Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

GRHPR glyoxylate reductase/hydroxypyruvate reductase [Homo sapiens (human)]

Gene Symbol GRHPR
Entrez Gene ID 9380
Full Name glyoxylate reductase/hydroxypyruvate reductase
Synonyms GLXR, GLYD, PH2
General protein information
Preferred Names
glyoxylate reductase/hydroxypyruvate reductase
glyoxylate reductase/hydroxypyruvate reductase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Hyperoxaluria, primary, type II, 260000 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu42881 XM_005251631 PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu62784 XM_011518073 PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu19343 NM_012203 Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu42881D
Sequence Information ORF Nucleotide Sequence (Length: 666bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008413.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)86..715(+)
Misc Feature(2)86..691(+)
Misc Feature(3)212..463(+)
Position Chain Variation Link
6 6 c, t dbSNP:534440132
8 8 a, c, g dbSNP:149749351
9 9 c, g, t dbSNP:764081167
19 19 a, c dbSNP:757530903
29 29 a, g dbSNP:765438095
33 33 a, c dbSNP:377087833
34 34 c, t dbSNP:750839268
35 35 g, t dbSNP:577436763
36 36 c, g dbSNP:780431255
39 39 c, t dbSNP:747479930
41 41 a, g dbSNP:370961823
43 43 a, g dbSNP:777207347
46 46 g, t dbSNP:748805098
49 49 a, g dbSNP:770749390
52 52 a, g dbSNP:201826196
53 53 c, t dbSNP:200847843
61 61 a, g dbSNP:772023163
62 62 c, t dbSNP:775288188
69 69 a, g dbSNP:760538945
71 71 c, t dbSNP:147185003
73 73 c, g dbSNP:111232251
79 79 a, g dbSNP:776638978
89 89 a, g dbSNP:761847384
91 91 c, t dbSNP:765256070
93 93 a, g dbSNP:750677922
99 99 c, t dbSNP:758553267
100 100 -, a dbSNP:180177311
106 106 c, t dbSNP:138843824
116 116 a, g dbSNP:751940452
129 129 a, g dbSNP:755504903
133 133 a, g dbSNP:781702870
146 146 c, t dbSNP:746364242
153 153 c, t dbSNP:566239341
154 154 a, g dbSNP:758880537
164 164 c, g dbSNP:780635481
174 174 a, g dbSNP:201661750
181 181 c, t dbSNP:560441686
187 187 -, a dbSNP:771019056
189 189 c, g, t dbSNP:747664983
190 190 a, g dbSNP:140612021
192 192 a, g dbSNP:748913563
202 202 c, t dbSNP:142509393
203 203 c, g dbSNP:774233908
209 209 a, g dbSNP:759447197
211 211 c, t dbSNP:767483014
212 212 a, g dbSNP:180177312
221 221 c, t dbSNP:760782027
222 222 a, g dbSNP:764111479
223 223 c, g dbSNP:754089807
228 228 a, g dbSNP:180177314
234 234 -, c dbSNP:767052015
236 236 a, g dbSNP:767940909
243 243 a, g dbSNP:12002324
245 245 c, t dbSNP:370733771
246 246 a, g dbSNP:200106110
259 259 c, t dbSNP:749885934
260 260 a, g, t dbSNP:377374419
267 267 -, ag dbSNP:749832848
272 272 -, t dbSNP:755802187
274 274 -, t dbSNP:180177315
277 277 c, g dbSNP:370395134
280 280 c, t dbSNP:754799506
286 286 g, t dbSNP:780899894
287 287 c, t dbSNP:748100930
297 297 c, g dbSNP:755995624
301 301 c, t dbSNP:777978915
304 304 a, g dbSNP:749299411
312 312 c, t dbSNP:771231175
313 313 a, g dbSNP:309458
342 342 -, ct dbSNP:180177316
342 342 c, t dbSNP:751218068
343 343 a, t dbSNP:759131163
347 347 a, c dbSNP:767361628
358 358 a, g dbSNP:528909225
360 360 c, t dbSNP:375014308
368 368 a, g dbSNP:777552498
370 370 c, t dbSNP:548848730
371 371 a, g dbSNP:145899443
373 373 c, t dbSNP:568786902
390 390 c, t dbSNP:368512158
396 396 c, g, t dbSNP:772410150
397 397 a, g dbSNP:138575944
399 399 c, t dbSNP:747304081
400 400 c, g, t dbSNP:146227450
401 401 a, g dbSNP:762313648
411 411 c, g dbSNP:780674890
415 415 c, g dbSNP:770441615
416 416 a, g dbSNP:74692381
420 420 a, t dbSNP:202212690
421 421 -, ctt dbSNP:754788389
421 421 c, t dbSNP:759255604
424 424 a, c dbSNP:185747820
435 435 c, t dbSNP:143596402
445 445 a, c dbSNP:760405997
447 447 c, t dbSNP:763906407
464 464 a, g dbSNP:753719446
472 472 c, t dbSNP:750846577
474 474 a, g dbSNP:180177318
475 475 c, t dbSNP:549318773
476 476 a, g dbSNP:369950120
478 478 c, t dbSNP:373541730
479 479 a, g dbSNP:769568097
490 490 c, t dbSNP:777753552
491 491 a, g dbSNP:376446449
493 493 c, g dbSNP:770585067
496 496 a, g dbSNP:201872828
499 499 a, c, t dbSNP:759328663
500 500 c, t dbSNP:775530794
501 501 -, g dbSNP:775659622
505 505 c, g, t dbSNP:367671150
511 511 c, t dbSNP:201303429
532 532 c, t dbSNP:754249229
535 535 a, c dbSNP:141800325
540 540 a, g dbSNP:369698939
542 542 a, g dbSNP:765478360
546 546 c, t dbSNP:750954346
547 547 a, g dbSNP:373622439
577 577 a, t dbSNP:780918729
578 578 c, t dbSNP:202120724
580 580 -, c dbSNP:749705881
580 580 c, g dbSNP:146293016
582 582 g, t dbSNP:777592522
585 585 a, c dbSNP:200326253
586 586 c, t dbSNP:375012546
589 589 a, g dbSNP:553861073
594 594 a, g dbSNP:563726915
596 596 -, tg dbSNP:768997865
598 598 -, tg dbSNP:180177321
601 601 a, g dbSNP:748156467
605 605 c, t dbSNP:1135283
614 614 a, g dbSNP:139554205
615 615 c, t dbSNP:777890250
623 623 a, g dbSNP:200632069
624 624 a, c dbSNP:562262441
625 625 c, t dbSNP:771438574
631 631 c, g dbSNP:774847239
638 638 c, t dbSNP:180177322
639 639 a, g dbSNP:180177323
643 643 c, t dbSNP:776250933
648 648 c, t dbSNP:761249461
651 651 c, g dbSNP:764762587
654 654 c, t dbSNP:750047290
655 655 c, g, t dbSNP:531886256
660 660 c, t dbSNP:766228863
664 664 -, aac dbSNP:780317388
668 668 a, g dbSNP:180177324
689 689 g, t dbSNP:142835989
696 696 c, t dbSNP:142356700
697 697 a, g dbSNP:76299266
699 699 c, g, t dbSNP:180177325
700 700 c, g dbSNP:756155443
705 705 c, g dbSNP:777855353
712 712 c, t dbSNP:749583128
721 721 a, g dbSNP:371501708
722 722 -, caaa dbSNP:749509830
723 723 -, aa dbSNP:768803443
724 724 a, c, g dbSNP:752397163
725 725 -, aacag dbSNP:774788936
728 728 -, agt dbSNP:748410064
736 736 g, t dbSNP:570858068
741 741 a, g dbSNP:772430983
743 743 c, t dbSNP:775891475
744 744 c, g, t dbSNP:374742361
745 745 a, g dbSNP:202111075
757 757 a, g dbSNP:370704714
760 760 -, c dbSNP:772661509
768 768 c, t dbSNP:765995083
773 773 a, c dbSNP:773945388
839 839 a, g dbSNP:115124458
847 847 c, t dbSNP:3198078
867 867 a, g dbSNP:1057507
907 907 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version XM_005251631
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu62784D
Sequence Information ORF Nucleotide Sequence (Length: 585bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008413.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)884..1372(+)
Misc Feature(2)884..1348(+)
Misc Feature(3)938..1120(+)
Position Chain Variation Link
5 5 a, g dbSNP:765438095
9 9 a, c dbSNP:377087833
10 10 c, t dbSNP:750839268
11 11 g, t dbSNP:577436763
12 12 c, g dbSNP:780431255
15 15 c, t dbSNP:747479930
17 17 a, g dbSNP:370961823
19 19 a, g dbSNP:777207347
22 22 g, t dbSNP:748805098
25 25 a, g dbSNP:770749390
28 28 a, g dbSNP:201826196
29 29 c, t dbSNP:200847843
37 37 a, g dbSNP:772023163
38 38 c, t dbSNP:775288188
45 45 a, g dbSNP:760538945
47 47 c, t dbSNP:147185003
49 49 c, g dbSNP:111232251
55 55 a, g dbSNP:776638978
65 65 a, g dbSNP:761847384
67 67 c, t dbSNP:765256070
69 69 a, g dbSNP:750677922
75 75 c, t dbSNP:758553267
76 76 -, a dbSNP:180177311
82 82 c, t dbSNP:138843824
92 92 a, g dbSNP:751940452
105 105 a, g dbSNP:755504903
109 109 a, g dbSNP:781702870
116 116 c, t dbSNP:749935481
117 117 g, t dbSNP:758049256
123 123 g, t dbSNP:555739115
124 124 a, g dbSNP:141330907
132 132 -, g dbSNP:746720647
133 133 a, g dbSNP:180177304
134 134 -, g dbSNP:80356708
138 138 c, t dbSNP:768530117
139 139 a, g dbSNP:377072887
145 145 a, g dbSNP:572388564
146 146 a, c dbSNP:748100952
150 150 c, t dbSNP:769706192
152 152 c, t dbSNP:773348414
153 153 c, t dbSNP:763059780
157 157 c, t dbSNP:771110153
167 167 c, g dbSNP:202022170
170 170 c, t dbSNP:774654020
174 174 a, c, g dbSNP:759635458
179 179 a, g dbSNP:753053100
180 180 -, g dbSNP:751101495
180 180 c, t dbSNP:150805048
181 181 a, g dbSNP:369721488
185 185 a, g, t dbSNP:749990630
186 186 c, g, t dbSNP:779393751
187 187 c, g dbSNP:754532633
190 190 a, c, t dbSNP:781026957
191 191 a, g dbSNP:756085471
193 193 c, g dbSNP:777666462
197 197 c, t dbSNP:749132898
209 209 g, t dbSNP:771071997
211 211 c, t dbSNP:139689525
212 212 a, g dbSNP:371660673
218 218 a, g dbSNP:772410247
220 220 a, g dbSNP:776059959
223 223 c, t dbSNP:543901638
232 232 a, c dbSNP:149782105
234 234 c, t dbSNP:180177305
265 265 c, t dbSNP:143337459
279 279 -, tg dbSNP:672601351
283 283 a, c dbSNP:139595138
286 286 c, t dbSNP:372985143
287 287 a, g dbSNP:745927190
289 289 a, c dbSNP:772459393
289 289 -, c dbSNP:540425024
295 295 c, g dbSNP:775829035
304 304 a, t dbSNP:747177860
316 316 -, gcg dbSNP:750079140
317 317 c, t dbSNP:78920863
319 319 c, t dbSNP:201553816
321 321 a, g dbSNP:771573531
323 323 a, t dbSNP:374332294
325 325 c, g dbSNP:774921138
326 326 c, t dbSNP:119490108
327 327 a, g dbSNP:146603229
330 330 c, t dbSNP:763645212
334 334 c, t dbSNP:11546644
336 336 a, g dbSNP:35975284
338 338 a, g dbSNP:377116902
339 339 c, t dbSNP:761490627
342 342 c, t dbSNP:765032330
345 345 a, g dbSNP:750415781
350 350 c, t dbSNP:758355273
354 354 c, t dbSNP:370530139
364 364 c, t dbSNP:751686181
367 367 c, t dbSNP:148778319
368 368 a, g dbSNP:180177307
373 373 c, t dbSNP:374108537
374 374 a, g dbSNP:113602485
376 376 a, t dbSNP:147053190
379 379 -, c dbSNP:755926095
381 381 -, ccctgctacttaccacctgccgc dbSNP:779996558
382 382 c, t dbSNP:778134721
383 383 c, t dbSNP:182258378
388 388 a, g dbSNP:186922220
389 389 c, t dbSNP:11546642
391 391 -, a dbSNP:749029919
396 396 c, t dbSNP:200249904
401 401 c, t dbSNP:372712521
402 402 a, g, t dbSNP:768403579
404 404 c, t dbSNP:761485918
405 405 a, g dbSNP:199560759
406 406 -, g dbSNP:180177308
407 407 g, t dbSNP:750231875
411 411 c, t dbSNP:763052360
412 412 a, g dbSNP:151336686
415 415 a, g dbSNP:372351685
416 416 g, t dbSNP:755040146
418 418 a, c dbSNP:529454212
421 421 c, g, t dbSNP:752869610
422 422 a, g dbSNP:369339903
428 428 g, t dbSNP:749644821
443 443 c, t dbSNP:746364242
450 450 c, t dbSNP:566239341
451 451 a, g dbSNP:758880537
461 461 c, g dbSNP:780635481
471 471 a, g dbSNP:201661750
478 478 c, t dbSNP:560441686
484 484 -, a dbSNP:771019056
486 486 c, g, t dbSNP:747664983
487 487 a, g dbSNP:140612021
489 489 a, g dbSNP:748913563
499 499 c, t dbSNP:142509393
500 500 c, g dbSNP:774233908
506 506 a, g dbSNP:759447197
508 508 c, t dbSNP:767483014
509 509 a, g dbSNP:180177312
518 518 c, t dbSNP:760782027
519 519 a, g dbSNP:764111479
520 520 c, g dbSNP:754089807
526 526 a, t dbSNP:180177313
533 533 c, t dbSNP:41303225
537 537 c, t dbSNP:765596317
538 538 c, t dbSNP:141090601
543 543 a, c, t dbSNP:746648380
544 544 a, g dbSNP:780588937
551 551 c, t dbSNP:146896070
552 552 a, g dbSNP:374838995
553 553 c, t dbSNP:369699672
556 556 c, t dbSNP:373472631
557 557 a, g dbSNP:147934112
558 558 a, g dbSNP:770696432
562 562 c, g, t dbSNP:376674882
565 565 a, c dbSNP:377116116
568 568 c, t dbSNP:371264136
569 569 a, g dbSNP:373213853
573 573 c, t dbSNP:760489628
578 578 -, a dbSNP:776773819
578 578 a, c dbSNP:768726104
580 580 -, cc dbSNP:759810267
584 584 -, gg dbSNP:769852092
584 584 g, t dbSNP:776632391
588 588 -, c dbSNP:775855961
603 603 c, t dbSNP:762078399
622 622 c, g dbSNP:765415889
626 626 g, t dbSNP:566785032
636 636 c, t dbSNP:750803720
648 648 a, g dbSNP:763398450
664 664 a, g dbSNP:556203401
669 669 a, g dbSNP:766613829
670 670 c, t dbSNP:752115702
682 682 -, a dbSNP:763263606
728 728 c, g dbSNP:755488609
751 751 c, t dbSNP:309462
759 759 -, a dbSNP:376781208
819 819 c, g, t dbSNP:780811992
856 856 a, g dbSNP:141708617
863 863 a, g dbSNP:370451439
874 874 c, t dbSNP:538445999
885 885 a, g dbSNP:180177314
891 891 -, c dbSNP:767052015
893 893 a, g dbSNP:767940909
900 900 a, g dbSNP:12002324
902 902 c, t dbSNP:370733771
903 903 a, g dbSNP:200106110
916 916 c, t dbSNP:749885934
917 917 a, g, t dbSNP:377374419
924 924 -, ag dbSNP:749832848
929 929 -, t dbSNP:755802187
931 931 -, t dbSNP:180177315
934 934 c, g dbSNP:370395134
937 937 c, t dbSNP:754799506
943 943 g, t dbSNP:780899894
944 944 c, t dbSNP:748100930
954 954 c, g dbSNP:755995624
958 958 c, t dbSNP:777978915
961 961 a, g dbSNP:749299411
969 969 c, t dbSNP:771231175
970 970 a, g dbSNP:309458
999 999 -, ct dbSNP:180177316
999 999 c, t dbSNP:751218068
1000 1000 a, t dbSNP:759131163
1004 1004 a, c dbSNP:767361628
1015 1015 a, g dbSNP:528909225
1017 1017 c, t dbSNP:375014308
1025 1025 a, g dbSNP:777552498
1027 1027 c, t dbSNP:548848730
1028 1028 a, g dbSNP:145899443
1030 1030 c, t dbSNP:568786902
1047 1047 c, t dbSNP:368512158
1053 1053 c, g, t dbSNP:772410150
1054 1054 a, g dbSNP:138575944
1056 1056 c, t dbSNP:747304081
1057 1057 c, g, t dbSNP:146227450
1058 1058 a, g dbSNP:762313648
1068 1068 c, g dbSNP:780674890
1072 1072 c, g dbSNP:770441615
1073 1073 a, g dbSNP:74692381
1077 1077 a, t dbSNP:202212690
1078 1078 -, ctt dbSNP:754788389
1078 1078 c, t dbSNP:759255604
1081 1081 a, c dbSNP:185747820
1092 1092 c, t dbSNP:143596402
1102 1102 a, c dbSNP:760405997
1104 1104 c, t dbSNP:763906407
1121 1121 a, g dbSNP:753719446
1129 1129 c, t dbSNP:750846577
1131 1131 a, g dbSNP:180177318
1132 1132 c, t dbSNP:549318773
1133 1133 a, g dbSNP:369950120
1135 1135 c, t dbSNP:373541730
1136 1136 a, g dbSNP:769568097
1147 1147 c, t dbSNP:777753552
1148 1148 a, g dbSNP:376446449
1150 1150 c, g dbSNP:770585067
1153 1153 a, g dbSNP:201872828
1156 1156 a, c, t dbSNP:759328663
1157 1157 c, t dbSNP:775530794
1158 1158 -, g dbSNP:775659622
1162 1162 c, g, t dbSNP:367671150
1168 1168 c, t dbSNP:201303429
1189 1189 c, t dbSNP:754249229
1192 1192 a, c dbSNP:141800325
1197 1197 a, g dbSNP:369698939
1199 1199 a, g dbSNP:765478360
1203 1203 c, t dbSNP:750954346
1204 1204 a, g dbSNP:373622439
1234 1234 a, t dbSNP:780918729
1235 1235 c, t dbSNP:202120724
1237 1237 -, c dbSNP:749705881
1237 1237 c, g dbSNP:146293016
1239 1239 g, t dbSNP:777592522
1242 1242 a, c dbSNP:200326253
1243 1243 c, t dbSNP:375012546
1246 1246 a, g dbSNP:553861073
1251 1251 a, g dbSNP:563726915
1253 1253 -, tg dbSNP:768997865
1255 1255 -, tg dbSNP:180177321
1258 1258 a, g dbSNP:748156467
1262 1262 c, t dbSNP:1135283
1271 1271 a, g dbSNP:139554205
1272 1272 c, t dbSNP:777890250
1280 1280 a, g dbSNP:200632069
1281 1281 a, c dbSNP:562262441
1282 1282 c, t dbSNP:771438574
1288 1288 c, g dbSNP:774847239
1295 1295 c, t dbSNP:180177322
1296 1296 a, g dbSNP:180177323
1300 1300 c, t dbSNP:776250933
1305 1305 c, t dbSNP:761249461
1308 1308 c, g dbSNP:764762587
1311 1311 c, t dbSNP:750047290
1312 1312 c, g, t dbSNP:531886256
1317 1317 c, t dbSNP:766228863
1321 1321 -, aac dbSNP:780317388
1325 1325 a, g dbSNP:180177324
1346 1346 g, t dbSNP:142835989
1353 1353 c, t dbSNP:142356700
1354 1354 a, g dbSNP:76299266
1356 1356 c, g, t dbSNP:180177325
1357 1357 c, g dbSNP:756155443
1362 1362 c, g dbSNP:777855353
1369 1369 c, t dbSNP:749583128
1378 1378 a, g dbSNP:371501708
1379 1379 -, caaa dbSNP:749509830
1380 1380 -, aa dbSNP:768803443
1381 1381 a, c, g dbSNP:752397163
1382 1382 -, aacag dbSNP:774788936
1385 1385 -, agt dbSNP:748410064
1393 1393 g, t dbSNP:570858068
1398 1398 a, g dbSNP:772430983
1400 1400 c, t dbSNP:775891475
1401 1401 c, g, t dbSNP:374742361
1402 1402 a, g dbSNP:202111075
1414 1414 a, g dbSNP:370704714
1417 1417 -, c dbSNP:772661509
1425 1425 c, t dbSNP:765995083
1430 1430 a, c dbSNP:773945388
1496 1496 a, g dbSNP:115124458
1504 1504 c, t dbSNP:3198078
1524 1524 a, g dbSNP:1057507
1564 1564 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version XM_011518073
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu19343D
Sequence Information ORF Nucleotide Sequence (Length: 987bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glyoxylate reductase/hydroxypyruvate reductase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF134895.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF134895.1, BC003131.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)60..1022(+)
Misc Feature(2)60..998(+)
Misc Feature(3)78..947(+)
Misc Feature(4)216..929(+)
Misc Feature(5)288..929(+)
Misc Feature(6)288..293(+)
Misc Feature(7)774..920(+)
Misc Feature(8)861..863(+)
Misc Feature(9)918..929(+)
Exon (1)1..124
Gene Synonym:
Exon (2)125..255
Gene Synonym:
Exon (3)256..328
Gene Synonym:
Exon (4)329..445
Gene Synonym:
Exon (5)446..534
Gene Synonym:
Exon (6)535..639
Gene Synonym:
Exon (7)640..775
Gene Synonym:
Exon (8)776..906
Gene Synonym:
Exon (9)907..1235
Gene Synonym:
Position Chain Variation Link
5 5 a, c dbSNP:757530903
15 15 a, g dbSNP:765438095
19 19 a, c dbSNP:377087833
20 20 c, t dbSNP:750839268
21 21 g, t dbSNP:577436763
22 22 c, g dbSNP:780431255
25 25 c, t dbSNP:747479930
27 27 a, g dbSNP:370961823
29 29 a, g dbSNP:777207347
32 32 g, t dbSNP:748805098
35 35 a, g dbSNP:770749390
38 38 a, g dbSNP:201826196
39 39 c, t dbSNP:200847843
47 47 a, g dbSNP:772023163
48 48 c, t dbSNP:775288188
55 55 a, g dbSNP:760538945
57 57 c, t dbSNP:147185003
59 59 c, g dbSNP:111232251
65 65 a, g dbSNP:776638978
75 75 a, g dbSNP:761847384
77 77 c, t dbSNP:765256070
79 79 a, g dbSNP:750677922
85 85 c, t dbSNP:758553267
86 86 -, a dbSNP:180177311
92 92 c, t dbSNP:138843824
102 102 a, g dbSNP:751940452
115 115 a, g dbSNP:755504903
119 119 a, g dbSNP:781702870
126 126 c, t dbSNP:749935481
127 127 g, t dbSNP:758049256
133 133 g, t dbSNP:555739115
134 134 a, g dbSNP:141330907
142 142 -, g dbSNP:746720647
143 143 a, g dbSNP:180177304
144 144 -, g dbSNP:80356708
148 148 c, t dbSNP:768530117
149 149 a, g dbSNP:377072887
155 155 a, g dbSNP:572388564
156 156 a, c dbSNP:748100952
160 160 c, t dbSNP:769706192
162 162 c, t dbSNP:773348414
163 163 c, t dbSNP:763059780
167 167 c, t dbSNP:771110153
177 177 c, g dbSNP:202022170
180 180 c, t dbSNP:774654020
184 184 a, c, g dbSNP:759635458
189 189 a, g dbSNP:753053100
190 190 -, g dbSNP:751101495
190 190 c, t dbSNP:150805048
191 191 a, g dbSNP:369721488
195 195 a, g, t dbSNP:749990630
196 196 c, g, t dbSNP:779393751
197 197 c, g dbSNP:754532633
200 200 a, c, t dbSNP:781026957
201 201 a, g dbSNP:756085471
203 203 c, g dbSNP:777666462
207 207 c, t dbSNP:749132898
219 219 g, t dbSNP:771071997
221 221 c, t dbSNP:139689525
222 222 a, g dbSNP:371660673
228 228 a, g dbSNP:772410247
230 230 a, g dbSNP:776059959
233 233 c, t dbSNP:543901638
242 242 a, c dbSNP:149782105
244 244 c, t dbSNP:180177305
275 275 c, t dbSNP:143337459
289 289 -, tg dbSNP:672601351
293 293 a, c dbSNP:139595138
296 296 c, t dbSNP:372985143
297 297 a, g dbSNP:745927190
299 299 a, c dbSNP:772459393
299 299 -, c dbSNP:540425024
305 305 c, g dbSNP:775829035
314 314 a, t dbSNP:747177860
326 326 -, gcg dbSNP:750079140
327 327 c, t dbSNP:78920863
329 329 c, t dbSNP:201553816
331 331 a, g dbSNP:771573531
333 333 a, t dbSNP:374332294
335 335 c, g dbSNP:774921138
336 336 c, t dbSNP:119490108
337 337 a, g dbSNP:146603229
340 340 c, t dbSNP:763645212
344 344 c, t dbSNP:11546644
346 346 a, g dbSNP:35975284
348 348 a, g dbSNP:377116902
349 349 c, t dbSNP:761490627
352 352 c, t dbSNP:765032330
355 355 a, g dbSNP:750415781
360 360 c, t dbSNP:758355273
364 364 c, t dbSNP:370530139
374 374 c, t dbSNP:751686181
377 377 c, t dbSNP:148778319
378 378 a, g dbSNP:180177307
383 383 c, t dbSNP:374108537
384 384 a, g dbSNP:113602485
386 386 a, t dbSNP:147053190
389 389 -, c dbSNP:755926095
391 391 -, ccctgctacttaccacctgccgc dbSNP:779996558
392 392 c, t dbSNP:778134721
393 393 c, t dbSNP:182258378
398 398 a, g dbSNP:186922220
399 399 c, t dbSNP:11546642
401 401 -, a dbSNP:749029919
406 406 c, t dbSNP:200249904
411 411 c, t dbSNP:372712521
412 412 a, g, t dbSNP:768403579
414 414 c, t dbSNP:761485918
415 415 a, g dbSNP:199560759
416 416 -, g dbSNP:180177308
417 417 g, t dbSNP:750231875
421 421 c, t dbSNP:763052360
422 422 a, g dbSNP:151336686
425 425 a, g dbSNP:372351685
426 426 g, t dbSNP:755040146
428 428 a, c dbSNP:529454212
431 431 c, g, t dbSNP:752869610
432 432 a, g dbSNP:369339903
438 438 g, t dbSNP:749644821
453 453 c, t dbSNP:746364242
460 460 c, t dbSNP:566239341
461 461 a, g dbSNP:758880537
471 471 c, g dbSNP:780635481
481 481 a, g dbSNP:201661750
488 488 c, t dbSNP:560441686
494 494 -, a dbSNP:771019056
496 496 c, g, t dbSNP:747664983
497 497 a, g dbSNP:140612021
499 499 a, g dbSNP:748913563
509 509 c, t dbSNP:142509393
510 510 c, g dbSNP:774233908
516 516 a, g dbSNP:759447197
518 518 c, t dbSNP:767483014
519 519 a, g dbSNP:180177312
528 528 c, t dbSNP:760782027
529 529 a, g dbSNP:764111479
530 530 c, g dbSNP:754089807
535 535 a, g dbSNP:180177314
541 541 -, c dbSNP:767052015
543 543 a, g dbSNP:767940909
550 550 a, g dbSNP:12002324
552 552 c, t dbSNP:370733771
553 553 a, g dbSNP:200106110
566 566 c, t dbSNP:749885934
567 567 a, g, t dbSNP:377374419
574 574 -, ag dbSNP:749832848
579 579 -, t dbSNP:755802187
581 581 -, t dbSNP:180177315
584 584 c, g dbSNP:370395134
587 587 c, t dbSNP:754799506
593 593 g, t dbSNP:780899894
594 594 c, t dbSNP:748100930
604 604 c, g dbSNP:755995624
608 608 c, t dbSNP:777978915
611 611 a, g dbSNP:749299411
619 619 c, t dbSNP:771231175
620 620 a, g dbSNP:309458
649 649 -, ct dbSNP:180177316
649 649 c, t dbSNP:751218068
650 650 a, t dbSNP:759131163
654 654 a, c dbSNP:767361628
665 665 a, g dbSNP:528909225
667 667 c, t dbSNP:375014308
675 675 a, g dbSNP:777552498
677 677 c, t dbSNP:548848730
678 678 a, g dbSNP:145899443
680 680 c, t dbSNP:568786902
697 697 c, t dbSNP:368512158
703 703 c, g, t dbSNP:772410150
704 704 a, g dbSNP:138575944
706 706 c, t dbSNP:747304081
707 707 c, g, t dbSNP:146227450
708 708 a, g dbSNP:762313648
718 718 c, g dbSNP:780674890
722 722 c, g dbSNP:770441615
723 723 a, g dbSNP:74692381
727 727 a, t dbSNP:202212690
728 728 -, ctt dbSNP:754788389
728 728 c, t dbSNP:759255604
731 731 a, c dbSNP:185747820
742 742 c, t dbSNP:143596402
752 752 a, c dbSNP:760405997
754 754 c, t dbSNP:763906407
771 771 a, g dbSNP:753719446
779 779 c, t dbSNP:750846577
781 781 a, g dbSNP:180177318
782 782 c, t dbSNP:549318773
783 783 a, g dbSNP:369950120
785 785 c, t dbSNP:373541730
786 786 a, g dbSNP:769568097
797 797 c, t dbSNP:777753552
798 798 a, g dbSNP:376446449
800 800 c, g dbSNP:770585067
803 803 a, g dbSNP:201872828
806 806 a, c, t dbSNP:759328663
807 807 c, t dbSNP:775530794
808 808 -, g dbSNP:775659622
812 812 c, g, t dbSNP:367671150
818 818 c, t dbSNP:201303429
839 839 c, t dbSNP:754249229
842 842 a, c dbSNP:141800325
847 847 a, g dbSNP:369698939
849 849 a, g dbSNP:765478360
853 853 c, t dbSNP:750954346
854 854 a, g dbSNP:373622439
884 884 a, t dbSNP:780918729
885 885 c, t dbSNP:202120724
887 887 -, c dbSNP:749705881
887 887 c, g dbSNP:146293016
889 889 g, t dbSNP:777592522
892 892 a, c dbSNP:200326253
893 893 c, t dbSNP:375012546
896 896 a, g dbSNP:553861073
901 901 a, g dbSNP:563726915
903 903 -, tg dbSNP:768997865
905 905 -, tg dbSNP:180177321
908 908 a, g dbSNP:748156467
912 912 c, t dbSNP:1135283
921 921 a, g dbSNP:139554205
922 922 c, t dbSNP:777890250
930 930 a, g dbSNP:200632069
931 931 a, c dbSNP:562262441
932 932 c, t dbSNP:771438574
938 938 c, g dbSNP:774847239
945 945 c, t dbSNP:180177322
946 946 a, g dbSNP:180177323
950 950 c, t dbSNP:776250933
955 955 c, t dbSNP:761249461
958 958 c, g dbSNP:764762587
961 961 c, t dbSNP:750047290
962 962 c, g, t dbSNP:531886256
967 967 c, t dbSNP:766228863
971 971 -, aac dbSNP:780317388
975 975 a, g dbSNP:180177324
996 996 g, t dbSNP:142835989
1003 1003 c, t dbSNP:142356700
1004 1004 a, g dbSNP:76299266
1006 1006 c, g, t dbSNP:180177325
1007 1007 c, g dbSNP:756155443
1012 1012 c, g dbSNP:777855353
1019 1019 c, t dbSNP:749583128
1028 1028 a, g dbSNP:371501708
1029 1029 -, caaa dbSNP:749509830
1030 1030 -, aa dbSNP:768803443
1031 1031 a, c, g dbSNP:752397163
1032 1032 -, aacag dbSNP:774788936
1035 1035 -, agt dbSNP:748410064
1043 1043 g, t dbSNP:570858068
1048 1048 a, g dbSNP:772430983
1050 1050 c, t dbSNP:775891475
1051 1051 c, g, t dbSNP:374742361
1052 1052 a, g dbSNP:202111075
1064 1064 a, g dbSNP:370704714
1067 1067 -, c dbSNP:772661509
1075 1075 c, t dbSNP:765995083
1080 1080 a, c dbSNP:773945388
1146 1146 a, g dbSNP:115124458
1154 1154 c, t dbSNP:3198078
1174 1174 a, g dbSNP:1057507
1214 1214 -, atta dbSNP:535077257

Target ORF information:

RefSeq Version NM_012203
Organism Homo sapiens (human)
Definition Homo sapiens glyoxylate reductase/hydroxypyruvate reductase (GRHPR), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.