dbSNP:755079504
2373 2373 a, g dbSNP:374829436
2376 2376 c, t dbSNP:766859969
2377 2377 a, g dbSNP:151058544
2380 2380 a, g dbSNP:146288848
2390 2390 g, t dbSNP:767167390
2396 2396 a, g dbSNP:761508333
2398 2398 g, t dbSNP:773984298
2402 2402 a, g dbSNP:200229876
2403 2403 c, t dbSNP:762480795
2415 2415 a, t dbSNP:775325477
2416 2416 c, g dbSNP:769707840
2433 2433 c, t dbSNP:745667443
2446 2446 a, c dbSNP:776627583
2455 2455 a, g dbSNP:770847623
2461 2461 a, g dbSNP:748421084
2472 2472 c, g dbSNP:774387985
2474 2474 a, g dbSNP:779253317
2479 2479 c, t dbSNP:368984076
2482 2482 a, g, t dbSNP:558455871
2484 2484 a, g dbSNP:140177021
2500 2500 a, g dbSNP:750913226
2502 2502 c, t dbSNP:767932318
2503 2503 a, g, t dbSNP:751238481
2508 2508 c, t dbSNP:763699163
2510 2510 a, g dbSNP:762378009
2512 2512 c, t dbSNP:775011550
2522 2522 a, g dbSNP:764641378
2526 2526 c, t dbSNP:146167183
2538 2538 a, t dbSNP:375879494
2539 2539 c, g dbSNP:372931447
2559 2559 a, g dbSNP:150460861
2562 2562 c, g dbSNP:141668371
2564 2564 a, g dbSNP:376397867
2569 2569 c, t dbSNP:572325988
2580 2580 a, g dbSNP:112604755
2592 2592 a, g dbSNP:749340270
2595 2595 a, g dbSNP:780235099
2596 2596 a, g dbSNP:769754175
2600 2600 a, g dbSNP:746412433
2601 2601 g, t dbSNP:781646475
2610 2610 c, t dbSNP:181012033
2611 2611 a, g, t dbSNP:777307822
2612 2612 c, t dbSNP:535566803
2617 2617 a, g dbSNP:751502191
2625 2625 c, t dbSNP:764843699
2630 2630 a, g dbSNP:758948172
2640 2640 a, g dbSNP:61754217
2642 2642 a, c dbSNP:766377026
2643 2643 c, t dbSNP:555946241
2652 2652 g, t dbSNP:773082850
2655 2655 g, t dbSNP:771747868
2662 2662 a, c, g dbSNP:775542045
2671 2671 c, g dbSNP:375975939
2673 2673 a, g dbSNP:745912189
2688 2688 a, g dbSNP:373238688
2691 2691 a, g dbSNP:78696431
2693 2693 a, g, t dbSNP:570431400
2700 2700 g, t dbSNP:377199908
2703 2703 a, g dbSNP:144985354
2719 2719 a, g dbSNP:772391343
2720 2720 a, g dbSNP:748558147
2722 2722 c, t dbSNP:774636249
2735 2735 c, t dbSNP:762292211
2736 2736 a, g dbSNP:774963838
2753 2753 a, g dbSNP:769187520
2770 2770 c, t dbSNP:763358402
2772 2772 c, t dbSNP:775311588
2773 2773 a, g dbSNP:769516378
2781 2781 c, t dbSNP:375524346
2787 2787 c, t dbSNP:564591215
2788 2788 c, t dbSNP:780637413
2789 2789 a, g dbSNP:770448480
2802 2802 a, g dbSNP:367984135
2805 2805 a, g dbSNP:746969064
2820 2820 c, t dbSNP:777639807
2821 2821 a, c dbSNP:61740330
2822 2822 c, g dbSNP:752424969
2823 2823 a, g dbSNP:780266409
2826 2826 a, g dbSNP:756347559
2828 2828 g, t dbSNP:201132775
2829 2829 g, t dbSNP:558577754
2835 2835 c, t dbSNP:538890441
2844 2844 a, g dbSNP:752131188
2852 2852 a, g dbSNP:374454357
2867 2867 a, g dbSNP:572527250
2889 2889 c, g dbSNP:776057848
2896 2896 a, c dbSNP:770193154
2897 2897 a, c dbSNP:759154568
2902 2902 a, c dbSNP:746590380
2919 2919 c, g dbSNP:776328637
2922 2922 c, g dbSNP:770370338
2925 2925 c, t dbSNP:746483958
2936 2936 a, g dbSNP:777693118
2945 2945 a, g, t dbSNP:180991722
2947 2947 c, t dbSNP:778744814
2949 2949 c, t dbSNP:768353148
2950 2950 a, g dbSNP:749067256
2952 2952 a, g dbSNP:781271761
2958 2958 a, t dbSNP:143586931
2966 2966 c, t dbSNP:747233154
2967 2967 a, g, t dbSNP:770992534
2969 2969 a, c, t dbSNP:141982446
2970 2970 a, g dbSNP:189599108
2972 2972 a, g dbSNP:148592085
2974 2974 c, t dbSNP:766642379
2976 2976 g, t dbSNP:760385793
2983 2983 g, t dbSNP:201645519
2990 2990 c, g dbSNP:767062949
2992 2992 c, g dbSNP:761260561
2998 2998 -, ga dbSNP:139764373
3004 3004 a, t dbSNP:774183335
3005 3005 a, c dbSNP:768568989
3011 3011 c, t dbSNP:370772572
3012 3012 a, g dbSNP:200026736
3018 3018 c, t dbSNP:769684424
3029 3029 c, t dbSNP:747286701
3030 3030 a, c, g dbSNP:574583271
3034 3034 c, g dbSNP:377256709
3043 3043 c, t dbSNP:201912749
3057 3057 c, t dbSNP:780489292
3066 3066 a, g dbSNP:756501564
3075 3075 g, t dbSNP:750716620
3111 3111 a, g dbSNP:780834760
3112 3112 c, t dbSNP:756990030
3118 3118 a, g dbSNP:751143382
3142 3142 a, g dbSNP:376560565
3144 3144 a, g dbSNP:764830580
3159 3159 c, t dbSNP:755036583
3161 3161 a, t dbSNP:753798139
3162 3162 c, t dbSNP:766323717
3165 3165 c, t dbSNP:760336137
3168 3168 c, t dbSNP:147385291
3169 3169 a, g dbSNP:764151093
3172 3172 c, t dbSNP:371939525
3173 3173 a, g dbSNP:375197593
3175 3175 c, t dbSNP:200690850
3177 3177 a, g dbSNP:150093034
3179 3179 c, g dbSNP:201936743
3183 3183 c, t dbSNP:771359940
3199 3199 c, t dbSNP:557781972
3212 3212 c, t dbSNP:541514140
3221 3221 c, t dbSNP:375183927
3239 3239 c, t dbSNP:747801179
3246 3246 a, c dbSNP:778609250
3254 3254 g, t dbSNP:754512219
3261 3261 a, g dbSNP:753846981
3279 3279 c, t dbSNP:534515783
3289 3289 a, g dbSNP:755937804
3290 3290 c, t dbSNP:750128468
3291 3291 a, g dbSNP:565704580
3293 3293 c, t dbSNP:763226685
3296 3296 a, g dbSNP:140857612
3298 3298 c, t dbSNP:765325696
3307 3307 g, t dbSNP:759574344
3314 3314 c, t dbSNP:200362587
3315 3315 a, g dbSNP:771285835
3318 3318 g, t dbSNP:571060062
3319 3319 c, g dbSNP:768361954
3323 3323 a, g dbSNP:748935727
3327 3327 c, t dbSNP:779496276
3333 3333 a, c, t dbSNP:370716808
3334 3334 a, g dbSNP:143546019
3337 3337 a, g dbSNP:757052038
3344 3344 c, t dbSNP:202069482
3349 3349 a, g dbSNP:777531492
3350 3350 c, t dbSNP:560981424
3351 3351 c, t dbSNP:755264631
3356 3356 c, g dbSNP:754063810
3364 3364 a, g dbSNP:766421426
3365 3365 a, g dbSNP:143734705
3370 3370 a, g dbSNP:527701578
3373 3373 a, c dbSNP:768067706
3377 3377 c, t dbSNP:141306692
3379 3379 a, g dbSNP:774910493
3380 3380 c, t dbSNP:764548432
3381 3381 c, t dbSNP:201017105
3384 3384 a, g dbSNP:764500887
3385 3385 c, t dbSNP:769219782
3394 3394 c, g dbSNP:745320055
3399 3399 a, g dbSNP:531832718
3400 3400 c, t dbSNP:770913746
3401 3401 a, g dbSNP:368569997
3402 3402 c, t dbSNP:149984668
3403 3403 a, c dbSNP:758170584
3404 3404 c, t dbSNP:763320183
3407 3407 c, g, t dbSNP:201945322
3408 3408 g, t dbSNP:756151040
3412 3412 a, g dbSNP:750455235
3414 3414 c, g dbSNP:200157567
3426 3426 a, g dbSNP:553795607
3434 3434 c, t dbSNP:757905500
3435 3435 a, c, g, t dbSNP:763326793
3443 3443 c, t dbSNP:775012081
3447 3447 c, t dbSNP:764888683
3450 3450 c, t dbSNP:748055573
3454 3454 a, g dbSNP:759097317
3462 3462 c, t dbSNP:776191948
3468 3468 c, t dbSNP:150916367
3480 3480 c, t dbSNP:747001044
3483 3483 c, t dbSNP:773086494
3485 3485 c, g dbSNP:140952372
3486 3486 a, g dbSNP:540491557
3492 3492 c, t dbSNP:370681942
3496 3496 a, g dbSNP:756412481
3501 3501 -, cagcaccgtggt dbSNP:746051828
3511 3511 c, g dbSNP:138724998
3515 3515 a, g dbSNP:746069792
3521 3521 a, g dbSNP:781460712
3522 3522 c, t dbSNP:574379618
3525 3525 c, t dbSNP:752133128
3526 3526 a, g dbSNP:149468264
3529 3529 a, g dbSNP:199554026
3535 3535 c, t dbSNP:150383800
3536 3536 a, g dbSNP:140787779
3540 3540 c, t dbSNP:377474846
3558 3558 c, t dbSNP:370394890
3565 3565 a, g dbSNP:753471850
3573 3573 a, g dbSNP:765899118
3576 3576 -, gtgtcc dbSNP:772909693
3586 3586 a, g dbSNP:760140821
3591 3591 c, t dbSNP:373125823
3596 3596 a, c dbSNP:771985580
3602 3602 a, c dbSNP:761639684
3606 3606 c, t dbSNP:144800395
3622 3622 c, t dbSNP:756672225
3624 3624 c, t dbSNP:369447858
3629 3629 c, t dbSNP:763870274
3631 3631 a, g dbSNP:762972419
3645 3645 a, t dbSNP:756817148
3650 3650 a, g dbSNP:765094156
3651 3651 g, t dbSNP:761027431
3665 3665 c, g dbSNP:773262025
3670 3670 a, g dbSNP:772228910
3675 3675 c, t dbSNP:748111931
3676 3676 c, t dbSNP:774938423
3677 3677 a, g dbSNP:142788987
3691 3691 a, c dbSNP:749789614
3703 3703 c, t dbSNP:201650657
3710 3710 g, t dbSNP:780434014
3712 3712 c, g dbSNP:756445885
3713 3713 a, c dbSNP:745555624
3717 3717 a, c dbSNP:780666116
3725 3725 a, g dbSNP:756795614
3728 3728 c, g dbSNP:376161036
3737 3737 a, g dbSNP:774033144
3759 3759 a, g dbSNP:763656004
3762 3762 c, t dbSNP:758449858
3769 3769 a, g dbSNP:371746914
3770 3770 a, g dbSNP:145856320
3771 3771 a, g dbSNP:752660776
3775 3775 a, g dbSNP:765149482
3776 3776 c, t dbSNP:554050964
3777 3777 a, g dbSNP:773492897
3784 3784 a, g dbSNP:767581703
3792 3792 c, t dbSNP:762078815
3796 3796 c, t dbSNP:774357236
3797 3797 a, g dbSNP:768689132
3808 3808 a, g dbSNP:749840027
3811 3811 g, t dbSNP:775925540
3821 3821 c, t dbSNP:574932979
3822 3822 a, g dbSNP:149841839
3824 3824 a, t dbSNP:147286102
3826 3826 a, g dbSNP:768079102
3843 3843 c, t dbSNP:748764569
3849 3849 a, g dbSNP:561570190
3850 3850 a, g dbSNP:769827275
3853 3853 a, t dbSNP:745800026
3859 3859 a, t dbSNP:781014591
3862 3862 a, g dbSNP:756997508
3864 3864 c, t dbSNP:748403286
3871 3871 -, aca dbSNP:746906102
3874 3874 c, t dbSNP:779125903
3876 3876 c, t dbSNP:755030000
3881 3881 c, t dbSNP:754010597
3884 3884 c, t dbSNP:77560728
3894 3894 a, g dbSNP:756728787
3896 3896 a, c, t dbSNP:768012585
3905 3905 c, t dbSNP:755667537
3911 3911 a, g dbSNP:781735668
3928 3928 c, g dbSNP:757707422
3947 3947 a, t dbSNP:752017880
3950 3950 a, t dbSNP:764361449
3952 3952 g, t dbSNP:762706081
3960 3960 a, g dbSNP:752243923
3961 3961 g, t dbSNP:764759916
3970 3970 a, c, g dbSNP:201532034
3971 3971 a, g dbSNP:764813698
3972 3972 a, g dbSNP:759177851
3996 3996 a, g dbSNP:140391670
4032 4032 a, c dbSNP:765847458
4040 4040 a, g dbSNP:572896098
4044 4044 a, g dbSNP:772970636
4061 4061 a, g dbSNP:767372794
4069 4069 c, t dbSNP:141617754
4070 4070 a, g dbSNP:775865692
4076 4076 c, g dbSNP:770197511
4080 4080 a, g dbSNP:746081738
4083 4083 c, t dbSNP:200297547
4084 4084 a, g dbSNP:770893503
4092 4092 a, c, g dbSNP:778076526
4095 4095 a, g dbSNP:758804981
4099 4099 c, g, t dbSNP:779247838
4121 4121 a, g dbSNP:113893379
4130 4130 c, t dbSNP:755291131
4133 4133 a, t dbSNP:748965783
4140 4140 c, t dbSNP:144745135
4143 4143 g, t dbSNP:200416805
4149 4149 c, t dbSNP:144451025
4169 4169 c, t dbSNP:749957286
4172 4172 a, g dbSNP:767047773
4178 4178 a, c, t dbSNP:370182220
4180 4180 c, g dbSNP:764002832
4185 4185 g, t dbSNP:762770187
4188 4188 g, t dbSNP:754126405
4193 4193 a, g dbSNP:766569102
4197 4197 c, t dbSNP:760949455
4201 4201 c, t dbSNP:760886450
4202 4202 a, g dbSNP:144736804
4204 4204 a, g dbSNP:773296837
4210 4210 c, t dbSNP:201117026
4217 4217 c, t dbSNP:138217245
4226 4226 a, c, g dbSNP:202003931
4233 4233 c, t dbSNP:61751923
4238 4238 c, t dbSNP:769401664
4242 4242 a, g dbSNP:745504590
4256 4256 a, c dbSNP:115182995
4259 4259 a, g dbSNP:748064535
4267 4267 c, g dbSNP:778839760
4270 4270 c, t dbSNP:778997395
4271 4271 a, g dbSNP:368993221
4272 4272 a, c, t dbSNP:199590961
4273 4273 a, c, g dbSNP:755039176
4275 4275 c, g dbSNP:764182268
4277 4277 c, g dbSNP:758465109
4279 4279 a, g dbSNP:149895880
4280 4280 c, t dbSNP:765830224
4285 4285 a, g, t dbSNP:372252686
4286 4286 a, g dbSNP:766826512
4301 4301 c, t dbSNP:760423671
4313 4313 c, g dbSNP:772956114
4314 4314 c, g dbSNP:771709988
4321 4321 c, g dbSNP:747632332
4322 4322 a, t dbSNP:773725399
4324 4324 -, c dbSNP:148202277
4324 4324 c, t dbSNP:768709936
4326 4326 c, t dbSNP:749153064
4327 4327 c, t dbSNP:779875559
4328 4328 c, g dbSNP:755857207
4338 4338 c, g dbSNP:747264518
4340 4340 c, t dbSNP:139105394
4341 4341 a, g, t dbSNP:752888572
4342 4342 c, t dbSNP:373087043
4347 4347 a, g dbSNP:755557334
4360 4360 c, t dbSNP:754346795
4363 4363 a, g dbSNP:766879624
4372 4372 a, c dbSNP:761051639
4377 4377 a, g dbSNP:142535854
4380 4380 a, c dbSNP:767254242
4382 4382 -, cac dbSNP:745355125
4382 4382 c, t dbSNP:752671181
4387 4387 a, g dbSNP:369284216
4391 4391 a, g dbSNP:773955229
4395 4395 a, g dbSNP:768031873
4404 4404 c, t dbSNP:762972100
4410 4410 a, g dbSNP:775367508
4418 4418 a, g dbSNP:769581565
4432 4432 a, t dbSNP:192423645
4433 4433 a, g dbSNP:780961185
4434 4434 c, t dbSNP:374891335
4446 4446 c, t dbSNP:748295432
4448 4448 a, g dbSNP:779070587
4449 4449 g, t dbSNP:754970655
4450 4450 a, g dbSNP:754398016
4467 4467 c, t dbSNP:201291352
4473 4473 g, t dbSNP:780645225
4474 4474 c, t dbSNP:756673268
4476 4476 a, g dbSNP:750888080
4481 4481 a, g dbSNP:765843799
4483 4483 c, g dbSNP:767747158
4485 4485 c, t dbSNP:200863149
4488 4488 c, g dbSNP:751127040
4495 4495 a, g dbSNP:763692539
4496 4496 c, t dbSNP:780292530
4515 4515 a, g dbSNP:775420448
4528 4528 c, g dbSNP:371334183
4531 4531 a, g dbSNP:544348166
4532 4532 a, g dbSNP:759437474
4539 4539 a, g dbSNP:776538913
4545 4545 c, g, t dbSNP:748431740
4552 4552 a, g dbSNP:778933016
4555 4555 a, g dbSNP:768791893
4558 4558 a, g dbSNP:760080102
4560 4560 c, t dbSNP:141542625
4565 4565 a, g dbSNP:780273082
4567 4567 a, g dbSNP:558561010
4572 4572 c, t dbSNP:368890215
4574 4574 a, g dbSNP:199909203
4585 4585 c, t dbSNP:757523874
4594 4594 c, t dbSNP:146045041
4604 4604 a, g dbSNP:763596169
4607 4607 c, g, t dbSNP:148072697
4608 4608 c, t dbSNP:201975771
4609 4609 c, t dbSNP:759490528
4615 4615 a, g dbSNP:142375705
4617 4617 c, t dbSNP:776391815
4618 4618 a, c, g, t dbSNP:773042890
4620 4620 c, t dbSNP:147123131
4621 4621 a, c dbSNP:749494789
4624 4624 a, g, t dbSNP:536453395
4627 4627 g, t dbSNP:140619230
4628 4628 c, t dbSNP:142406539
4632 4632 a, g dbSNP:757655358
4636 4636 a, t dbSNP:747390339
4641 4641 a, g dbSNP:201918063
4643 4643 a, g dbSNP:537179465
4647 4647 a, c dbSNP:750777961
4648 4648 a, g dbSNP:764756034
4650 4650 a, g dbSNP:754416898
4651 4651 a, g dbSNP:753823882
4654 4654 a, g dbSNP:766282453
4655 4655 a, g dbSNP:760652364
4657 4657 c, t dbSNP:772917639
4658 4658 a, g dbSNP:767401164
4664 4664 c, t dbSNP:763294631
4667 4667 c, t dbSNP:571243906
4684 4684 c, g dbSNP:770002282
4687 4687 c, t dbSNP:745880197
4697 4697 a, c dbSNP:776758597
4699 4699 -, c dbSNP:778690306
4713 4713 c, t dbSNP:771408778
4714 4714 c, t dbSNP:79971348
4715 4715 c, t dbSNP:747528094
4717 4717 c, t dbSNP:778133321
4719 4719 a, c dbSNP:772384564
4724 4724 g, t dbSNP:747802043
4733 4733 g, t dbSNP:778476779
4737 4737 c, t dbSNP:754609491
4747 4747 c, t dbSNP:753351918
4749 4749 c, g dbSNP:779581641
4758 4758 c, g dbSNP:756058727
4763 4763 a, g dbSNP:750330382
4766 4766 a, c, t dbSNP:761636491
4767 4767 c, t dbSNP:752983335
4769 4769 c, t dbSNP:199689289
4770 4770 a, c, g, t dbSNP:538884768
4773 4773 a, g dbSNP:770994040
4777 4777 a, c dbSNP:146708091
4778 4778 a, g dbSNP:368712377
4781 4781 a, g dbSNP:772437991
4782 4782 a, g dbSNP:199866884
4783 4783 g, t dbSNP:779242047
4785 4785 a, g dbSNP:201236076
4787 4787 -, gg dbSNP:756790346
4791 4791 c, g dbSNP:200637894
4794 4794 c, t dbSNP:200685812
4799 4799 c, g dbSNP:748944757
4800 4800 c, t dbSNP:375043389
4803 4803 c, g dbSNP:755614336
4804 4804 a, g dbSNP:766083821
4808 4808 a, g dbSNP:762533994
4814 4814 c, t dbSNP:567163793
4816 4816 c, g, t dbSNP:370430462
4826 4826 a, g, t dbSNP:763951532
4828 4828 c, g dbSNP:759698655
4833 4833 c, g dbSNP:754051443
4836 4836 c, t dbSNP:766372209
4837 4837 c, t dbSNP:376310060
4839 4839 -, cgagc dbSNP:778062138
4840 4840 a, g dbSNP:760749180
4854 4854 g, t dbSNP:773263998
4856 4856 a, g dbSNP:772629631
4860 4860 c, t dbSNP:762274991
4876 4876 a, g dbSNP:774743568
4877 4877 a, g, t dbSNP:748927229
4893 4893 c, t dbSNP:775146505
4897 4897 c, g dbSNP:769205130
4900 4900 c, g dbSNP:745429984
4904 4904 a, g dbSNP:757626815
4906 4906 a, g dbSNP:780845400
4911 4911 a, g dbSNP:757302518
4918 4918 c, g dbSNP:746922593
4919 4919 c, t dbSNP:777458552
4925 4925 a, g dbSNP:201195412
4930 4930 c, g dbSNP:139829422
4932 4932 c, t dbSNP:376367437
4933 4933 a, g dbSNP:769748546
4934 4934 a, g, t dbSNP:144133607
4942 4942 g, t dbSNP:750537588
4951 4951 c, t dbSNP:767559877
4956 4956 a, g dbSNP:762326391
4962 4962 c, g dbSNP:373197382
4971 4971 a, c dbSNP:774802749
4987 4987 a, g dbSNP:764373595
4991 4991 a, c dbSNP:763322801
4993 4993 g, t dbSNP:752024318
4995 4995 a, c dbSNP:775707857
4997 4997 a, g, t dbSNP:745485618
5011 5011 g, t dbSNP:745857251
5014 5014 a, g dbSNP:201086171
5019 5019 a, g dbSNP:746945278
5021 5021 a, g dbSNP:777708263
5023 5023 a, t dbSNP:758253746
5036 5036 a, g dbSNP:369386292
5037 5037 c, t dbSNP:566838271
5039 5039 g, t dbSNP:756374693
5040 5040 c, t dbSNP:750592552
5041 5041 a, g dbSNP:767619035
5048 5048 c, g dbSNP:757263313
5052 5052 a, g dbSNP:752025303
5055 5055 g, t dbSNP:200190351
5090 5090 c, t dbSNP:143597514
5098 5098 a, g dbSNP:530939706
5152 5152 a, c dbSNP:370683168
5176 5176 a, g dbSNP:564906908
5248 5248 c, t dbSNP:553874761
5278 5278 c, g dbSNP:770780706
5280 5280 g, t dbSNP:746768666
5311 5311 a, g dbSNP:573010357
5321 5321 g, t dbSNP:559599770
5325 5325 a, g dbSNP:759061789
5368 5368 a, t dbSNP:542601484
5389 5389 c, t dbSNP:188877308
5416 5416 a, t dbSNP:557222591
5451 5451 a, g dbSNP:537118218
5580 5580 c, t dbSNP:577831072
5614 5614 a, g dbSNP:766579184
5645 5645 a, g dbSNP:145472641
5656 5656 c, t dbSNP:145732685
5676 5676 c, t dbSNP:76436325
5691 5691 c, g dbSNP:778070911
5701 5701 g, t dbSNP:776041030
5709 5709 -, t dbSNP:372250601
5712 5712 -, t dbSNP:566284593
5733 5733 a, c dbSNP:1045730
5748 5748 a, g dbSNP:565587633
5759 5759 c, t dbSNP:533784348
5773 5773 a, c dbSNP:536576679
5780 5780 c, t dbSNP:760462328
5788 5788 a, g dbSNP:147583412
5795 5795 c, t dbSNP:144875664
5804 5804 a, g dbSNP:779085497
5809 5809 a, g dbSNP:530879181
5817 5817 a, g dbSNP:565045055
5847 5847 g, t dbSNP:551311964
5852 5852 c, g dbSNP:528480984
5886 5886 a, g dbSNP:559523706
5913 5913 c, t dbSNP:542887398
5937 5937 a, g dbSNP:773011249
5948 5948 a, c dbSNP:573876686
5983 5983 a, g dbSNP:141040288
6002 6002 a, g dbSNP:574446665
6091 6091 a, c dbSNP:185766757
6122 6122 a, g dbSNP:192830991
6125 6125 a, g dbSNP:151078305
6152 6152 a, g dbSNP:2061937
6166 6166 a, c dbSNP:555790520
6266 6266 a, g dbSNP:142975084
6276 6276 g, t dbSNP:536923391
6279 6279 c, t dbSNP:536192155
6280 6280 a, g dbSNP:567635477
6284 6284 a, g dbSNP:3796146
6291 6291 c, t dbSNP:182513824
6308 6308 c, g dbSNP:762467755
6348 6348 g, t dbSNP:775105136
6351 6351 c, g dbSNP:571553807
6369 6369 a, g dbSNP:191953095
6394 6394 c, t dbSNP:528277215
6447 6447 a, g dbSNP:528607575
6460 6460 g, t dbSNP:186767017
6501 6501 -, a dbSNP:559634584
6512 6512 c, t dbSNP:549126832
6518 6518 c, t dbSNP:556754224
6522 6522 a, g dbSNP:529148356
6541 6541 g, t dbSNP:563577490
6553 6553 a, g dbSNP:543787230
6579 6579 a, c dbSNP:749383467
6633 6633 a, g dbSNP:769336941
6653 6653 a, g dbSNP:182421493
6671 6671 a, g dbSNP:148578144
6693 6693 a, t dbSNP:368329278
6695 6695 a, g dbSNP:58844841
6715 6715 c, t dbSNP:572067003
6737 6737 a, c dbSNP:146306183
6786 6786 c, t dbSNP:375738388
6801 6801 a, g dbSNP:762097448
6840 6840 c, g dbSNP:545164123
6866 6866 c, t dbSNP:541470679
6901 6901 a, g dbSNP:547454135
6905 6905 a, g dbSNP:573947244
6928 6928 a, g dbSNP:373356165
6946 6946 a, t dbSNP:557226097
6961 6961 c, t dbSNP:537386960
6979 6979 g, t dbSNP:9831035
7016 7016 a, g dbSNP:558093485
7020 7020 a, g dbSNP:114100933
7055 7055 a, g dbSNP:746825011
7056 7056 -, c dbSNP:142195850
7064 7064 a, g dbSNP:140091543
7068 7068 a, g dbSNP:549313012
7070 7070 a, c, g dbSNP:369936028
7075 7075 a, g dbSNP:777391442
7086 7086 a, g dbSNP:772359808
7102 7102 a, g dbSNP:146090545
7103 7103 a, g dbSNP:550085814
7115 7115 a, g dbSNP:748428827
7135 7135 a, c dbSNP:149520750
7151 7151 c, t dbSNP:138036732
7163 7163 a, g dbSNP:540882905
7177 7177 c, g dbSNP:527340075
7241 7241 c, t dbSNP:561628886
7286 7286 c, t dbSNP:541953560
7301 7301 a, g dbSNP:192198128
7304 7304 c, t dbSNP:150764234
7308 7308 a, g dbSNP:543682802
7309 7309 a, t dbSNP:755171939
7319 7319 g, t dbSNP:577934744
7365 7365 c, g dbSNP:141365463
7384 7384 c, t dbSNP:578075238
7409 7409 a, g dbSNP:534912504
7540 7540 c, t dbSNP:138913167
7544 7544 a, g dbSNP:566310118
7548 7548 g, t dbSNP:187083945
7551 7551 a, g dbSNP:746025985
7552 7552 -, ta dbSNP:780101889
7552 7552 c, t dbSNP:145800109
7652 7652 c, t