Email to GenScript

CRLF1 cytokine receptor-like factor 1 [Homo sapiens (human)]

Gene Symbol CRLF1
Entrez Gene ID 9244
Full Name cytokine receptor-like factor 1
Synonyms CISS, CISS1, CLF, CLF-1, NR6, zcytor5
General protein information
Preferred Names
cytokine receptor-like factor 1
cytokine receptor-like factor 1
cytokine-like factor 1
class I cytokine receptor
cytokine type 1 receptor CRLP-1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:


Disorder Html: Cold-induced sweating syndrome, 272430 (3); Crisponi syndrome,

The following CRLF1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CRLF1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu62657 XM_011528422 PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu62658 XM_011528423 PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu62659 XM_011528424 PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319
OHu18874 NM_004750 Homo sapiens cytokine receptor-like factor 1 (CRLF1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu62657
Accession Version XM_011528422.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1272bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cytokine receptor-like factor 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)374..649(+)
Misc Feature(2)374..625(+)
Misc Feature(3)626..637(+)
Misc Feature(4)677..985(+)
Misc Feature(5)878..949(+)
Misc Feature(6)950..964(+)
Position Chain Variation Link
14 14 a, g dbSNP:547952607
45 45 g, t dbSNP:758119146
52 52 c, t dbSNP:745332499
58 58 a, g dbSNP:144720158
89 89 a, t dbSNP:372707184
91 91 a, t dbSNP:748473690
97 97 -, tg dbSNP:756689237
97 97 a, g dbSNP:779267686
107 107 c, g dbSNP:751733093
113 113 a, c dbSNP:754292165
117 117 c, g, t dbSNP:367833835
118 118 a, g dbSNP:7259478
122 122 -, ctc dbSNP:751257411
124 124 c, t dbSNP:767093375
127 127 c, t dbSNP:761465676
128 128 a, g dbSNP:200728283
134 134 c, t dbSNP:763900232
137 137 -, c dbSNP:34603196
140 140 c, t dbSNP:763035784
142 142 a, g dbSNP:775538615
143 143 c, g dbSNP:151254980
156 156 c, t dbSNP:747071986
161 161 a, g dbSNP:142326326
166 166 a, c dbSNP:772185315
181 181 c, t dbSNP:572291511
182 182 a, g dbSNP:370673214
184 184 c, g, t dbSNP:201940100
185 185 a, g dbSNP:780528096
194 194 c, t dbSNP:756560447
197 197 g, t dbSNP:137853143
203 203 c, g dbSNP:749910321
205 205 a, c dbSNP:780713735
208 208 c, t dbSNP:2238647
209 209 a, g dbSNP:751204280
213 213 a, g dbSNP:104894670
215 215 a, c, t dbSNP:752738274
216 216 a, g dbSNP:374345199
217 217 c, t dbSNP:759478897
219 219 c, t dbSNP:773193414
220 220 a, g dbSNP:146098226
224 224 c, t dbSNP:202030926
229 229 a, g dbSNP:774598847
236 236 c, t dbSNP:556263201
237 237 a, g dbSNP:143326783
240 240 c, t dbSNP:199855680
246 246 a, g dbSNP:770320771
247 247 c, t dbSNP:775994224
256 256 c, t dbSNP:746338472
259 259 a, g dbSNP:371298845
263 263 c, t dbSNP:756762794
268 268 c, t dbSNP:751239369
269 269 c, g dbSNP:547116691
271 271 a, g dbSNP:201176844
272 272 a, g dbSNP:556620471
274 274 -, c dbSNP:137853931
282 282 a, g dbSNP:117193413
292 292 a, g dbSNP:765081779
296 296 -, agc dbSNP:763606003
296 296 c, t dbSNP:551665120
297 297 a, c, g dbSNP:767530836
310 310 a, c dbSNP:761942142
312 312 c, t dbSNP:774359694
313 313 c, t dbSNP:139923667
314 314 a, g dbSNP:763125360
326 326 c, t dbSNP:775855897
327 327 a, g dbSNP:146027258
331 331 c, t dbSNP:562764303
332 332 a, g dbSNP:373564660
340 340 c, t dbSNP:770404854
348 348 a, g dbSNP:746540745
353 353 c, t dbSNP:777352123
362 362 c, g dbSNP:758154908
368 368 c, t dbSNP:747750093
370 370 a, g dbSNP:778701303
384 384 c, t dbSNP:137853930
385 385 c, g, t dbSNP:199728865
386 386 a, g dbSNP:779676934
407 407 a, c dbSNP:756103761
418 418 a, g dbSNP:114059820
424 424 c, g dbSNP:764200371
425 425 a, c dbSNP:758469818
431 431 -, c dbSNP:754123386
431 431 c, t dbSNP:752976921
432 432 a, g, t dbSNP:189608159
438 438 c, t dbSNP:150710034
444 444 c, g dbSNP:372978101
447 447 a, c dbSNP:766603780
451 451 c, t dbSNP:761309301
452 452 a, g, t dbSNP:141162071
457 457 c, g dbSNP:747646025
470 470 a, g dbSNP:553165333
475 475 c, g dbSNP:376052792
477 477 a, t dbSNP:768389255
498 498 a, g dbSNP:11672248
499 499 a, g dbSNP:754977219
507 507 a, g dbSNP:754151928
509 509 c, t dbSNP:137853926
510 510 a, c dbSNP:756344545
511 511 g, t dbSNP:750851361
514 514 c, g dbSNP:767947330
524 524 a, g dbSNP:762462362
530 530 c, t dbSNP:751982790
531 531 a, g dbSNP:763727380
540 540 c, t dbSNP:762357416
542 542 c, g dbSNP:775007856
544 544 -, gc dbSNP:374441450
545 545 c, t dbSNP:769443319
549 549 -, act dbSNP:761252267
549 549 a, c dbSNP:759147221
551 551 c, t dbSNP:776432176
553 553 -, c dbSNP:773800902
556 556 c, t dbSNP:770690590
562 562 -, a dbSNP:767713562
562 562 a, c dbSNP:747007390
564 564 c, t dbSNP:375245522
574 574 a, g dbSNP:754203257
585 585 c, t dbSNP:768835014
586 586 c, g dbSNP:370811634
593 593 a, g dbSNP:780244288
601 601 a, g dbSNP:756430224
616 616 c, t dbSNP:746069265
617 617 c, t dbSNP:556029569
618 618 a, g, t dbSNP:752167079
619 619 c, t dbSNP:764523214
621 621 a, t dbSNP:758874639
624 624 a, g dbSNP:752178642
625 625 a, c, g dbSNP:759235065
630 630 a, c dbSNP:557128507
631 631 c, g, t dbSNP:148208638
632 632 c, t dbSNP:199625640
633 633 a, g dbSNP:771905543
637 637 c, t dbSNP:200226757
638 638 a, c, g dbSNP:145884498
645 645 g, t dbSNP:746163812
647 647 -, a dbSNP:761746361
648 648 c, t dbSNP:781552408
649 649 a, g dbSNP:757444080
672 672 c, t dbSNP:557461110
676 676 a, c, g dbSNP:767283349
684 684 -, c dbSNP:768727082
686 686 c, t dbSNP:201795161
688 688 c, t dbSNP:761655766
689 689 a, c, g dbSNP:764135517
690 690 a, t dbSNP:762946618
694 694 a, g dbSNP:776875106
697 697 c, g, t dbSNP:760844216
704 704 c, t dbSNP:773474924
707 707 a, g dbSNP:772375122
709 709 c, g dbSNP:748525943
714 714 a, g dbSNP:369142430
718 718 g, t dbSNP:769181592
720 720 a, g dbSNP:749775432
726 726 a, t dbSNP:779471836
732 732 a, c, g dbSNP:142531140
733 733 a, c, t dbSNP:780915776
734 734 c, g dbSNP:756906640
737 737 c, t dbSNP:139919292
738 738 a, g dbSNP:763935340
739 739 a, c dbSNP:758456131
748 748 a, g dbSNP:752647111
752 752 c, t dbSNP:766431820
756 756 c, t dbSNP:760792044
763 763 a, g dbSNP:370364717
764 764 g, t dbSNP:767783644
774 774 c, t dbSNP:761982168
777 777 a, g dbSNP:774718772
779 779 a, g dbSNP:768979541
786 786 a, g dbSNP:749861042
791 791 a, c dbSNP:147108114
793 793 c, g dbSNP:149015379
795 795 a, g dbSNP:745392621
799 799 c, t dbSNP:780531297
800 800 c, g, t dbSNP:137853145
801 801 a, g dbSNP:777747919
805 805 a, g dbSNP:758261006
812 812 a, g dbSNP:752630628
815 815 -, gt dbSNP:137853928
816 816 a, t dbSNP:765230520
823 823 g, t dbSNP:137853927
827 827 a, g dbSNP:781318458
828 828 -, tggtggac dbSNP:367543004
836 836 a, g dbSNP:757317728
837 837 a, t dbSNP:751582270
841 841 a, g dbSNP:764304912
844 844 c, t dbSNP:145872761
848 848 a, c dbSNP:369152505
853 853 c, g dbSNP:201135202
856 856 c, t dbSNP:562107248
860 860 c, t dbSNP:765500879
861 861 a, g, t dbSNP:777271351
871 871 a, c dbSNP:770620678
874 874 c, g dbSNP:149763685
875 875 a, c dbSNP:772777727
881 881 c, g dbSNP:771881717
883 883 a, c dbSNP:747706339
887 887 a, g dbSNP:778815231
905 905 c, t dbSNP:768303738
906 906 a, g, t dbSNP:137853933
911 911 a, g dbSNP:779981519
931 931 c, t dbSNP:755980118
935 935 a, g dbSNP:546500486
942 942 c, g dbSNP:777786780
943 943 c, t dbSNP:758698603
947 947 a, g dbSNP:752834862
948 948 a, t dbSNP:765697276
957 957 -, agtg dbSNP:756815834
957 957 a, c dbSNP:529563490
958 958 c, g dbSNP:754193561
970 970 c, t dbSNP:766994193
977 977 a, g dbSNP:376384592
982 982 c, t dbSNP:772871567
989 989 c, t dbSNP:771459625
991 991 c, g dbSNP:35459448
998 998 c, t dbSNP:750926892
999 999 g, t dbSNP:531798440
1005 1005 c, g dbSNP:767121196
1008 1008 c, g, t dbSNP:773846726
1016 1016 g, t dbSNP:763686070
1021 1021 a, g, t dbSNP:775318147
1028 1028 c, t dbSNP:541501038
1032 1032 a, g dbSNP:745875637
1035 1035 g, t dbSNP:776416499
1036 1036 c, t dbSNP:770841163
1051 1051 a, g dbSNP:748177094
1057 1057 g, t dbSNP:779007210
1063 1063 a, g, t dbSNP:201943206
1064 1064 c, t dbSNP:780603994
1065 1065 a, g dbSNP:756540804
1070 1070 c, t dbSNP:200022768
1073 1073 a, t dbSNP:137853144
1082 1082 c, t dbSNP:767915668
1088 1088 a, t dbSNP:757742984
1092 1092 g, t dbSNP:104894668
1095 1095 a, g dbSNP:751055366
1117 1117 c, t dbSNP:17854326
1130 1130 c, g, t dbSNP:762638116
1132 1132 c, g dbSNP:751808856
1138 1138 c, t dbSNP:765078381
1146 1146 a, g dbSNP:371082999
1153 1153 a, g dbSNP:776417728
1156 1156 a, g dbSNP:770801557
1168 1168 c, g dbSNP:746912748
1174 1174 c, t dbSNP:774342845
1175 1175 c, t dbSNP:768825506
1178 1178 a, g dbSNP:749586942
1185 1185 a, g dbSNP:373638052
1188 1188 g, t dbSNP:200867722
1192 1192 g, t dbSNP:781453921
1208 1208 c, t dbSNP:771327238
1220 1220 a, g dbSNP:747531005
1224 1224 a, c, g dbSNP:569275222
1313 1313 a, g dbSNP:569690919
1314 1314 c, t dbSNP:550428992
1321 1321 g, t dbSNP:776102111
1323 1323 c, t dbSNP:35960467
1333 1333 a, c dbSNP:530362686
1341 1341 a, g dbSNP:561525378
1342 1342 c, t dbSNP:116531742
1347 1347 a, g dbSNP:111286343
1351 1351 c, t dbSNP:766163327
1386 1386 a, g dbSNP:7256319
1398 1398 a, g dbSNP:773197009
1400 1400 a, c dbSNP:565001675
1413 1413 a, c dbSNP:545117711
1428 1428 c, g dbSNP:576004197
1455 1455 c, t dbSNP:562774214
1474 1474 g, t dbSNP:543691441
1475 1475 c, t dbSNP:750126679
1476 1476 c, g dbSNP:201615162
1477 1477 a, g dbSNP:761793607
1479 1479 c, t dbSNP:775763417
1492 1492 a, c dbSNP:769963837
1508 1508 c, t dbSNP:759747004
1510 1510 c, t dbSNP:776903837

Target ORF information:

RefSeq Version XM_011528422
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu62658
Accession Version XM_011528423.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1260bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cytokine receptor-like factor 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)403..678(+)
Misc Feature(2)403..654(+)
Misc Feature(3)655..666(+)
Misc Feature(4)706..1014(+)
Misc Feature(5)907..978(+)
Misc Feature(6)979..993(+)
Position Chain Variation Link
31 31 -, caatccgcgcggcggccgccgcc dbSNP:137853929
73 73 -, ctg dbSNP:137853925
75 75 -, gct dbSNP:34503316
118 118 a, t dbSNP:372707184
120 120 a, t dbSNP:748473690
126 126 -, tg dbSNP:756689237
126 126 a, g dbSNP:779267686
136 136 c, g dbSNP:751733093
142 142 a, c dbSNP:754292165
146 146 c, g, t dbSNP:367833835
147 147 a, g dbSNP:7259478
151 151 -, ctc dbSNP:751257411
153 153 c, t dbSNP:767093375
156 156 c, t dbSNP:761465676
157 157 a, g dbSNP:200728283
163 163 c, t dbSNP:763900232
166 166 -, c dbSNP:34603196
169 169 c, t dbSNP:763035784
171 171 a, g dbSNP:775538615
172 172 c, g dbSNP:151254980
185 185 c, t dbSNP:747071986
190 190 a, g dbSNP:142326326
195 195 a, c dbSNP:772185315
210 210 c, t dbSNP:572291511
211 211 a, g dbSNP:370673214
213 213 c, g, t dbSNP:201940100
214 214 a, g dbSNP:780528096
223 223 c, t dbSNP:756560447
226 226 g, t dbSNP:137853143
232 232 c, g dbSNP:749910321
234 234 a, c dbSNP:780713735
237 237 c, t dbSNP:2238647
238 238 a, g dbSNP:751204280
242 242 a, g dbSNP:104894670
244 244 a, c, t dbSNP:752738274
245 245 a, g dbSNP:374345199
246 246 c, t dbSNP:759478897
248 248 c, t dbSNP:773193414
249 249 a, g dbSNP:146098226
253 253 c, t dbSNP:202030926
258 258 a, g dbSNP:774598847
265 265 c, t dbSNP:556263201
266 266 a, g dbSNP:143326783
269 269 c, t dbSNP:199855680
275 275 a, g dbSNP:770320771
276 276 c, t dbSNP:775994224
285 285 c, t dbSNP:746338472
288 288 a, g dbSNP:371298845
292 292 c, t dbSNP:756762794
297 297 c, t dbSNP:751239369
298 298 c, g dbSNP:547116691
300 300 a, g dbSNP:201176844
301 301 a, g dbSNP:556620471
303 303 -, c dbSNP:137853931
311 311 a, g dbSNP:117193413
321 321 a, g dbSNP:765081779
325 325 -, agc dbSNP:763606003
325 325 c, t dbSNP:551665120
326 326 a, c, g dbSNP:767530836
339 339 a, c dbSNP:761942142
341 341 c, t dbSNP:774359694
342 342 c, t dbSNP:139923667
343 343 a, g dbSNP:763125360
355 355 c, t dbSNP:775855897
356 356 a, g dbSNP:146027258
360 360 c, t dbSNP:562764303
361 361 a, g dbSNP:373564660
369 369 c, t dbSNP:770404854
377 377 a, g dbSNP:746540745
382 382 c, t dbSNP:777352123
391 391 c, g dbSNP:758154908
397 397 c, t dbSNP:747750093
399 399 a, g dbSNP:778701303
413 413 c, t dbSNP:137853930
414 414 c, g, t dbSNP:199728865
415 415 a, g dbSNP:779676934
436 436 a, c dbSNP:756103761
447 447 a, g dbSNP:114059820
453 453 c, g dbSNP:764200371
454 454 a, c dbSNP:758469818
460 460 -, c dbSNP:754123386
460 460 c, t dbSNP:752976921
461 461 a, g, t dbSNP:189608159
467 467 c, t dbSNP:150710034
473 473 c, g dbSNP:372978101
476 476 a, c dbSNP:766603780
480 480 c, t dbSNP:761309301
481 481 a, g, t dbSNP:141162071
486 486 c, g dbSNP:747646025
499 499 a, g dbSNP:553165333
504 504 c, g dbSNP:376052792
506 506 a, t dbSNP:768389255
527 527 a, g dbSNP:11672248
528 528 a, g dbSNP:754977219
536 536 a, g dbSNP:754151928
538 538 c, t dbSNP:137853926
539 539 a, c dbSNP:756344545
540 540 g, t dbSNP:750851361
543 543 c, g dbSNP:767947330
553 553 a, g dbSNP:762462362
559 559 c, t dbSNP:751982790
560 560 a, g dbSNP:763727380
569 569 c, t dbSNP:762357416
571 571 c, g dbSNP:775007856
573 573 -, gc dbSNP:374441450
574 574 c, t dbSNP:769443319
578 578 -, act dbSNP:761252267
578 578 a, c dbSNP:759147221
580 580 c, t dbSNP:776432176
582 582 -, c dbSNP:773800902
585 585 c, t dbSNP:770690590
591 591 -, a dbSNP:767713562
591 591 a, c dbSNP:747007390
593 593 c, t dbSNP:375245522
603 603 a, g dbSNP:754203257
614 614 c, t dbSNP:768835014
615 615 c, g dbSNP:370811634
622 622 a, g dbSNP:780244288
630 630 a, g dbSNP:756430224
645 645 c, t dbSNP:746069265
646 646 c, t dbSNP:556029569
647 647 a, g, t dbSNP:752167079
648 648 c, t dbSNP:764523214
650 650 a, t dbSNP:758874639
653 653 a, g dbSNP:752178642
654 654 a, c, g dbSNP:759235065
659 659 a, c dbSNP:557128507
660 660 c, g, t dbSNP:148208638
661 661 c, t dbSNP:199625640
662 662 a, g dbSNP:771905543
666 666 c, t dbSNP:200226757
667 667 a, c, g dbSNP:145884498
674 674 g, t dbSNP:746163812
676 676 -, a dbSNP:761746361
677 677 c, t dbSNP:781552408
678 678 a, g dbSNP:757444080
701 701 c, t dbSNP:557461110
705 705 a, c, g dbSNP:767283349
713 713 -, c dbSNP:768727082
715 715 c, t dbSNP:201795161
717 717 c, t dbSNP:761655766
718 718 a, c, g dbSNP:764135517
719 719 a, t dbSNP:762946618
723 723 a, g dbSNP:776875106
726 726 c, g, t dbSNP:760844216
733 733 c, t dbSNP:773474924
736 736 a, g dbSNP:772375122
738 738 c, g dbSNP:748525943
743 743 a, g dbSNP:369142430
747 747 g, t dbSNP:769181592
749 749 a, g dbSNP:749775432
755 755 a, t dbSNP:779471836
761 761 a, c, g dbSNP:142531140
762 762 a, c, t dbSNP:780915776
763 763 c, g dbSNP:756906640
766 766 c, t dbSNP:139919292
767 767 a, g dbSNP:763935340
768 768 a, c dbSNP:758456131
777 777 a, g dbSNP:752647111
781 781 c, t dbSNP:766431820
785 785 c, t dbSNP:760792044
792 792 a, g dbSNP:370364717
793 793 g, t dbSNP:767783644
803 803 c, t dbSNP:761982168
806 806 a, g dbSNP:774718772
808 808 a, g dbSNP:768979541
815 815 a, g dbSNP:749861042
820 820 a, c dbSNP:147108114
822 822 c, g dbSNP:149015379
824 824 a, g dbSNP:745392621
828 828 c, t dbSNP:780531297
829 829 c, g, t dbSNP:137853145
830 830 a, g dbSNP:777747919
834 834 a, g dbSNP:758261006
841 841 a, g dbSNP:752630628
844 844 -, gt dbSNP:137853928
845 845 a, t dbSNP:765230520
852 852 g, t dbSNP:137853927
856 856 a, g dbSNP:781318458
857 857 -, tggtggac dbSNP:367543004
865 865 a, g dbSNP:757317728
866 866 a, t dbSNP:751582270
870 870 a, g dbSNP:764304912
873 873 c, t dbSNP:145872761
877 877 a, c dbSNP:369152505
882 882 c, g dbSNP:201135202
885 885 c, t dbSNP:562107248
889 889 c, t dbSNP:765500879
890 890 a, g, t dbSNP:777271351
900 900 a, c dbSNP:770620678
903 903 c, g dbSNP:149763685
904 904 a, c dbSNP:772777727
910 910 c, g dbSNP:771881717
912 912 a, c dbSNP:747706339
916 916 a, g dbSNP:778815231
934 934 c, t dbSNP:768303738
935 935 a, g, t dbSNP:137853933
940 940 a, g dbSNP:779981519
960 960 c, t dbSNP:755980118
964 964 a, g dbSNP:546500486
971 971 c, g dbSNP:777786780
972 972 c, t dbSNP:758698603
976 976 a, g dbSNP:752834862
977 977 a, t dbSNP:765697276
986 986 -, agtg dbSNP:756815834
986 986 a, c dbSNP:529563490
987 987 c, g dbSNP:754193561
999 999 c, t dbSNP:766994193
1006 1006 a, g dbSNP:376384592
1011 1011 c, t dbSNP:772871567
1018 1018 c, t dbSNP:771459625
1020 1020 c, g dbSNP:35459448
1027 1027 c, t dbSNP:750926892
1028 1028 g, t dbSNP:531798440
1034 1034 c, g dbSNP:767121196
1037 1037 c, g, t dbSNP:773846726
1045 1045 g, t dbSNP:763686070
1050 1050 a, g, t dbSNP:775318147
1057 1057 c, t dbSNP:541501038
1061 1061 a, g dbSNP:745875637
1064 1064 g, t dbSNP:776416499
1065 1065 c, t dbSNP:770841163
1080 1080 a, g dbSNP:748177094
1086 1086 g, t dbSNP:779007210
1092 1092 a, g, t dbSNP:201943206
1093 1093 c, t dbSNP:780603994
1094 1094 a, g dbSNP:756540804
1099 1099 c, t dbSNP:200022768
1102 1102 a, t dbSNP:137853144
1111 1111 c, t dbSNP:767915668
1117 1117 a, t dbSNP:757742984
1121 1121 g, t dbSNP:104894668
1124 1124 a, g dbSNP:751055366
1146 1146 c, t dbSNP:17854326
1159 1159 c, g, t dbSNP:762638116
1161 1161 c, g dbSNP:751808856
1167 1167 c, t dbSNP:765078381
1175 1175 a, g dbSNP:371082999
1182 1182 a, g dbSNP:776417728
1185 1185 a, g dbSNP:770801557
1197 1197 c, g dbSNP:746912748
1203 1203 c, t dbSNP:774342845
1204 1204 c, t dbSNP:768825506
1207 1207 a, g dbSNP:749586942
1216 1216 g, t dbSNP:781453921
1232 1232 c, t dbSNP:771327238
1244 1244 a, g dbSNP:747531005
1248 1248 a, c, g dbSNP:569275222
1337 1337 a, g dbSNP:569690919
1338 1338 c, t dbSNP:550428992
1345 1345 g, t dbSNP:776102111

Target ORF information:

RefSeq Version XM_011528423
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu62659
Accession Version XM_011528424.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1215bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cytokine receptor-like factor 1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)371..646(+)
Misc Feature(2)371..622(+)
Misc Feature(3)623..634(+)
Misc Feature(4)674..982(+)
Misc Feature(5)875..946(+)
Misc Feature(6)947..961(+)
Position Chain Variation Link
11 11 a, g dbSNP:547952607
42 42 g, t dbSNP:758119146
49 49 c, t dbSNP:745332499
55 55 a, g dbSNP:144720158
86 86 a, t dbSNP:372707184
88 88 a, t dbSNP:748473690
94 94 -, tg dbSNP:756689237
94 94 a, g dbSNP:779267686
104 104 c, g dbSNP:751733093
110 110 a, c dbSNP:754292165
114 114 c, g, t dbSNP:367833835
115 115 a, g dbSNP:7259478
119 119 -, ctc dbSNP:751257411
121 121 c, t dbSNP:767093375
124 124 c, t dbSNP:761465676
125 125 a, g dbSNP:200728283
131 131 c, t dbSNP:763900232
134 134 -, c dbSNP:34603196
137 137 c, t dbSNP:763035784
139 139 a, g dbSNP:775538615
140 140 c, g dbSNP:151254980
153 153 c, t dbSNP:747071986
158 158 a, g dbSNP:142326326
163 163 a, c dbSNP:772185315
178 178 c, t dbSNP:572291511
179 179 a, g dbSNP:370673214
181 181 c, g, t dbSNP:201940100
182 182 a, g dbSNP:780528096
191 191 c, t dbSNP:756560447
194 194 g, t dbSNP:137853143
200 200 c, g dbSNP:749910321
202 202 a, c dbSNP:780713735
205 205 c, t dbSNP:2238647
206 206 a, g dbSNP:751204280
210 210 a, g dbSNP:104894670
212 212 a, c, t dbSNP:752738274
213 213 a, g dbSNP:374345199
214 214 c, t dbSNP:759478897
216 216 c, t dbSNP:773193414
217 217 a, g dbSNP:146098226
221 221 c, t dbSNP:202030926
226 226 a, g dbSNP:774598847
233 233 c, t dbSNP:556263201
234 234 a, g dbSNP:143326783
237 237 c, t dbSNP:199855680
243 243 a, g dbSNP:770320771
244 244 c, t dbSNP:775994224
253 253 c, t dbSNP:746338472
256 256 a, g dbSNP:371298845
260 260 c, t dbSNP:756762794
265 265 c, t dbSNP:751239369
266 266 c, g dbSNP:547116691
268 268 a, g dbSNP:201176844
269 269 a, g dbSNP:556620471
271 271 -, c dbSNP:137853931
279 279 a, g dbSNP:117193413
289 289 a, g dbSNP:765081779
293 293 -, agc dbSNP:763606003
293 293 c, t dbSNP:551665120
294 294 a, c, g dbSNP:767530836
307 307 a, c dbSNP:761942142
309 309 c, t dbSNP:774359694
310 310 c, t dbSNP:139923667
311 311 a, g dbSNP:763125360
323 323 c, t dbSNP:775855897
324 324 a, g dbSNP:146027258
328 328 c, t dbSNP:562764303
329 329 a, g dbSNP:373564660
337 337 c, t dbSNP:770404854
345 345 a, g dbSNP:746540745
350 350 c, t dbSNP:777352123
359 359 c, g dbSNP:758154908
365 365 c, t dbSNP:747750093
367 367 a, g dbSNP:778701303
381 381 c, t dbSNP:137853930
382 382 c, g, t dbSNP:199728865
383 383 a, g dbSNP:779676934
404 404 a, c dbSNP:756103761
415 415 a, g dbSNP:114059820
421 421 c, g dbSNP:764200371
422 422 a, c dbSNP:758469818
428 428 -, c dbSNP:754123386
428 428 c, t dbSNP:752976921
429 429 a, g, t dbSNP:189608159
435 435 c, t dbSNP:150710034
441 441 c, g dbSNP:372978101
444 444 a, c dbSNP:766603780
448 448 c, t dbSNP:761309301
449 449 a, g, t dbSNP:141162071
454 454 c, g dbSNP:747646025
467 467 a, g dbSNP:553165333
472 472 c, g dbSNP:376052792
474 474 a, t dbSNP:768389255
495 495 a, g dbSNP:11672248
496 496 a, g dbSNP:754977219
504 504 a, g dbSNP:754151928
506 506 c, t dbSNP:137853926
507 507 a, c dbSNP:756344545
508 508 g, t dbSNP:750851361
511 511 c, g dbSNP:767947330
521 521 a, g dbSNP:762462362
527 527 c, t dbSNP:751982790
528 528 a, g dbSNP:763727380
537 537 c, t dbSNP:762357416
539 539 c, g dbSNP:775007856
541 541 -, gc dbSNP:374441450
542 542 c, t dbSNP:769443319
546 546 -, act dbSNP:761252267
546 546 a, c dbSNP:759147221
548 548 c, t dbSNP:776432176
550 550 -, c dbSNP:773800902
553 553 c, t dbSNP:770690590
559 559 -, a dbSNP:767713562
559 559 a, c dbSNP:747007390
561 561 c, t dbSNP:375245522
571 571 a, g dbSNP:754203257
582 582 c, t dbSNP:768835014
583 583 c, g dbSNP:370811634
590 590 a, g dbSNP:780244288
598 598 a, g dbSNP:756430224
613 613 c, t dbSNP:746069265
614 614 c, t dbSNP:556029569
615 615 a, g, t dbSNP:752167079
616 616 c, t dbSNP:764523214
618 618 a, t dbSNP:758874639
621 621 a, g dbSNP:752178642
622 622 a, c, g dbSNP:759235065
627 627 a, c dbSNP:557128507
628 628 c, g, t dbSNP:148208638
629 629 c, t dbSNP:199625640
630 630 a, g dbSNP:771905543
634 634 c, t dbSNP:200226757
635 635 a, c, g dbSNP:145884498
642 642 g, t dbSNP:746163812
644 644 -, a dbSNP:761746361
645 645 c, t dbSNP:781552408
646 646 a, g dbSNP:757444080
669 669 c, t dbSNP:557461110
673 673 a, c, g dbSNP:767283349
681 681 -, c dbSNP:768727082
683 683 c, t dbSNP:201795161
685 685 c, t dbSNP:761655766
686 686 a, c, g dbSNP:764135517
687 687 a, t dbSNP:762946618
691 691 a, g dbSNP:776875106
694 694 c, g, t dbSNP:760844216
701 701 c, t dbSNP:773474924
704 704 a, g dbSNP:772375122
706 706 c, g dbSNP:748525943
711 711 a, g dbSNP:369142430
715 715 g, t dbSNP:769181592
717 717 a, g dbSNP:749775432
723 723 a, t dbSNP:779471836
729 729 a, c, g dbSNP:142531140
730 730 a, c, t dbSNP:780915776
731 731 c, g dbSNP:756906640
734 734 c, t dbSNP:139919292
735 735 a, g dbSNP:763935340
736 736 a, c dbSNP:758456131
745 745 a, g dbSNP:752647111
749 749 c, t dbSNP:766431820
753 753 c, t dbSNP:760792044
760 760 a, g dbSNP:370364717
761 761 g, t dbSNP:767783644
771 771 c, t dbSNP:761982168
774 774 a, g dbSNP:774718772
776 776 a, g dbSNP:768979541
783 783 a, g dbSNP:749861042
788 788 a, c dbSNP:147108114
790 790 c, g dbSNP:149015379
792 792 a, g dbSNP:745392621
796 796 c, t dbSNP:780531297
797 797 c, g, t dbSNP:137853145
798 798 a, g dbSNP:777747919
802 802 a, g dbSNP:758261006
809 809 a, g dbSNP:752630628
812 812 -, gt dbSNP:137853928
813 813 a, t dbSNP:765230520
820 820 g, t dbSNP:137853927
824 824 a, g dbSNP:781318458
825 825 -, tggtggac dbSNP:367543004
833 833 a, g dbSNP:757317728
834 834 a, t dbSNP:751582270
838 838 a, g dbSNP:764304912
841 841 c, t dbSNP:145872761
845 845 a, c dbSNP:369152505
850 850 c, g dbSNP:201135202
853 853 c, t dbSNP:562107248
857 857 c, t dbSNP:765500879
858 858 a, g, t dbSNP:777271351
868 868 a, c dbSNP:770620678
871 871 c, g dbSNP:149763685
872 872 a, c dbSNP:772777727
878 878 c, g dbSNP:771881717
880 880 a, c dbSNP:747706339
884 884 a, g dbSNP:778815231
902 902 c, t dbSNP:768303738
903 903 a, g, t dbSNP:137853933
908 908 a, g dbSNP:779981519
928 928 c, t dbSNP:755980118
932 932 a, g dbSNP:546500486
939 939 c, g dbSNP:777786780
940 940 c, t dbSNP:758698603
944 944 a, g dbSNP:752834862
945 945 a, t dbSNP:765697276
954 954 -, agtg dbSNP:756815834
954 954 a, c dbSNP:529563490
955 955 c, g dbSNP:754193561
967 967 c, t dbSNP:766994193
974 974 a, g dbSNP:376384592
979 979 c, t dbSNP:772871567
986 986 c, t dbSNP:771459625
988 988 c, g dbSNP:35459448
995 995 c, t dbSNP:750926892
996 996 g, t dbSNP:531798440
1002 1002 c, g dbSNP:767121196
1005 1005 c, g, t dbSNP:773846726
1013 1013 g, t dbSNP:763686070
1018 1018 a, g, t dbSNP:775318147
1025 1025 c, t dbSNP:541501038
1029 1029 a, g dbSNP:745875637
1032 1032 g, t dbSNP:776416499
1033 1033 c, t dbSNP:770841163
1048 1048 a, g dbSNP:748177094
1054 1054 g, t dbSNP:779007210
1060 1060 a, g, t dbSNP:201943206
1061 1061 c, t dbSNP:780603994
1062 1062 a, g dbSNP:756540804
1067 1067 c, t dbSNP:200022768
1070 1070 a, t dbSNP:137853144
1079 1079 c, t dbSNP:767915668
1085 1085 a, t dbSNP:757742984
1089 1089 g, t dbSNP:104894668
1092 1092 a, g dbSNP:751055366
1114 1114 c, t dbSNP:17854326
1127 1127 c, g, t dbSNP:762638116
1129 1129 c, g dbSNP:751808856
1135 1135 c, t dbSNP:765078381
1143 1143 a, g dbSNP:371082999
1150 1150 a, g dbSNP:776417728
1153 1153 a, g dbSNP:770801557
1165 1165 c, g dbSNP:746912748
1171 1171 c, t dbSNP:774342845
1172 1172 c, t dbSNP:768825506
1175 1175 a, g dbSNP:749586942
1182 1182 a, g dbSNP:373638052
1185 1185 g, t dbSNP:200867722
1189 1189 g, t dbSNP:781453921
1205 1205 c, t dbSNP:771327238
1217 1217 a, g dbSNP:747531005
1221 1221 a, c, g dbSNP:569275222
1233 1233 c, t dbSNP:140937454
1235 1235 c, g dbSNP:748628554
1238 1238 a, g dbSNP:778433875
1247 1247 c, t dbSNP:371687287
1253 1253 a, c, t dbSNP:140234226
1260 1260 c, t dbSNP:755684000
1265 1265 c, t dbSNP:750266467
1274 1274 c, t dbSNP:370205810
1275 1275 a, g dbSNP:757302431
1280 1280 a, g dbSNP:751540772
1282 1282 a, c, t dbSNP:1802330
1283 1283 a, g dbSNP:759679563
1291 1291 c, t dbSNP:776511583
1310 1310 c, t dbSNP:534477786
1315 1315 g, t dbSNP:572284857
1384 1384 a, g dbSNP:747964653
1393 1393 c, t dbSNP:3202500
1428 1428 c, t dbSNP:1061404
1435 1435 g, t dbSNP:558657059
1441 1441 g, t dbSNP:774358392
1444 1444 a, g dbSNP:560777470
1448 1448 -, tg dbSNP:763788359
1449 1449 -, tg dbSNP:375500909
1505 1505 c, t dbSNP:373372451
1524 1524 a, g dbSNP:80184203

Target ORF information:

RefSeq Version XM_011528424
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cytokine receptor-like factor 1 (CRLF1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18874
Accession Version NM_004750.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1269bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cytokine receptor-like factor 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF073515.1 and AY358291.1. This sequence is a reference standard in the RefSeqGene project. On Oct 7, 2009 this sequence version replaced gi:169881244. Summary: This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF073515.1, BC044634.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1966682, SAMEA1968189 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)27..29(+)
Misc Feature(2)597..872(+)
Misc Feature(3)597..848(+)
Misc Feature(4)849..860(+)
Misc Feature(5)900..1208(+)
Misc Feature(6)1101..1172(+)
Misc Feature(7)1173..1187(+)
Misc Feature(8)1173..1187(+)
Exon (1)1..309
Gene Synonym:
Exon (2)310..591
Gene Synonym:
Exon (3)592..721
Gene Synonym:
Exon (4)722..891
Gene Synonym:
Exon (5)892..1049
Gene Synonym:
Exon (6)1050..1218
Gene Synonym:
Exon (7)1219..1406
Gene Synonym:
Exon (8)1407..1449
Gene Synonym:
Exon (9)1450..1804
Gene Synonym:
Position Chain Variation Link
24 24 c, t dbSNP:141412226
225 225 -, caatccgcgcggcggccgccgcc dbSNP:137853929
267 267 -, ctg dbSNP:137853925
269 269 -, gct dbSNP:34503316
312 312 a, t dbSNP:372707184
314 314 a, t dbSNP:748473690
320 320 -, tg dbSNP:756689237
320 320 a, g dbSNP:779267686
330 330 c, g dbSNP:751733093
336 336 a, c dbSNP:754292165
340 340 c, g, t dbSNP:367833835
341 341 a, g dbSNP:7259478
345 345 -, ctc dbSNP:751257411
347 347 c, t dbSNP:767093375
350 350 c, t dbSNP:761465676
351 351 a, g dbSNP:200728283
357 357 c, t dbSNP:763900232
360 360 -, c dbSNP:34603196
363 363 c, t dbSNP:763035784
365 365 a, g dbSNP:775538615
366 366 c, g dbSNP:151254980
379 379 c, t dbSNP:747071986
384 384 a, g dbSNP:142326326
389 389 a, c dbSNP:772185315
404 404 c, t dbSNP:572291511
405 405 a, g dbSNP:370673214
407 407 c, g, t dbSNP:201940100
408 408 a, g dbSNP:780528096
417 417 c, t dbSNP:756560447
420 420 g, t dbSNP:137853143
426 426 c, g dbSNP:749910321
428 428 a, c dbSNP:780713735
431 431 c, t dbSNP:2238647
432 432 a, g dbSNP:751204280
436 436 a, g dbSNP:104894670
438 438 a, c, t dbSNP:752738274
439 439 a, g dbSNP:374345199
440 440 c, t dbSNP:759478897
442 442 c, t dbSNP:773193414
443 443 a, g dbSNP:146098226
447 447 c, t dbSNP:202030926
452 452 a, g dbSNP:774598847
459 459 c, t dbSNP:556263201
460 460 a, g dbSNP:143326783
463 463 c, t dbSNP:199855680
469 469 a, g dbSNP:770320771
470 470 c, t dbSNP:775994224
479 479 c, t dbSNP:746338472
482 482 a, g dbSNP:371298845
486 486 c, t dbSNP:756762794
491 491 c, t dbSNP:751239369
492 492 c, g dbSNP:547116691
494 494 a, g dbSNP:201176844
495 495 a, g dbSNP:556620471
497 497 -, c dbSNP:137853931
505 505 a, g dbSNP:117193413
515 515 a, g dbSNP:765081779
519 519 -, agc dbSNP:763606003
519 519 c, t dbSNP:551665120
520 520 a, c, g dbSNP:767530836
533 533 a, c dbSNP:761942142
535 535 c, t dbSNP:774359694
536 536 c, t dbSNP:139923667
537 537 a, g dbSNP:763125360
549 549 c, t dbSNP:775855897
550 550 a, g dbSNP:146027258
554 554 c, t dbSNP:562764303
555 555 a, g dbSNP:373564660
563 563 c, t dbSNP:770404854
571 571 a, g dbSNP:746540745
576 576 c, t dbSNP:777352123
585 585 c, g dbSNP:758154908
591 591 c, t dbSNP:747750093
593 593 a, g dbSNP:778701303
607 607 c, t dbSNP:137853930
608 608 c, g, t dbSNP:199728865
609 609 a, g dbSNP:779676934
630 630 a, c dbSNP:756103761
641 641 a, g dbSNP:114059820
647 647 c, g dbSNP:764200371
648 648 a, c dbSNP:758469818
654 654 -, c dbSNP:754123386
654 654 c, t dbSNP:752976921
655 655 a, g, t dbSNP:189608159
661 661 c, t dbSNP:150710034
667 667 c, g dbSNP:372978101
670 670 a, c dbSNP:766603780
674 674 c, t dbSNP:761309301
675 675 a, g, t dbSNP:141162071
680 680 c, g dbSNP:747646025
693 693 a, g dbSNP:553165333
698 698 c, g dbSNP:376052792
700 700 a, t dbSNP:768389255
721 721 a, g dbSNP:11672248
722 722 a, g dbSNP:754977219
730 730 a, g dbSNP:754151928
732 732 c, t dbSNP:137853926
733 733 a, c dbSNP:756344545
734 734 g, t dbSNP:750851361
737 737 c, g dbSNP:767947330
747 747 a, g dbSNP:762462362
753 753 c, t dbSNP:751982790
754 754 a, g dbSNP:763727380
763 763 c, t dbSNP:762357416
765 765 c, g dbSNP:775007856
767 767 -, gc dbSNP:374441450
768 768 c, t dbSNP:769443319
772 772 -, act dbSNP:761252267
772 772 a, c dbSNP:759147221
774 774 c, t dbSNP:776432176
776 776 -, c dbSNP:773800902
779 779 c, t dbSNP:770690590
785 785 -, a dbSNP:767713562
785 785 a, c dbSNP:747007390
787 787 c, t dbSNP:375245522
797 797 a, g dbSNP:754203257
808 808 c, t dbSNP:768835014
809 809 c, g dbSNP:370811634
816 816 a, g dbSNP:780244288
824 824 a, g dbSNP:756430224
839 839 c, t dbSNP:746069265
840 840 c, t dbSNP:556029569
841 841 a, g, t dbSNP:752167079
842 842 c, t dbSNP:764523214
844 844 a, t dbSNP:758874639
847 847 a, g dbSNP:752178642
848 848 a, c, g dbSNP:759235065
853 853 a, c dbSNP:557128507
854 854 c, g, t dbSNP:148208638
855 855 c, t dbSNP:199625640
856 856 a, g dbSNP:771905543
860 860 c, t dbSNP:200226757
861 861 a, c, g dbSNP:145884498
868 868 g, t dbSNP:746163812
870 870 -, a dbSNP:761746361
871 871 c, t dbSNP:781552408
872 872 a, g dbSNP:757444080
895 895 c, t dbSNP:557461110
899 899 a, c, g dbSNP:767283349
907 907 -, c dbSNP:768727082
909 909 c, t dbSNP:201795161
911 911 c, t dbSNP:761655766
912 912 a, c, g dbSNP:764135517
913 913 a, t dbSNP:762946618
917 917 a, g dbSNP:776875106
920 920 c, g, t dbSNP:760844216
927 927 c, t dbSNP:773474924
930 930 a, g dbSNP:772375122
932 932 c, g dbSNP:748525943
937 937 a, g dbSNP:369142430
941 941 g, t dbSNP:769181592
943 943 a, g dbSNP:749775432
949 949 a, t dbSNP:779471836
955 955 a, c, g dbSNP:142531140
956 956 a, c, t dbSNP:780915776
957 957 c, g dbSNP:756906640
960 960 c, t dbSNP:139919292
961 961 a, g dbSNP:763935340
962 962 a, c dbSNP:758456131
971 971 a, g dbSNP:752647111
975 975 c, t dbSNP:766431820
979 979 c, t dbSNP:760792044
986 986 a, g dbSNP:370364717
987 987 g, t dbSNP:767783644
997 997 c, t dbSNP:761982168
1000 1000 a, g dbSNP:774718772
1002 1002 a, g dbSNP:768979541
1009 1009 a, g dbSNP:749861042
1014 1014 a, c dbSNP:147108114
1016 1016 c, g dbSNP:149015379
1018 1018 a, g dbSNP:745392621
1022 1022 c, t dbSNP:780531297
1023 1023 c, g, t dbSNP:137853145
1024 1024 a, g dbSNP:777747919
1028 1028 a, g dbSNP:758261006
1035 1035 a, g dbSNP:752630628
1038 1038 -, gt dbSNP:137853928
1039 1039 a, t dbSNP:765230520
1046 1046 g, t dbSNP:137853927
1050 1050 a, g dbSNP:781318458
1051 1051 -, tggtggac dbSNP:367543004
1059 1059 a, g dbSNP:757317728
1060 1060 a, t dbSNP:751582270
1064 1064 a, g dbSNP:764304912
1067 1067 c, t dbSNP:145872761
1071 1071 a, c dbSNP:369152505
1076 1076 c, g dbSNP:201135202
1079 1079 c, t dbSNP:562107248
1083 1083 c, t dbSNP:765500879
1084 1084 a, g, t dbSNP:777271351
1094 1094 a, c dbSNP:770620678
1097 1097 c, g dbSNP:149763685
1098 1098 a, c dbSNP:772777727
1104 1104 c, g dbSNP:771881717
1106 1106 a, c dbSNP:747706339
1110 1110 a, g dbSNP:778815231
1128 1128 c, t dbSNP:768303738
1129 1129 a, g, t dbSNP:137853933
1134 1134 a, g dbSNP:779981519
1154 1154 c, t dbSNP:755980118
1158 1158 a, g dbSNP:546500486
1165 1165 c, g dbSNP:777786780
1166 1166 c, t dbSNP:758698603
1170 1170 a, g dbSNP:752834862
1171 1171 a, t dbSNP:765697276
1180 1180 -, agtg dbSNP:756815834
1180 1180 a, c dbSNP:529563490
1181 1181 c, g dbSNP:754193561
1193 1193 c, t dbSNP:766994193
1200 1200 a, g dbSNP:376384592
1205 1205 c, t dbSNP:772871567
1212 1212 c, t dbSNP:771459625
1214 1214 c, g dbSNP:35459448
1221 1221 c, t dbSNP:750926892
1222 1222 g, t dbSNP:531798440
1228 1228 c, g dbSNP:767121196
1231 1231 c, g, t dbSNP:773846726
1239 1239 g, t dbSNP:763686070
1244 1244 a, g, t dbSNP:775318147
1251 1251 c, t dbSNP:541501038
1255 1255 a, g dbSNP:745875637
1258 1258 g, t dbSNP:776416499
1259 1259 c, t dbSNP:770841163
1274 1274 a, g dbSNP:748177094
1280 1280 g, t dbSNP:779007210
1286 1286 a, g, t dbSNP:201943206
1287 1287 c, t dbSNP:780603994
1288 1288 a, g dbSNP:756540804
1293 1293 c, t dbSNP:200022768
1296 1296 a, t dbSNP:137853144
1305 1305 c, t dbSNP:767915668
1311 1311 a, t dbSNP:757742984
1315 1315 g, t dbSNP:104894668
1318 1318 a, g dbSNP:751055366
1340 1340 c, t dbSNP:17854326
1353 1353 c, g, t dbSNP:762638116
1355 1355 c, g dbSNP:751808856
1361 1361 c, t dbSNP:765078381
1369 1369 a, g dbSNP:371082999
1376 1376 a, g dbSNP:776417728
1379 1379 a, g dbSNP:770801557
1391 1391 c, g dbSNP:746912748
1397 1397 c, t dbSNP:774342845
1398 1398 c, t dbSNP:768825506
1401 1401 a, g dbSNP:749586942
1410 1410 g, t dbSNP:781453921
1426 1426 c, t dbSNP:771327238
1438 1438 a, g dbSNP:747531005
1442 1442 a, c, g dbSNP:569275222
1454 1454 c, t dbSNP:140937454
1456 1456 c, g dbSNP:748628554
1459 1459 a, g dbSNP:778433875
1468 1468 c, t dbSNP:371687287
1474 1474 a, c, t dbSNP:140234226
1481 1481 c, t dbSNP:755684000
1486 1486 c, t dbSNP:750266467
1495 1495 c, t dbSNP:370205810
1496 1496 a, g dbSNP:757302431
1501 1501 a, g dbSNP:751540772
1503 1503 a, c, t dbSNP:1802330
1504 1504 a, g dbSNP:759679563
1512 1512 c, t dbSNP:776511583
1531 1531 c, t dbSNP:534477786
1536 1536 g, t dbSNP:572284857
1605 1605 a, g dbSNP:747964653
1614 1614 c, t dbSNP:3202500
1649 1649 c, t dbSNP:1061404
1656 1656 g, t dbSNP:558657059
1662 1662 g, t dbSNP:774358392
1665 1665 a, g dbSNP:560777470
1669 1669 -, tg dbSNP:763788359
1670 1670 -, tg dbSNP:375500909
1726 1726 c, t dbSNP:373372451
1745 1745 a, g dbSNP:80184203
1794 1794 a, g dbSNP:555927277

Target ORF information:

RefSeq Version NM_004750
Organism Homo sapiens (human)
Definition Homo sapiens cytokine receptor-like factor 1 (CRLF1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.