
MED12 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MED12
Entrez Gene ID 9968
Full Name mediator complex subunit 12
Synonyms ARC240, CAGH45, FGS1, HOPA, MED12S, OHDOX, OKS, OPA1, TNRC11, TRAP230
General protein information
Preferred Names
mediator of RNA polymerase II transcription subunit 12
mediator of RNA polymerase II transcription subunit 12
CAG repeat protein 45
human opposite paired
OPA-containing protein
putative mediator subunit 12
activator-recruited cofactor 240 kDa component
trinucleotide repeat-containing gene 11 protein
thyroid hormone receptor-associated protein, 230 kDa subunit
mediator of RNA polymerase II transcription, subunit 12 homolog
thyroid hormone receptor-associated protein complex 230 kDa component
trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit)
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009]. lac of sum
Disorder MIM:


Disorder Html: Opitz-Kaveggia syndrome, 305450 (3); Lujan-Fryns syndrome, 309520 (3)

The following MED12 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MED12 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu54272 XM_005262317 PREDICTED: Homo sapiens mediator complex subunit 12 (MED12), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu54273 XM_005262319 PREDICTED: Homo sapiens mediator complex subunit 12 (MED12), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu19668 NM_005120 Homo sapiens mediator complex subunit 12 (MED12), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu54272
Accession Version XM_005262317.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 6543bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mediator of RNA polymerase II transcription subunit 12 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011651.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)500..682(+)
Misc Feature(2)1052..2470(+)
Misc Feature(3)5648..6268(+)
Position Chain Variation Link
15 15 c, t dbSNP:755120050
73 73 a, g dbSNP:781522411
118 118 c, g dbSNP:748336778
138 138 a, c dbSNP:769876044
153 153 a, t dbSNP:767078113
160 160 c, t dbSNP:773181240
161 161 g, t dbSNP:749937972
164 164 c, t dbSNP:755790492
168 168 a, g dbSNP:766027203
172 172 g, t dbSNP:373552360
188 188 c, g dbSNP:754723833
189 189 a, g dbSNP:778856985
197 197 a, g dbSNP:748008926
219 219 g, t dbSNP:758482018
226 226 c, t dbSNP:376743527
239 239 c, g dbSNP:747105314
245 245 a, c dbSNP:749802630
253 253 a, g dbSNP:781452716
257 257 a, g dbSNP:746256454
259 259 a, g dbSNP:770218060
270 270 -, t dbSNP:778396432
274 274 -, ccctc dbSNP:747588961
275 275 c, g dbSNP:776154055
281 281 a, g dbSNP:371385969
296 296 a, g dbSNP:769202858
302 302 -, gaactgacggccttgaatgtaaaacaaggtttcaat dbSNP:199469678
304 304 a, g dbSNP:746030482
306 306 gc, tgacg dbSNP:199469679
306 306 g, t dbSNP:199469667
308 308 a, t dbSNP:770128096
310 310 -, ggccttgaatgtaaaacaaggtttcaataaccagcctgctgtctc dbSNP:199469681
312 312 -, ccttgaatg dbSNP:199469682
316 316 -, gaatgt dbSNP:199469683
317 317 aatgtaaaacaaggtttcaataaccagcc, tt dbSNP:199469685
317 317 aatgtaaaacaaggttt, ta dbSNP:199469680
317 317 -, aatgtaaaacaaggt dbSNP:199469684
321 321 -, taaaacaaggtttcaataaccagcctgctgtctctggggatg dbSNP:199469687
321 321 -, taaaacaaggtttcaataaccagcctg dbSNP:199469686
322 322 -, aaaacaaggtttcaataaccagcctgctgt dbSNP:199469688
325 325 -, acaaggtttcaataa dbSNP:199469690
325 325 -, acaagg dbSNP:199469689
327 327 a, c dbSNP:199469668
328 328 -, aggtttcaataacca dbSNP:199469692
328 328 -, aggtttcaa dbSNP:199469691
328 328 a, g dbSNP:780634712
329 329 a, c, g, t dbSNP:199469669
330 330 a, c, g, t dbSNP:199469672
332 332 -, ttcaataaccag dbSNP:199469693
336 336 a, g dbSNP:769095144
346 346 a, t dbSNP:774875020
348 348 -, ctgtctctggggatg dbSNP:199469694
367 367 c, t dbSNP:760138274
382 382 c, t dbSNP:770411750
400 400 c, g dbSNP:374555675
429 429 a, t dbSNP:756351657
436 436 a, g dbSNP:779295599
505 505 c, t dbSNP:2471968
520 520 a, c dbSNP:748627661
523 523 a, g dbSNP:772440501
547 547 g, t dbSNP:776188083
560 560 g, t dbSNP:745348543
568 568 a, c dbSNP:769484204
579 579 c, t dbSNP:775072642
580 580 a, g dbSNP:202125318
583 583 a, g dbSNP:201566660
598 598 c, t dbSNP:754050535
622 622 a, g dbSNP:755316164
637 637 a, g dbSNP:35068602
638 638 a, g dbSNP:748453083
647 647 a, g dbSNP:758980420
663 663 a, g dbSNP:778227705
749 749 a, g dbSNP:745402126
767 767 a, g dbSNP:374780236
801 801 c, g, t dbSNP:776982089
812 812 c, t dbSNP:765342782
836 836 a, g dbSNP:200333229
845 845 g, t dbSNP:746326251
852 852 c, t dbSNP:369083173
853 853 a, g dbSNP:751995503
879 879 a, c dbSNP:755634255
907 907 c, g, t dbSNP:34668206
950 950 a, c dbSNP:753413601
996 996 a, g dbSNP:754407926
1009 1009 c, t dbSNP:778635250
1048 1048 c, t dbSNP:750832089
1061 1061 -, g dbSNP:35454896
1071 1071 a, c dbSNP:754533515
1076 1076 c, t dbSNP:764716429
1108 1108 a, g dbSNP:184426039
1133 1133 c, g dbSNP:377403264
1134 1134 c, t dbSNP:777541463
1135 1135 c, g dbSNP:746820232
1143 1143 a, t dbSNP:759516228
1157 1157 a, g, t dbSNP:781192327
1165 1165 c, t dbSNP:370616416
1180 1180 a, g dbSNP:769757456
1181 1181 c, t dbSNP:767398040
1197 1197 c, t dbSNP:775499343
1210 1210 a, c dbSNP:749348331
1214 1214 a, g dbSNP:768889545
1221 1221 c, t dbSNP:774518546
1224 1224 c, t dbSNP:762172777
1227 1227 c, t dbSNP:764107388
1230 1230 a, c dbSNP:773615925
1232 1232 c, t dbSNP:761157306
1237 1237 c, t dbSNP:766874065
1238 1238 a, g dbSNP:752300879
1245 1245 a, t dbSNP:757929935
1265 1265 a, c dbSNP:763867883
1266 1266 a, g dbSNP:751188840
1267 1267 a, g dbSNP:757086557
1275 1275 -, t dbSNP:776803467
1312 1312 a, g dbSNP:780470012
1327 1327 c, t dbSNP:750206494
1330 1330 c, g dbSNP:755897379
1331 1331 a, g dbSNP:779969587
1339 1339 c, t dbSNP:753714929
1342 1342 c, t dbSNP:754893689
1366 1366 a, g dbSNP:374324656
1368 1368 a, c dbSNP:748224921
1369 1369 c, t dbSNP:772236514
1396 1396 a, t dbSNP:754944788
1402 1402 a, g, t dbSNP:368546216
1417 1417 a, g dbSNP:771358421
1422 1422 a, g dbSNP:777293696
1423 1423 a, g dbSNP:760180422
1456 1456 a, c dbSNP:754943978
1463 1463 c, t dbSNP:368913305
1464 1464 a, g dbSNP:752746769
1468 1468 a, g dbSNP:758467351
1476 1476 a, g dbSNP:777865279
1480 1480 a, g dbSNP:747199355
1511 1511 c, t dbSNP:771266719
1512 1512 a, g dbSNP:587778439
1522 1522 c, t dbSNP:371928861
1531 1531 c, t dbSNP:746205041
1543 1543 g, t dbSNP:375202766
1552 1552 -, c dbSNP:36079314
1563 1563 a, g dbSNP:760696164
1569 1569 g, t dbSNP:758423721
1576 1576 a, t dbSNP:764293738
1585 1585 g, t dbSNP:186153976
1597 1597 c, t dbSNP:757594691
1629 1629 c, t dbSNP:75527463
1637 1637 c, g dbSNP:369762911
1687 1687 a, c dbSNP:759335153
1699 1699 c, t dbSNP:765028184
1703 1703 a, g, t dbSNP:370204234
1712 1712 a, t dbSNP:763909049
1718 1718 c, t dbSNP:751739283
1738 1738 c, t dbSNP:757363462
1804 1804 a, g dbSNP:767857185
1813 1813 c, t dbSNP:750614309
1818 1818 a, g dbSNP:774363039
1838 1838 a, g dbSNP:370812643
1858 1858 c, t dbSNP:763388314
1869 1869 c, t dbSNP:750525966
1873 1873 g, t dbSNP:775083099
1881 1881 c, t dbSNP:766485358
1882 1882 c, t dbSNP:754247833
1883 1883 a, g dbSNP:374138730
1894 1894 a, t dbSNP:138984044
1901 1901 g, t dbSNP:188593863
1937 1937 a, g dbSNP:576733100
1944 1944 c, t dbSNP:772155788
1945 1945 a, g dbSNP:773240125
1953 1953 a, g dbSNP:747113641
1981 1981 c, t dbSNP:770861130
1993 1993 a, g dbSNP:776762599
2020 2020 a, t dbSNP:375897167
2048 2048 a, g dbSNP:765417606
2053 2053 c, t dbSNP:775882680
2068 2068 c, t dbSNP:367973899
2082 2082 c, t dbSNP:764617392
2090 2090 c, g dbSNP:778208176
2094 2094 a, g dbSNP:199582086
2101 2101 c, t dbSNP:372068010
2107 2107 c, t dbSNP:765871609
2116 2116 c, t dbSNP:753356456
2122 2122 c, t dbSNP:754725206
2125 2125 c, t dbSNP:778656381
2126 2126 g, t dbSNP:747985405
2128 2128 c, t dbSNP:758195942
2134 2134 a, g dbSNP:376986062
2137 2137 c, g dbSNP:749990040
2142 2142 a, c dbSNP:746981338
2150 2150 -, gca dbSNP:763375719
2151 2151 -, gca dbSNP:752904587
2155 2155 c, t dbSNP:199873151
2160 2160 a, g dbSNP:776618166
2167 2167 a, g dbSNP:201473962
2181 2181 g, t dbSNP:753307215
2183 2183 c, t dbSNP:754495912
2185 2185 c, t dbSNP:777329342
2193 2193 c, g dbSNP:764981858
2201 2201 a, g dbSNP:752335726
2216 2216 a, g dbSNP:753140335
2230 2230 a, g dbSNP:755299794
2243 2243 a, c dbSNP:758113987
2293 2293 c, t dbSNP:749577436
2318 2318 a, g dbSNP:768834535
2329 2329 a, g dbSNP:774625985
2335 2335 c, t dbSNP:377207665
2336 2336 c, t dbSNP:772484830
2342 2342 a, g dbSNP:773699580
2359 2359 a, g dbSNP:759126508
2369 2369 g, t dbSNP:764894174
2370 2370 g, t dbSNP:752254115
2371 2371 c, t dbSNP:187478018
2377 2377 c, t dbSNP:763782632
2378 2378 a, g, t dbSNP:192331892
2380 2380 c, g dbSNP:780996949
2393 2393 a, g dbSNP:750304793
2402 2402 a, g dbSNP:756039521
2419 2419 c, t dbSNP:370195616
2457 2457 a, g dbSNP:761529397
2458 2458 a, g dbSNP:61752446
2464 2464 c, t dbSNP:750186446
2467 2467 a, g dbSNP:769827044
2470 2470 a, g dbSNP:756091104
2473 2473 c, t dbSNP:779918145
2479 2479 a, g dbSNP:753948557
2504 2504 a, c dbSNP:755014778
2505 2505 a, g dbSNP:779012737
2507 2507 a, g dbSNP:199860580
2510 2510 a, g dbSNP:749158402
2511 2511 c, t dbSNP:778325168
2522 2522 a, g dbSNP:747358083
2544 2544 a, t dbSNP:771591691
2550 2550 a, g dbSNP:777238737
2551 2551 c, t dbSNP:748753383
2608 2608 c, g dbSNP:756908016
2612 2612 a, c dbSNP:747413033
2615 2615 g, t dbSNP:757629606
2628 2628 a, c dbSNP:752847512
2643 2643 a, g dbSNP:762905361
2649 2649 a, g dbSNP:749801457
2654 2654 c, t dbSNP:751774081
2664 2664 a, c dbSNP:757541657
2670 2670 c, t dbSNP:761085895
2683 2683 c, t dbSNP:781733323
2733 2733 c, t dbSNP:750730080
2767 2767 c, t dbSNP:746727639
2770 2770 a, g dbSNP:368090262
2773 2773 c, t dbSNP:776541226
2788 2788 a, g dbSNP:759205860
2803 2803 c, t dbSNP:769804888
2812 2812 a, g dbSNP:372344160
2818 2818 g, t dbSNP:763140070
2830 2830 c, t dbSNP:751190759
2879 2879 a, g dbSNP:751687978
2920 2920 a, g dbSNP:757010467
2926 2926 c, t dbSNP:372816429
2928 2928 a, g dbSNP:763052446
2947 2947 a, c dbSNP:768686458
2953 2953 c, t dbSNP:774593737
2958 2958 c, t dbSNP:778697440
2961 2961 a, g dbSNP:767783777
2977 2977 c, t dbSNP:375971110
2978 2978 g, t dbSNP:760933452
2992 2992 a, g dbSNP:560621486
3010 3010 c, t dbSNP:766716404
3019 3019 c, t dbSNP:754167644
3061 3061 c, t dbSNP:748251157
3062 3062 a, g dbSNP:772101551
3072 3072 a, g dbSNP:397515554
3073 3073 a, g dbSNP:773333573
3078 3078 a, g dbSNP:760844083
3080 3080 c, t dbSNP:80338758
3081 3081 a, g dbSNP:766598254
3085 3085 c, t dbSNP:34761462
3103 3103 a, g dbSNP:369276718
3105 3105 a, g dbSNP:765741173
3121 3121 c, t dbSNP:552568236
3136 3136 c, t dbSNP:758935114
3182 3182 a, g dbSNP:771092011
3187 3187 c, t dbSNP:776771030
3188 3188 c, t dbSNP:2503120
3190 3190 c, t dbSNP:751044891
3208 3208 a, c, g dbSNP:375493995
3211 3211 c, t dbSNP:775829185
3214 3214 c, t dbSNP:370685994
3219 3219 a, g dbSNP:80338759
3232 3232 a, g dbSNP:764642821
3253 3253 a, c dbSNP:749926584
3268 3268 c, t dbSNP:753751305
3309 3309 c, t dbSNP:377078179
3310 3310 a, g dbSNP:185658730
3317 3317 a, g dbSNP:753602358
3337 3337 a, c dbSNP:754673791
3384 3384 g, t dbSNP:778887337
3390 3390 a, g dbSNP:752512200
3400 3400 a, t dbSNP:758288118
3401 3401 c, t dbSNP:777724452
3403 3403 c, t dbSNP:201807437
3404 3404 a, g dbSNP:770988288
3421 3421 c, t dbSNP:374156594
3422 3422 g, t dbSNP:41303701
3532 3532 c, t dbSNP:781289776
3556 3556 c, t dbSNP:773679943
3580 3580 g, t dbSNP:369946933
3607 3607 c, t dbSNP:756127182
3625 3625 c, t dbSNP:779981418
3642 3642 a, g dbSNP:387907360
3682 3682 c, t dbSNP:774227521
3692 3692 c, t dbSNP:387907361
3696 3696 a, t dbSNP:2503121
3713 3713 a, c dbSNP:761559213
3718 3718 c, t dbSNP:767449566
3722 3722 a, g dbSNP:750415430
3748 3748 a, g dbSNP:756037504
3756 3756 a, g dbSNP:766516518
3762 3762 g, t dbSNP:750380399
3763 3763 c, t dbSNP:755250008
3770 3770 a, g dbSNP:778961820
3784 3784 g, t dbSNP:761612336
3808 3808 c, t dbSNP:751742488
3829 3829 c, t dbSNP:748892629
3832 3832 a, c dbSNP:755212046
3844 3844 c, t dbSNP:760651439
3898 3898 a, g dbSNP:184162709
3935 3935 a, g dbSNP:770904571
3968 3968 a, g dbSNP:776373565
3984 3984 a, g dbSNP:202120461
3988 3988 c, g dbSNP:765481362
3991 3991 g, t dbSNP:752795407
3994 3994 c, t dbSNP:763317363
3996 3996 a, g dbSNP:587780391
3999 3999 a, g dbSNP:752008407
4007 4007 c, g dbSNP:757500838
4008 4008 c, t dbSNP:781730846
4015 4015 a, c dbSNP:750953189
4042 4042 c, t dbSNP:369268877
4043 4043 a, g dbSNP:398124197
4048 4048 g, t dbSNP:377409217
4060 4060 c, t dbSNP:747604195
4063 4063 a, g dbSNP:370431544
4075 4075 a, t dbSNP:368144948
4099 4099 a, g dbSNP:763090662
4111 4111 c, t dbSNP:762887632
4117 4117 c, t dbSNP:372389957
4129 4129 a, c dbSNP:5030619
4141 4141 c, t dbSNP:3810670
4150 4150 a, g dbSNP:755194632
4156 4156 a, c dbSNP:368549870
4184 4184 c, g dbSNP:766827969
4198 4198 c, t dbSNP:752208223
4200 4200 a, g dbSNP:372238830
4213 4213 a, c dbSNP:775331048
4215 4215 c, t dbSNP:757845624
4220 4220 c, t dbSNP:777250096
4221 4221 a, g dbSNP:746705248
4226 4226 c, t dbSNP:762692180
4227 4227 a, g dbSNP:201044355
4230 4230 c, t dbSNP:780900807
4235 4235 c, t dbSNP:745627308
4240 4240 c, t dbSNP:769884032
4243 4243 c, t dbSNP:367674919
4291 4291 a, g dbSNP:756882570
4310 4310 c, t dbSNP:587778437
4314 4314 a, g dbSNP:202009066
4316 4316 a, g dbSNP:755920101
4353 4353 c, t dbSNP:771349148
4360 4360 c, t dbSNP:776947543
4374 4374 a, g dbSNP:1139013
4378 4378 a, c dbSNP:376058351
4390 4390 g, t dbSNP:765727984
4401 4401 c, g dbSNP:774091279
4417 4417 c, t dbSNP:751061930
4431 4431 a, g dbSNP:761320689
4437 4437 a, c dbSNP:759532414
4459 4459 a, g dbSNP:34299769
4463 4463 c, t dbSNP:776011599
4498 4498 c, t dbSNP:763359998
4525 4525 c, t dbSNP:767123637
4544 4544 c, g dbSNP:749925159
4552 4552 a, g dbSNP:760423553
4558 4558 a, g dbSNP:766087487
4562 4562 c, g dbSNP:761728689
4579 4579 c, t dbSNP:377119772
4624 4624 a, g dbSNP:370211858
4648 4648 a, g dbSNP:769025272
4660 4660 a, g dbSNP:772877700
4663 4663 c, t dbSNP:760194613
4669 4669 a, g dbSNP:766138859
4672 4672 a, g dbSNP:776476529
4685 4685 c, t dbSNP:759105512
4687 4687 c, t dbSNP:531754497
4705 4705 c, t dbSNP:754662384
4734 4734 a, g dbSNP:753169363
4776 4776 a, g dbSNP:774937112
4783 4783 -, atgc dbSNP:768035778
4819 4819 a, g dbSNP:756385578
4834 4834 c, t dbSNP:151316557
4864 4864 a, g dbSNP:375001801
4876 4876 g, t dbSNP:755449496
4879 4879 c, t dbSNP:779412664
4960 4960 c, t dbSNP:369563649
4961 4961 a, g dbSNP:767396596
4963 4963 a, g, t dbSNP:750517588
4976 4976 a, g dbSNP:766467215
4984 4984 c, t dbSNP:754072422
5005 5005 a, g dbSNP:755218771
5026 5026 c, t dbSNP:779466860
5030 5030 c, g dbSNP:727503868
5039 5039 a, g dbSNP:374216233
5049 5049 c, t dbSNP:753061449
5050 5050 a, g dbSNP:377210068
5069 5069 c, t dbSNP:766406937
5078 5078 c, t dbSNP:776748297
5079 5079 a, g dbSNP:759857680
5119 5119 a, t dbSNP:765515717
5140 5140 c, t dbSNP:753148075
5149 5149 a, g dbSNP:756839501
5170 5170 c, t dbSNP:398124198
5173 5173 c, t dbSNP:376179450
5188 5188 c, g dbSNP:752074440
5203 5203 c, t dbSNP:370610104
5204 5204 a, g dbSNP:779481901
5287 5287 a, g dbSNP:202167558
5302 5302 c, t dbSNP:762801267
5308 5308 c, t dbSNP:781134410
5323 5323 a, c dbSNP:775912778
5333 5333 c, t dbSNP:763233945
5337 5337 a, g dbSNP:374390933
5338 5338 a, c dbSNP:751934349
5356 5356 a, g dbSNP:757730166
5365 5365 a, g dbSNP:768033414
5384 5384 a, c dbSNP:387907362
5389 5389 c, g dbSNP:753355369
5397 5397 a, g dbSNP:754537871
5402 5402 c, t dbSNP:778386823
5404 5404 c, t dbSNP:747836622
5423 5423 c, t dbSNP:758043683
5428 5428 a, g dbSNP:777450271
5430 5430 c, t dbSNP:746777806
5447 5447 a, g dbSNP:368542728
5451 5451 a, c, t dbSNP:748064846
5452 5452 a, g dbSNP:770067057
5461 5461 c, t dbSNP:771798591
5466 5466 c, t dbSNP:201843482
5494 5494 c, g dbSNP:763136667
5509 5509 a, c dbSNP:768875937
5514 5514 c, t dbSNP:774613786
5515 5515 a, g dbSNP:398124199
5526 5526 c, t dbSNP:767850812
5542 5542 a, g dbSNP:750991975
5575 5575 c, t dbSNP:761137877
5604 5604 a, g dbSNP:375152466
5616 5616 c, t dbSNP:368093012
5617 5617 a, g dbSNP:770957462
5621 5621 c, t dbSNP:372271659
5626 5626 c, t dbSNP:772462354
5641 5641 c, g dbSNP:773540568
5652 5652 c, t dbSNP:761189421
5684 5684 a, g dbSNP:766830015
5687 5687 a, c dbSNP:752152022
5689 5689 a, c, g dbSNP:762466624
5693 5693 c, t dbSNP:751294090
5709 5709 c, g dbSNP:200328506
5726 5726 a, c dbSNP:781184955
5732 5732 -, a dbSNP:758232218
5733 5733 a, c dbSNP:750197108
5734 5734 c, t dbSNP:34784349
5759 5759 c, t dbSNP:747305574
5760 5760 a, g dbSNP:759125296
5767 5767 c, t dbSNP:777253437
5774 5774 c, t dbSNP:759956340
5775 5775 a, g dbSNP:763700798
5783 5783 c, t dbSNP:200279192
5784 5784 a, g dbSNP:773713291
5789 5789 c, t dbSNP:764510212
5792 5792 a, g dbSNP:587778438
5811 5811 a, g dbSNP:761581305
5812 5812 a, c dbSNP:767241359
5815 5815 a, c dbSNP:750250372
5816 5816 a, g dbSNP:372326268
5828 5828 g, t dbSNP:766078065
5843 5843 a, g dbSNP:376830660
5849 5849 a, g dbSNP:147354926
5851 5851 c, t dbSNP:779068766
5852 5852 a, g dbSNP:762659794
5858 5858 a, g dbSNP:758621985
5868 5868 c, t dbSNP:777912357
5878 5878 c, t dbSNP:747217643
5907 5907 a, c dbSNP:7473655
5910 5910 c, t dbSNP:200663107
5911 5911 a, g dbSNP:189962028
5917 5917 c, t dbSNP:746436864
5925 5925 a, g dbSNP:770153551
5927 5927 a, c dbSNP:773945032
5929 5929 c, t dbSNP:751276767
5934 5934 a, g dbSNP:767294730
5955 5955 c, t dbSNP:201797170
5960 5960 a, c dbSNP:752786651
5971 5971 a, g dbSNP:762208323
5983 5983 a, g dbSNP:376753995
5986 5986 c, t dbSNP:758530859
6006 6006 a, g dbSNP:777825769
6013 6013 c, t dbSNP:201608537
6016 6016 c, t dbSNP:757398839
6017 6017 a, g dbSNP:781638379
6063 6063 g, t dbSNP:752697076
6081 6081 c, g dbSNP:762846340
6082 6082 c, t dbSNP:370235478
6111 6111 a, c dbSNP:751590721
6113 6113 c, t dbSNP:757532503
6140 6140 c, t dbSNP:781207905
6156 6156 c, t dbSNP:374901524
6189 6189 a, g dbSNP:750926172
6199 6199 c, t dbSNP:780565385
6222 6222 c, t dbSNP:749856104
6225 6225 a, c dbSNP:769232520
6245 6245 a, c dbSNP:777453338
6253 6253 a, g dbSNP:763950825
6268 6268 a, t dbSNP:751668146
6280 6280 a, t dbSNP:200692655
6283 6283 a, c dbSNP:767609800
6287 6287 a, g dbSNP:750648216
6305 6305 a, g dbSNP:372606012
6319 6319 c, t dbSNP:370522888
6320 6320 a, g dbSNP:762612521
6332 6332 a, g dbSNP:755577187
6336 6336 a, g dbSNP:779515761
6347 6347 a, g dbSNP:748668603
6353 6353 a, c dbSNP:756758050
6356 6356 -, agc, agcagcagc dbSNP:775460241
6357 6357 -, agcagc dbSNP:749468415
6357 6357 -, agc dbSNP:769857818
6363 6363 a, g dbSNP:780750191
6367 6367 -, cagcagcaa dbSNP:774751179
6368 6368 -, cagcagcaa dbSNP:762261992
6371 6371 -, cagcaacagcagcaa dbSNP:767827315
6376 6376 a, g dbSNP:745565325
6379 6379 -, cagcaa dbSNP:765873195
6379 6379 a, g dbSNP:769378169
6380 6380 -, cagcaa dbSNP:753370104
6385 6385 a, g dbSNP:775267316
6391 6391 -, cag dbSNP:764842201
6391 6391 a, g dbSNP:749041154
6392 6392 -, cag dbSNP:754533796
6397 6397 -, caacagcaa dbSNP:752416697
6403 6403 -, cagcaa dbSNP:758203078
6404 6404 -, cagcaa dbSNP:777446206
6409 6409 a, g dbSNP:375793297
6415 6415 -, cag, cagcag dbSNP:746921153
6415 6415 a, g dbSNP:774201765
6416 6416 -, cag dbSNP:757160341
6436 6436 -, cag dbSNP:786200970
6443 6443 a, g dbSNP:200820997
6447 6447 -, gca dbSNP:768921894
6448 6448 -, gca dbSNP:763466801
6457 6457 a, g dbSNP:767555481
6466 6466 -, cag dbSNP:786200971
6481 6481 -, cagcaa dbSNP:761195801
6493 6493 -, cag, cagcag dbSNP:777164189
6494 6494 -, cag dbSNP:766775649
6499 6499 a, g dbSNP:756285149
6512 6512 -, cagcaa dbSNP:764789036
6518 6518 -, cagcaacagcagcag dbSNP:752292446
6529 6529 -, gcagcagcaacagca dbSNP:727503869
6529 6529 a, g dbSNP:778103349
6532 6532 a, g dbSNP:749807888
6534 6534 a, c dbSNP:755793630
6538 6538 a, t dbSNP:80213780
6547 6547 a, g dbSNP:757508922
6548 6548 -, agcaacaccag dbSNP:5030620
6556 6556 c, g dbSNP:79912241
6567 6567 -, ccagcagcaaca dbSNP:398124200
6568 6568 c, g dbSNP:779631682
6599 6599 c, g dbSNP:748914486
6634 6634 g, t dbSNP:763374211
6673 6673 c, t dbSNP:764620745
6675 6675 a, g dbSNP:779119355
6700 6700 c, t dbSNP:745748011
6701 6701 a, c dbSNP:771928081
6734 6734 c, t dbSNP:777818556
6735 6735 a, g dbSNP:746914362
6737 6737 c, t dbSNP:771203240
6738 6738 a, t dbSNP:776838069
6744 6744 c, t dbSNP:759851468
6754 6754 a, g dbSNP:769990908
6757 6757 a, c dbSNP:775748389
6763 6763 g, t dbSNP:763326717
6767 6767 a, g dbSNP:369519934
6780 6780 c, t dbSNP:373723581
6788 6788 c, t dbSNP:762299869
6791 6791 -, tct dbSNP:763897867
6931 6931 c, g dbSNP:190398158

Target ORF information:

RefSeq Version XM_005262317
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mediator complex subunit 12 (MED12), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54273
Accession Version XM_005262319.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 6468bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mediator of RNA polymerase II transcription subunit 12 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011651.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)500..682(+)
Misc Feature(2)1052..2470(+)
Misc Feature(3)5648..6193(+)
Position Chain Variation Link
15 15 c, t dbSNP:755120050
73 73 a, g dbSNP:781522411
118 118 c, g dbSNP:748336778
138 138 a, c dbSNP:769876044
153 153 a, t dbSNP:767078113
160 160 c, t dbSNP:773181240
161 161 g, t dbSNP:749937972
164 164 c, t dbSNP:755790492
168 168 a, g dbSNP:766027203
172 172 g, t dbSNP:373552360
188 188 c, g dbSNP:754723833
189 189 a, g dbSNP:778856985
197 197 a, g dbSNP:748008926
219 219 g, t dbSNP:758482018
226 226 c, t dbSNP:376743527
239 239 c, g dbSNP:747105314
245 245 a, c dbSNP:749802630
253 253 a, g dbSNP:781452716
257 257 a, g dbSNP:746256454
259 259 a, g dbSNP:770218060
270 270 -, t dbSNP:778396432
274 274 -, ccctc dbSNP:747588961
275 275 c, g dbSNP:776154055
281 281 a, g dbSNP:371385969
296 296 a, g dbSNP:769202858
302 302 -, gaactgacggccttgaatgtaaaacaaggtttcaat dbSNP:199469678
304 304 a, g dbSNP:746030482
306 306 gc, tgacg dbSNP:199469679
306 306 g, t dbSNP:199469667
308 308 a, t dbSNP:770128096
310 310 -, ggccttgaatgtaaaacaaggtttcaataaccagcctgctgtctc dbSNP:199469681
312 312 -, ccttgaatg dbSNP:199469682
316 316 -, gaatgt dbSNP:199469683
317 317 aatgtaaaacaaggtttcaataaccagcc, tt dbSNP:199469685
317 317 aatgtaaaacaaggttt, ta dbSNP:199469680
317 317 -, aatgtaaaacaaggt dbSNP:199469684
321 321 -, taaaacaaggtttcaataaccagcctgctgtctctggggatg dbSNP:199469687
321 321 -, taaaacaaggtttcaataaccagcctg dbSNP:199469686
322 322 -, aaaacaaggtttcaataaccagcctgctgt dbSNP:199469688
325 325 -, acaaggtttcaataa dbSNP:199469690
325 325 -, acaagg dbSNP:199469689
327 327 a, c dbSNP:199469668
328 328 -, aggtttcaataacca dbSNP:199469692
328 328 -, aggtttcaa dbSNP:199469691
328 328 a, g dbSNP:780634712
329 329 a, c, g, t dbSNP:199469669
330 330 a, c, g, t dbSNP:199469672
332 332 -, ttcaataaccag dbSNP:199469693
336 336 a, g dbSNP:769095144
346 346 a, t dbSNP:774875020
348 348 -, ctgtctctggggatg dbSNP:199469694
367 367 c, t dbSNP:760138274
382 382 c, t dbSNP:770411750
400 400 c, g dbSNP:374555675
429 429 a, t dbSNP:756351657
436 436 a, g dbSNP:779295599
505 505 c, t dbSNP:2471968
520 520 a, c dbSNP:748627661
523 523 a, g dbSNP:772440501
547 547 g, t dbSNP:776188083
560 560 g, t dbSNP:745348543
568 568 a, c dbSNP:769484204
579 579 c, t dbSNP:775072642
580 580 a, g dbSNP:202125318
583 583 a, g dbSNP:201566660
598 598 c, t dbSNP:754050535
622 622 a, g dbSNP:755316164
637 637 a, g dbSNP:35068602
638 638 a, g dbSNP:748453083
647 647 a, g dbSNP:758980420
663 663 a, g dbSNP:778227705
749 749 a, g dbSNP:745402126
767 767 a, g dbSNP:374780236
801 801 c, g, t dbSNP:776982089
812 812 c, t dbSNP:765342782
836 836 a, g dbSNP:200333229
845 845 g, t dbSNP:746326251
852 852 c, t dbSNP:369083173
853 853 a, g dbSNP:751995503
879 879 a, c dbSNP:755634255
907 907 c, g, t dbSNP:34668206
950 950 a, c dbSNP:753413601
996 996 a, g dbSNP:754407926
1009 1009 c, t dbSNP:778635250
1048 1048 c, t dbSNP:750832089
1061 1061 -, g dbSNP:35454896
1071 1071 a, c dbSNP:754533515
1076 1076 c, t dbSNP:764716429
1108 1108 a, g dbSNP:184426039
1133 1133 c, g dbSNP:377403264
1134 1134 c, t dbSNP:777541463
1135 1135 c, g dbSNP:746820232
1143 1143 a, t dbSNP:759516228
1157 1157 a, g, t dbSNP:781192327
1165 1165 c, t dbSNP:370616416
1180 1180 a, g dbSNP:769757456
1181 1181 c, t dbSNP:767398040
1197 1197 c, t dbSNP:775499343
1210 1210 a, c dbSNP:749348331
1214 1214 a, g dbSNP:768889545
1221 1221 c, t dbSNP:774518546
1224 1224 c, t dbSNP:762172777
1227 1227 c, t dbSNP:764107388
1230 1230 a, c dbSNP:773615925
1232 1232 c, t dbSNP:761157306
1237 1237 c, t dbSNP:766874065
1238 1238 a, g dbSNP:752300879
1245 1245 a, t dbSNP:757929935
1265 1265 a, c dbSNP:763867883
1266 1266 a, g dbSNP:751188840
1267 1267 a, g dbSNP:757086557
1275 1275 -, t dbSNP:776803467
1312 1312 a, g dbSNP:780470012
1327 1327 c, t dbSNP:750206494
1330 1330 c, g dbSNP:755897379
1331 1331 a, g dbSNP:779969587
1339 1339 c, t dbSNP:753714929
1342 1342 c, t dbSNP:754893689
1366 1366 a, g dbSNP:374324656
1368 1368 a, c dbSNP:748224921
1369 1369 c, t dbSNP:772236514
1396 1396 a, t dbSNP:754944788
1402 1402 a, g, t dbSNP:368546216
1417 1417 a, g dbSNP:771358421
1422 1422 a, g dbSNP:777293696
1423 1423 a, g dbSNP:760180422
1456 1456 a, c dbSNP:754943978
1463 1463 c, t dbSNP:368913305
1464 1464 a, g dbSNP:752746769
1468 1468 a, g dbSNP:758467351
1476 1476 a, g dbSNP:777865279
1480 1480 a, g dbSNP:747199355
1511 1511 c, t dbSNP:771266719
1512 1512 a, g dbSNP:587778439
1522 1522 c, t dbSNP:371928861
1531 1531 c, t dbSNP:746205041
1543 1543 g, t dbSNP:375202766
1552 1552 -, c dbSNP:36079314
1563 1563 a, g dbSNP:760696164
1569 1569 g, t dbSNP:758423721
1576 1576 a, t dbSNP:764293738
1585 1585 g, t dbSNP:186153976
1597 1597 c, t dbSNP:757594691
1629 1629 c, t dbSNP:75527463
1637 1637 c, g dbSNP:369762911
1687 1687 a, c dbSNP:759335153
1699 1699 c, t dbSNP:765028184
1703 1703 a, g, t dbSNP:370204234
1712 1712 a, t dbSNP:763909049
1718 1718 c, t dbSNP:751739283
1738 1738 c, t dbSNP:757363462
1804 1804 a, g dbSNP:767857185
1813 1813 c, t dbSNP:750614309
1818 1818 a, g dbSNP:774363039
1838 1838 a, g dbSNP:370812643
1858 1858 c, t dbSNP:763388314
1869 1869 c, t dbSNP:750525966
1873 1873 g, t dbSNP:775083099
1881 1881 c, t dbSNP:766485358
1882 1882 c, t dbSNP:754247833
1883 1883 a, g dbSNP:374138730
1894 1894 a, t dbSNP:138984044
1901 1901 g, t dbSNP:188593863
1937 1937 a, g dbSNP:576733100
1944 1944 c, t dbSNP:772155788
1945 1945 a, g dbSNP:773240125
1953 1953 a, g dbSNP:747113641
1981 1981 c, t dbSNP:770861130
1993 1993 a, g dbSNP:776762599
2020 2020 a, t dbSNP:375897167
2048 2048 a, g dbSNP:765417606
2053 2053 c, t dbSNP:775882680
2068 2068 c, t dbSNP:367973899
2082 2082 c, t dbSNP:764617392
2090 2090 c, g dbSNP:778208176
2094 2094 a, g dbSNP:199582086
2101 2101 c, t dbSNP:372068010
2107 2107 c, t dbSNP:765871609
2116 2116 c, t dbSNP:753356456
2122 2122 c, t dbSNP:754725206
2125 2125 c, t dbSNP:778656381
2126 2126 g, t dbSNP:747985405
2128 2128 c, t dbSNP:758195942
2134 2134 a, g dbSNP:376986062
2137 2137 c, g dbSNP:749990040
2142 2142 a, c dbSNP:746981338
2150 2150 -, gca dbSNP:763375719
2151 2151 -, gca dbSNP:752904587
2155 2155 c, t dbSNP:199873151
2160 2160 a, g dbSNP:776618166
2167 2167 a, g dbSNP:201473962
2181 2181 g, t dbSNP:753307215
2183 2183 c, t dbSNP:754495912
2185 2185 c, t dbSNP:777329342
2193 2193 c, g dbSNP:764981858
2201 2201 a, g dbSNP:752335726
2216 2216 a, g dbSNP:753140335
2230 2230 a, g dbSNP:755299794
2243 2243 a, c dbSNP:758113987
2293 2293 c, t dbSNP:749577436
2318 2318 a, g dbSNP:768834535
2329 2329 a, g dbSNP:774625985
2335 2335 c, t dbSNP:377207665
2336 2336 c, t dbSNP:772484830
2342 2342 a, g dbSNP:773699580
2359 2359 a, g dbSNP:759126508
2369 2369 g, t dbSNP:764894174
2370 2370 g, t dbSNP:752254115
2371 2371 c, t dbSNP:187478018
2377 2377 c, t dbSNP:763782632
2378 2378 a, g, t dbSNP:192331892
2380 2380 c, g dbSNP:780996949
2393 2393 a, g dbSNP:750304793
2402 2402 a, g dbSNP:756039521
2419 2419 c, t dbSNP:370195616
2457 2457 a, g dbSNP:761529397
2458 2458 a, g dbSNP:61752446
2464 2464 c, t dbSNP:750186446
2467 2467 a, g dbSNP:769827044
2470 2470 a, g dbSNP:756091104
2473 2473 c, t dbSNP:779918145
2479 2479 a, g dbSNP:753948557
2504 2504 a, c dbSNP:755014778
2505 2505 a, g dbSNP:779012737
2507 2507 a, g dbSNP:199860580
2510 2510 a, g dbSNP:749158402
2511 2511 c, t dbSNP:778325168
2522 2522 a, g dbSNP:747358083
2544 2544 a, t dbSNP:771591691
2550 2550 a, g dbSNP:777238737
2551 2551 c, t dbSNP:748753383
2608 2608 c, g dbSNP:756908016
2612 2612 a, c dbSNP:747413033
2615 2615 g, t dbSNP:757629606
2628 2628 a, c dbSNP:752847512
2643 2643 a, g dbSNP:762905361
2649 2649 a, g dbSNP:749801457
2654 2654 c, t dbSNP:751774081
2664 2664 a, c dbSNP:757541657
2670 2670 c, t dbSNP:761085895
2683 2683 c, t dbSNP:781733323
2733 2733 c, t dbSNP:750730080
2767 2767 c, t dbSNP:746727639
2770 2770 a, g dbSNP:368090262
2773 2773 c, t dbSNP:776541226
2788 2788 a, g dbSNP:759205860
2803 2803 c, t dbSNP:769804888
2812 2812 a, g dbSNP:372344160
2818 2818 g, t dbSNP:763140070
2830 2830 c, t dbSNP:751190759
2879 2879 a, g dbSNP:751687978
2920 2920 a, g dbSNP:757010467
2926 2926 c, t dbSNP:372816429
2928 2928 a, g dbSNP:763052446
2947 2947 a, c dbSNP:768686458
2953 2953 c, t dbSNP:774593737
2958 2958 c, t dbSNP:778697440
2961 2961 a, g dbSNP:767783777
2977 2977 c, t dbSNP:375971110
2978 2978 g, t dbSNP:760933452
2992 2992 a, g dbSNP:560621486
3010 3010 c, t dbSNP:766716404
3019 3019 c, t dbSNP:754167644
3061 3061 c, t dbSNP:748251157
3062 3062 a, g dbSNP:772101551
3072 3072 a, g dbSNP:397515554
3073 3073 a, g dbSNP:773333573
3078 3078 a, g dbSNP:760844083
3080 3080 c, t dbSNP:80338758
3081 3081 a, g dbSNP:766598254
3085 3085 c, t dbSNP:34761462
3103 3103 a, g dbSNP:369276718
3105 3105 a, g dbSNP:765741173
3121 3121 c, t dbSNP:552568236
3136 3136 c, t dbSNP:758935114
3182 3182 a, g dbSNP:771092011
3187 3187 c, t dbSNP:776771030
3188 3188 c, t dbSNP:2503120
3190 3190 c, t dbSNP:751044891
3208 3208 a, c, g dbSNP:375493995
3211 3211 c, t dbSNP:775829185
3214 3214 c, t dbSNP:370685994
3219 3219 a, g dbSNP:80338759
3232 3232 a, g dbSNP:764642821
3253 3253 a, c dbSNP:749926584
3268 3268 c, t dbSNP:753751305
3309 3309 c, t dbSNP:377078179
3310 3310 a, g dbSNP:185658730
3317 3317 a, g dbSNP:753602358
3337 3337 a, c dbSNP:754673791
3384 3384 g, t dbSNP:778887337
3390 3390 a, g dbSNP:752512200
3400 3400 a, t dbSNP:758288118
3401 3401 c, t dbSNP:777724452
3403 3403 c, t dbSNP:201807437
3404 3404 a, g dbSNP:770988288
3421 3421 c, t dbSNP:374156594
3422 3422 g, t dbSNP:41303701
3532 3532 c, t dbSNP:781289776
3556 3556 c, t dbSNP:773679943
3580 3580 g, t dbSNP:369946933
3607 3607 c, t dbSNP:756127182
3625 3625 c, t dbSNP:779981418
3642 3642 a, g dbSNP:387907360
3682 3682 c, t dbSNP:774227521
3692 3692 c, t dbSNP:387907361
3696 3696 a, t dbSNP:2503121
3713 3713 a, c dbSNP:761559213
3718 3718 c, t dbSNP:767449566
3722 3722 a, g dbSNP:750415430
3748 3748 a, g dbSNP:756037504
3756 3756 a, g dbSNP:766516518
3762 3762 g, t dbSNP:750380399
3763 3763 c, t dbSNP:755250008
3770 3770 a, g dbSNP:778961820
3784 3784 g, t dbSNP:761612336
3808 3808 c, t dbSNP:751742488
3829 3829 c, t dbSNP:748892629
3832 3832 a, c dbSNP:755212046
3844 3844 c, t dbSNP:760651439
3898 3898 a, g dbSNP:184162709
3935 3935 a, g dbSNP:770904571
3968 3968 a, g dbSNP:776373565
3984 3984 a, g dbSNP:202120461
3988 3988 c, g dbSNP:765481362
3991 3991 g, t dbSNP:752795407
3994 3994 c, t dbSNP:763317363
3996 3996 a, g dbSNP:587780391
3999 3999 a, g dbSNP:752008407
4007 4007 c, g dbSNP:757500838
4008 4008 c, t dbSNP:781730846
4015 4015 a, c dbSNP:750953189
4042 4042 c, t dbSNP:369268877
4043 4043 a, g dbSNP:398124197
4048 4048 g, t dbSNP:377409217
4060 4060 c, t dbSNP:747604195
4063 4063 a, g dbSNP:370431544
4075 4075 a, t dbSNP:368144948
4099 4099 a, g dbSNP:763090662
4111 4111 c, t dbSNP:762887632
4117 4117 c, t dbSNP:372389957
4129 4129 a, c dbSNP:5030619
4141 4141 c, t dbSNP:3810670
4150 4150 a, g dbSNP:755194632
4156 4156 a, c dbSNP:368549870
4184 4184 c, g dbSNP:766827969
4198 4198 c, t dbSNP:752208223
4200 4200 a, g dbSNP:372238830
4213 4213 a, c dbSNP:775331048
4215 4215 c, t dbSNP:757845624
4220 4220 c, t dbSNP:777250096
4221 4221 a, g dbSNP:746705248
4226 4226 c, t dbSNP:762692180
4227 4227 a, g dbSNP:201044355
4230 4230 c, t dbSNP:780900807
4235 4235 c, t dbSNP:745627308
4240 4240 c, t dbSNP:769884032
4243 4243 c, t dbSNP:367674919
4291 4291 a, g dbSNP:756882570
4310 4310 c, t dbSNP:587778437
4314 4314 a, g dbSNP:202009066
4316 4316 a, g dbSNP:755920101
4353 4353 c, t dbSNP:771349148
4360 4360 c, t dbSNP:776947543
4374 4374 a, g dbSNP:1139013
4378 4378 a, c dbSNP:376058351
4390 4390 g, t dbSNP:765727984
4401 4401 c, g dbSNP:774091279
4417 4417 c, t dbSNP:751061930
4431 4431 a, g dbSNP:761320689
4437 4437 a, c dbSNP:759532414
4459 4459 a, g dbSNP:34299769
4463 4463 c, t dbSNP:776011599
4498 4498 c, t dbSNP:763359998
4525 4525 c, t dbSNP:767123637
4544 4544 c, g dbSNP:749925159
4552 4552 a, g dbSNP:760423553
4558 4558 a, g dbSNP:766087487
4562 4562 c, g dbSNP:761728689
4579 4579 c, t dbSNP:377119772
4624 4624 a, g dbSNP:370211858
4648 4648 a, g dbSNP:769025272
4660 4660 a, g dbSNP:772877700
4663 4663 c, t dbSNP:760194613
4669 4669 a, g dbSNP:766138859
4672 4672 a, g dbSNP:776476529
4685 4685 c, t dbSNP:759105512
4687 4687 c, t dbSNP:531754497
4705 4705 c, t dbSNP:754662384
4734 4734 a, g dbSNP:753169363
4776 4776 a, g dbSNP:774937112
4783 4783 -, atgc dbSNP:768035778
4819 4819 a, g dbSNP:756385578
4834 4834 c, t dbSNP:151316557
4864 4864 a, g dbSNP:375001801
4876 4876 g, t dbSNP:755449496
4879 4879 c, t dbSNP:779412664
4960 4960 c, t dbSNP:369563649
4961 4961 a, g dbSNP:767396596
4963 4963 a, g, t dbSNP:750517588
4976 4976 a, g dbSNP:766467215
4984 4984 c, t dbSNP:754072422
5005 5005 a, g dbSNP:755218771
5026 5026 c, t dbSNP:779466860
5030 5030 c, g dbSNP:727503868
5039 5039 a, g dbSNP:374216233
5049 5049 c, t dbSNP:753061449
5050 5050 a, g dbSNP:377210068
5069 5069 c, t dbSNP:766406937
5078 5078 c, t dbSNP:776748297
5079 5079 a, g dbSNP:759857680
5119 5119 a, t dbSNP:765515717
5140 5140 c, t dbSNP:753148075
5149 5149 a, g dbSNP:756839501
5170 5170 c, t dbSNP:398124198
5173 5173 c, t dbSNP:376179450
5188 5188 c, g dbSNP:752074440
5203 5203 c, t dbSNP:370610104
5204 5204 a, g dbSNP:779481901
5287 5287 a, g dbSNP:202167558
5302 5302 c, t dbSNP:762801267
5308 5308 c, t dbSNP:781134410
5323 5323 a, c dbSNP:775912778
5333 5333 c, t dbSNP:763233945
5337 5337 a, g dbSNP:374390933
5338 5338 a, c dbSNP:751934349
5356 5356 a, g dbSNP:757730166
5365 5365 a, g dbSNP:768033414
5384 5384 a, c dbSNP:387907362
5389 5389 c, g dbSNP:753355369
5397 5397 a, g dbSNP:754537871
5402 5402 c, t dbSNP:778386823
5404 5404 c, t dbSNP:747836622
5423 5423 c, t dbSNP:758043683
5428 5428 a, g dbSNP:777450271
5430 5430 c, t dbSNP:746777806
5447 5447 a, g dbSNP:368542728
5451 5451 a, c, t dbSNP:748064846
5452 5452 a, g dbSNP:770067057
5461 5461 c, t dbSNP:771798591
5466 5466 c, t dbSNP:201843482
5494 5494 c, g dbSNP:763136667
5509 5509 a, c dbSNP:768875937
5514 5514 c, t dbSNP:774613786
5515 5515 a, g dbSNP:398124199
5526 5526 c, t dbSNP:767850812
5542 5542 a, g dbSNP:750991975
5575 5575 c, t dbSNP:761137877
5604 5604 a, g dbSNP:375152466
5616 5616 c, t dbSNP:368093012
5617 5617 a, g dbSNP:770957462
5621 5621 c, t dbSNP:372271659
5626 5626 c, t dbSNP:772462354
5641 5641 c, g dbSNP:773540568
5652 5652 c, t dbSNP:761189421
5684 5684 a, g dbSNP:766830015
5687 5687 a, c dbSNP:752152022
5689 5689 a, c, g dbSNP:762466624
5693 5693 c, t dbSNP:751294090
5709 5709 c, g dbSNP:200328506
5726 5726 a, c dbSNP:781184955
5732 5732 -, a dbSNP:758232218
5733 5733 a, c dbSNP:750197108
5734 5734 c, t dbSNP:34784349
5759 5759 c, t dbSNP:747305574
5760 5760 a, g dbSNP:759125296
5767 5767 c, t dbSNP:777253437
5774 5774 c, t dbSNP:759956340
5775 5775 a, g dbSNP:763700798
5783 5783 c, t dbSNP:200279192
5784 5784 a, g dbSNP:773713291
5789 5789 c, t dbSNP:764510212
5792 5792 a, g dbSNP:587778438
5811 5811 a, g dbSNP:761581305
5812 5812 a, c dbSNP:767241359
5815 5815 a, c dbSNP:750250372
5816 5816 a, g dbSNP:372326268
5828 5828 g, t dbSNP:766078065
5843 5843 a, g dbSNP:376830660
5849 5849 a, g dbSNP:147354926
5851 5851 c, t dbSNP:779068766
5852 5852 a, g dbSNP:762659794
5858 5858 a, g dbSNP:758621985
5868 5868 c, t dbSNP:777912357
5878 5878 c, t dbSNP:747217643
5907 5907 a, c dbSNP:7473655
5910 5910 c, t dbSNP:200663107
5911 5911 a, g dbSNP:189962028
5917 5917 c, t dbSNP:746436864
5925 5925 a, g dbSNP:770153551
5927 5927 a, c dbSNP:773945032
5929 5929 c, t dbSNP:751276767
5934 5934 a, g dbSNP:767294730
5955 5955 c, t dbSNP:201797170
5960 5960 a, c dbSNP:752786651
5971 5971 a, g dbSNP:762208323
5983 5983 a, g dbSNP:376753995
5986 5986 c, t dbSNP:758530859
6006 6006 a, g dbSNP:777825769
6013 6013 c, t dbSNP:201608537
6016 6016 c, t dbSNP:757398839
6017 6017 a, g dbSNP:781638379
6063 6063 g, t dbSNP:752697076
6081 6081 c, g dbSNP:762846340
6082 6082 c, t dbSNP:370235478
6114 6114 a, g dbSNP:750926172
6124 6124 c, t dbSNP:780565385
6147 6147 c, t dbSNP:749856104
6150 6150 a, c dbSNP:769232520
6170 6170 a, c dbSNP:777453338
6178 6178 a, g dbSNP:763950825
6193 6193 a, t dbSNP:751668146
6205 6205 a, t dbSNP:200692655
6208 6208 a, c dbSNP:767609800
6212 6212 a, g dbSNP:750648216
6230 6230 a, g dbSNP:372606012
6244 6244 c, t dbSNP:370522888
6245 6245 a, g dbSNP:762612521
6257 6257 a, g dbSNP:755577187
6261 6261 a, g dbSNP:779515761
6272 6272 a, g dbSNP:748668603
6278 6278 a, c dbSNP:756758050
6281 6281 -, agc, agcagcagc dbSNP:775460241
6282 6282 -, agcagc dbSNP:749468415
6282 6282 -, agc dbSNP:769857818
6288 6288 a, g dbSNP:780750191
6292 6292 -, cagcagcaa dbSNP:774751179
6293 6293 -, cagcagcaa dbSNP:762261992
6296 6296 -, cagcaacagcagcaa dbSNP:767827315
6301 6301 a, g dbSNP:745565325
6304 6304 -, cagcaa dbSNP:765873195
6304 6304 a, g dbSNP:769378169
6305 6305 -, cagcaa dbSNP:753370104
6310 6310 a, g dbSNP:775267316
6316 6316 -, cag dbSNP:764842201
6316 6316 a, g dbSNP:749041154
6317 6317 -, cag dbSNP:754533796
6322 6322 -, caacagcaa dbSNP:752416697
6328 6328 -, cagcaa dbSNP:758203078
6329 6329 -, cagcaa dbSNP:777446206
6334 6334 a, g dbSNP:375793297
6340 6340 -, cag, cagcag dbSNP:746921153
6340 6340 a, g dbSNP:774201765
6341 6341 -, cag dbSNP:757160341
6361 6361 -, cag dbSNP:786200970
6368 6368 a, g dbSNP:200820997
6372 6372 -, gca dbSNP:768921894
6373 6373 -, gca dbSNP:763466801
6382 6382 a, g dbSNP:767555481
6391 6391 -, cag dbSNP:786200971
6406 6406 -, cagcaa dbSNP:761195801
6418 6418 -, cag, cagcag dbSNP:777164189
6419 6419 -, cag dbSNP:766775649
6424 6424 a, g dbSNP:756285149
6437 6437 -, cagcaa dbSNP:764789036
6443 6443 -, cagcaacagcagcag dbSNP:752292446
6454 6454 -, gcagcagcaacagca dbSNP:727503869
6454 6454 a, g dbSNP:778103349
6457 6457 a, g dbSNP:749807888
6459 6459 a, c dbSNP:755793630
6463 6463 a, t dbSNP:80213780
6472 6472 a, g dbSNP:757508922
6473 6473 -, agcaacaccag dbSNP:5030620
6481 6481 c, g dbSNP:79912241
6492 6492 -, ccagcagcaaca dbSNP:398124200
6493 6493 c, g dbSNP:779631682
6524 6524 c, g dbSNP:748914486
6559 6559 g, t dbSNP:763374211
6598 6598 c, t dbSNP:764620745
6600 6600 a, g dbSNP:779119355
6625 6625 c, t dbSNP:745748011
6626 6626 a, c dbSNP:771928081
6659 6659 c, t dbSNP:777818556
6660 6660 a, g dbSNP:746914362
6662 6662 c, t dbSNP:771203240
6663 6663 a, t dbSNP:776838069
6669 6669 c, t dbSNP:759851468
6679 6679 a, g dbSNP:769990908
6682 6682 a, c dbSNP:775748389
6688 6688 g, t dbSNP:763326717
6692 6692 a, g dbSNP:369519934
6705 6705 c, t dbSNP:373723581
6713 6713 c, t dbSNP:762299869
6716 6716 -, tct dbSNP:763897867
6856 6856 c, g dbSNP:190398158

Target ORF information:

RefSeq Version XM_005262319
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mediator complex subunit 12 (MED12), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19668
Accession Version NM_005120.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 6534bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mediator of RNA polymerase II transcription subunit 12
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB069668.1, AF117755.1, AF071309.1 and BM662470.1. This sequence is a reference standard in the RefSeqGene project. On Jul 14, 2006 this sequence version replaced gi:4827041. Summary: The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)500..682(+)
Misc Feature(2)695..697(+)
Misc Feature(3)1052..2470(+)
Misc Feature(4)2102..2104(+)
Misc Feature(5)2102..2104(+)
Misc Feature(6)3971..3973(+)
Misc Feature(7)4004..4006(+)
Misc Feature(8)5045..6352(+)
Misc Feature(9)5648..6259(+)
Exon (1)1..298
Gene Synonym:
Exon (2)299..403
Gene Synonym:
Exon (3)404..595
Gene Synonym:
Exon (4)596..752
Gene Synonym:
Exon (5)753..934
Gene Synonym:
Exon (6)935..1045
Gene Synonym:
Exon (7)1046..1300
Gene Synonym:
Exon (8)1301..1447
Gene Synonym:
Exon (9)1448..1547
Gene Synonym:
Exon (10)1548..1684
Gene Synonym:
Exon (11)1685..1816
Gene Synonym:
Exon (12)1817..1943
Gene Synonym:
Exon (13)1944..2173
Gene Synonym:
Exon (14)2174..2254
Gene Synonym:
Exon (15)2255..2425
Gene Synonym:
Exon (16)2426..2570
Gene Synonym:
Exon (17)2571..2621
Gene Synonym:
Exon (18)2622..2740
Gene Synonym:
Exon (19)2741..2884
Gene Synonym:
Exon (20)2885..3048
Gene Synonym:
Exon (21)3049..3180
Gene Synonym:
Exon (22)3181..3408
Gene Synonym:
Exon (23)3409..3553
Gene Synonym:
Exon (24)3554..3674
Gene Synonym:
Exon (25)3675..3776
Gene Synonym:
Exon (26)3777..3890
Gene Synonym:
Exon (27)3891..4066
Gene Synonym:
Exon (28)4067..4246
Gene Synonym:
Exon (29)4247..4318
Gene Synonym:
Exon (30)4319..4452
Gene Synonym:
Exon (31)4453..4614
Gene Synonym:
Exon (32)4615..4726
Gene Synonym:
Exon (33)4727..4816
Gene Synonym:
Exon (34)4817..4926
Gene Synonym:
Exon (35)4927..5062
Gene Synonym:
Exon (36)5063..5224
Gene Synonym:
Exon (37)5225..5599
Gene Synonym:
Exon (38)5600..5750
Gene Synonym:
Exon (39)5751..5947
Gene Synonym:
Exon (40)5948..6025
Gene Synonym:
Exon (41)6026..6243
Gene Synonym:
Exon (42)6244..6466
Gene Synonym:
Exon (43)6467..6607
Gene Synonym:
Exon (44)6608..6689
Gene Synonym:
Exon (45)6690..6969
Gene Synonym:
Position Chain Variation Link
15 15 c, t dbSNP:755120050
73 73 a, g dbSNP:781522411
118 118 c, g dbSNP:748336778
138 138 a, c dbSNP:769876044
153 153 a, t dbSNP:767078113
160 160 c, t dbSNP:773181240
161 161 g, t dbSNP:749937972
164 164 c, t dbSNP:755790492
168 168 a, g dbSNP:766027203
172 172 g, t dbSNP:373552360
188 188 c, g dbSNP:754723833
189 189 a, g dbSNP:778856985
197 197 a, g dbSNP:748008926
219 219 g, t dbSNP:758482018
226 226 c, t dbSNP:376743527
239 239 c, g dbSNP:747105314
245 245 a, c dbSNP:749802630
253 253 a, g dbSNP:781452716
257 257 a, g dbSNP:746256454
259 259 a, g dbSNP:770218060
270 270 -, t dbSNP:778396432
274 274 -, ccctc dbSNP:747588961
275 275 c, g dbSNP:776154055
281 281 a, g dbSNP:371385969
296 296 a, g dbSNP:769202858
302 302 -, gaactgacggccttgaatgtaaaacaaggtttcaat dbSNP:199469678
304 304 a, g dbSNP:746030482
306 306 gc, tgacg dbSNP:199469679
306 306 g, t dbSNP:199469667
308 308 a, t dbSNP:770128096
310 310 -, ggccttgaatgtaaaacaaggtttcaataaccagcctgctgtctc dbSNP:199469681
312 312 -, ccttgaatg dbSNP:199469682
316 316 -, gaatgt dbSNP:199469683
317 317 aatgtaaaacaaggtttcaataaccagcc, tt dbSNP:199469685
317 317 aatgtaaaacaaggttt, ta dbSNP:199469680
317 317 -, aatgtaaaacaaggt dbSNP:199469684
321 321 -, taaaacaaggtttcaataaccagcctgctgtctctggggatg dbSNP:199469687
321 321 -, taaaacaaggtttcaataaccagcctg dbSNP:199469686
322 322 -, aaaacaaggtttcaataaccagcctgctgt dbSNP:199469688
325 325 -, acaaggtttcaataa dbSNP:199469690
325 325 -, acaagg dbSNP:199469689
327 327 a, c dbSNP:199469668
328 328 -, aggtttcaataacca dbSNP:199469692
328 328 -, aggtttcaa dbSNP:199469691
328 328 a, g dbSNP:780634712
329 329 a, c, g, t dbSNP:199469669
330 330 a, c, g, t dbSNP:199469672
332 332 -, ttcaataaccag dbSNP:199469693
336 336 a, g dbSNP:769095144
346 346 a, t dbSNP:774875020
348 348 -, ctgtctctggggatg dbSNP:199469694
367 367 c, t dbSNP:760138274
382 382 c, t dbSNP:770411750
400 400 c, g dbSNP:374555675
429 429 a, t dbSNP:756351657
436 436 a, g dbSNP:779295599
505 505 c, t dbSNP:2471968
520 520 a, c dbSNP:748627661
523 523 a, g dbSNP:772440501
547 547 g, t dbSNP:776188083
560 560 g, t dbSNP:745348543
568 568 a, c dbSNP:769484204
579 579 c, t dbSNP:775072642
580 580 a, g dbSNP:202125318
583 583 a, g dbSNP:201566660
598 598 c, t dbSNP:754050535
622 622 a, g dbSNP:755316164
637 637 a, g dbSNP:35068602
638 638 a, g dbSNP:748453083
647 647 a, g dbSNP:758980420
663 663 a, g dbSNP:778227705
749 749 a, g dbSNP:745402126
767 767 a, g dbSNP:374780236
801 801 c, g, t dbSNP:776982089
812 812 c, t dbSNP:765342782
836 836 a, g dbSNP:200333229
845 845 g, t dbSNP:746326251
852 852 c, t dbSNP:369083173
853 853 a, g dbSNP:751995503
879 879 a, c dbSNP:755634255
907 907 c, g, t dbSNP:34668206
950 950 a, c dbSNP:753413601
996 996 a, g dbSNP:754407926
1009 1009 c, t dbSNP:778635250
1048 1048 c, t dbSNP:750832089
1061 1061 -, g dbSNP:35454896
1071 1071 a, c dbSNP:754533515
1076 1076 c, t dbSNP:764716429
1108 1108 a, g dbSNP:184426039
1133 1133 c, g dbSNP:377403264
1134 1134 c, t dbSNP:777541463
1135 1135 c, g dbSNP:746820232
1143 1143 a, t dbSNP:759516228
1157 1157 a, g, t dbSNP:781192327
1165 1165 c, t dbSNP:370616416
1180 1180 a, g dbSNP:769757456
1181 1181 c, t dbSNP:767398040
1197 1197 c, t dbSNP:775499343
1210 1210 a, c dbSNP:749348331
1214 1214 a, g dbSNP:768889545
1221 1221 c, t dbSNP:774518546
1224 1224 c, t dbSNP:762172777
1227 1227 c, t dbSNP:764107388
1230 1230 a, c dbSNP:773615925
1232 1232 c, t dbSNP:761157306
1237 1237 c, t dbSNP:766874065
1238 1238 a, g dbSNP:752300879
1245 1245 a, t dbSNP:757929935
1265 1265 a, c dbSNP:763867883
1266 1266 a, g dbSNP:751188840
1267 1267 a, g dbSNP:757086557
1275 1275 -, t dbSNP:776803467
1312 1312 a, g dbSNP:780470012
1327 1327 c, t dbSNP:750206494
1330 1330 c, g dbSNP:755897379
1331 1331 a, g dbSNP:779969587
1339 1339 c, t dbSNP:753714929
1342 1342 c, t dbSNP:754893689
1366 1366 a, g dbSNP:374324656
1368 1368 a, c dbSNP:748224921
1369 1369 c, t dbSNP:772236514
1396 1396 a, t dbSNP:754944788
1402 1402 a, g, t dbSNP:368546216
1417 1417 a, g dbSNP:771358421
1422 1422 a, g dbSNP:777293696
1423 1423 a, g dbSNP:760180422
1456 1456 a, c dbSNP:754943978
1463 1463 c, t dbSNP:368913305
1464 1464 a, g dbSNP:752746769
1468 1468 a, g dbSNP:758467351
1476 1476 a, g dbSNP:777865279
1480 1480 a, g dbSNP:747199355
1511 1511 c, t dbSNP:771266719
1512 1512 a, g dbSNP:587778439
1522 1522 c, t dbSNP:371928861
1531 1531 c, t dbSNP:746205041
1543 1543 g, t dbSNP:375202766
1552 1552 -, c dbSNP:36079314
1563 1563 a, g dbSNP:760696164
1569 1569 g, t dbSNP:758423721
1576 1576 a, t dbSNP:764293738
1585 1585 g, t dbSNP:186153976
1597 1597 c, t dbSNP:757594691
1629 1629 c, t dbSNP:75527463
1637 1637 c, g dbSNP:369762911
1687 1687 a, c dbSNP:759335153
1699 1699 c, t dbSNP:765028184
1703 1703 a, g, t dbSNP:370204234
1712 1712 a, t dbSNP:763909049
1718 1718 c, t dbSNP:751739283
1738 1738 c, t dbSNP:757363462
1804 1804 a, g dbSNP:767857185
1813 1813 c, t dbSNP:750614309
1818 1818 a, g dbSNP:774363039
1838 1838 a, g dbSNP:370812643
1858 1858 c, t dbSNP:763388314
1869 1869 c, t dbSNP:750525966
1873 1873 g, t dbSNP:775083099
1881 1881 c, t dbSNP:766485358
1882 1882 c, t dbSNP:754247833
1883 1883 a, g dbSNP:374138730
1894 1894 a, t dbSNP:138984044
1901 1901 g, t dbSNP:188593863
1937 1937 a, g dbSNP:576733100
1944 1944 c, t dbSNP:772155788
1945 1945 a, g dbSNP:773240125
1953 1953 a, g dbSNP:747113641
1981 1981 c, t dbSNP:770861130
1993 1993 a, g dbSNP:776762599
2020 2020 a, t dbSNP:375897167
2048 2048 a, g dbSNP:765417606
2053 2053 c, t dbSNP:775882680
2068 2068 c, t dbSNP:367973899
2082 2082 c, t dbSNP:764617392
2090 2090 c, g dbSNP:778208176
2094 2094 a, g dbSNP:199582086
2101 2101 c, t dbSNP:372068010
2107 2107 c, t dbSNP:765871609
2116 2116 c, t dbSNP:753356456
2122 2122 c, t dbSNP:754725206
2125 2125 c, t dbSNP:778656381
2126 2126 g, t dbSNP:747985405
2128 2128 c, t dbSNP:758195942
2134 2134 a, g dbSNP:376986062
2137 2137 c, g dbSNP:749990040
2142 2142 a, c dbSNP:746981338
2150 2150 -, gca dbSNP:763375719
2151 2151 -, gca dbSNP:752904587
2155 2155 c, t dbSNP:199873151
2160 2160 a, g dbSNP:776618166
2167 2167 a, g dbSNP:201473962
2181 2181 g, t dbSNP:753307215
2183 2183 c, t dbSNP:754495912
2185 2185 c, t dbSNP:777329342
2193 2193 c, g dbSNP:764981858
2201 2201 a, g dbSNP:752335726
2216 2216 a, g dbSNP:753140335
2230 2230 a, g dbSNP:755299794
2243 2243 a, c dbSNP:758113987
2293 2293 c, t dbSNP:749577436
2318 2318 a, g dbSNP:768834535
2329 2329 a, g dbSNP:774625985
2335 2335 c, t dbSNP:377207665
2336 2336 c, t dbSNP:772484830
2342 2342 a, g dbSNP:773699580
2359 2359 a, g dbSNP:759126508
2369 2369 g, t dbSNP:764894174
2370 2370 g, t dbSNP:752254115
2371 2371 c, t dbSNP:187478018
2377 2377 c, t dbSNP:763782632
2378 2378 a, g, t dbSNP:192331892
2380 2380 c, g dbSNP:780996949
2393 2393 a, g dbSNP:750304793
2402 2402 a, g dbSNP:756039521
2419 2419 c, t dbSNP:370195616
2457 2457 a, g dbSNP:761529397
2458 2458 a, g dbSNP:61752446
2464 2464 c, t dbSNP:750186446
2467 2467 a, g dbSNP:769827044
2470 2470 a, g dbSNP:756091104
2473 2473 c, t dbSNP:779918145
2479 2479 a, g dbSNP:753948557
2504 2504 a, c dbSNP:755014778
2505 2505 a, g dbSNP:779012737
2507 2507 a, g dbSNP:199860580
2510 2510 a, g dbSNP:749158402
2511 2511 c, t dbSNP:778325168
2522 2522 a, g dbSNP:747358083
2544 2544 a, t dbSNP:771591691
2550 2550 a, g dbSNP:777238737
2551 2551 c, t dbSNP:748753383
2608 2608 c, g dbSNP:756908016
2612 2612 a, c dbSNP:747413033
2615 2615 g, t dbSNP:757629606
2628 2628 a, c dbSNP:752847512
2643 2643 a, g dbSNP:762905361
2649 2649 a, g dbSNP:749801457
2654 2654 c, t dbSNP:751774081
2664 2664 a, c dbSNP:757541657
2670 2670 c, t dbSNP:761085895
2683 2683 c, t dbSNP:781733323
2733 2733 c, t dbSNP:750730080
2767 2767 c, t dbSNP:746727639
2770 2770 a, g dbSNP:368090262
2773 2773 c, t dbSNP:776541226
2788 2788 a, g dbSNP:759205860
2803 2803 c, t dbSNP:769804888
2812 2812 a, g dbSNP:372344160
2818 2818 g, t dbSNP:763140070
2830 2830 c, t dbSNP:751190759
2879 2879 a, g dbSNP:751687978
2920 2920 a, g dbSNP:757010467
2926 2926 c, t dbSNP:372816429
2928 2928 a, g dbSNP:763052446
2947 2947 a, c dbSNP:768686458
2953 2953 c, t dbSNP:774593737
2958 2958 c, t dbSNP:778697440
2961 2961 a, g dbSNP:767783777
2977 2977 c, t dbSNP:375971110
2978 2978 g, t dbSNP:760933452
2992 2992 a, g dbSNP:560621486
3010 3010 c, t dbSNP:766716404
3019 3019 c, t dbSNP:754167644
3061 3061 c, t dbSNP:748251157
3062 3062 a, g dbSNP:772101551
3072 3072 a, g dbSNP:397515554
3073 3073 a, g dbSNP:773333573
3078 3078 a, g dbSNP:760844083
3080 3080 c, t dbSNP:80338758
3081 3081 a, g dbSNP:766598254
3085 3085 c, t dbSNP:34761462
3103 3103 a, g dbSNP:369276718
3105 3105 a, g dbSNP:765741173
3121 3121 c, t dbSNP:552568236
3136 3136 c, t dbSNP:758935114
3182 3182 a, g dbSNP:771092011
3187 3187 c, t dbSNP:776771030
3188 3188 c, t dbSNP:2503120
3190 3190 c, t dbSNP:751044891
3208 3208 a, c, g dbSNP:375493995
3211 3211 c, t dbSNP:775829185
3214 3214 c, t dbSNP:370685994
3219 3219 a, g dbSNP:80338759
3232 3232 a, g dbSNP:764642821
3253 3253 a, c dbSNP:749926584
3268 3268 c, t dbSNP:753751305
3309 3309 c, t dbSNP:377078179
3310 3310 a, g dbSNP:185658730
3317 3317 a, g dbSNP:753602358
3337 3337 a, c dbSNP:754673791
3384 3384 g, t dbSNP:778887337
3390 3390 a, g dbSNP:752512200
3400 3400 a, t dbSNP:758288118
3401 3401 c, t dbSNP:777724452
3403 3403 c, t dbSNP:201807437
3404 3404 a, g dbSNP:770988288
3421 3421 c, t dbSNP:374156594
3422 3422 g, t dbSNP:41303701
3532 3532 c, t dbSNP:781289776
3556 3556 c, t dbSNP:773679943
3580 3580 g, t dbSNP:369946933
3607 3607 c, t dbSNP:756127182
3625 3625 c, t dbSNP:779981418
3642 3642 a, g dbSNP:387907360
3682 3682 c, t dbSNP:774227521
3692 3692 c, t dbSNP:387907361
3696 3696 a, t dbSNP:2503121
3713 3713 a, c dbSNP:761559213
3718 3718 c, t dbSNP:767449566
3722 3722 a, g dbSNP:750415430
3748 3748 a, g dbSNP:756037504
3756 3756 a, g dbSNP:766516518
3762 3762 g, t dbSNP:750380399
3763 3763 c, t dbSNP:755250008
3770 3770 a, g dbSNP:778961820
3784 3784 g, t dbSNP:761612336
3808 3808 c, t dbSNP:751742488
3829 3829 c, t dbSNP:748892629
3832 3832 a, c dbSNP:755212046
3844 3844 c, t dbSNP:760651439
3898 3898 a, g dbSNP:184162709
3935 3935 a, g dbSNP:770904571
3968 3968 a, g dbSNP:776373565
3984 3984 a, g dbSNP:202120461
3988 3988 c, g dbSNP:765481362
3991 3991 g, t dbSNP:752795407
3994 3994 c, t dbSNP:763317363
3996 3996 a, g dbSNP:587780391
3999 3999 a, g dbSNP:752008407
4007 4007 c, g dbSNP:757500838
4008 4008 c, t dbSNP:781730846
4015 4015 a, c dbSNP:750953189
4042 4042 c, t dbSNP:369268877
4043 4043 a, g dbSNP:398124197
4048 4048 g, t dbSNP:377409217
4060 4060 c, t dbSNP:747604195
4063 4063 a, g dbSNP:370431544
4075 4075 a, t dbSNP:368144948
4099 4099 a, g dbSNP:763090662
4111 4111 c, t dbSNP:762887632
4117 4117 c, t dbSNP:372389957
4129 4129 a, c dbSNP:5030619
4141 4141 c, t dbSNP:3810670
4150 4150 a, g dbSNP:755194632
4156 4156 a, c dbSNP:368549870
4184 4184 c, g dbSNP:766827969
4198 4198 c, t dbSNP:752208223
4200 4200 a, g dbSNP:372238830
4213 4213 a, c dbSNP:775331048
4215 4215 c, t dbSNP:757845624
4220 4220 c, t dbSNP:777250096
4221 4221 a, g dbSNP:746705248
4226 4226 c, t dbSNP:762692180
4227 4227 a, g dbSNP:201044355
4230 4230 c, t dbSNP:780900807
4235 4235 c, t dbSNP:745627308
4240 4240 c, t dbSNP:769884032
4243 4243 c, t dbSNP:367674919
4291 4291 a, g dbSNP:756882570
4310 4310 c, t dbSNP:587778437
4314 4314 a, g dbSNP:202009066
4316 4316 a, g dbSNP:755920101
4353 4353 c, t dbSNP:771349148
4360 4360 c, t dbSNP:776947543
4374 4374 a, g dbSNP:1139013
4378 4378 a, c dbSNP:376058351
4390 4390 g, t dbSNP:765727984
4401 4401 c, g dbSNP:774091279
4417 4417 c, t dbSNP:751061930
4431 4431 a, g dbSNP:761320689
4437 4437 a, c dbSNP:759532414
4459 4459 a, g dbSNP:34299769
4463 4463 c, t dbSNP:776011599
4498 4498 c, t dbSNP:763359998
4525 4525 c, t dbSNP:767123637
4544 4544 c, g dbSNP:749925159
4552 4552 a, g dbSNP:760423553
4558 4558 a, g dbSNP:766087487
4562 4562 c, g dbSNP:761728689
4579 4579 c, t dbSNP:377119772
4624 4624 a, g dbSNP:370211858
4648 4648 a, g dbSNP:769025272
4660 4660 a, g dbSNP:772877700
4663 4663 c, t dbSNP:760194613
4669 4669 a, g dbSNP:766138859
4672 4672 a, g dbSNP:776476529
4685 4685 c, t dbSNP:759105512
4687 4687 c, t dbSNP:531754497
4705 4705 c, t dbSNP:754662384
4734 4734 a, g dbSNP:753169363
4776 4776 a, g dbSNP:774937112
4783 4783 -, atgc dbSNP:768035778
4819 4819 a, g dbSNP:756385578
4834 4834 c, t dbSNP:151316557
4864 4864 a, g dbSNP:375001801
4876 4876 g, t dbSNP:755449496
4879 4879 c, t dbSNP:779412664
4960 4960 c, t dbSNP:369563649
4961 4961 a, g dbSNP:767396596
4963 4963 a, g, t dbSNP:750517588
4976 4976 a, g dbSNP:766467215
4984 4984 c, t dbSNP:754072422
5005 5005 a, g dbSNP:755218771
5026 5026 c, t dbSNP:779466860
5030 5030 c, g dbSNP:727503868
5039 5039 a, g dbSNP:374216233
5049 5049 c, t dbSNP:753061449
5050 5050 a, g dbSNP:377210068
5069 5069 c, t dbSNP:766406937
5078 5078 c, t dbSNP:776748297
5079 5079 a, g dbSNP:759857680
5119 5119 a, t dbSNP:765515717
5140 5140 c, t dbSNP:753148075
5149 5149 a, g dbSNP:756839501
5170 5170 c, t dbSNP:398124198
5173 5173 c, t dbSNP:376179450
5188 5188 c, g dbSNP:752074440
5203 5203 c, t dbSNP:370610104
5204 5204 a, g dbSNP:779481901
5287 5287 a, g dbSNP:202167558
5302 5302 c, t dbSNP:762801267
5308 5308 c, t dbSNP:781134410
5323 5323 a, c dbSNP:775912778
5333 5333 c, t dbSNP:763233945
5337 5337 a, g dbSNP:374390933
5338 5338 a, c dbSNP:751934349
5356 5356 a, g dbSNP:757730166
5365 5365 a, g dbSNP:768033414
5384 5384 a, c dbSNP:387907362
5389 5389 c, g dbSNP:753355369
5397 5397 a, g dbSNP:754537871
5402 5402 c, t dbSNP:778386823
5404 5404 c, t dbSNP:747836622
5423 5423 c, t dbSNP:758043683
5428 5428 a, g dbSNP:777450271
5430 5430 c, t dbSNP:746777806
5447 5447 a, g dbSNP:368542728
5451 5451 a, c, t dbSNP:748064846
5452 5452 a, g dbSNP:770067057
5461 5461 c, t dbSNP:771798591
5466 5466 c, t dbSNP:201843482
5494 5494 c, g dbSNP:763136667
5509 5509 a, c dbSNP:768875937
5514 5514 c, t dbSNP:774613786
5515 5515 a, g dbSNP:398124199
5526 5526 c, t dbSNP:767850812
5542 5542 a, g dbSNP:750991975
5575 5575 c, t dbSNP:761137877
5604 5604 a, g dbSNP:375152466
5616 5616 c, t dbSNP:368093012
5617 5617 a, g dbSNP:770957462
5621 5621 c, t dbSNP:372271659
5626 5626 c, t dbSNP:772462354
5641 5641 c, g dbSNP:773540568
5652 5652 c, t dbSNP:761189421
5684 5684 a, g dbSNP:766830015
5687 5687 a, c dbSNP:752152022
5689 5689 a, c, g dbSNP:762466624
5693 5693 c, t dbSNP:751294090
5709 5709 c, g dbSNP:200328506
5726 5726 a, c dbSNP:781184955
5732 5732 -, a dbSNP:758232218
5733 5733 a, c dbSNP:750197108
5734 5734 c, t dbSNP:34784349
5759 5759 c, t dbSNP:747305574
5760 5760 a, g dbSNP:759125296
5767 5767 c, t dbSNP:777253437
5774 5774 c, t dbSNP:759956340
5775 5775 a, g dbSNP:763700798
5783 5783 c, t dbSNP:200279192
5784 5784 a, g dbSNP:773713291
5789 5789 c, t dbSNP:764510212
5792 5792 a, g dbSNP:587778438
5811 5811 a, g dbSNP:761581305
5812 5812 a, c dbSNP:767241359
5815 5815 a, c dbSNP:750250372
5816 5816 a, g dbSNP:372326268
5828 5828 g, t dbSNP:766078065
5843 5843 a, g dbSNP:376830660
5849 5849 a, g dbSNP:147354926
5851 5851 c, t dbSNP:779068766
5852 5852 a, g dbSNP:762659794
5858 5858 a, g dbSNP:758621985
5868 5868 c, t dbSNP:777912357
5878 5878 c, t dbSNP:747217643
5907 5907 a, c dbSNP:7473655
5910 5910 c, t dbSNP:200663107
5911 5911 a, g dbSNP:189962028
5917 5917 c, t dbSNP:746436864
5925 5925 a, g dbSNP:770153551
5927 5927 a, c dbSNP:773945032
5929 5929 c, t dbSNP:751276767
5934 5934 a, g dbSNP:767294730
5951 5951 a, c dbSNP:752786651
5962 5962 a, g dbSNP:762208323
5974 5974 a, g dbSNP:376753995
5977 5977 c, t dbSNP:758530859
5997 5997 a, g dbSNP:777825769
6004 6004 c, t dbSNP:201608537
6007 6007 c, t dbSNP:757398839
6008 6008 a, g dbSNP:781638379
6054 6054 g, t dbSNP:752697076
6072 6072 c, g dbSNP:762846340
6073 6073 c, t dbSNP:370235478
6102 6102 a, c dbSNP:751590721
6104 6104 c, t dbSNP:757532503
6131 6131 c, t dbSNP:781207905
6147 6147 c, t dbSNP:374901524
6180 6180 a, g dbSNP:750926172
6190 6190 c, t dbSNP:780565385
6213 6213 c, t dbSNP:749856104
6216 6216 a, c dbSNP:769232520
6236 6236 a, c dbSNP:777453338
6244 6244 a, g dbSNP:763950825
6259 6259 a, t dbSNP:751668146
6271 6271 a, t dbSNP:200692655
6274 6274 a, c dbSNP:767609800
6278 6278 a, g dbSNP:750648216
6296 6296 a, g dbSNP:372606012
6310 6310 c, t dbSNP:370522888
6311 6311 a, g dbSNP:762612521
6323 6323 a, g dbSNP:755577187
6327 6327 a, g dbSNP:779515761
6338 6338 a, g dbSNP:748668603
6344 6344 a, c dbSNP:756758050
6347 6347 -, agc, agcagcagc dbSNP:775460241
6348 6348 -, agcagc dbSNP:749468415
6348 6348 -, agc dbSNP:769857818
6354 6354 a, g dbSNP:780750191
6358 6358 -, cagcagcaa dbSNP:774751179
6359 6359 -, cagcagcaa dbSNP:762261992
6362 6362 -, cagcaacagcagcaa dbSNP:767827315
6367 6367 a, g dbSNP:745565325
6370 6370 -, cagcaa dbSNP:765873195
6370 6370 a, g dbSNP:769378169
6371 6371 -, cagcaa dbSNP:753370104
6376 6376 a, g dbSNP:775267316
6382 6382 -, cag dbSNP:764842201
6382 6382 a, g dbSNP:749041154
6383 6383 -, cag dbSNP:754533796
6388 6388 -, caacagcaa dbSNP:752416697
6394 6394 -, cagcaa dbSNP:758203078
6395 6395 -, cagcaa dbSNP:777446206
6400 6400 a, g dbSNP:375793297
6406 6406 -, cag, cagcag dbSNP:746921153
6406 6406 a, g dbSNP:774201765
6407 6407 -, cag dbSNP:757160341
6427 6427 -, cag dbSNP:786200970
6434 6434 a, g dbSNP:200820997
6438 6438 -, gca dbSNP:768921894
6439 6439 -, gca dbSNP:763466801
6448 6448 a, g dbSNP:767555481
6457 6457 -, cag dbSNP:786200971
6472 6472 -, cagcaa dbSNP:761195801
6484 6484 -, cag, cagcag dbSNP:777164189
6485 6485 -, cag dbSNP:766775649
6490 6490 a, g dbSNP:756285149
6503 6503 -, cagcaa dbSNP:764789036
6509 6509 -, cagcaacagcagcag dbSNP:752292446
6520 6520 -, gcagcagcaacagca dbSNP:727503869
6520 6520 a, g dbSNP:778103349
6523 6523 a, g dbSNP:749807888
6525 6525 a, c dbSNP:755793630
6529 6529 a, t dbSNP:80213780
6538 6538 a, g dbSNP:757508922
6539 6539 -, agcaacaccag dbSNP:5030620
6547 6547 c, g dbSNP:79912241
6558 6558 -, ccagcagcaaca dbSNP:398124200
6559 6559 c, g dbSNP:779631682
6590 6590 c, g dbSNP:748914486
6625 6625 g, t dbSNP:763374211
6664 6664 c, t dbSNP:764620745
6666 6666 a, g dbSNP:779119355
6691 6691 c, t dbSNP:745748011
6692 6692 a, c dbSNP:771928081
6725 6725 c, t dbSNP:777818556
6726 6726 a, g dbSNP:746914362
6728 6728 c, t dbSNP:771203240
6729 6729 a, t dbSNP:776838069
6735 6735 c, t dbSNP:759851468
6745 6745 a, g dbSNP:769990908
6748 6748 a, c dbSNP:775748389
6754 6754 g, t dbSNP:763326717
6758 6758 a, g dbSNP:369519934
6771 6771 c, t dbSNP:373723581
6779 6779 c, t dbSNP:762299869
6782 6782 -, tct dbSNP:763897867
6922 6922 c, g dbSNP:190398158

Target ORF information:

RefSeq Version NM_005120
Organism Homo sapiens (human)
Definition Homo sapiens mediator complex subunit 12 (MED12), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
