Home » Species Summary » Mus musculus » Pik3cd cDNA ORF clone
Email to GenScript

Pik3cd cDNA ORF clone, Mus musculus (house mouse)

Gene Symbol Pik3cd
Entrez Gene ID 18707
Full Name phosphatidylinositol 3-kinase catalytic delta polypeptide
Synonyms 2410099E07Rik, 2610208K16Rik, AW545373, p110delta
General protein information
Gene Type protein-coding
Organism Mus musculus (house mouse)


4|4 E2

Summary lac of sum
Disorder MIM:

Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
XM_006538641 XP_006538704 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538642 XP_006538705 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538643 XP_006538706 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_011250205 XP_011248507 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538644 XP_006538707 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538645 XP_006538708 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538646 XP_006538709 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006538647 XP_006538710 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
XM_006538648 XP_006538711 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
XM_006538649 XP_006538712 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
XM_006538650 XP_006538713 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
XM_006538651 XP_006538714 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
XM_011250206 XP_011248508 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
XM_006538652 XP_006538715 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
XM_006538653 XP_006538716 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
XM_006535999 XP_006536062 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536000 XP_006536063 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536001 XP_006536064 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536002 XP_006536065 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536003 XP_006536066 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536004 XP_006536067 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
XM_006536006 XP_006536069 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
XM_006536007 XP_006536070 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
XM_006536008 XP_006536071 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
XM_006536011 XP_006536074 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
XM_006536013 XP_006536076 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
XM_006536015 XP_006536078 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
XM_006536016 XP_006536079 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
NM_001029837 NP_001025008 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
NM_008840 NP_032866 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform c
NM_001164049 NP_001157521 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
NM_001164050 NP_001157522 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform d
NM_001164051 NP_001157523 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform e
NM_001164052 NP_001157524 phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform a

mmu00562 Inositol phosphate metabolism
mmu04370 VEGF signaling pathway
mmu04070 Phosphatidylinositol signaling system
mmu04012 ErbB signaling pathway
mmu04210 Apoptosis
mmu04510 Focal adhesion
mmu04150 mTOR signaling pathway
mmu04664 Fc epsilon RI signaling pathway
mmu04650 Natural killer cell mediated cytotoxicity
mmu04662 B cell receptor signaling pathway
mmu04630 Jak-STAT signaling pathway
mmu04810 Regulation of actin cytoskeleton
mmu05211 Renal cell carcinoma
mmu04620 Toll-like receptor signaling pathway
mmu04670 Leukocyte transendothelial migration
mmu04910 Insulin signaling pathway
mmu04660 T cell receptor signaling pathway
mmu05210 Colorectal cancer
mmu05215 Prostate cancer
mmu05214 Glioma
mmu05220 Chronic myeloid leukemia
mmu05212 Pancreatic cancer
mmu05213 Endometrial cancer
mmu05218 Melanoma
mmu04930 Type II diabetes mellitus
mmu05221 Acute myeloid leukemia
mmu05200 Pathways in cancer
mmu05223 Non-small cell lung cancer
mmu05222 Small cell lung cancer
mmu04722 Neurotrophin signaling pathway
mmu04666 Fc gamma R-mediated phagocytosis
mmu04960 Aldosterone-regulated sodium reabsorption
mmu04914 Progesterone-mediated oocyte maturation
mmu04062 Chemokine signaling pathway
mmu05142 Chagas disease (American trypanosomiasis)
mmu05146 Amoebiasis
mmu05145 Toxoplasmosis
mmu04973 Carbohydrate digestion and absorption
mmu05160 Hepatitis C
mmu04380 Osteoclast differentiation
mmu05100 Bacterial invasion of epithelial cells
mmu05162 Measles
mmu04725 Cholinergic synapse
mmu05166 HTLV-I infection
mmu05164 Influenza A
mmu05203 Viral carcinogenesis
mmu05205 Proteoglycans in cancer
mmu04151 PI3K-Akt signaling pathway
mmu05161 Hepatitis B
mmu04066 HIF-1 signaling pathway
mmu05169 Epstein-Barr virus infection
mmu04261 Adrenergic signaling in cardiomyocytes
mmu04915 Estrogen signaling pathway
mmu04750 Inflammatory mediator regulation of TRP channels
mmu04068 FoxO signaling pathway
mmu04919 Thyroid hormone signaling pathway
mmu04921 Oxytocin signaling pathway
mmu04022 cGMP-PKG signaling pathway
mmu04611 Platelet activation
mmu04152 AMPK signaling pathway
mmu04024 cAMP signaling pathway
mmu04550 Signaling pathways regulating pluripotency of stem cells
mmu05231 Choline metabolism in cancer
mmu05230 Central carbon metabolism in cancer
mmu04071 Sphingolipid signaling pathway
mmu04668 TNF signaling pathway
mmu04917 Prolactin signaling pathway
mmu04923 Regulation of lipolysis in adipocytes
mmu04932 Non-alcoholic fatty liver disease (NAFLD)
mmu_M00676 PI3K-Akt signaling
mmu04014 Ras signaling pathway
mmu04015 Rap1 signaling pathway
MOUSE_PWY-6352 3-phosphoinositide biosynthesis
MOUSE_PWY3DJ-219 PIP metabolism
WP1763 PluriNetWork
WP93 IL-4 signaling Pathway
WP572 EGFR1 Signaling Pathway
WP450 IL-2 Signaling Pathway
WP1560 MicroRNAs in cardiomyocyte hypertrophy
WP298 G13 Signaling Pathway
WP65 Insulin Signaling
WP488 Alpha6-Beta4 Integrin Signaling Pathway
WP339 ESC Pluripotency Pathways
WP85 Focal Adhesion
WP373 IL-3 Signaling Pathway
WP523 Regulation of Actin Cytoskeleton
WP2309 XPodNet - protein-protein interactions in the podocyte expanded by STRING
WP2310 PodNet: protein-protein interactions in the podocyte
WP2292 Chemokine signaling pathway
PI3K PI3K/Akt/mTOR signaling pathway
Apoptosis Apoptosis signaling pathway

Homo sapiens (human) PIK3CD NP_005017.3
Pan troglodytes (chimpanzee) PIK3CD XP_001160824.1
Canis lupus familiaris (dog) PIK3CD XP_005620563.1
Bos taurus (cattle) PIK3CD NP_001192477.1
Mus musculus (house mouse) Pik3cd NP_032866.2
Rattus norvegicus (Norway rat) Pik3cd NP_001102448.1
Gallus gallus (chicken) PIK3CD NP_001012714.1
Danio rerio (zebrafish) pik3cd NP_957493.1
Drosophila melanogaster (fruit fly) Pi3K92E NP_732536.1


ID Name Evidence
GO:0005886 plasma membrane ISO
GO:0005942 phosphatidylinositol 3-kinase complex IEA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004428 inositol or phosphatidylinositol kinase activity IEA
GO:0005488 binding IEA
GO:0005524 ATP binding IEA
GO:0016301 kinase activity IEA
GO:0016303 1-phosphatidylinositol-3-kinase activity IEA
GO:0016740 transferase activity IEA
GO:0016772 transferase activity, transferring phosphorus-containing groups IEA
GO:0016773 phosphotransferase activity, alcohol group as acceptor IEA
GO:0046934 phosphatidylinositol-4,5-bisphosphate 3-kinase activity IEA


ID Name Evidence
GO:0001782 B cell homeostasis IMP
GO:0007165 signal transduction IEA
GO:0007166 cell surface receptor linked signaling pathway IMP
GO:0016310 phosphorylation IEA
GO:0042113 B cell activation IMP
GO:0046854 phosphatidylinositol phosphorylation IEA
GO:0048015 phosphatidylinositol-mediated signaling IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

Alleles of this type are documented at Mouse Genome Informatics  (MGI)

The following Pik3cd gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the Pik3cd cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OMu34052 XM_006538641 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538642 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538643 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_011250205 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538644 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538645 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538646 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34053 XM_006538647 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34054 XM_006538648 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 XM_006538649 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 XM_006538650 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_006538651 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_011250206 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 XM_006538652 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34055 XM_006538653 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OMu34052 XM_006535999 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536000 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536001 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536002 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536003 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536004 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34053 XM_006536006 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34054 XM_006536007 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 XM_006536008 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 XM_006536011 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_006536013 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 XM_006536015 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34055 XM_006536016 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OMu18986 NM_001029837 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19651 NM_008840 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 NM_001164049 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 NM_001164050 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19247 NM_001164051 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 NM_001164052 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OMu34052
Accession Version XM_006538641.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930776. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)481..714(+)
Misc Feature(2)940..1233(+)
Misc Feature(3)1330..1833(+)
Misc Feature(4)1900..2529(+)
Misc Feature(5)2503..3606(+)
Misc Feature(6)2734..3213(+)
Misc Feature(7)2938..3468(+)
Misc Feature(8)3079..3081(+)
Misc Feature(9)3148..3174(+)
Misc Feature(10)3211..3285(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538641
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538642.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930778. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)555..788(+)
Misc Feature(2)1014..1307(+)
Misc Feature(3)1404..1907(+)
Misc Feature(4)1974..2603(+)
Misc Feature(5)2577..3680(+)
Misc Feature(6)2808..3287(+)
Misc Feature(7)3012..3542(+)
Misc Feature(8)3153..3155(+)
Misc Feature(9)3222..3248(+)
Misc Feature(10)3285..3359(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538642
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538643.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930780. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)364..597(+)
Misc Feature(2)823..1116(+)
Misc Feature(3)1213..1716(+)
Misc Feature(4)1783..2412(+)
Misc Feature(5)2386..3489(+)
Misc Feature(6)2617..3096(+)
Misc Feature(7)2821..3351(+)
Misc Feature(8)2962..2964(+)
Misc Feature(9)3031..3057(+)
Misc Feature(10)3094..3168(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538643
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_011250205.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)276..509(+)
Misc Feature(2)735..1028(+)
Misc Feature(3)1125..1628(+)
Misc Feature(4)1695..2324(+)
Misc Feature(5)2298..3401(+)
Misc Feature(6)2529..3008(+)
Misc Feature(7)2733..3263(+)
Misc Feature(8)2874..2876(+)
Misc Feature(9)2943..2969(+)
Misc Feature(10)3006..3080(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_011250205
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538644.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930782. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)417..650(+)
Misc Feature(2)876..1169(+)
Misc Feature(3)1266..1769(+)
Misc Feature(4)1836..2465(+)
Misc Feature(5)2439..3542(+)
Misc Feature(6)2670..3149(+)
Misc Feature(7)2874..3404(+)
Misc Feature(8)3015..3017(+)
Misc Feature(9)3084..3110(+)
Misc Feature(10)3147..3221(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538644
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538645.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)287..520(+)
Misc Feature(2)746..1039(+)
Misc Feature(3)1136..1639(+)
Misc Feature(4)1706..2335(+)
Misc Feature(5)2309..3412(+)
Misc Feature(6)2540..3019(+)
Misc Feature(7)2744..3274(+)
Misc Feature(8)2885..2887(+)
Misc Feature(9)2954..2980(+)
Misc Feature(10)3017..3091(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538645
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538646.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)345..578(+)
Misc Feature(2)804..1097(+)
Misc Feature(3)1194..1697(+)
Misc Feature(4)1764..2393(+)
Misc Feature(5)2367..3470(+)
Misc Feature(6)2598..3077(+)
Misc Feature(7)2802..3332(+)
Misc Feature(8)2943..2945(+)
Misc Feature(9)3012..3038(+)
Misc Feature(10)3075..3149(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538646
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34053
Accession Version XM_006538647.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930788. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)479..712(+)
Misc Feature(2)938..1231(+)
Misc Feature(3)1328..1831(+)
Misc Feature(4)1898..2527(+)
Misc Feature(5)2501..3601(+)
Misc Feature(6)2729..3208(+)
Misc Feature(7)2933..3463(+)
Misc Feature(8)3074..3076(+)
Misc Feature(9)3143..3169(+)
Misc Feature(10)3206..3280(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538647
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34054
Accession Version XM_006538648.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930790. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)482..715(+)
Misc Feature(2)941..1234(+)
Misc Feature(3)1331..1834(+)
Misc Feature(4)1904..2527(+)
Misc Feature(5)2501..3604(+)
Misc Feature(6)2732..3211(+)
Misc Feature(7)2936..3466(+)
Misc Feature(8)3077..3079(+)
Misc Feature(9)3146..3172(+)
Misc Feature(10)3209..3283(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538648
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version XM_006538649.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930792. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)478..711(+)
Misc Feature(2)937..1230(+)
Misc Feature(3)1327..1830(+)
Misc Feature(4)1897..2448(+)
Misc Feature(5)2422..3522(+)
Misc Feature(6)2650..3129(+)
Misc Feature(7)2854..3384(+)
Misc Feature(8)2995..2997(+)
Misc Feature(9)3064..3090(+)
Misc Feature(10)3127..3201(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538649
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19695
Accession Version XM_006538650.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3138bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930794. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)478..711(+)
Misc Feature(2)937..1230(+)
Misc Feature(3)1327..1830(+)
Misc Feature(4)1897..2439(+)
Misc Feature(5)2413..3516(+)
Misc Feature(6)2644..3123(+)
Misc Feature(7)2848..3378(+)
Misc Feature(8)2989..2991(+)
Misc Feature(9)3058..3084(+)
Misc Feature(10)3121..3195(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538650
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_006538651.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930796. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)476..709(+)
Misc Feature(2)935..1228(+)
Misc Feature(3)1325..1828(+)
Misc Feature(4)1895..2437(+)
Misc Feature(5)2411..3511(+)
Misc Feature(6)2639..3118(+)
Misc Feature(7)2843..3373(+)
Misc Feature(8)2984..2986(+)
Misc Feature(9)3053..3079(+)
Misc Feature(10)3116..3190(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538651
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_011250206.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)276..509(+)
Misc Feature(2)735..1028(+)
Misc Feature(3)1125..1628(+)
Misc Feature(4)1695..2237(+)
Misc Feature(5)2211..3311(+)
Misc Feature(6)2439..2918(+)
Misc Feature(7)2643..3173(+)
Misc Feature(8)2784..2786(+)
Misc Feature(9)2853..2879(+)
Misc Feature(10)2916..2990(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_011250206
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19427
Accession Version XM_006538652.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3132bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930798. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)477..710(+)
Misc Feature(2)936..1229(+)
Misc Feature(3)1326..1829(+)
Misc Feature(4)1899..2435(+)
Misc Feature(5)2409..3509(+)
Misc Feature(6)2637..3116(+)
Misc Feature(7)2841..3371(+)
Misc Feature(8)2982..2984(+)
Misc Feature(9)3051..3077(+)
Misc Feature(10)3114..3188(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538652
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34055
Accession Version XM_006538653.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2439bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)325..747(+)
Misc Feature(2)814..1443(+)
Misc Feature(3)1417..2520(+)
Misc Feature(4)1648..2127(+)
Misc Feature(5)1852..2382(+)
Misc Feature(6)1993..1995(+)
Misc Feature(7)2062..2088(+)
Misc Feature(8)2125..2199(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538653
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006535999.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2445(+)
Misc Feature(5)2419..3522(+)
Misc Feature(6)2650..3129(+)
Misc Feature(7)2854..3384(+)
Misc Feature(8)2995..2997(+)
Misc Feature(9)3064..3090(+)
Misc Feature(10)3127..3201(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006535999
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536000.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)396..629(+)
Misc Feature(2)855..1148(+)
Misc Feature(3)1245..1748(+)
Misc Feature(4)1815..2444(+)
Misc Feature(5)2418..3521(+)
Misc Feature(6)2649..3128(+)
Misc Feature(7)2853..3383(+)
Misc Feature(8)2994..2996(+)
Misc Feature(9)3063..3089(+)
Misc Feature(10)3126..3200(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536000
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X6, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536001.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018987. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)279..512(+)
Misc Feature(2)738..1031(+)
Misc Feature(3)1128..1631(+)
Misc Feature(4)1698..2327(+)
Misc Feature(5)2301..3404(+)
Misc Feature(6)2532..3011(+)
Misc Feature(7)2736..3266(+)
Misc Feature(8)2877..2879(+)
Misc Feature(9)2946..2972(+)
Misc Feature(10)3009..3083(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536001
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536002.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018989. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)417..650(+)
Misc Feature(2)876..1169(+)
Misc Feature(3)1266..1769(+)
Misc Feature(4)1836..2465(+)
Misc Feature(5)2439..3542(+)
Misc Feature(6)2670..3149(+)
Misc Feature(7)2874..3404(+)
Misc Feature(8)3015..3017(+)
Misc Feature(9)3084..3110(+)
Misc Feature(10)3147..3221(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536002
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536003.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)287..520(+)
Misc Feature(2)746..1039(+)
Misc Feature(3)1136..1639(+)
Misc Feature(4)1706..2335(+)
Misc Feature(5)2309..3412(+)
Misc Feature(6)2540..3019(+)
Misc Feature(7)2744..3274(+)
Misc Feature(8)2885..2887(+)
Misc Feature(9)2954..2980(+)
Misc Feature(10)3017..3091(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536003
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536004.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)345..578(+)
Misc Feature(2)804..1097(+)
Misc Feature(3)1194..1697(+)
Misc Feature(4)1764..2393(+)
Misc Feature(5)2367..3470(+)
Misc Feature(6)2598..3077(+)
Misc Feature(7)2802..3332(+)
Misc Feature(8)2943..2945(+)
Misc Feature(9)3012..3038(+)
Misc Feature(10)3075..3149(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536004
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34053
Accession Version XM_006536006.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018997. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2445(+)
Misc Feature(5)2419..3519(+)
Misc Feature(6)2647..3126(+)
Misc Feature(7)2851..3381(+)
Misc Feature(8)2992..2994(+)
Misc Feature(9)3061..3087(+)
Misc Feature(10)3124..3198(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536006
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34054
Accession Version XM_006536007.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1819..2442(+)
Misc Feature(5)2416..3519(+)
Misc Feature(6)2647..3126(+)
Misc Feature(7)2851..3381(+)
Misc Feature(8)2992..2994(+)
Misc Feature(9)3061..3087(+)
Misc Feature(10)3124..3198(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536007
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version XM_006536008.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019001. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2367(+)
Misc Feature(5)2341..3441(+)
Misc Feature(6)2569..3048(+)
Misc Feature(7)2773..3303(+)
Misc Feature(8)2914..2916(+)
Misc Feature(9)2983..3009(+)
Misc Feature(10)3046..3120(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536008
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19695
Accession Version XM_006536011.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3138bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019007. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2358(+)
Misc Feature(5)2332..3435(+)
Misc Feature(6)2563..3042(+)
Misc Feature(7)2767..3297(+)
Misc Feature(8)2908..2910(+)
Misc Feature(9)2977..3003(+)
Misc Feature(10)3040..3114(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536011
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_006536013.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)396..629(+)
Misc Feature(2)855..1148(+)
Misc Feature(3)1245..1748(+)
Misc Feature(4)1815..2357(+)
Misc Feature(5)2331..3431(+)
Misc Feature(6)2559..3038(+)
Misc Feature(7)2763..3293(+)
Misc Feature(8)2904..2906(+)
Misc Feature(9)2973..2999(+)
Misc Feature(10)3036..3110(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536013
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19427
Accession Version XM_006536015.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3132bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019015. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1819..2355(+)
Misc Feature(5)2329..3429(+)
Misc Feature(6)2557..3036(+)
Misc Feature(7)2761..3291(+)
Misc Feature(8)2902..2904(+)
Misc Feature(9)2971..2997(+)
Misc Feature(10)3034..3108(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536015
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34055
Accession Version XM_006536016.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2439bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)325..747(+)
Misc Feature(2)814..1443(+)
Misc Feature(3)1417..2520(+)
Misc Feature(4)1648..2127(+)
Misc Feature(5)1852..2382(+)
Misc Feature(6)1993..1995(+)
Misc Feature(7)2062..2088(+)
Misc Feature(8)2125..2199(+)
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536016
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version NM_001029837.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CF164288.1, AK040867.1, AK149935.1, AK153304.1 and AW124359.1. On or before Mar 2, 2012 this sequence version replaced gi:377837187, gi:377837189, gi:377837191, gi:377837193, gi:377837195, gi:377837197, gi:377837199, gi:377837201, gi:377837203, gi:377837205, gi:377837207, gi:377837209, gi:377837211, gi:377837213, gi:377837215, gi:377837217, gi:71067115. Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 4. The resulting isoform (b) includes an additional 3-aa internal segment, compared to isoform c. Both variants 2 and 3 encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK040867.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)267..269(+)
Misc Feature(2)369..602(+)
Misc Feature(3)828..1121(+)
Misc Feature(4)1218..1721(+)
Misc Feature(5)1788..2339(+)
Misc Feature(6)2313..3413(+)
Misc Feature(7)2541..3020(+)
Misc Feature(8)2745..3275(+)
Misc Feature(9)2886..2888(+)
Misc Feature(10)2955..2981(+)
Misc Feature(11)3018..3092(+)
Exon (1)1..127
Gene Synonym:
Exon (2)128..246
Gene Synonym:
Exon (3)247..419
Gene Synonym:
Exon (4)420..648
Gene Synonym:
Exon (5)649..878
Gene Synonym:
Exon (6)879..1058
Gene Synonym:
Exon (7)1059..1208
Gene Synonym:
Exon (8)1209..1298
Gene Synonym:
Exon (9)1299..1520
Gene Synonym:
Exon (10)1521..1617
Gene Synonym:
Exon (11)1618..1748
Gene Synonym:
Exon (12)1749..1799
Gene Synonym:
Exon (13)1800..1967
Gene Synonym:
Exon (14)1968..2098
Gene Synonym:
Exon (15)2099..2242
Gene Synonym:
Exon (16)2243..2342
Gene Synonym:
Exon (17)2343..2521
Gene Synonym:
Exon (18)2522..2634
Gene Synonym:
Exon (19)2635..2713
Gene Synonym:
Exon (20)2714..2881
Gene Synonym:
Exon (21)2882..3005
Gene Synonym:
Exon (22)3006..3151
Gene Synonym:
Exon (23)3152..3284
Gene Synonym:
Exon (24)3285..4894
Gene Synonym:
Position Chain Variation Link
9 9 -, gtggttctttctggcttctc dbSNP:218461214
22 22 c, t dbSNP:387854858
28 28 a, c dbSNP:212036299
43 43 a, g dbSNP:387482248
45 45 c, t dbSNP:32062068
82 82 -, agtg dbSNP:253122108
103 103 a, t dbSNP:47150377
109 109 c, t dbSNP:216712105
209 209 a, g dbSNP:223972376
249 249 a, g dbSNP:239338675
255 255 a, g dbSNP:218964167
581 581 c, g dbSNP:240300958
623 623 c, t dbSNP:222723878
767 767 c, g dbSNP:213837013
818 818 c, t dbSNP:251700991
825 825 c, t dbSNP:236548726
830 830 c, t dbSNP:213119376
1031 1031 c, t dbSNP:220759106
1283 1283 g, t dbSNP:32625894
1313 1313 c, t dbSNP:222152211
1385 1385 c, t dbSNP:257984189
1630 1630 a, g dbSNP:260749632
1736 1736 c, t dbSNP:242945471
1952 1952 c, t dbSNP:32631645
2246 2246 c, t dbSNP:261481932
2342 2342 a, g dbSNP:235501245
2366 2366 a, g dbSNP:261669710
2393 2393 c, t dbSNP:32477590
2558 2558 a, g dbSNP:32630912
2591 2591 a, g dbSNP:239609762
2909 2909 a, g dbSNP:258949751
2951 2951 g, t dbSNP:51799546
2975 2975 c, t dbSNP:47860031
3107 3107 c, t dbSNP:256715650
3158 3158 a, c dbSNP:6365974
3179 3179 c, t dbSNP:6365934
3197 3197 c, t dbSNP:258157993
3236 3236 c, t dbSNP:236687438
3257 3257 c, t dbSNP:213222593
3260 3260 c, t dbSNP:248385673
3357 3357 a, c dbSNP:50245876
3392 3392 a, g dbSNP:254775112
3498 3498 c, g dbSNP:236808332
3606 3606 a, g dbSNP:214858058
3688 3688 a, c, g dbSNP:48275057
3703 3703 c, t dbSNP:49353469
3840 3840 c, t dbSNP:387099947
3886 3886 c, g dbSNP:214459290
3974 3974 a, g dbSNP:50863494
3979 3979 c, t dbSNP:51318895
4046 4046 a, g dbSNP:258855642
4104 4104 c, t dbSNP:247414873
4122 4122 c, t dbSNP:48281206
4133 4133 a, g dbSNP:265520140
4160 4160 g, t dbSNP:46963869
4174 4174 a, c dbSNP:46783071
4180 4180 a, g dbSNP:51750552
4273 4273 a, c dbSNP:50539445
4290 4290 a, g dbSNP:49120436
4307 4307 c, t dbSNP:48262359
4323 4323 -, ag dbSNP:229051276
4330 4330 c, t dbSNP:236746252
4357 4357 a, g dbSNP:49735657
4362 4362 g, t dbSNP:50235754
4375 4375 -, caccc dbSNP:250517494
4379 4379 a, g dbSNP:4224946
4406 4406 a, g dbSNP:387614635
4416 4416 c, t dbSNP:4224947
4435 4435 c, t dbSNP:4224948
4438 4438 a, g dbSNP:4224949
4481 4481 a, g dbSNP:4224950
4522 4522 g, t dbSNP:387548839
4593 4593 -, gtg dbSNP:240099061
4634 4634 c, t dbSNP:4224951
4638 4638 c, t dbSNP:386923887
4646 4646 c, t dbSNP:4224952
4654 4654 a, c dbSNP:4224953
4764 4764 -, ggcctgtgt dbSNP:234773386
4765 4765 c, t dbSNP:4224954
4792 4792 -, aa dbSNP:260773300
4792 4792 c, t dbSNP:13470755
4808 4808 a, g dbSNP:4224955
4839 4839 a, t dbSNP:229997234
4844 4844 a, g dbSNP:265318113

Target ORF information:

RefSeq Version NM_001029837
Organism Mus musculus (house mouse)
Definition Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version NM_008840.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform c
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL626808.28, AK149935.1, AK040867.1, AK153304.1 and AW124359.1. On or before Feb 15, 2015 this sequence version replaced gi:755567889, gi:569019013, gi:71067113. Transcript Variant: This variant (4) represents the longest transcript and encodes isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK149935.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)469..471(+)
Misc Feature(2)571..804(+)
Misc Feature(3)1030..1323(+)
Misc Feature(4)1420..1923(+)
Misc Feature(5)1990..2532(+)
Misc Feature(6)2050..2052(+)
Misc Feature(7)2506..3606(+)
Misc Feature(8)2734..3213(+)
Misc Feature(9)2938..3468(+)
Misc Feature(10)3079..3081(+)
Misc Feature(11)3148..3174(+)
Misc Feature(12)3211..3285(+)
Misc Feature(13)3595..3597(+)
Exon (1)1..154
Gene Synonym:
Exon (2)155..329
Gene Synonym:
Exon (3)330..448
Gene Synonym:
Exon (4)449..621
Gene Synonym:
Exon (5)622..850
Gene Synonym:
Exon (6)851..1080
Gene Synonym:
Exon (7)1081..1260
Gene Synonym:
Exon (8)1261..1410
Gene Synonym:
Exon (9)1411..1500
Gene Synonym:
Exon (10)1501..1722
Gene Synonym:
Exon (11)1723..1819
Gene Synonym:
Exon (12)1820..1950
Gene Synonym:
Exon (13)1951..2001
Gene Synonym:
Exon (14)2002..2169
Gene Synonym:
Exon (15)2170..2291
Gene Synonym:
Exon (16)2292..2435
Gene Synonym:
Exon (17)2436..2535
Gene Synonym:
Exon (18)2536..2714
Gene Synonym:
Exon (19)2715..2827
Gene Synonym:
Exon (20)2828..2906
Gene Synonym:
Exon (21)2907..3074
Gene Synonym:
Exon (22)3075..3198
Gene Synonym:
Exon (23)3199..3344
Gene Synonym:
Exon (24)3345..3477
Gene Synonym:
Exon (25)3478..5087
Gene Synonym:
Position Chain Variation Link
411 411 a, g dbSNP:223972376
451 451 a, g dbSNP:239338675
457 457 a, g dbSNP:218964167
783 783 c, g dbSNP:240300958
825 825 c, t dbSNP:222723878
969 969 c, g dbSNP:213837013
1020 1020 c, t dbSNP:251700991
1027 1027 c, t dbSNP:236548726
1032 1032 c, t dbSNP:213119376
1233 1233 c, t dbSNP:220759106
1485 1485 g, t dbSNP:32625894
1515 1515 c, t dbSNP:222152211
1587 1587 c, t dbSNP:257984189
1832 1832 a, g dbSNP:260749632
1938 1938 c, t dbSNP:242945471
2154 2154 c, t dbSNP:32631645
2439 2439 c, t dbSNP:261481932
2535 2535 a, g dbSNP:235501245
2559 2559 a, g dbSNP:261669710
2586 2586 c, t dbSNP:32477590
2751 2751 a, g dbSNP:32630912
2784 2784 a, g dbSNP:239609762
3102 3102 a, g dbSNP:258949751
3144 3144 g, t dbSNP:51799546
3168 3168 c, t dbSNP:47860031
3300 3300 c, t dbSNP:256715650
3351 3351 a, c dbSNP:6365974
3372 3372 c, t dbSNP:6365934
3390 3390 c, t dbSNP:258157993
3429 3429 c, t dbSNP:236687438
3450 3450 c, t dbSNP:213222593
3453 3453 c, t dbSNP:248385673
3550 3550 a, c dbSNP:50245876
3585 3585 a, g dbSNP:254775112
3691 3691 c, g dbSNP:236808332
3799 3799 a, g dbSNP:214858058
3881 3881 a, c, g dbSNP:48275057
3896 3896 c, t dbSNP:49353469
4033 4033 c, t dbSNP:387099947
4079 4079 c, g dbSNP:214459290
4167 4167 a, g dbSNP:50863494
4172 4172 c, t dbSNP:51318895
4239 4239 a, g dbSNP:258855642
4297 4297 c, t dbSNP:247414873
4315 4315 c, t dbSNP:48281206
4326 4326 a, g dbSNP:265520140
4353 4353 g, t dbSNP:46963869
4367 4367 a, c dbSNP:46783071
4373 4373 a, g dbSNP:51750552
4466 4466 a, c dbSNP:50539445
4483 4483 a, g dbSNP:49120436
4500 4500 c, t dbSNP:48262359
4516 4516 -, ag dbSNP:229051276
4523 4523 c, t dbSNP:236746252
4550 4550 a, g dbSNP:49735657
4555 4555 g, t dbSNP:50235754
4568 4568 -, caccc dbSNP:250517494
4572 4572 a, g dbSNP:4224946
4599 4599 a, g dbSNP:387614635
4609 4609 c, t dbSNP:4224947
4628 4628 c, t dbSNP:4224948
4631 4631 a, g dbSNP:4224949
4674 4674 a, g dbSNP:4224950
4715 4715 g, t dbSNP:387548839
4786 4786 -, gtg dbSNP:240099061
4827 4827 c, t dbSNP:4224951
4831 4831 c, t dbSNP:386923887
4839 4839 c, t dbSNP:4224952
4847 4847 a, c dbSNP:4224953
4957 4957 -, ggcctgtgt dbSNP:234773386
4958 4958 c, t dbSNP:4224954
4985 4985 -, aa dbSNP:260773300
4985 4985 c, t dbSNP:13470755
5001 5001 a, g dbSNP:4224955
5032 5032 a, t dbSNP:229997234
5037 5037 a, g dbSNP:265318113

Target ORF information:

RefSeq Version NM_008840
Organism Mus musculus (house mouse)
Definition Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version NM_001164049.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL626808.28 and AL607078.26. On or before Feb 15, 2015 this sequence version replaced gi:755567882, gi:569019003, gi:407264606, gi:407264608, gi:407264610, gi:407264612, gi:407264614, gi:407264616, gi:407264618, gi:407264620, gi:407264622, gi:407264624, gi:407264626, gi:407264628, gi:407264630, gi:407264632. Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 4. The resulting isoform (b) includes an additional 3-aa internal segment, compared to isoform c. Both variants 2 and 3 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK172222.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)294..296(+)
Misc Feature(2)396..629(+)
Misc Feature(3)855..1148(+)
Misc Feature(4)1245..1748(+)
Misc Feature(5)1815..2366(+)
Misc Feature(6)1875..1877(+)
Misc Feature(7)2340..3440(+)
Misc Feature(8)2568..3047(+)
Misc Feature(9)2772..3302(+)
Misc Feature(10)2913..2915(+)
Misc Feature(11)2982..3008(+)
Misc Feature(12)3045..3119(+)
Misc Feature(13)3429..3431(+)
Exon (1)1..154
Gene Synonym:
Exon (2)155..273
Gene Synonym:
Exon (3)274..446
Gene Synonym:
Exon (4)447..675
Gene Synonym:
Exon (5)676..905
Gene Synonym:
Exon (6)906..1085
Gene Synonym:
Exon (7)1086..1235
Gene Synonym:
Exon (8)1236..1325
Gene Synonym:
Exon (9)1326..1547
Gene Synonym:
Exon (10)1548..1644
Gene Synonym:
Exon (11)1645..1775
Gene Synonym:
Exon (12)1776..1826
Gene Synonym:
Exon (13)1827..1994
Gene Synonym:
Exon (14)1995..2125
Gene Synonym:
Exon (15)2126..2269
Gene Synonym:
Exon (16)2270..2369
Gene Synonym:
Exon (17)2370..2548
Gene Synonym:
Exon (18)2549..2661
Gene Synonym:
Exon (19)2662..2740
Gene Synonym:
Exon (20)2741..2908
Gene Synonym:
Exon (21)2909..3032
Gene Synonym:
Exon (22)3033..3178
Gene Synonym:
Exon (23)3179..3311
Gene Synonym:
Exon (24)3312..4921
Gene Synonym:
Position Chain Variation Link
236 236 a, g dbSNP:223972376
276 276 a, g dbSNP:239338675
282 282 a, g dbSNP:218964167
608 608 c, g dbSNP:240300958
650 650 c, t dbSNP:222723878
794 794 c, g dbSNP:213837013
845 845 c, t dbSNP:251700991
852 852 c, t dbSNP:236548726
857 857 c, t dbSNP:213119376
1058 1058 c, t dbSNP:220759106
1310 1310 g, t dbSNP:32625894
1340 1340 c, t dbSNP:222152211
1412 1412 c, t dbSNP:257984189
1657 1657 a, g dbSNP:260749632
1763 1763 c, t dbSNP:242945471
1979 1979 c, t dbSNP:32631645
2273 2273 c, t dbSNP:261481932
2369 2369 a, g dbSNP:235501245
2393 2393 a, g dbSNP:261669710
2420 2420 c, t dbSNP:32477590
2585 2585 a, g dbSNP:32630912
2618 2618 a, g dbSNP:239609762
2936 2936 a, g dbSNP:258949751
2978 2978 g, t dbSNP:51799546
3002 3002 c, t dbSNP:47860031
3134 3134 c, t dbSNP:256715650
3185 3185 a, c dbSNP:6365974
3206 3206 c, t dbSNP:6365934
3224 3224 c, t dbSNP:258157993
3263 3263 c, t dbSNP:236687438
3284 3284 c, t dbSNP:213222593
3287 3287 c, t dbSNP:248385673
3384 3384 a, c dbSNP:50245876
3419 3419 a, g dbSNP:254775112
3525 3525 c, g dbSNP:236808332
3633 3633 a, g dbSNP:214858058
3715 3715 a, c, g dbSNP:48275057
3730 3730 c, t dbSNP:49353469
3867 3867 c, t dbSNP:387099947
3913 3913 c, g dbSNP:214459290
4001 4001 a, g dbSNP:50863494
4006 4006 c, t dbSNP:51318895
4073 4073 a, g dbSNP:258855642
4131 4131 c, t dbSNP:247414873
4149 4149