Email to GenScript

Pcdh15 protocadherin 15 [Mus musculus (house mouse)]

Gene Symbol Pcdh15
Entrez Gene ID 11994
Full Name protocadherin 15
Synonyms BB078305, ENSMUSG00000046980, Gm9815, Ush1f, av, nmf19
General protein information
Preferred Names
Ames waltzer
protocadherin 15 CD2
protocadherin 15 CD3 isoform
Gene Type protein-coding
Organism Mus musculus (house mouse)


10 B5.3|10 37.43 cM

Summary lac of sum
Disorder MIM:

Disorder Html:

Alleles of this type are documented at Mouse Genome Informatics  (MGI)
  • Spontaneous (6)  1 citation
  • Transgenic (random, gene disruption) (1)  1 citation
  • Chemically induced (ENU) (2) 

The following Pcdh15 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the Pcdh15 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OMu13166 XM_006513143 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu44154 XM_006513148 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu44155 XM_006513149 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu44156 XM_006513151 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu67190 XM_011243320 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu44160 XM_006513155 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu44161 XM_006513156 PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13166 NM_023115 Mus musculus protocadherin 15 (Pcdh15), transcript variant A, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13229 NM_001142735 Mus musculus protocadherin 15 (Pcdh15), transcript variant B, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13182 NM_001142736 Mus musculus protocadherin 15 (Pcdh15), transcript variant C, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13215 NM_001142737 Mus musculus protocadherin 15 (Pcdh15), transcript variant D, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13179 NM_001142738 Mus musculus protocadherin 15 (Pcdh15), transcript variant F, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13216 NM_001142739 Mus musculus protocadherin 15 (Pcdh15), transcript variant G, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13244 NM_001142740 Mus musculus protocadherin 15 (Pcdh15), transcript variant E, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13142 NM_001142741 Mus musculus protocadherin 15 (Pcdh15), transcript variant H, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13240 NM_001142742 Mus musculus protocadherin 15 (Pcdh15), transcript variant I, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13214 NM_001142743 Mus musculus protocadherin 15 (Pcdh15), transcript variant J, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13141 NM_001142746 Mus musculus protocadherin 15 (Pcdh15), transcript variant K, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OMu13242 NM_001142747 Mus musculus protocadherin 15 (Pcdh15), transcript variant M, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu13222 NM_001142748 Mus musculus protocadherin 15 (Pcdh15), transcript variant N, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu13136 NM_001142760 Mus musculus protocadherin 15 (Pcdh15), transcript variant L, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OMu13166
Accession Version XM_006513143.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5832bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966504. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513143
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu44154
Accession Version XM_006513148.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5826bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966515. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513148
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu44155
Accession Version XM_006513149.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5823bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966517. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513149
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu44156
Accession Version XM_006513151.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5817bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966521. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513151
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu67190
Accession Version XM_011243320.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5493bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X5
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1890(+)
Misc Feature(6)1570..1887(+)
Misc Feature(7)1912..2202(+)
Misc Feature(8)1933..2202(+)
Misc Feature(9)2236..2514(+)
Misc Feature(10)2254..2511(+)
Misc Feature(11)2539..2820(+)
Misc Feature(12)2560..2817(+)
Misc Feature(13)2842..3138(+)
Misc Feature(14)2863..3138(+)
Misc Feature(15)3163..3456(+)
Misc Feature(16)3184..3366(+)
Misc Feature(17)3508..3795(+)
Misc Feature(18)3514..3792(+)
Misc Feature(19)3820..4104(+)
Misc Feature(20)3838..4014(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_011243320
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu44160
Accession Version XM_006513155.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5043bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X6
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966529. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513155
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X6, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu44161
Accession Version XM_006513156.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5034bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_039500.8) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568966531. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)805..1074(+)
Misc Feature(2)826..1023(+)
Misc Feature(3)1195..1521(+)
Misc Feature(4)1216..1521(+)
Misc Feature(5)1549..1869(+)
Misc Feature(6)1570..1866(+)
Misc Feature(7)1891..2181(+)
Misc Feature(8)1912..2181(+)
Misc Feature(9)2215..2493(+)
Misc Feature(10)2233..2490(+)
Misc Feature(11)2518..2799(+)
Misc Feature(12)2539..2796(+)
Misc Feature(13)2821..3117(+)
Misc Feature(14)2842..3117(+)
Misc Feature(15)3142..3435(+)
Misc Feature(16)3163..3345(+)
Misc Feature(17)3487..3774(+)
Misc Feature(18)3493..3771(+)
Misc Feature(19)3799..4083(+)
Misc Feature(20)3817..3993(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006513156
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13166
Accession Version NM_023115.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5832bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-1 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, AF281899.1, AC121142.12 and AC153858.3. On Dec 19, 2008 this sequence version replaced gi:111074521. Transcript Variant: This variant (A) encodes isoform CD1-1, also known as protocadherin-15-CD1 isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF281899.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164131, SAMN01164132 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)887..1156(+)
Misc Feature(3)908..1105(+)
Misc Feature(4)1277..1603(+)
Misc Feature(5)1298..1603(+)
Misc Feature(6)1631..1951(+)
Misc Feature(7)1652..1948(+)
Misc Feature(8)1973..2263(+)
Misc Feature(9)1994..2263(+)
Misc Feature(10)2297..2575(+)
Misc Feature(11)2315..2572(+)
Misc Feature(12)2600..2881(+)
Misc Feature(13)2621..2878(+)
Misc Feature(14)2903..3199(+)
Misc Feature(15)2924..3199(+)
Misc Feature(16)3224..3517(+)
Misc Feature(17)3245..3427(+)
Misc Feature(18)3569..3856(+)
Misc Feature(19)3575..3853(+)
Misc Feature(20)3881..4165(+)
Misc Feature(21)3899..4075(+)
Misc Feature(22)4565..4627(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..527
Gene Synonym:
Exon (4)528..593
Gene Synonym:
Exon (5)594..754
Gene Synonym:
Exon (6)755..910
Gene Synonym:
Exon (7)911..1030
Gene Synonym:
Exon (8)1031..1141
Gene Synonym:
Exon (9)1142..1312
Gene Synonym:
Exon (10)1313..1421
Gene Synonym:
Exon (11)1422..1534
Gene Synonym:
Exon (12)1535..1741
Gene Synonym:
Exon (13)1742..1876
Gene Synonym:
Exon (14)1877..2026
Gene Synonym:
Exon (15)2027..2220
Gene Synonym:
Exon (16)2221..2353
Gene Synonym:
Exon (17)2354..2433
Gene Synonym:
Exon (18)2434..2527
Gene Synonym:
Exon (19)2528..2656
Gene Synonym:
Exon (20)2657..2962
Gene Synonym:
Exon (21)2963..3187
Gene Synonym:
Exon (22)3188..3304
Gene Synonym:
Exon (23)3305..3445
Gene Synonym:
Exon (24)3446..3558
Gene Synonym:
Exon (25)3559..3668
Gene Synonym:
Exon (26)3669..3809
Gene Synonym:
Exon (27)3810..3937
Gene Synonym:
Exon (28)3938..4153
Gene Synonym:
Exon (29)4154..4242
Gene Synonym:
Exon (30)4243..4419
Gene Synonym:
Exon (31)4420..4638
Gene Synonym:
Exon (32)4639..4647
Gene Synonym:
Exon (33)4648..4803
Gene Synonym:
Exon (34)4804..4809
Gene Synonym:
Exon (35)4810..9064
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
592 592 c, t dbSNP:46087908
610 610 c, t dbSNP:50061218
901 901 c, t dbSNP:244689568
1063 1063 a, g dbSNP:49962731
1138 1138 a, g dbSNP:256412847
1237 1237 c, t dbSNP:47222354
1672 1672 c, t dbSNP:232979244
1709 1709 a, c dbSNP:244779234
1786 1786 a, g dbSNP:234971152
1792 1792 c, t dbSNP:253848918
2017 2017 c, t dbSNP:244151985
2041 2041 c, t dbSNP:258930706
2215 2215 a, g dbSNP:229047978
2254 2254 a, t dbSNP:225553757
2374 2374 c, t dbSNP:46546428
2725 2725 c, t dbSNP:47972196
2740 2740 c, t dbSNP:236565609
2827 2827 c, t dbSNP:254494033
2938 2938 c, t dbSNP:212906806
3013 3013 a, g dbSNP:261949476
3064 3064 c, t dbSNP:228122452
3094 3094 c, g dbSNP:50379170
3148 3148 g, t dbSNP:265026670
3172 3172 c, g dbSNP:47892298
3208 3208 a, g dbSNP:265542592
3469 3469 c, t dbSNP:51119205
3472 3472 c, t dbSNP:48157089
3592 3592 a, g dbSNP:51765115
3625 3625 c, t dbSNP:50449153
3706 3706 c, t dbSNP:232407113
3904 3904 c, t dbSNP:48056426
3985 3985 c, t dbSNP:251516372
4255 4255 c, t dbSNP:240966622
4261 4261 g, t dbSNP:254718603
4747 4747 a, c dbSNP:221348700
4806 4806 a, g dbSNP:231369012
4889 4889 a, c dbSNP:247089690
5119 5119 a, g dbSNP:264788330
5170 5170 a, g dbSNP:227262542
5253 5253 a, g dbSNP:255811802
5254 5254 a, g, t dbSNP:213998609
5262 5262 a, c dbSNP:227876075
5270 5270 a, g dbSNP:245533364
5275 5275 c, t dbSNP:217497061
5503 5503 c, t dbSNP:47551679
5530 5530 c, t dbSNP:256453274
5561 5561 a, g dbSNP:212390023
5581 5581 a, t dbSNP:237083139
5656 5656 c, t dbSNP:251246553
5682 5682 c, t dbSNP:219567688
5767 5767 a, c dbSNP:241213664
5884 5884 a, g dbSNP:52603492
5908 5908 c, t dbSNP:226556489
5909 5909 c, t dbSNP:249907062
5912 5912 a, g dbSNP:261832188
5929 5929 c, t dbSNP:219765160
5946 5946 a, g dbSNP:238081103
6010 6010 c, t dbSNP:255034472
6250 6250 a, g dbSNP:227933915
6309 6309 c, t dbSNP:245588156
6429 6429 a, c dbSNP:266228669
6556 6556 a, g dbSNP:233361628
6618 6618 a, c dbSNP:254480234
6718 6718 g, t dbSNP:212201657
6732 6732 a, g dbSNP:239156281
6749 6749 a, c dbSNP:245083199
6751 6751 g, t dbSNP:215975117
6766 6766 g, t dbSNP:234797948
6773 6773 c, t dbSNP:252792666
6779 6779 a, g dbSNP:227063645
6814 6814 a, c dbSNP:239365701
6833 6833 c, t dbSNP:261425566
6868 6868 c, t dbSNP:220116863
6889 6889 a, g dbSNP:50611886
6904 6904 c, t dbSNP:255096925
6959 6959 a, g dbSNP:49178684
6962 6962 a, g dbSNP:221174491
6978 6978 c, t dbSNP:239644238
6985 6985 -, t dbSNP:243692372
7019 7019 c, t dbSNP:264610476
7031 7031 g, t dbSNP:234430526
7034 7034 a, c dbSNP:250188765
7035 7035 a, g dbSNP:264715900
7039 7039 -, a dbSNP:240115926
7071 7071 c, t dbSNP:226761283
7093 7093 a, c dbSNP:245139138
7211 7211 a, c dbSNP:216021261
7233 7233 c, g dbSNP:234024166
7269 7269 -, tgagctcaatggat dbSNP:261119203
7280 7280 a, g dbSNP:260225959
7285 7285 a, g dbSNP:219190842
7293 7293 a, g dbSNP:242011563
7309 7309 c, t dbSNP:256183140
7315 7315 a, g dbSNP:219920607
7337 7337 a, c dbSNP:45726787
7373 7373 a, g dbSNP:231973326
7378 7378 a, g dbSNP:249465171
7409 7409 a, t dbSNP:221232333
7484 7484 a, g dbSNP:238869723
7527 7527 a, t dbSNP:264019798
7534 7534 a, g dbSNP:226209256
7593 7593 a, t dbSNP:245453066
7702 7702 a, t dbSNP:261694370
7783 7783 c, t dbSNP:226812140
7787 7787 c, t dbSNP:239137103
7792 7792 c, g dbSNP:260098002
7806 7806 c, t dbSNP:227494619
7835 7835 -, t dbSNP:244582154
7837 7837 g, t dbSNP:254791750
7838 7838 a, t dbSNP:218175371
7891 7891 c, t dbSNP:233118706
7905 7905 a, t dbSNP:254171875
7916 7916 a, c dbSNP:211980447
7988 7988 -, c dbSNP:214920647
8037 8037 a, g dbSNP:232030870
8039 8039 a, g dbSNP:249527418
8040 8040 c, t dbSNP:50224043
8111 8111 g, t dbSNP:215734464
8130 8130 a, g dbSNP:232624402
8217 8217 c, t dbSNP:260664149
8243 8243 a, g dbSNP:48874784
8268 8268 c, t dbSNP:242684744
8270 8270 c, t dbSNP:261199956
8280 8280 a, g dbSNP:220591986
8301 8301 c, t dbSNP:239198824
8341 8341 c, t dbSNP:260156970
8396 8396 a, g dbSNP:227563946
8436 8436 -, gtgtgt dbSNP:233316663
8437 8437 -, ta dbSNP:223821384
8515 8515 c, t dbSNP:251583854
8565 8565 a, g dbSNP:264082494
8575 8575 c, t dbSNP:229309169
8593 8593 a, g dbSNP:249158054
8614 8614 a, g dbSNP:212046557
8621 8621 a, g dbSNP:226030260
8637 8637 a, t dbSNP:243722116
8655 8655 a, g dbSNP:215796231
8664 8664 c, t dbSNP:237679859
8693 8693 a, g dbSNP:264090722
8704 8704 c, t dbSNP:217624350
8719 8719 g, t dbSNP:236844958
8770 8770 -, ccccagccctaaaattattttgctg dbSNP:228556907
8873 8873 a, c dbSNP:249253923
8881 8881 c, g dbSNP:220644848
8884 8884 a, g dbSNP:232237955
8936 8936 c, g dbSNP:253885520
8997 8997 a, g dbSNP:221255954
8998 8998 a, g dbSNP:45637247
9011 9011 c, t dbSNP:248568766
9029 9029 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_023115
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant A, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13229
Accession Version NM_001142735.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5817bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-2 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354396.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (B) lacks an alternate in-frame exon in the 5' coding region, compared to variant A. The resulting isoform (CD1-2), also known as protocadherin-15-CD1 isoform 2, lacks a 5-aa segment near the N-terminus, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354396.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164131, SAMN01164132 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)872..1141(+)
Misc Feature(3)893..1090(+)
Misc Feature(4)1262..1588(+)
Misc Feature(5)1283..1588(+)
Misc Feature(6)1616..1936(+)
Misc Feature(7)1637..1933(+)
Misc Feature(8)1958..2248(+)
Misc Feature(9)1979..2248(+)
Misc Feature(10)2282..2560(+)
Misc Feature(11)2300..2557(+)
Misc Feature(12)2585..2866(+)
Misc Feature(13)2606..2863(+)
Misc Feature(14)2888..3184(+)
Misc Feature(15)2909..3184(+)
Misc Feature(16)3209..3502(+)
Misc Feature(17)3230..3412(+)
Misc Feature(18)3554..3841(+)
Misc Feature(19)3560..3838(+)
Misc Feature(20)3866..4150(+)
Misc Feature(21)3884..4060(+)
Misc Feature(22)4550..4612(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..578
Gene Synonym:
Exon (4)579..739
Gene Synonym:
Exon (5)740..895
Gene Synonym:
Exon (6)896..1015
Gene Synonym:
Exon (7)1016..1126
Gene Synonym:
Exon (8)1127..1297
Gene Synonym:
Exon (9)1298..1406
Gene Synonym:
Exon (10)1407..1519
Gene Synonym:
Exon (11)1520..1726
Gene Synonym:
Exon (12)1727..1861
Gene Synonym:
Exon (13)1862..2011
Gene Synonym:
Exon (14)2012..2205
Gene Synonym:
Exon (15)2206..2338
Gene Synonym:
Exon (16)2339..2418
Gene Synonym:
Exon (17)2419..2512
Gene Synonym:
Exon (18)2513..2641
Gene Synonym:
Exon (19)2642..2947
Gene Synonym:
Exon (20)2948..3172
Gene Synonym:
Exon (21)3173..3289
Gene Synonym:
Exon (22)3290..3430
Gene Synonym:
Exon (23)3431..3543
Gene Synonym:
Exon (24)3544..3653
Gene Synonym:
Exon (25)3654..3794
Gene Synonym:
Exon (26)3795..3922
Gene Synonym:
Exon (27)3923..4138
Gene Synonym:
Exon (28)4139..4227
Gene Synonym:
Exon (29)4228..4404
Gene Synonym:
Exon (30)4405..4623
Gene Synonym:
Exon (31)4624..4632
Gene Synonym:
Exon (32)4633..4788
Gene Synonym:
Exon (33)4789..4794
Gene Synonym:
Exon (34)4795..9049
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
577 577 c, t dbSNP:46087908
595 595 c, t dbSNP:50061218
886 886 c, t dbSNP:244689568
1048 1048 a, g dbSNP:49962731
1123 1123 a, g dbSNP:256412847
1222 1222 c, t dbSNP:47222354
1657 1657 c, t dbSNP:232979244
1694 1694 a, c dbSNP:244779234
1771 1771 a, g dbSNP:234971152
1777 1777 c, t dbSNP:253848918
2002 2002 c, t dbSNP:244151985
2026 2026 c, t dbSNP:258930706
2200 2200 a, g dbSNP:229047978
2239 2239 a, t dbSNP:225553757
2359 2359 c, t dbSNP:46546428
2710 2710 c, t dbSNP:47972196
2725 2725 c, t dbSNP:236565609
2812 2812 c, t dbSNP:254494033
2923 2923 c, t dbSNP:212906806
2998 2998 a, g dbSNP:261949476
3049 3049 c, t dbSNP:228122452
3079 3079 c, g dbSNP:50379170
3133 3133 g, t dbSNP:265026670
3157 3157 c, g dbSNP:47892298
3193 3193 a, g dbSNP:265542592
3454 3454 c, t dbSNP:51119205
3457 3457 c, t dbSNP:48157089
3577 3577 a, g dbSNP:51765115
3610 3610 c, t dbSNP:50449153
3691 3691 c, t dbSNP:232407113
3889 3889 c, t dbSNP:48056426
3970 3970 c, t dbSNP:251516372
4240 4240 c, t dbSNP:240966622
4246 4246 g, t dbSNP:254718603
4732 4732 a, c dbSNP:221348700
4791 4791 a, g dbSNP:231369012
4874 4874 a, c dbSNP:247089690
5104 5104 a, g dbSNP:264788330
5155 5155 a, g dbSNP:227262542
5238 5238 a, g dbSNP:255811802
5239 5239 a, g, t dbSNP:213998609
5247 5247 a, c dbSNP:227876075
5255 5255 a, g dbSNP:245533364
5260 5260 c, t dbSNP:217497061
5488 5488 c, t dbSNP:47551679
5515 5515 c, t dbSNP:256453274
5546 5546 a, g dbSNP:212390023
5566 5566 a, t dbSNP:237083139
5641 5641 c, t dbSNP:251246553
5667 5667 c, t dbSNP:219567688
5752 5752 a, c dbSNP:241213664
5869 5869 a, g dbSNP:52603492
5893 5893 c, t dbSNP:226556489
5894 5894 c, t dbSNP:249907062
5897 5897 a, g dbSNP:261832188
5914 5914 c, t dbSNP:219765160
5931 5931 a, g dbSNP:238081103
5995 5995 c, t dbSNP:255034472
6235 6235 a, g dbSNP:227933915
6294 6294 c, t dbSNP:245588156
6414 6414 a, c dbSNP:266228669
6541 6541 a, g dbSNP:233361628
6603 6603 a, c dbSNP:254480234
6703 6703 g, t dbSNP:212201657
6717 6717 a, g dbSNP:239156281
6734 6734 a, c dbSNP:245083199
6736 6736 g, t dbSNP:215975117
6751 6751 g, t dbSNP:234797948
6758 6758 c, t dbSNP:252792666
6764 6764 a, g dbSNP:227063645
6799 6799 a, c dbSNP:239365701
6818 6818 c, t dbSNP:261425566
6853 6853 c, t dbSNP:220116863
6874 6874 a, g dbSNP:50611886
6889 6889 c, t dbSNP:255096925
6944 6944 a, g dbSNP:49178684
6947 6947 a, g dbSNP:221174491
6963 6963 c, t dbSNP:239644238
6970 6970 -, t dbSNP:243692372
7004 7004 c, t dbSNP:264610476
7016 7016 g, t dbSNP:234430526
7019 7019 a, c dbSNP:250188765
7020 7020 a, g dbSNP:264715900
7024 7024 -, a dbSNP:240115926
7056 7056 c, t dbSNP:226761283
7078 7078 a, c dbSNP:245139138
7196 7196 a, c dbSNP:216021261
7218 7218 c, g dbSNP:234024166
7254 7254 -, tgagctcaatggat dbSNP:261119203
7265 7265 a, g dbSNP:260225959
7270 7270 a, g dbSNP:219190842
7278 7278 a, g dbSNP:242011563
7294 7294 c, t dbSNP:256183140
7300 7300 a, g dbSNP:219920607
7322 7322 a, c dbSNP:45726787
7358 7358 a, g dbSNP:231973326
7363 7363 a, g dbSNP:249465171
7394 7394 a, t dbSNP:221232333
7469 7469 a, g dbSNP:238869723
7512 7512 a, t dbSNP:264019798
7519 7519 a, g dbSNP:226209256
7578 7578 a, t dbSNP:245453066
7687 7687 a, t dbSNP:261694370
7768 7768 c, t dbSNP:226812140
7772 7772 c, t dbSNP:239137103
7777 7777 c, g dbSNP:260098002
7791 7791 c, t dbSNP:227494619
7820 7820 -, t dbSNP:244582154
7822 7822 g, t dbSNP:254791750
7823 7823 a, t dbSNP:218175371
7876 7876 c, t dbSNP:233118706
7890 7890 a, t dbSNP:254171875
7901 7901 a, c dbSNP:211980447
7973 7973 -, c dbSNP:214920647
8022 8022 a, g dbSNP:232030870
8024 8024 a, g dbSNP:249527418
8025 8025 c, t dbSNP:50224043
8096 8096 g, t dbSNP:215734464
8115 8115 a, g dbSNP:232624402
8202 8202 c, t dbSNP:260664149
8228 8228 a, g dbSNP:48874784
8253 8253 c, t dbSNP:242684744
8255 8255 c, t dbSNP:261199956
8265 8265 a, g dbSNP:220591986
8286 8286 c, t dbSNP:239198824
8326 8326 c, t dbSNP:260156970
8381 8381 a, g dbSNP:227563946
8421 8421 -, gtgtgt dbSNP:233316663
8422 8422 -, ta dbSNP:223821384
8500 8500 c, t dbSNP:251583854
8550 8550 a, g dbSNP:264082494
8560 8560 c, t dbSNP:229309169
8578 8578 a, g dbSNP:249158054
8599 8599 a, g dbSNP:212046557
8606 8606 a, g dbSNP:226030260
8622 8622 a, t dbSNP:243722116
8640 8640 a, g dbSNP:215796231
8649 8649 c, t dbSNP:237679859
8678 8678 a, g dbSNP:264090722
8689 8689 c, t dbSNP:217624350
8704 8704 g, t dbSNP:236844958
8755 8755 -, ccccagccctaaaattattttgctg dbSNP:228556907
8858 8858 a, c dbSNP:249253923
8866 8866 c, g dbSNP:220644848
8869 8869 a, g dbSNP:232237955
8921 8921 c, g dbSNP:253885520
8982 8982 a, g dbSNP:221255954
8983 8983 a, g dbSNP:45637247
8996 8996 c, t dbSNP:248568766
9014 9014 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_001142735
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant B, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13182
Accession Version NM_001142736.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5811bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-4 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354398.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (C) lacks two alternate in-frame exons in the 5' and 3' coding region, compared to variant A. The resulting isoform (CD1-4), also known as protocadherin-15-CD1 isoform 4, lacks a 5-aa segment near the N-terminus and a 2-aa segment near the C-terminus, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354398.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164136, SAMN01164138 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)872..1141(+)
Misc Feature(3)893..1090(+)
Misc Feature(4)1262..1588(+)
Misc Feature(5)1283..1588(+)
Misc Feature(6)1616..1936(+)
Misc Feature(7)1637..1933(+)
Misc Feature(8)1958..2248(+)
Misc Feature(9)1979..2248(+)
Misc Feature(10)2282..2560(+)
Misc Feature(11)2300..2557(+)
Misc Feature(12)2585..2866(+)
Misc Feature(13)2606..2863(+)
Misc Feature(14)2888..3184(+)
Misc Feature(15)2909..3184(+)
Misc Feature(16)3209..3502(+)
Misc Feature(17)3230..3412(+)
Misc Feature(18)3554..3841(+)
Misc Feature(19)3560..3838(+)
Misc Feature(20)3866..4150(+)
Misc Feature(21)3884..4060(+)
Misc Feature(22)4550..4612(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..578
Gene Synonym:
Exon (4)579..739
Gene Synonym:
Exon (5)740..895
Gene Synonym:
Exon (6)896..1015
Gene Synonym:
Exon (7)1016..1126
Gene Synonym:
Exon (8)1127..1297
Gene Synonym:
Exon (9)1298..1406
Gene Synonym:
Exon (10)1407..1519
Gene Synonym:
Exon (11)1520..1726
Gene Synonym:
Exon (12)1727..1861
Gene Synonym:
Exon (13)1862..2011
Gene Synonym:
Exon (14)2012..2205
Gene Synonym:
Exon (15)2206..2338
Gene Synonym:
Exon (16)2339..2418
Gene Synonym:
Exon (17)2419..2512
Gene Synonym:
Exon (18)2513..2641
Gene Synonym:
Exon (19)2642..2947
Gene Synonym:
Exon (20)2948..3172
Gene Synonym:
Exon (21)3173..3289
Gene Synonym:
Exon (22)3290..3430
Gene Synonym:
Exon (23)3431..3543
Gene Synonym:
Exon (24)3544..3653
Gene Synonym:
Exon (25)3654..3794
Gene Synonym:
Exon (26)3795..3922
Gene Synonym:
Exon (27)3923..4138
Gene Synonym:
Exon (28)4139..4227
Gene Synonym:
Exon (29)4228..4404
Gene Synonym:
Exon (30)4405..4623
Gene Synonym:
Exon (31)4624..4632
Gene Synonym:
Exon (32)4633..4788
Gene Synonym:
Exon (33)4789..9043
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
577 577 c, t dbSNP:46087908
595 595 c, t dbSNP:50061218
886 886 c, t dbSNP:244689568
1048 1048 a, g dbSNP:49962731
1123 1123 a, g dbSNP:256412847
1222 1222 c, t dbSNP:47222354
1657 1657 c, t dbSNP:232979244
1694 1694 a, c dbSNP:244779234
1771 1771 a, g dbSNP:234971152
1777 1777 c, t dbSNP:253848918
2002 2002 c, t dbSNP:244151985
2026 2026 c, t dbSNP:258930706
2200 2200 a, g dbSNP:229047978
2239 2239 a, t dbSNP:225553757
2359 2359 c, t dbSNP:46546428
2710 2710 c, t dbSNP:47972196
2725 2725 c, t dbSNP:236565609
2812 2812 c, t dbSNP:254494033
2923 2923 c, t dbSNP:212906806
2998 2998 a, g dbSNP:261949476
3049 3049 c, t dbSNP:228122452
3079 3079 c, g dbSNP:50379170
3133 3133 g, t dbSNP:265026670
3157 3157 c, g dbSNP:47892298
3193 3193 a, g dbSNP:265542592
3454 3454 c, t dbSNP:51119205
3457 3457 c, t dbSNP:48157089
3577 3577 a, g dbSNP:51765115
3610 3610 c, t dbSNP:50449153
3691 3691 c, t dbSNP:232407113
3889 3889 c, t dbSNP:48056426
3970 3970 c, t dbSNP:251516372
4240 4240 c, t dbSNP:240966622
4246 4246 g, t dbSNP:254718603
4732 4732 a, c dbSNP:221348700
4868 4868 a, c dbSNP:247089690
5098 5098 a, g dbSNP:264788330
5149 5149 a, g dbSNP:227262542
5232 5232 a, g dbSNP:255811802
5233 5233 a, g, t dbSNP:213998609
5241 5241 a, c dbSNP:227876075
5249 5249 a, g dbSNP:245533364
5254 5254 c, t dbSNP:217497061
5482 5482 c, t dbSNP:47551679
5509 5509 c, t dbSNP:256453274
5540 5540 a, g dbSNP:212390023
5560 5560 a, t dbSNP:237083139
5635 5635 c, t dbSNP:251246553
5661 5661 c, t dbSNP:219567688
5746 5746 a, c dbSNP:241213664
5863 5863 a, g dbSNP:52603492
5887 5887 c, t dbSNP:226556489
5888 5888 c, t dbSNP:249907062
5891 5891 a, g dbSNP:261832188
5908 5908 c, t dbSNP:219765160
5925 5925 a, g dbSNP:238081103
5989 5989 c, t dbSNP:255034472
6229 6229 a, g dbSNP:227933915
6288 6288 c, t dbSNP:245588156
6408 6408 a, c dbSNP:266228669
6535 6535 a, g dbSNP:233361628
6597 6597 a, c dbSNP:254480234
6697 6697 g, t dbSNP:212201657
6711 6711 a, g dbSNP:239156281
6728 6728 a, c dbSNP:245083199
6730 6730 g, t dbSNP:215975117
6745 6745 g, t dbSNP:234797948
6752 6752 c, t dbSNP:252792666
6758 6758 a, g dbSNP:227063645
6793 6793 a, c dbSNP:239365701
6812 6812 c, t dbSNP:261425566
6847 6847 c, t dbSNP:220116863
6868 6868 a, g dbSNP:50611886
6883 6883 c, t dbSNP:255096925
6938 6938 a, g dbSNP:49178684
6941 6941 a, g dbSNP:221174491
6957 6957 c, t dbSNP:239644238
6964 6964 -, t dbSNP:243692372
6998 6998 c, t dbSNP:264610476
7010 7010 g, t dbSNP:234430526
7013 7013 a, c dbSNP:250188765
7014 7014 a, g dbSNP:264715900
7018 7018 -, a dbSNP:240115926
7050 7050 c, t dbSNP:226761283
7072 7072 a, c dbSNP:245139138
7190 7190 a, c dbSNP:216021261
7212 7212 c, g dbSNP:234024166
7248 7248 -, tgagctcaatggat dbSNP:261119203
7259 7259 a, g dbSNP:260225959
7264 7264 a, g dbSNP:219190842
7272 7272 a, g dbSNP:242011563
7288 7288 c, t dbSNP:256183140
7294 7294 a, g dbSNP:219920607
7316 7316 a, c dbSNP:45726787
7352 7352 a, g dbSNP:231973326
7357 7357 a, g dbSNP:249465171
7388 7388 a, t dbSNP:221232333
7463 7463 a, g dbSNP:238869723
7506 7506 a, t dbSNP:264019798
7513 7513 a, g dbSNP:226209256
7572 7572 a, t dbSNP:245453066
7681 7681 a, t dbSNP:261694370
7762 7762 c, t dbSNP:226812140
7766 7766 c, t dbSNP:239137103
7771 7771 c, g dbSNP:260098002
7785 7785 c, t dbSNP:227494619
7814 7814 -, t dbSNP:244582154
7816 7816 g, t dbSNP:254791750
7817 7817 a, t dbSNP:218175371
7870 7870 c, t dbSNP:233118706
7884 7884 a, t dbSNP:254171875
7895 7895 a, c dbSNP:211980447
7967 7967 -, c dbSNP:214920647
8016 8016 a, g dbSNP:232030870
8018 8018 a, g dbSNP:249527418
8019 8019 c, t dbSNP:50224043
8090 8090 g, t dbSNP:215734464
8109 8109 a, g dbSNP:232624402
8196 8196 c, t dbSNP:260664149
8222 8222 a, g dbSNP:48874784
8247 8247 c, t dbSNP:242684744
8249 8249 c, t dbSNP:261199956
8259 8259 a, g dbSNP:220591986
8280 8280 c, t dbSNP:239198824
8320 8320 c, t dbSNP:260156970
8375 8375 a, g dbSNP:227563946
8415 8415 -, gtgtgt dbSNP:233316663
8416 8416 -, ta dbSNP:223821384
8494 8494 c, t dbSNP:251583854
8544 8544 a, g dbSNP:264082494
8554 8554 c, t dbSNP:229309169
8572 8572 a, g dbSNP:249158054
8593 8593 a, g dbSNP:212046557
8600 8600 a, g dbSNP:226030260
8616 8616 a, t dbSNP:243722116
8634 8634 a, g dbSNP:215796231
8643 8643 c, t dbSNP:237679859
8672 8672 a, g dbSNP:264090722
8683 8683 c, t dbSNP:217624350
8698 8698 g, t dbSNP:236844958
8749 8749 -, ccccagccctaaaattattttgctg dbSNP:228556907
8852 8852 a, c dbSNP:249253923
8860 8860 c, g dbSNP:220644848
8863 8863 a, g dbSNP:232237955
8915 8915 c, g dbSNP:253885520
8976 8976 a, g dbSNP:221255954
8977 8977 a, g dbSNP:45637247
8990 8990 c, t dbSNP:248568766
9008 9008 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_001142736
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant C, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13215
Accession Version NM_001142737.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5604bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-6 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354400.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (D) lacks an alternate in-frame exon in the 5' coding region and two alternate in-frame exons in the central coding region, compared to variant A. The resulting isoform (CD1-6), also known as protocadherin-15-CD1 isoform 6, lacks a 5-aa segment near the N-terminus and a 71-aa segment in the central protein, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354400.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN01164131, SAMN01164132 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)872..1141(+)
Misc Feature(3)893..1090(+)
Misc Feature(4)1262..1588(+)
Misc Feature(5)1283..1588(+)
Misc Feature(6)1616..1936(+)
Misc Feature(7)1637..1933(+)
Misc Feature(8)1958..2347(+)
Misc Feature(9)1979..2344(+)
Misc Feature(10)2372..2653(+)
Misc Feature(11)2393..2650(+)
Misc Feature(12)2675..2971(+)
Misc Feature(13)2696..2971(+)
Misc Feature(14)2996..3289(+)
Misc Feature(15)3017..3199(+)
Misc Feature(16)3341..3628(+)
Misc Feature(17)3347..3625(+)
Misc Feature(18)3653..3937(+)
Misc Feature(19)3671..3847(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..578
Gene Synonym:
Exon (4)579..739
Gene Synonym:
Exon (5)740..895
Gene Synonym:
Exon (6)896..1015
Gene Synonym:
Exon (7)1016..1126
Gene Synonym:
Exon (8)1127..1297
Gene Synonym:
Exon (9)1298..1406
Gene Synonym:
Exon (10)1407..1519
Gene Synonym:
Exon (11)1520..1726
Gene Synonym:
Exon (12)1727..1861
Gene Synonym:
Exon (13)1862..2011
Gene Synonym:
Exon (14)2012..2205
Gene Synonym:
Exon (15)2206..2299
Gene Synonym:
Exon (16)2300..2428
Gene Synonym:
Exon (17)2429..2734
Gene Synonym:
Exon (18)2735..2959
Gene Synonym:
Exon (19)2960..3076
Gene Synonym:
Exon (20)3077..3217
Gene Synonym:
Exon (21)3218..3330
Gene Synonym:
Exon (22)3331..3440
Gene Synonym:
Exon (23)3441..3581
Gene Synonym:
Exon (24)3582..3709
Gene Synonym:
Exon (25)3710..3925
Gene Synonym:
Exon (26)3926..4014
Gene Synonym:
Exon (27)4015..4191
Gene Synonym:
Exon (28)4192..4410
Gene Synonym:
Exon (29)4411..4419
Gene Synonym:
Exon (30)4420..4575
Gene Synonym:
Exon (31)4576..4581
Gene Synonym:
Exon (32)4582..8836
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
577 577 c, t dbSNP:46087908
595 595 c, t dbSNP:50061218
886 886 c, t dbSNP:244689568
1048 1048 a, g dbSNP:49962731
1123 1123 a, g dbSNP:256412847
1222 1222 c, t dbSNP:47222354
1657 1657 c, t dbSNP:232979244
1694 1694 a, c dbSNP:244779234
1771 1771 a, g dbSNP:234971152
1777 1777 c, t dbSNP:253848918
2002 2002 c, t dbSNP:244151985
2026 2026 c, t dbSNP:258930706
2200 2200 a, g dbSNP:229047978
2497 2497 c, t dbSNP:47972196
2512 2512 c, t dbSNP:236565609
2599 2599 c, t dbSNP:254494033
2710 2710 c, t dbSNP:212906806
2785 2785 a, g dbSNP:261949476
2836 2836 c, t dbSNP:228122452
2866 2866 c, g dbSNP:50379170
2920 2920 g, t dbSNP:265026670
2944 2944 c, g dbSNP:47892298
2980 2980 a, g dbSNP:265542592
3241 3241 c, t dbSNP:51119205
3244 3244 c, t dbSNP:48157089
3364 3364 a, g dbSNP:51765115
3397 3397 c, t dbSNP:50449153
3478 3478 c, t dbSNP:232407113
3676 3676 c, t dbSNP:48056426
3757 3757 c, t dbSNP:251516372
4027 4027 c, t dbSNP:240966622
4033 4033 g, t dbSNP:254718603
4519 4519 a, c dbSNP:221348700
4578 4578 a, g dbSNP:231369012
4661 4661 a, c dbSNP:247089690
4891 4891 a, g dbSNP:264788330
4942 4942 a, g dbSNP:227262542
5025 5025 a, g dbSNP:255811802
5026 5026 a, g, t dbSNP:213998609
5034 5034 a, c dbSNP:227876075
5042 5042 a, g dbSNP:245533364
5047 5047 c, t dbSNP:217497061
5275 5275 c, t dbSNP:47551679
5302 5302 c, t dbSNP:256453274
5333 5333 a, g dbSNP:212390023
5353 5353 a, t dbSNP:237083139
5428 5428 c, t dbSNP:251246553
5454 5454 c, t dbSNP:219567688
5539 5539 a, c dbSNP:241213664
5656 5656 a, g dbSNP:52603492
5680 5680 c, t dbSNP:226556489
5681 5681 c, t dbSNP:249907062
5684 5684 a, g dbSNP:261832188
5701 5701 c, t dbSNP:219765160
5718 5718 a, g dbSNP:238081103
5782 5782 c, t dbSNP:255034472
6022 6022 a, g dbSNP:227933915
6081 6081 c, t dbSNP:245588156
6201 6201 a, c dbSNP:266228669
6328 6328 a, g dbSNP:233361628
6390 6390 a, c dbSNP:254480234
6490 6490 g, t dbSNP:212201657
6504 6504 a, g dbSNP:239156281
6521 6521 a, c dbSNP:245083199
6523 6523 g, t dbSNP:215975117
6538 6538 g, t dbSNP:234797948
6545 6545 c, t dbSNP:252792666
6551 6551 a, g dbSNP:227063645
6586 6586 a, c dbSNP:239365701
6605 6605 c, t dbSNP:261425566
6640 6640 c, t dbSNP:220116863
6661 6661 a, g dbSNP:50611886
6676 6676 c, t dbSNP:255096925
6731 6731 a, g dbSNP:49178684
6734 6734 a, g dbSNP:221174491
6750 6750 c, t dbSNP:239644238
6757 6757 -, t dbSNP:243692372
6791 6791 c, t dbSNP:264610476
6803 6803 g, t dbSNP:234430526
6806 6806 a, c dbSNP:250188765
6807 6807 a, g dbSNP:264715900
6811 6811 -, a dbSNP:240115926
6843 6843 c, t dbSNP:226761283
6865 6865 a, c dbSNP:245139138
6983 6983 a, c dbSNP:216021261
7005 7005 c, g dbSNP:234024166
7041 7041 -, tgagctcaatggat dbSNP:261119203
7052 7052 a, g dbSNP:260225959
7057 7057 a, g dbSNP:219190842
7065 7065 a, g dbSNP:242011563
7081 7081 c, t dbSNP:256183140
7087 7087 a, g dbSNP:219920607
7109 7109 a, c dbSNP:45726787
7145 7145 a, g dbSNP:231973326
7150 7150 a, g dbSNP:249465171
7181 7181 a, t dbSNP:221232333
7256 7256 a, g dbSNP:238869723
7299 7299 a, t dbSNP:264019798
7306 7306 a, g dbSNP:226209256
7365 7365 a, t dbSNP:245453066
7474 7474 a, t dbSNP:261694370
7555 7555 c, t dbSNP:226812140
7559 7559 c, t dbSNP:239137103
7564 7564 c, g dbSNP:260098002
7578 7578 c, t dbSNP:227494619
7607 7607 -, t dbSNP:244582154
7609 7609 g, t dbSNP:254791750
7610 7610 a, t dbSNP:218175371
7663 7663 c, t dbSNP:233118706
7677 7677 a, t dbSNP:254171875
7688 7688 a, c dbSNP:211980447
7760 7760 -, c dbSNP:214920647
7809 7809 a, g dbSNP:232030870
7811 7811 a, g dbSNP:249527418
7812 7812 c, t dbSNP:50224043
7883 7883 g, t dbSNP:215734464
7902 7902 a, g dbSNP:232624402
7989 7989 c, t dbSNP:260664149
8015 8015 a, g dbSNP:48874784
8040 8040 c, t dbSNP:242684744
8042 8042 c, t dbSNP:261199956
8052 8052 a, g dbSNP:220591986
8073 8073 c, t dbSNP:239198824
8113 8113 c, t dbSNP:260156970
8168 8168 a, g dbSNP:227563946
8208 8208 -, gtgtgt dbSNP:233316663
8209 8209 -, ta dbSNP:223821384
8287 8287 c, t dbSNP:251583854
8337 8337 a, g dbSNP:264082494
8347 8347 c, t dbSNP:229309169
8365 8365 a, g dbSNP:249158054
8386 8386 a, g dbSNP:212046557
8393 8393 a, g dbSNP:226030260
8409 8409 a, t dbSNP:243722116
8427 8427 a, g dbSNP:215796231
8436 8436 c, t dbSNP:237679859
8465 8465 a, g dbSNP:264090722
8476 8476 c, t dbSNP:217624350
8491 8491 g, t dbSNP:236844958
8542 8542 -, ccccagccctaaaattattttgctg dbSNP:228556907
8645 8645 a, c dbSNP:249253923
8653 8653 c, g dbSNP:220644848
8656 8656 a, g dbSNP:232237955
8708 8708 c, g dbSNP:253885520
8769 8769 a, g dbSNP:221255954
8770 8770 a, g dbSNP:45637247
8783 8783 c, t dbSNP:248568766
8801 8801 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_001142737
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant D, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13179
Accession Version NM_001142738.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5691bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-8 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354401.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (F) lacks 4 alternate in-frame exons, compared to variant A. The resulting isoform (CD1-8), also known as protocadherin-15-CD1 isoform 8, has the same N- and C-termini but lacks four internal segments, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354401.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)1151..1477(+)
Misc Feature(3)1172..1477(+)
Misc Feature(4)1505..1825(+)
Misc Feature(5)1526..1822(+)
Misc Feature(6)1847..2137(+)
Misc Feature(7)1868..2137(+)
Misc Feature(8)2171..2449(+)
Misc Feature(9)2189..2446(+)
Misc Feature(10)2474..2755(+)
Misc Feature(11)2495..2752(+)
Misc Feature(12)2777..3073(+)
Misc Feature(13)2798..3073(+)
Misc Feature(14)3098..3391(+)
Misc Feature(15)3119..3301(+)
Misc Feature(16)3443..3730(+)
Misc Feature(17)3449..3727(+)
Misc Feature(18)3755..4039(+)
Misc Feature(19)3773..3949(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..578
Gene Synonym:
Exon (4)579..739
Gene Synonym:
Exon (5)740..895
Gene Synonym:
Exon (6)896..1015
Gene Synonym:
Exon (7)1016..1186
Gene Synonym:
Exon (8)1187..1295
Gene Synonym:
Exon (9)1296..1408
Gene Synonym:
Exon (10)1409..1615
Gene Synonym:
Exon (11)1616..1750
Gene Synonym:
Exon (12)1751..1900
Gene Synonym:
Exon (13)1901..2094
Gene Synonym:
Exon (14)2095..2227
Gene Synonym:
Exon (15)2228..2307
Gene Synonym:
Exon (16)2308..2401
Gene Synonym:
Exon (17)2402..2530
Gene Synonym:
Exon (18)2531..2836
Gene Synonym:
Exon (19)2837..3061
Gene Synonym:
Exon (20)3062..3178
Gene Synonym:
Exon (21)3179..3319
Gene Synonym:
Exon (22)3320..3432
Gene Synonym:
Exon (23)3433..3542
Gene Synonym:
Exon (24)3543..3683
Gene Synonym:
Exon (25)3684..3811
Gene Synonym:
Exon (26)3812..4027
Gene Synonym:
Exon (27)4028..4116
Gene Synonym:
Exon (28)4117..4293
Gene Synonym:
Exon (29)4294..4512
Gene Synonym:
Exon (30)4513..4668
Gene Synonym:
Exon (31)4669..8923
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
577 577 c, t dbSNP:46087908
595 595 c, t dbSNP:50061218
886 886 c, t dbSNP:244689568
1111 1111 c, t dbSNP:47222354
1546 1546 c, t dbSNP:232979244
1583 1583 a, c dbSNP:244779234
1660 1660 a, g dbSNP:234971152
1666 1666 c, t dbSNP:253848918
1891 1891 c, t dbSNP:244151985
1915 1915 c, t dbSNP:258930706
2089 2089 a, g dbSNP:229047978
2128 2128 a, t dbSNP:225553757
2248 2248 c, t dbSNP:46546428
2599 2599 c, t dbSNP:47972196
2614 2614 c, t dbSNP:236565609
2701 2701 c, t dbSNP:254494033
2812 2812 c, t dbSNP:212906806
2887 2887 a, g dbSNP:261949476
2938 2938 c, t dbSNP:228122452
2968 2968 c, g dbSNP:50379170
3022 3022 g, t dbSNP:265026670
3046 3046 c, g dbSNP:47892298
3082 3082 a, g dbSNP:265542592
3343 3343 c, t dbSNP:51119205
3346 3346 c, t dbSNP:48157089
3466 3466 a, g dbSNP:51765115
3499 3499 c, t dbSNP:50449153
3580 3580 c, t dbSNP:232407113
3778 3778 c, t dbSNP:48056426
3859 3859 c, t dbSNP:251516372
4129 4129 c, t dbSNP:240966622
4135 4135 g, t dbSNP:254718603
4612 4612 a, c dbSNP:221348700
4748 4748 a, c dbSNP:247089690
4978 4978 a, g dbSNP:264788330
5029 5029 a, g dbSNP:227262542
5112 5112 a, g dbSNP:255811802
5113 5113 a, g, t dbSNP:213998609
5121 5121 a, c dbSNP:227876075
5129 5129 a, g dbSNP:245533364
5134 5134 c, t dbSNP:217497061
5362 5362 c, t dbSNP:47551679
5389 5389 c, t dbSNP:256453274
5420 5420 a, g dbSNP:212390023
5440 5440 a, t dbSNP:237083139
5515 5515 c, t dbSNP:251246553
5541 5541 c, t dbSNP:219567688
5626 5626 a, c dbSNP:241213664
5743 5743 a, g dbSNP:52603492
5767 5767 c, t dbSNP:226556489
5768 5768 c, t dbSNP:249907062
5771 5771 a, g dbSNP:261832188
5788 5788 c, t dbSNP:219765160
5805 5805 a, g dbSNP:238081103
5869 5869 c, t dbSNP:255034472
6109 6109 a, g dbSNP:227933915
6168 6168 c, t dbSNP:245588156
6288 6288 a, c dbSNP:266228669
6415 6415 a, g dbSNP:233361628
6477 6477 a, c dbSNP:254480234
6577 6577 g, t dbSNP:212201657
6591 6591 a, g dbSNP:239156281
6608 6608 a, c dbSNP:245083199
6610 6610 g, t dbSNP:215975117
6625 6625 g, t dbSNP:234797948
6632 6632 c, t dbSNP:252792666
6638 6638 a, g dbSNP:227063645
6673 6673 a, c dbSNP:239365701
6692 6692 c, t dbSNP:261425566
6727 6727 c, t dbSNP:220116863
6748 6748 a, g dbSNP:50611886
6763 6763 c, t dbSNP:255096925
6818 6818 a, g dbSNP:49178684
6821 6821 a, g dbSNP:221174491
6837 6837 c, t dbSNP:239644238
6844 6844 -, t dbSNP:243692372
6878 6878 c, t dbSNP:264610476
6890 6890 g, t dbSNP:234430526
6893 6893 a, c dbSNP:250188765
6894 6894 a, g dbSNP:264715900
6898 6898 -, a dbSNP:240115926
6930 6930 c, t dbSNP:226761283
6952 6952 a, c dbSNP:245139138
7070 7070 a, c dbSNP:216021261
7092 7092 c, g dbSNP:234024166
7128 7128 -, tgagctcaatggat dbSNP:261119203
7139 7139 a, g dbSNP:260225959
7144 7144 a, g dbSNP:219190842
7152 7152 a, g dbSNP:242011563
7168 7168 c, t dbSNP:256183140
7174 7174 a, g dbSNP:219920607
7196 7196 a, c dbSNP:45726787
7232 7232 a, g dbSNP:231973326
7237 7237 a, g dbSNP:249465171
7268 7268 a, t dbSNP:221232333
7343 7343 a, g dbSNP:238869723
7386 7386 a, t dbSNP:264019798
7393 7393 a, g dbSNP:226209256
7452 7452 a, t dbSNP:245453066
7561 7561 a, t dbSNP:261694370
7642 7642 c, t dbSNP:226812140
7646 7646 c, t dbSNP:239137103
7651 7651 c, g dbSNP:260098002
7665 7665 c, t dbSNP:227494619
7694 7694 -, t dbSNP:244582154
7696 7696 g, t dbSNP:254791750
7697 7697 a, t dbSNP:218175371
7750 7750 c, t dbSNP:233118706
7764 7764 a, t dbSNP:254171875
7775 7775 a, c dbSNP:211980447
7847 7847 -, c dbSNP:214920647
7896 7896 a, g dbSNP:232030870
7898 7898 a, g dbSNP:249527418
7899 7899 c, t dbSNP:50224043
7970 7970 g, t dbSNP:215734464
7989 7989 a, g dbSNP:232624402
8076 8076 c, t dbSNP:260664149
8102 8102 a, g dbSNP:48874784
8127 8127 c, t dbSNP:242684744
8129 8129 c, t dbSNP:261199956
8139 8139 a, g dbSNP:220591986
8160 8160 c, t dbSNP:239198824
8200 8200 c, t dbSNP:260156970
8255 8255 a, g dbSNP:227563946
8295 8295 -, gtgtgt dbSNP:233316663
8296 8296 -, ta dbSNP:223821384
8374 8374 c, t dbSNP:251583854
8424 8424 a, g dbSNP:264082494
8434 8434 c, t dbSNP:229309169
8452 8452 a, g dbSNP:249158054
8473 8473 a, g dbSNP:212046557
8480 8480 a, g dbSNP:226030260
8496 8496 a, t dbSNP:243722116
8514 8514 a, g dbSNP:215796231
8523 8523 c, t dbSNP:237679859
8552 8552 a, g dbSNP:264090722
8563 8563 c, t dbSNP:217624350
8578 8578 g, t dbSNP:236844958
8629 8629 -, ccccagccctaaaattattttgctg dbSNP:228556907
8732 8732 a, c dbSNP:249253923
8740 8740 c, g dbSNP:220644848
8743 8743 a, g dbSNP:232237955
8795 8795 c, g dbSNP:253885520
8856 8856 a, g dbSNP:221255954
8857 8857 a, g dbSNP:45637247
8870 8870 c, t dbSNP:248568766
8888 8888 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_001142738
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant F, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13216
Accession Version NM_001142739.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5751bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-9 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354402.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (G) lacks two alternate in-frame exons in the 5' coding region, compared to variant A. The resulting isoform (CD1-9), also known as protocadherin-15-CD1 isoform 9, lacks a 27-aa segment near the N-terminus, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354402.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN01164131, SAMN01164132 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)806..1075(+)
Misc Feature(3)827..1024(+)
Misc Feature(4)1196..1522(+)
Misc Feature(5)1217..1522(+)
Misc Feature(6)1550..1870(+)
Misc Feature(7)1571..1867(+)
Misc Feature(8)1892..2182(+)
Misc Feature(9)1913..2182(+)
Misc Feature(10)2216..2494(+)
Misc Feature(11)2234..2491(+)
Misc Feature(12)2519..2800(+)
Misc Feature(13)2540..2797(+)
Misc Feature(14)2822..3118(+)
Misc Feature(15)2843..3118(+)
Misc Feature(16)3143..3436(+)
Misc Feature(17)3164..3346(+)
Misc Feature(18)3488..3775(+)
Misc Feature(19)3494..3772(+)
Misc Feature(20)3800..4084(+)
Misc Feature(21)3818..3994(+)
Misc Feature(22)4484..4546(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..673
Gene Synonym:
Exon (4)674..829
Gene Synonym:
Exon (5)830..949
Gene Synonym:
Exon (6)950..1060
Gene Synonym:
Exon (7)1061..1231
Gene Synonym:
Exon (8)1232..1340
Gene Synonym:
Exon (9)1341..1453
Gene Synonym:
Exon (10)1454..1660
Gene Synonym:
Exon (11)1661..1795
Gene Synonym:
Exon (12)1796..1945
Gene Synonym:
Exon (13)1946..2139
Gene Synonym:
Exon (14)2140..2272
Gene Synonym:
Exon (15)2273..2352
Gene Synonym:
Exon (16)2353..2446
Gene Synonym:
Exon (17)2447..2575
Gene Synonym:
Exon (18)2576..2881
Gene Synonym:
Exon (19)2882..3106
Gene Synonym:
Exon (20)3107..3223
Gene Synonym:
Exon (21)3224..3364
Gene Synonym:
Exon (22)3365..3477
Gene Synonym:
Exon (23)3478..3587
Gene Synonym:
Exon (24)3588..3728
Gene Synonym:
Exon (25)3729..3856
Gene Synonym:
Exon (26)3857..4072
Gene Synonym:
Exon (27)4073..4161
Gene Synonym:
Exon (28)4162..4338
Gene Synonym:
Exon (29)4339..4557
Gene Synonym:
Exon (30)4558..4566
Gene Synonym:
Exon (31)4567..4722
Gene Synonym:
Exon (32)4723..4728
Gene Synonym:
Exon (33)4729..8983
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
529 529 c, t dbSNP:50061218
820 820 c, t dbSNP:244689568
982 982 a, g dbSNP:49962731
1057 1057 a, g dbSNP:256412847
1156 1156 c, t dbSNP:47222354
1591 1591 c, t dbSNP:232979244
1628 1628 a, c dbSNP:244779234
1705 1705 a, g dbSNP:234971152
1711 1711 c, t dbSNP:253848918
1936 1936 c, t dbSNP:244151985
1960 1960 c, t dbSNP:258930706
2134 2134 a, g dbSNP:229047978
2173 2173 a, t dbSNP:225553757
2293 2293 c, t dbSNP:46546428
2644 2644 c, t dbSNP:47972196
2659 2659 c, t dbSNP:236565609
2746 2746 c, t dbSNP:254494033
2857 2857 c, t dbSNP:212906806
2932 2932 a, g dbSNP:261949476
2983 2983 c, t dbSNP:228122452
3013 3013 c, g dbSNP:50379170
3067 3067 g, t dbSNP:265026670
3091 3091 c, g dbSNP:47892298
3127 3127 a, g dbSNP:265542592
3388 3388 c, t dbSNP:51119205
3391 3391 c, t dbSNP:48157089
3511 3511 a, g dbSNP:51765115
3544 3544 c, t dbSNP:50449153
3625 3625 c, t dbSNP:232407113
3823 3823 c, t dbSNP:48056426
3904 3904 c, t dbSNP:251516372
4174 4174 c, t dbSNP:240966622
4180 4180 g, t dbSNP:254718603
4666 4666 a, c dbSNP:221348700
4725 4725 a, g dbSNP:231369012
4808 4808 a, c dbSNP:247089690
5038 5038 a, g dbSNP:264788330
5089 5089 a, g dbSNP:227262542
5172 5172 a, g dbSNP:255811802
5173 5173 a, g, t dbSNP:213998609
5181 5181 a, c dbSNP:227876075
5189 5189 a, g dbSNP:245533364
5194 5194 c, t dbSNP:217497061
5422 5422 c, t dbSNP:47551679
5449 5449 c, t dbSNP:256453274
5480 5480 a, g dbSNP:212390023
5500 5500 a, t dbSNP:237083139
5575 5575 c, t dbSNP:251246553
5601 5601 c, t dbSNP:219567688
5686 5686 a, c dbSNP:241213664
5803 5803 a, g dbSNP:52603492
5827 5827 c, t dbSNP:226556489
5828 5828 c, t dbSNP:249907062
5831 5831 a, g dbSNP:261832188
5848 5848 c, t dbSNP:219765160
5865 5865 a, g dbSNP:238081103
5929 5929 c, t dbSNP:255034472
6169 6169 a, g dbSNP:227933915
6228 6228 c, t dbSNP:245588156
6348 6348 a, c dbSNP:266228669
6475 6475 a, g dbSNP:233361628
6537 6537 a, c dbSNP:254480234
6637 6637 g, t dbSNP:212201657
6651 6651 a, g dbSNP:239156281
6668 6668 a, c dbSNP:245083199
6670 6670 g, t dbSNP:215975117
6685 6685 g, t dbSNP:234797948
6692 6692 c, t dbSNP:252792666
6698 6698 a, g dbSNP:227063645
6733 6733 a, c dbSNP:239365701
6752 6752 c, t dbSNP:261425566
6787 6787 c, t dbSNP:220116863
6808 6808 a, g dbSNP:50611886
6823 6823 c, t dbSNP:255096925
6878 6878 a, g dbSNP:49178684
6881 6881 a, g dbSNP:221174491
6897 6897 c, t dbSNP:239644238
6904 6904 -, t dbSNP:243692372
6938 6938 c, t dbSNP:264610476
6950 6950 g, t dbSNP:234430526
6953 6953 a, c dbSNP:250188765
6954 6954 a, g dbSNP:264715900
6958 6958 -, a dbSNP:240115926
6990 6990 c, t dbSNP:226761283
7012 7012 a, c dbSNP:245139138
7130 7130 a, c dbSNP:216021261
7152 7152 c, g dbSNP:234024166
7188 7188 -, tgagctcaatggat dbSNP:261119203
7199 7199 a, g dbSNP:260225959
7204 7204 a, g dbSNP:219190842
7212 7212 a, g dbSNP:242011563
7228 7228 c, t dbSNP:256183140
7234 7234 a, g dbSNP:219920607
7256 7256 a, c dbSNP:45726787
7292 7292 a, g dbSNP:231973326
7297 7297 a, g dbSNP:249465171
7328 7328 a, t dbSNP:221232333
7403 7403 a, g dbSNP:238869723
7446 7446 a, t dbSNP:264019798
7453 7453 a, g dbSNP:226209256
7512 7512 a, t dbSNP:245453066
7621 7621 a, t dbSNP:261694370
7702 7702 c, t dbSNP:226812140
7706 7706 c, t dbSNP:239137103
7711 7711 c, g dbSNP:260098002
7725 7725 c, t dbSNP:227494619
7754 7754 -, t dbSNP:244582154
7756 7756 g, t dbSNP:254791750
7757 7757 a, t dbSNP:218175371
7810 7810 c, t dbSNP:233118706
7824 7824 a, t dbSNP:254171875
7835 7835 a, c dbSNP:211980447
7907 7907 -, c dbSNP:214920647
7956 7956 a, g dbSNP:232030870
7958 7958 a, g dbSNP:249527418
7959 7959 c, t dbSNP:50224043
8030 8030 g, t dbSNP:215734464
8049 8049 a, g dbSNP:232624402
8136 8136 c, t dbSNP:260664149
8162 8162 a, g dbSNP:48874784
8187 8187 c, t dbSNP:242684744
8189 8189 c, t dbSNP:261199956
8199 8199 a, g dbSNP:220591986
8220 8220 c, t dbSNP:239198824
8260 8260 c, t dbSNP:260156970
8315 8315 a, g dbSNP:227563946
8355 8355 -, gtgtgt dbSNP:233316663
8356 8356 -, ta dbSNP:223821384
8434 8434 c, t dbSNP:251583854
8484 8484 a, g dbSNP:264082494
8494 8494 c, t dbSNP:229309169
8512 8512 a, g dbSNP:249158054
8533 8533 a, g dbSNP:212046557
8540 8540 a, g dbSNP:226030260
8556 8556 a, t dbSNP:243722116
8574 8574 a, g dbSNP:215796231
8583 8583 c, t dbSNP:237679859
8612 8612 a, g dbSNP:264090722
8623 8623 c, t dbSNP:217624350
8638 8638 g, t dbSNP:236844958
8689 8689 -, ccccagccctaaaattattttgctg dbSNP:228556907
8792 8792 a, c dbSNP:249253923
8800 8800 c, g dbSNP:220644848
8803 8803 a, g dbSNP:232237955
8855 8855 c, g dbSNP:253885520
8916 8916 a, g dbSNP:221255954
8917 8917 a, g dbSNP:45637247
8930 8930 c, t dbSNP:248568766
8948 8948 c, t dbSNP:265973711

Target ORF information:

RefSeq Version NM_001142739
Organism Mus musculus (house mouse)
Definition Mus musculus protocadherin 15 (Pcdh15), transcript variant G, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu13244
Accession Version NM_001142740.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 5802bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product protocadherin-15 isoform CD1-7 precursor
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CJ166718.1, DQ354403.1, AK139154.1 and AC153858.3. Transcript Variant: This variant (E) lacks three alternate in-frame exons, compared to variant A. The resulting isoform (CD1-7), also known as protocadherin-15-CD1 isoform 7, has the same N- and C-termini but lacks three internal segments, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DQ354403.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164136, SAMN01164138 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)413..415(+)
Misc Feature(2)872..1141(+)
Misc Feature(3)893..1090(+)
Misc Feature(4)1262..1588(+)
Misc Feature(5)1283..1588(+)
Misc Feature(6)1616..1936(+)
Misc Feature(7)1637..1933(+)
Misc Feature(8)1958..2248(+)
Misc Feature(9)1979..2248(+)
Misc Feature(10)2282..2560(+)
Misc Feature(11)2300..2557(+)
Misc Feature(12)2585..2866(+)
Misc Feature(13)2606..2863(+)
Misc Feature(14)2888..3184(+)
Misc Feature(15)2909..3184(+)
Misc Feature(16)3209..3502(+)
Misc Feature(17)3230..3412(+)
Misc Feature(18)3554..3841(+)
Misc Feature(19)3560..3838(+)
Misc Feature(20)3866..4150(+)
Misc Feature(21)3884..4060(+)
Misc Feature(22)4550..4612(+)
Exon (1)1..393
Gene Synonym:
Exon (2)394..512
Gene Synonym:
Exon (3)513..578
Gene Synonym:
Exon (4)579..739
Gene Synonym:
Exon (5)740..895
Gene Synonym:
Exon (6)896..1015
Gene Synonym:
Exon (7)1016..1126
Gene Synonym:
Exon (8)1127..1297
Gene Synonym:
Exon (9)1298..1406
Gene Synonym:
Exon (10)1407..1519
Gene Synonym:
Exon (11)1520..1726
Gene Synonym:
Exon (12)1727..1861
Gene Synonym:
Exon (13)1862..2011
Gene Synonym:
Exon (14)2012..2205
Gene Synonym:
Exon (15)2206..2338
Gene Synonym:
Exon (16)2339..2418
Gene Synonym:
Exon (17)2419..2512
Gene Synonym:
Exon (18)2513..2641
Gene Synonym:
Exon (19)2642..2947
Gene Synonym:
Exon (20)2948..3172
Gene Synonym:
Exon (21)3173..3289
Gene Synonym:
Exon (22)3290..3430
Gene Synonym:
Exon (23)3431..3543
Gene Synonym:
Exon (24)3544..3653
Gene Synonym:
Exon (25)3654..3794
Gene Synonym:
Exon (26)3795..3922
Gene Synonym:
Exon (27)3923..4138
Gene Synonym:
Exon (28)4139..4227
Gene Synonym:
Exon (29)4228..4404
Gene Synonym:
Exon (30)4405..4623
Gene Synonym:
Exon (31)4624..4779
Gene Synonym:
Exon (32)4780..9034
Gene Synonym:
Position Chain Variation Link
82 82 c, t dbSNP:226206335
118 118 c, t dbSNP:235335068
135 135 a, g dbSNP:249524950
228 228 a, g dbSNP:220027179
303 303 c, t dbSNP:238626759
368 368 c, t dbSNP:259563704
369 369 a, g dbSNP:223911799
577 577 c, t dbSNP:46087908
595 595 c, t dbSNP:50061218
886 886 c, t dbSNP:244689568
1048 1048 a, g dbSNP:49962731
1123 1123 a, g dbSNP:256412847
1222 1222 c, t dbSNP:47222354
1657 1657 c, t dbSNP:232979244
1694 1694 a, c dbSNP:244779234
1771 1771 a, g dbSNP:234971152
1777 1777 c, t dbSNP:253848918
2002 2002 c, t dbSNP:244151985
2026 2026 c, t dbSNP:258930706
2200 2200 a, g dbSNP:229047978
2239 2239 a, t dbSNP:225553757
2359 2359 c, t dbSNP:46546428
2710 2710 c, t dbSNP:47972196
2725 2725 c, t dbSNP:236565609
2812 2812 c, t dbSNP:254494033
2923 2923 c, t dbSNP:212906806
2998 2998 a, g dbSNP:261949476
3049 3049 c, t dbSNP:228122452
3079 3079 c, g dbSNP:50379170
3133 3133 g, t dbSNP:265026670
3157 3157 c, g dbSNP:47892298
3193 3193 a, g dbSNP:265542592
3454 3454 c, t dbSNP:51119205
3457 3457 c, t dbSNP:48157089
3577 3577 a, g dbSNP:51765115
3610 3610 c, t dbSNP:50449153
3691 3691 c, t dbSNP:232407113
3889 3889 c, t dbSNP:48056426
3970 3970 c, t dbSNP:251516372
4240 4240 c, t dbSNP:240966622
4246 4246 g, t dbSNP:254718603
4723 4723 a, c dbSNP:221348700
4859 4859 a, c dbSNP:247089690
5089 5089 a, g dbSNP:264788330
5140 5140 a, g dbSNP:227262542
5223 5223 a, g dbSNP:255811802
5224 5224 a, g, t dbSNP:213998609
5232 5232 a, c dbSNP:227876075
5240 5240 a, g dbSNP:245533364
5245 5245 c, t dbSNP:217497061
5473 5473 c, t dbSNP:47551679
5500 5500 c, t dbSNP:256453274
5531 5531 a, g dbSNP:212390023
5551 5551 a, t dbSNP:237083139
5626 5626 c, t dbSNP:251246553
5652 5652 c, t dbSNP:219567688
5737 5737 a, c dbSNP:241213664
5854 5854 a, g dbSNP:52603492
5878 5878 c, t dbSNP:226556489
5879 5879 c, t dbSNP:249907062
5882 5882 a, g dbSNP:261832188
5899 5899 c, t dbSNP:219765160
5916 5916 a, g dbSNP:238081103
5980 5980 c, t dbSNP:255034472
6220 6220