Email to GenScript

GRHPR glyoxylate reductase/hydroxypyruvate reductase [Homo sapiens (human)]

Gene Symbol GRHPR
Entrez Gene ID 9380
Full Name glyoxylate reductase/hydroxypyruvate reductase
Synonyms GLXR, GLYD, PH2
General protein information
Preferred Names
glyoxylate reductase/hydroxypyruvate reductase
glyoxylate reductase/hydroxypyruvate reductase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Hyperoxaluria, primary, type II, 260000 (3)

The following GRHPR gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GRHPR gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu42881 XM_005251631 PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu62784 XM_011518073 PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu19343 NM_012203 Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $309

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu42881
Accession Version XM_005251631.1
Sequence Information ORF Nucleotide Sequence (Length: 666bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008413.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)86..715(+)
Misc Feature(2)86..691(+)
Misc Feature(3)212..463(+)
Position Chain Variation Link
6 6 c, t dbSNP:534440132
8 8 a, c, g dbSNP:149749351
9 9 c, g, t dbSNP:764081167
19 19 a, c dbSNP:757530903
29 29 a, g dbSNP:765438095
33 33 a, c dbSNP:377087833
34 34 c, t dbSNP:750839268
35 35 g, t dbSNP:577436763
36 36 c, g dbSNP:780431255
39 39 c, t dbSNP:747479930
41 41 a, g dbSNP:370961823
43 43 a, g dbSNP:777207347
46 46 g, t dbSNP:748805098
49 49 a, g dbSNP:770749390
52 52 a, g dbSNP:201826196
53 53 c, t dbSNP:200847843
61 61 a, g dbSNP:772023163
62 62 c, t dbSNP:775288188
69 69 a, g dbSNP:760538945
71 71 c, t dbSNP:147185003
73 73 c, g dbSNP:111232251
79 79 a, g dbSNP:776638978
89 89 a, g dbSNP:761847384
91 91 c, t dbSNP:765256070
93 93 a, g dbSNP:750677922
99 99 c, t dbSNP:758553267
100 100 -, a dbSNP:180177311
106 106 c, t dbSNP:138843824
116 116 a, g dbSNP:751940452
129 129 a, g dbSNP:755504903
133 133 a, g dbSNP:781702870
146 146 c, t dbSNP:746364242
153 153 c, t dbSNP:566239341
154 154 a, g dbSNP:758880537
164 164 c, g dbSNP:780635481
174 174 a, g dbSNP:201661750
181 181 c, t dbSNP:560441686
187 187 -, a dbSNP:771019056
189 189 c, g, t dbSNP:747664983
190 190 a, g dbSNP:140612021
192 192 a, g dbSNP:748913563
202 202 c, t dbSNP:142509393
203 203 c, g dbSNP:774233908
209 209 a, g dbSNP:759447197
211 211 c, t dbSNP:767483014
212 212 a, g dbSNP:180177312
221 221 c, t dbSNP:760782027
222 222 a, g dbSNP:764111479
223 223 c, g dbSNP:754089807
228 228 a, g dbSNP:180177314
234 234 -, c dbSNP:767052015
236 236 a, g dbSNP:767940909
243 243 a, g dbSNP:12002324
245 245 c, t dbSNP:370733771
246 246 a, g dbSNP:200106110
259 259 c, t dbSNP:749885934
260 260 a, g, t dbSNP:377374419
267 267 -, ag dbSNP:749832848
272 272 -, t dbSNP:755802187
274 274 -, t dbSNP:180177315
277 277 c, g dbSNP:370395134
280 280 c, t dbSNP:754799506
286 286 g, t dbSNP:780899894
287 287 c, t dbSNP:748100930
297 297 c, g dbSNP:755995624
301 301 c, t dbSNP:777978915
304 304 a, g dbSNP:749299411
312 312 c, t dbSNP:771231175
313 313 a, g dbSNP:309458
342 342 -, ct dbSNP:180177316
342 342 c, t dbSNP:751218068
343 343 a, t dbSNP:759131163
347 347 a, c dbSNP:767361628
358 358 a, g dbSNP:528909225
360 360 c, t dbSNP:375014308
368 368 a, g dbSNP:777552498
370 370 c, t dbSNP:548848730
371 371 a, g dbSNP:145899443
373 373 c, t dbSNP:568786902
390 390 c, t dbSNP:368512158
396 396 c, g, t dbSNP:772410150
397 397 a, g dbSNP:138575944
399 399 c, t dbSNP:747304081
400 400 c, g, t dbSNP:146227450
401 401 a, g dbSNP:762313648
411 411 c, g dbSNP:780674890
415 415 c, g dbSNP:770441615
416 416 a, g dbSNP:74692381
420 420 a, t dbSNP:202212690
421 421 -, ctt dbSNP:754788389
421 421 c, t dbSNP:759255604
424 424 a, c dbSNP:185747820
435 435 c, t dbSNP:143596402
445 445 a, c dbSNP:760405997
447 447 c, t dbSNP:763906407
464 464 a, g dbSNP:753719446
472 472 c, t dbSNP:750846577
474 474 a, g dbSNP:180177318
475 475 c, t dbSNP:549318773
476 476 a, g dbSNP:369950120
478 478 c, t dbSNP:373541730
479 479 a, g dbSNP:769568097
490 490 c, t dbSNP:777753552
491 491 a, g dbSNP:376446449
493 493 c, g dbSNP:770585067
496 496 a, g dbSNP:201872828
499 499 a, c, t dbSNP:759328663
500 500 c, t dbSNP:775530794
501 501 -, g dbSNP:775659622
505 505 c, g, t dbSNP:367671150
511 511 c, t dbSNP:201303429
532 532 c, t dbSNP:754249229
535 535 a, c dbSNP:141800325
540 540 a, g dbSNP:369698939
542 542 a, g dbSNP:765478360
546 546 c, t dbSNP:750954346
547 547 a, g dbSNP:373622439
577 577 a, t dbSNP:780918729
578 578 c, t dbSNP:202120724
580 580 -, c dbSNP:749705881
580 580 c, g dbSNP:146293016
582 582 g, t dbSNP:777592522
585 585 a, c dbSNP:200326253
586 586 c, t dbSNP:375012546
589 589 a, g dbSNP:553861073
594 594 a, g dbSNP:563726915
596 596 -, tg dbSNP:768997865
598 598 -, tg dbSNP:180177321
601 601 a, g dbSNP:748156467
605 605 c, t dbSNP:1135283
614 614 a, g dbSNP:139554205
615 615 c, t dbSNP:777890250
623 623 a, g dbSNP:200632069
624 624 a, c dbSNP:562262441
625 625 c, t dbSNP:771438574
631 631 c, g dbSNP:774847239
638 638 c, t dbSNP:180177322
639 639 a, g dbSNP:180177323
643 643 c, t dbSNP:776250933
648 648 c, t dbSNP:761249461
651 651 c, g dbSNP:764762587
654 654 c, t dbSNP:750047290
655 655 c, g, t dbSNP:531886256
660 660 c, t dbSNP:766228863
664 664 -, aac dbSNP:780317388
668 668 a, g dbSNP:180177324
689 689 g, t dbSNP:142835989
696 696 c, t dbSNP:142356700
697 697 a, g dbSNP:76299266
699 699 c, g, t dbSNP:180177325
700 700 c, g dbSNP:756155443
705 705 c, g dbSNP:777855353
712 712 c, t dbSNP:749583128
721 721 a, g dbSNP:371501708
722 722 -, caaa dbSNP:749509830
723 723 -, aa dbSNP:768803443
724 724 a, c, g dbSNP:752397163
725 725 -, aacag dbSNP:774788936
728 728 -, agt dbSNP:748410064
736 736 g, t dbSNP:570858068
741 741 a, g dbSNP:772430983
743 743 c, t dbSNP:775891475
744 744 c, g, t dbSNP:374742361
745 745 a, g dbSNP:202111075
757 757 a, g dbSNP:370704714
760 760 -, c dbSNP:772661509
768 768 c, t dbSNP:765995083
773 773 a, c dbSNP:773945388
839 839 a, g dbSNP:115124458
847 847 c, t dbSNP:3198078
867 867 a, g dbSNP:1057507
907 907 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version XM_005251631
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu62784
Accession Version XM_011518073.1
Sequence Information ORF Nucleotide Sequence (Length: 585bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008413.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)884..1372(+)
Misc Feature(2)884..1348(+)
Misc Feature(3)938..1120(+)
Position Chain Variation Link
5 5 a, g dbSNP:765438095
9 9 a, c dbSNP:377087833
10 10 c, t dbSNP:750839268
11 11 g, t dbSNP:577436763
12 12 c, g dbSNP:780431255
15 15 c, t dbSNP:747479930
17 17 a, g dbSNP:370961823
19 19 a, g dbSNP:777207347
22 22 g, t dbSNP:748805098
25 25 a, g dbSNP:770749390
28 28 a, g dbSNP:201826196
29 29 c, t dbSNP:200847843
37 37 a, g dbSNP:772023163
38 38 c, t dbSNP:775288188
45 45 a, g dbSNP:760538945
47 47 c, t dbSNP:147185003
49 49 c, g dbSNP:111232251
55 55 a, g dbSNP:776638978
65 65 a, g dbSNP:761847384
67 67 c, t dbSNP:765256070
69 69 a, g dbSNP:750677922
75 75 c, t dbSNP:758553267
76 76 -, a dbSNP:180177311
82 82 c, t dbSNP:138843824
92 92 a, g dbSNP:751940452
105 105 a, g dbSNP:755504903
109 109 a, g dbSNP:781702870
116 116 c, t dbSNP:749935481
117 117 g, t dbSNP:758049256
123 123 g, t dbSNP:555739115
124 124 a, g dbSNP:141330907
132 132 -, g dbSNP:746720647
133 133 a, g dbSNP:180177304
134 134 -, g dbSNP:80356708
138 138 c, t dbSNP:768530117
139 139 a, g dbSNP:377072887
145 145 a, g dbSNP:572388564
146 146 a, c dbSNP:748100952
150 150 c, t dbSNP:769706192
152 152 c, t dbSNP:773348414
153 153 c, t dbSNP:763059780
157 157 c, t dbSNP:771110153
167 167 c, g dbSNP:202022170
170 170 c, t dbSNP:774654020
174 174 a, c, g dbSNP:759635458
179 179 a, g dbSNP:753053100
180 180 -, g dbSNP:751101495
180 180 c, t dbSNP:150805048
181 181 a, g dbSNP:369721488
185 185 a, g, t dbSNP:749990630
186 186 c, g, t dbSNP:779393751
187 187 c, g dbSNP:754532633
190 190 a, c, t dbSNP:781026957
191 191 a, g dbSNP:756085471
193 193 c, g dbSNP:777666462
197 197 c, t dbSNP:749132898
209 209 g, t dbSNP:771071997
211 211 c, t dbSNP:139689525
212 212 a, g dbSNP:371660673
218 218 a, g dbSNP:772410247
220 220 a, g dbSNP:776059959
223 223 c, t dbSNP:543901638
232 232 a, c dbSNP:149782105
234 234 c, t dbSNP:180177305
265 265 c, t dbSNP:143337459
279 279 -, tg dbSNP:672601351
283 283 a, c dbSNP:139595138
286 286 c, t dbSNP:372985143
287 287 a, g dbSNP:745927190
289 289 a, c dbSNP:772459393
289 289 -, c dbSNP:540425024
295 295 c, g dbSNP:775829035
304 304 a, t dbSNP:747177860
316 316 -, gcg dbSNP:750079140
317 317 c, t dbSNP:78920863
319 319 c, t dbSNP:201553816
321 321 a, g dbSNP:771573531
323 323 a, t dbSNP:374332294
325 325 c, g dbSNP:774921138
326 326 c, t dbSNP:119490108
327 327 a, g dbSNP:146603229
330 330 c, t dbSNP:763645212
334 334 c, t dbSNP:11546644
336 336 a, g dbSNP:35975284
338 338 a, g dbSNP:377116902
339 339 c, t dbSNP:761490627
342 342 c, t dbSNP:765032330
345 345 a, g dbSNP:750415781
350 350 c, t dbSNP:758355273
354 354 c, t dbSNP:370530139
364 364 c, t dbSNP:751686181
367 367 c, t dbSNP:148778319
368 368 a, g dbSNP:180177307
373 373 c, t dbSNP:374108537
374 374 a, g dbSNP:113602485
376 376 a, t dbSNP:147053190
379 379 -, c dbSNP:755926095
381 381 -, ccctgctacttaccacctgccgc dbSNP:779996558
382 382 c, t dbSNP:778134721
383 383 c, t dbSNP:182258378
388 388 a, g dbSNP:186922220
389 389 c, t dbSNP:11546642
391 391 -, a dbSNP:749029919
396 396 c, t dbSNP:200249904
401 401 c, t dbSNP:372712521
402 402 a, g, t dbSNP:768403579
404 404 c, t dbSNP:761485918
405 405 a, g dbSNP:199560759
406 406 -, g dbSNP:180177308
407 407 g, t dbSNP:750231875
411 411 c, t dbSNP:763052360
412 412 a, g dbSNP:151336686
415 415 a, g dbSNP:372351685
416 416 g, t dbSNP:755040146
418 418 a, c dbSNP:529454212
421 421 c, g, t dbSNP:752869610
422 422 a, g dbSNP:369339903
428 428 g, t dbSNP:749644821
443 443 c, t dbSNP:746364242
450 450 c, t dbSNP:566239341
451 451 a, g dbSNP:758880537
461 461 c, g dbSNP:780635481
471 471 a, g dbSNP:201661750
478 478 c, t dbSNP:560441686
484 484 -, a dbSNP:771019056
486 486 c, g, t dbSNP:747664983
487 487 a, g dbSNP:140612021
489 489 a, g dbSNP:748913563
499 499 c, t dbSNP:142509393
500 500 c, g dbSNP:774233908
506 506 a, g dbSNP:759447197
508 508 c, t dbSNP:767483014
509 509 a, g dbSNP:180177312
518 518 c, t dbSNP:760782027
519 519 a, g dbSNP:764111479
520 520 c, g dbSNP:754089807
526 526 a, t dbSNP:180177313
533 533 c, t dbSNP:41303225
537 537 c, t dbSNP:765596317
538 538 c, t dbSNP:141090601
543 543 a, c, t dbSNP:746648380
544 544 a, g dbSNP:780588937
551 551 c, t dbSNP:146896070
552 552 a, g dbSNP:374838995
553 553 c, t dbSNP:369699672
556 556 c, t dbSNP:373472631
557 557 a, g dbSNP:147934112
558 558 a, g dbSNP:770696432
562 562 c, g, t dbSNP:376674882
565 565 a, c dbSNP:377116116
568 568 c, t dbSNP:371264136
569 569 a, g dbSNP:373213853
573 573 c, t dbSNP:760489628
578 578 -, a dbSNP:776773819
578 578 a, c dbSNP:768726104
580 580 -, cc dbSNP:759810267
584 584 -, gg dbSNP:769852092
584 584 g, t dbSNP:776632391
588 588 -, c dbSNP:775855961
603 603 c, t dbSNP:762078399
622 622 c, g dbSNP:765415889
626 626 g, t dbSNP:566785032
636 636 c, t dbSNP:750803720
648 648 a, g dbSNP:763398450
664 664 a, g dbSNP:556203401
669 669 a, g dbSNP:766613829
670 670 c, t dbSNP:752115702
682 682 -, a dbSNP:763263606
728 728 c, g dbSNP:755488609
751 751 c, t dbSNP:309462
759 759 -, a dbSNP:376781208
819 819 c, g, t dbSNP:780811992
856 856 a, g dbSNP:141708617
863 863 a, g dbSNP:370451439
874 874 c, t dbSNP:538445999
885 885 a, g dbSNP:180177314
891 891 -, c dbSNP:767052015
893 893 a, g dbSNP:767940909
900 900 a, g dbSNP:12002324
902 902 c, t dbSNP:370733771
903 903 a, g dbSNP:200106110
916 916 c, t dbSNP:749885934
917 917 a, g, t dbSNP:377374419
924 924 -, ag dbSNP:749832848
929 929 -, t dbSNP:755802187
931 931 -, t dbSNP:180177315
934 934 c, g dbSNP:370395134
937 937 c, t dbSNP:754799506
943 943 g, t dbSNP:780899894
944 944 c, t dbSNP:748100930
954 954 c, g dbSNP:755995624
958 958 c, t dbSNP:777978915
961 961 a, g dbSNP:749299411
969 969 c, t dbSNP:771231175
970 970 a, g dbSNP:309458
999 999 -, ct dbSNP:180177316
999 999 c, t dbSNP:751218068
1000 1000 a, t dbSNP:759131163
1004 1004 a, c dbSNP:767361628
1015 1015 a, g dbSNP:528909225
1017 1017 c, t dbSNP:375014308
1025 1025 a, g dbSNP:777552498
1027 1027 c, t dbSNP:548848730
1028 1028 a, g dbSNP:145899443
1030 1030 c, t dbSNP:568786902
1047 1047 c, t dbSNP:368512158
1053 1053 c, g, t dbSNP:772410150
1054 1054 a, g dbSNP:138575944
1056 1056 c, t dbSNP:747304081
1057 1057 c, g, t dbSNP:146227450
1058 1058 a, g dbSNP:762313648
1068 1068 c, g dbSNP:780674890
1072 1072 c, g dbSNP:770441615
1073 1073 a, g dbSNP:74692381
1077 1077 a, t dbSNP:202212690
1078 1078 -, ctt dbSNP:754788389
1078 1078 c, t dbSNP:759255604
1081 1081 a, c dbSNP:185747820
1092 1092 c, t dbSNP:143596402
1102 1102 a, c dbSNP:760405997
1104 1104 c, t dbSNP:763906407
1121 1121 a, g dbSNP:753719446
1129 1129 c, t dbSNP:750846577
1131 1131 a, g dbSNP:180177318
1132 1132 c, t dbSNP:549318773
1133 1133 a, g dbSNP:369950120
1135 1135 c, t dbSNP:373541730
1136 1136 a, g dbSNP:769568097
1147 1147 c, t dbSNP:777753552
1148 1148 a, g dbSNP:376446449
1150 1150 c, g dbSNP:770585067
1153 1153 a, g dbSNP:201872828
1156 1156 a, c, t dbSNP:759328663
1157 1157 c, t dbSNP:775530794
1158 1158 -, g dbSNP:775659622
1162 1162 c, g, t dbSNP:367671150
1168 1168 c, t dbSNP:201303429
1189 1189 c, t dbSNP:754249229
1192 1192 a, c dbSNP:141800325
1197 1197 a, g dbSNP:369698939
1199 1199 a, g dbSNP:765478360
1203 1203 c, t dbSNP:750954346
1204 1204 a, g dbSNP:373622439
1234 1234 a, t dbSNP:780918729
1235 1235 c, t dbSNP:202120724
1237 1237 -, c dbSNP:749705881
1237 1237 c, g dbSNP:146293016
1239 1239 g, t dbSNP:777592522
1242 1242 a, c dbSNP:200326253
1243 1243 c, t dbSNP:375012546
1246 1246 a, g dbSNP:553861073
1251 1251 a, g dbSNP:563726915
1253 1253 -, tg dbSNP:768997865
1255 1255 -, tg dbSNP:180177321
1258 1258 a, g dbSNP:748156467
1262 1262 c, t dbSNP:1135283
1271 1271 a, g dbSNP:139554205
1272 1272 c, t dbSNP:777890250
1280 1280 a, g dbSNP:200632069
1281 1281 a, c dbSNP:562262441
1282 1282 c, t dbSNP:771438574
1288 1288 c, g dbSNP:774847239
1295 1295 c, t dbSNP:180177322
1296 1296 a, g dbSNP:180177323
1300 1300 c, t dbSNP:776250933
1305 1305 c, t dbSNP:761249461
1308 1308 c, g dbSNP:764762587
1311 1311 c, t dbSNP:750047290
1312 1312 c, g, t dbSNP:531886256
1317 1317 c, t dbSNP:766228863
1321 1321 -, aac dbSNP:780317388
1325 1325 a, g dbSNP:180177324
1346 1346 g, t dbSNP:142835989
1353 1353 c, t dbSNP:142356700
1354 1354 a, g dbSNP:76299266
1356 1356 c, g, t dbSNP:180177325
1357 1357 c, g dbSNP:756155443
1362 1362 c, g dbSNP:777855353
1369 1369 c, t dbSNP:749583128
1378 1378 a, g dbSNP:371501708
1379 1379 -, caaa dbSNP:749509830
1380 1380 -, aa dbSNP:768803443
1381 1381 a, c, g dbSNP:752397163
1382 1382 -, aacag dbSNP:774788936
1385 1385 -, agt dbSNP:748410064
1393 1393 g, t dbSNP:570858068
1398 1398 a, g dbSNP:772430983
1400 1400 c, t dbSNP:775891475
1401 1401 c, g, t dbSNP:374742361
1402 1402 a, g dbSNP:202111075
1414 1414 a, g dbSNP:370704714
1417 1417 -, c dbSNP:772661509
1425 1425 c, t dbSNP:765995083
1430 1430 a, c dbSNP:773945388
1496 1496 a, g dbSNP:115124458
1504 1504 c, t dbSNP:3198078
1524 1524 a, g dbSNP:1057507
1564 1564 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version XM_011518073
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19343
Accession Version NM_012203.1
Sequence Information ORF Nucleotide Sequence (Length: 987bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF134895.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF134895.1, BC003131.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)60..1022(+)
Misc Feature(2)60..998(+)
Misc Feature(3)78..947(+)
Misc Feature(4)216..929(+)
Misc Feature(5)288..929(+)
Misc Feature(6)288..293(+)
Misc Feature(7)774..920(+)
Misc Feature(8)861..863(+)
Misc Feature(9)918..929(+)
Exon (1)1..124
Gene Synonym:
Exon (2)125..255
Gene Synonym:
Exon (3)256..328
Gene Synonym:
Exon (4)329..445
Gene Synonym:
Exon (5)446..534
Gene Synonym:
Exon (6)535..639
Gene Synonym:
Exon (7)640..775
Gene Synonym:
Exon (8)776..906
Gene Synonym:
Exon (9)907..1235
Gene Synonym:
Position Chain Variation Link
5 5 a, c dbSNP:757530903
15 15 a, g dbSNP:765438095
19 19 a, c dbSNP:377087833
20 20 c, t dbSNP:750839268
21 21 g, t dbSNP:577436763
22 22 c, g dbSNP:780431255
25 25 c, t dbSNP:747479930
27 27 a, g dbSNP:370961823
29 29 a, g dbSNP:777207347
32 32 g, t dbSNP:748805098
35 35 a, g dbSNP:770749390
38 38 a, g dbSNP:201826196
39 39 c, t dbSNP:200847843
47 47 a, g dbSNP:772023163
48 48 c, t dbSNP:775288188
55 55 a, g dbSNP:760538945
57 57 c, t dbSNP:147185003
59 59 c, g dbSNP:111232251
65 65 a, g dbSNP:776638978
75 75 a, g dbSNP:761847384
77 77 c, t dbSNP:765256070
79 79 a, g dbSNP:750677922
85 85 c, t dbSNP:758553267
86 86 -, a dbSNP:180177311
92 92 c, t dbSNP:138843824
102 102 a, g dbSNP:751940452
115 115 a, g dbSNP:755504903
119 119 a, g dbSNP:781702870
126 126 c, t dbSNP:749935481
127 127 g, t dbSNP:758049256
133 133 g, t dbSNP:555739115
134 134 a, g dbSNP:141330907
142 142 -, g dbSNP:746720647
143 143 a, g dbSNP:180177304
144 144 -, g dbSNP:80356708
148 148 c, t dbSNP:768530117
149 149 a, g dbSNP:377072887
155 155 a, g dbSNP:572388564
156 156 a, c dbSNP:748100952
160 160 c, t dbSNP:769706192
162 162 c, t dbSNP:773348414
163 163 c, t dbSNP:763059780
167 167 c, t dbSNP:771110153
177 177 c, g dbSNP:202022170
180 180 c, t dbSNP:774654020
184 184 a, c, g dbSNP:759635458
189 189 a, g dbSNP:753053100
190 190 -, g dbSNP:751101495
190 190 c, t dbSNP:150805048
191 191 a, g dbSNP:369721488
195 195 a, g, t dbSNP:749990630
196 196 c, g, t dbSNP:779393751
197 197 c, g dbSNP:754532633
200 200 a, c, t dbSNP:781026957
201 201 a, g dbSNP:756085471
203 203 c, g dbSNP:777666462
207 207 c, t dbSNP:749132898
219 219 g, t dbSNP:771071997
221 221 c, t dbSNP:139689525
222 222 a, g dbSNP:371660673
228 228 a, g dbSNP:772410247
230 230 a, g dbSNP:776059959
233 233 c, t dbSNP:543901638
242 242 a, c dbSNP:149782105
244 244 c, t dbSNP:180177305
275 275 c, t dbSNP:143337459
289 289 -, tg dbSNP:672601351
293 293 a, c dbSNP:139595138
296 296 c, t dbSNP:372985143
297 297 a, g dbSNP:745927190
299 299 a, c dbSNP:772459393
299 299 -, c dbSNP:540425024
305 305 c, g dbSNP:775829035
314 314 a, t dbSNP:747177860
326 326 -, gcg dbSNP:750079140
327 327 c, t dbSNP:78920863
329 329 c, t dbSNP:201553816
331 331 a, g dbSNP:771573531
333 333 a, t dbSNP:374332294
335 335 c, g dbSNP:774921138
336 336 c, t dbSNP:119490108
337 337 a, g dbSNP:146603229
340 340 c, t dbSNP:763645212
344 344 c, t dbSNP:11546644
346 346 a, g dbSNP:35975284
348 348 a, g dbSNP:377116902
349 349 c, t dbSNP:761490627
352 352 c, t dbSNP:765032330
355 355 a, g dbSNP:750415781
360 360 c, t dbSNP:758355273
364 364 c, t dbSNP:370530139
374 374 c, t dbSNP:751686181
377 377 c, t dbSNP:148778319
378 378 a, g dbSNP:180177307
383 383 c, t dbSNP:374108537
384 384 a, g dbSNP:113602485
386 386 a, t dbSNP:147053190
389 389 -, c dbSNP:755926095
391 391 -, ccctgctacttaccacctgccgc dbSNP:779996558
392 392 c, t dbSNP:778134721
393 393 c, t dbSNP:182258378
398 398 a, g dbSNP:186922220
399 399 c, t dbSNP:11546642
401 401 -, a dbSNP:749029919
406 406 c, t dbSNP:200249904
411 411 c, t dbSNP:372712521
412 412 a, g, t dbSNP:768403579
414 414 c, t dbSNP:761485918
415 415 a, g dbSNP:199560759
416 416 -, g dbSNP:180177308
417 417 g, t dbSNP:750231875
421 421 c, t dbSNP:763052360
422 422 a, g dbSNP:151336686
425 425 a, g dbSNP:372351685
426 426 g, t dbSNP:755040146
428 428 a, c dbSNP:529454212
431 431 c, g, t dbSNP:752869610
432 432 a, g dbSNP:369339903
438 438 g, t dbSNP:749644821
453 453 c, t dbSNP:746364242
460 460 c, t dbSNP:566239341
461 461 a, g dbSNP:758880537
471 471 c, g dbSNP:780635481
481 481 a, g dbSNP:201661750
488 488 c, t dbSNP:560441686
494 494 -, a dbSNP:771019056
496 496 c, g, t dbSNP:747664983
497 497 a, g dbSNP:140612021
499 499 a, g dbSNP:748913563
509 509 c, t dbSNP:142509393
510 510 c, g dbSNP:774233908
516 516 a, g dbSNP:759447197
518 518 c, t dbSNP:767483014
519 519 a, g dbSNP:180177312
528 528 c, t dbSNP:760782027
529 529 a, g dbSNP:764111479
530 530 c, g dbSNP:754089807
535 535 a, g dbSNP:180177314
541 541 -, c dbSNP:767052015
543 543 a, g dbSNP:767940909
550 550 a, g dbSNP:12002324
552 552 c, t dbSNP:370733771
553 553 a, g dbSNP:200106110
566 566 c, t dbSNP:749885934
567 567 a, g, t dbSNP:377374419
574 574 -, ag dbSNP:749832848
579 579 -, t dbSNP:755802187
581 581 -, t dbSNP:180177315
584 584 c, g dbSNP:370395134
587 587 c, t dbSNP:754799506
593 593 g, t dbSNP:780899894
594 594 c, t dbSNP:748100930
604 604 c, g dbSNP:755995624
608 608 c, t dbSNP:777978915
611 611 a, g dbSNP:749299411
619 619 c, t dbSNP:771231175
620 620 a, g dbSNP:309458
649 649 -, ct dbSNP:180177316
649 649 c, t dbSNP:751218068
650 650 a, t dbSNP:759131163
654 654 a, c dbSNP:767361628
665 665 a, g dbSNP:528909225
667 667 c, t dbSNP:375014308
675 675 a, g dbSNP:777552498
677 677 c, t dbSNP:548848730
678 678 a, g dbSNP:145899443
680 680 c, t dbSNP:568786902
697 697 c, t dbSNP:368512158
703 703 c, g, t dbSNP:772410150
704 704 a, g dbSNP:138575944
706 706 c, t dbSNP:747304081
707 707 c, g, t dbSNP:146227450
708 708 a, g dbSNP:762313648
718 718 c, g dbSNP:780674890
722 722 c, g dbSNP:770441615
723 723 a, g dbSNP:74692381
727 727 a, t dbSNP:202212690
728 728 -, ctt dbSNP:754788389
728 728 c, t dbSNP:759255604
731 731 a, c dbSNP:185747820
742 742 c, t dbSNP:143596402
752 752 a, c dbSNP:760405997
754 754 c, t dbSNP:763906407
771 771 a, g dbSNP:753719446
779 779 c, t dbSNP:750846577
781 781 a, g dbSNP:180177318
782 782 c, t dbSNP:549318773
783 783 a, g dbSNP:369950120
785 785 c, t dbSNP:373541730
786 786 a, g dbSNP:769568097
797 797 c, t dbSNP:777753552
798 798 a, g dbSNP:376446449
800 800 c, g dbSNP:770585067
803 803 a, g dbSNP:201872828
806 806 a, c, t dbSNP:759328663
807 807 c, t dbSNP:775530794
808 808 -, g dbSNP:775659622
812 812 c, g, t dbSNP:367671150
818 818 c, t dbSNP:201303429
839 839 c, t dbSNP:754249229
842 842 a, c dbSNP:141800325
847 847 a, g dbSNP:369698939
849 849 a, g dbSNP:765478360
853 853 c, t dbSNP:750954346
854 854 a, g dbSNP:373622439
884 884 a, t dbSNP:780918729
885 885 c, t dbSNP:202120724
887 887 -, c dbSNP:749705881
887 887 c, g dbSNP:146293016
889 889 g, t dbSNP:777592522
892 892 a, c dbSNP:200326253
893 893 c, t dbSNP:375012546
896 896 a, g dbSNP:553861073
901 901 a, g dbSNP:563726915
903 903 -, tg dbSNP:768997865
905 905 -, tg dbSNP:180177321
908 908 a, g dbSNP:748156467
912 912 c, t dbSNP:1135283
921 921 a, g dbSNP:139554205
922 922 c, t dbSNP:777890250
930 930 a, g dbSNP:200632069
931 931 a, c dbSNP:562262441
932 932 c, t dbSNP:771438574
938 938 c, g dbSNP:774847239
945 945 c, t dbSNP:180177322
946 946 a, g dbSNP:180177323
950 950 c, t dbSNP:776250933
955 955 c, t dbSNP:761249461
958 958 c, g dbSNP:764762587
961 961 c, t dbSNP:750047290
962 962 c, g, t dbSNP:531886256
967 967 c, t dbSNP:766228863
971 971 -, aac dbSNP:780317388
975 975 a, g dbSNP:180177324
996 996 g, t dbSNP:142835989
1003 1003 c, t dbSNP:142356700
1004 1004 a, g dbSNP:76299266
1006 1006 c, g, t dbSNP:180177325
1007 1007 c, g dbSNP:756155443
1012 1012 c, g dbSNP:777855353
1019 1019 c, t dbSNP:749583128
1028 1028 a, g dbSNP:371501708
1029 1029 -, caaa dbSNP:749509830
1030 1030 -, aa dbSNP:768803443
1031 1031 a, c, g dbSNP:752397163
1032 1032 -, aacag dbSNP:774788936
1035 1035 -, agt dbSNP:748410064
1043 1043 g, t dbSNP:570858068
1048 1048 a, g dbSNP:772430983
1050 1050 c, t dbSNP:775891475
1051 1051 c, g, t dbSNP:374742361
1052 1052 a, g dbSNP:202111075
1064 1064 a, g dbSNP:370704714
1067 1067 -, c dbSNP:772661509
1075 1075 c, t dbSNP:765995083
1080 1080 a, c dbSNP:773945388
1146 1146 a, g dbSNP:115124458
1154 1154 c, t dbSNP:3198078
1174 1174 a, g dbSNP:1057507
1214 1214 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version NM_012203
Organism Homo sapiens (human)
Definition Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.