Email to GenScript

Pik3cd phosphatidylinositol 3-kinase catalytic delta polypeptide [Mus musculus (house mouse)]

Gene Symbol Pik3cd
Entrez Gene ID 18707
Full Name phosphatidylinositol 3-kinase catalytic delta polypeptide
Synonyms 2410099E07Rik, 2610208K16Rik, AW545373, p110delta
General protein information
Gene Type protein-coding
Organism Mus musculus (house mouse)
Genome

4

4|4 E2

Summary lac of sum
Disorder MIM:

Disorder Html:





Alleles of this type are documented at Mouse Genome Informatics  (MGI)

The following Pik3cd gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the Pik3cd gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OMu34052 XM_006538641 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538642 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538643 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_011250205 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538644 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538645 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006538646 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34053 XM_006538647 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34054 XM_006538648 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 XM_006538649 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 XM_006538650 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_006538651 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_011250206 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 XM_006538652 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34055 XM_006538653 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OMu34052 XM_006535999 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536000 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536001 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536002 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536003 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34052 XM_006536004 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34053 XM_006536006 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34054 XM_006536007 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 XM_006536008 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 XM_006536011 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19651 XM_006536013 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 XM_006536015 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu34055 XM_006536016 PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OMu18986 NM_001029837 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19651 NM_008840 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu18986 NM_001164049 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OMu19695 NM_001164050 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19247 NM_001164051 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OMu19427 NM_001164052 Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OMu34052
Accession Version XM_006538641.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930776. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538704.1
CDS391..3615
Misc Feature(1)481..714(+)
Misc Feature(2)940..1233(+)
Misc Feature(3)1330..1833(+)
Misc Feature(4)1900..2529(+)
Misc Feature(5)2503..3606(+)
Misc Feature(6)2734..3213(+)
Misc Feature(7)2938..3468(+)
Misc Feature(8)3079..3081(+)
Misc Feature(9)3148..3174(+)
Misc Feature(10)3211..3285(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538641
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538641

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538642.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930778. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538705.1
CDS465..3689
Misc Feature(1)555..788(+)
Misc Feature(2)1014..1307(+)
Misc Feature(3)1404..1907(+)
Misc Feature(4)1974..2603(+)
Misc Feature(5)2577..3680(+)
Misc Feature(6)2808..3287(+)
Misc Feature(7)3012..3542(+)
Misc Feature(8)3153..3155(+)
Misc Feature(9)3222..3248(+)
Misc Feature(10)3285..3359(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538642
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538642

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538643.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930780. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538706.1
CDS274..3498
Misc Feature(1)364..597(+)
Misc Feature(2)823..1116(+)
Misc Feature(3)1213..1716(+)
Misc Feature(4)1783..2412(+)
Misc Feature(5)2386..3489(+)
Misc Feature(6)2617..3096(+)
Misc Feature(7)2821..3351(+)
Misc Feature(8)2962..2964(+)
Misc Feature(9)3031..3057(+)
Misc Feature(10)3094..3168(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538643
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538643

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_011250205.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011248507.1
CDS186..3410
Misc Feature(1)276..509(+)
Misc Feature(2)735..1028(+)
Misc Feature(3)1125..1628(+)
Misc Feature(4)1695..2324(+)
Misc Feature(5)2298..3401(+)
Misc Feature(6)2529..3008(+)
Misc Feature(7)2733..3263(+)
Misc Feature(8)2874..2876(+)
Misc Feature(9)2943..2969(+)
Misc Feature(10)3006..3080(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_011250205
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011250205

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538644.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930782. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538707.1
CDS327..3551
Misc Feature(1)417..650(+)
Misc Feature(2)876..1169(+)
Misc Feature(3)1266..1769(+)
Misc Feature(4)1836..2465(+)
Misc Feature(5)2439..3542(+)
Misc Feature(6)2670..3149(+)
Misc Feature(7)2874..3404(+)
Misc Feature(8)3015..3017(+)
Misc Feature(9)3084..3110(+)
Misc Feature(10)3147..3221(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538644
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538644

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538645.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538708.1
CDS197..3421
Misc Feature(1)287..520(+)
Misc Feature(2)746..1039(+)
Misc Feature(3)1136..1639(+)
Misc Feature(4)1706..2335(+)
Misc Feature(5)2309..3412(+)
Misc Feature(6)2540..3019(+)
Misc Feature(7)2744..3274(+)
Misc Feature(8)2885..2887(+)
Misc Feature(9)2954..2980(+)
Misc Feature(10)3017..3091(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538645
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538645

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006538646.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538709.1
CDS255..3479
Misc Feature(1)345..578(+)
Misc Feature(2)804..1097(+)
Misc Feature(3)1194..1697(+)
Misc Feature(4)1764..2393(+)
Misc Feature(5)2367..3470(+)
Misc Feature(6)2598..3077(+)
Misc Feature(7)2802..3332(+)
Misc Feature(8)2943..2945(+)
Misc Feature(9)3012..3038(+)
Misc Feature(10)3075..3149(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538646
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538646

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34053
Accession Version XM_006538647.2
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930788. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538710.1
CDS389..3610
Misc Feature(1)479..712(+)
Misc Feature(2)938..1231(+)
Misc Feature(3)1328..1831(+)
Misc Feature(4)1898..2527(+)
Misc Feature(5)2501..3601(+)
Misc Feature(6)2729..3208(+)
Misc Feature(7)2933..3463(+)
Misc Feature(8)3074..3076(+)
Misc Feature(9)3143..3169(+)
Misc Feature(10)3206..3280(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538647
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538647

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34054
Accession Version XM_006538648.2
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930790. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGGTGA GTAGAGAGGG GGGTTCGGGA AGACAGCCCC GGGGCAGATG GACAGTTCCC
GCCCACCCCT ACCTGACCAC CAAGCTGTCC CAGATGCTCT ATTTGCTGTG CTCCTGGCCC
GAGCTGCCTG TGCTGAGCGC CCTGGAACTT CTGGACTTTA GCTTTCCCGA CTGCTACGTG
GGCTCCTTCG CCATCAAGTC CCTTCGGAAG CTGACGGACG ATGAGCTCTT CCAGTACCTT
CTGCAGCTGG TGCAAGTGCT CAAATATGAG TCCTACCTGG ACTGCGAGCT GACCAAATTC
TTGCTGGGCC GAGCCCTGGC TAACCGCAAG ATCGGACACT TCCTGTTCTG GCACCTCCGC
TCTGAGATGC ACGTACCATC AGTGGCTCTG CGGTTTGGTC TCATCATGGA AGCCTACTGC
AGAGGCAGCA CCCACCACAT GAAGGTGCTG ATGAAGCAGG GGGAAGCACT GAGCAAGCTT
AAGGCACTGA ATGACTTTGT GAAGGTGAGT TCCCAGAAGA CCACCAAGCC CCAAACCAAG
GAGATGATGC ATATGTGCAT GCGCCAGGAG ACCTACATGG AGGCCCTGTC CCACCTGCAG
TCTCCACTCG ACCCCAGCAC CCTGCTGGAG GAAGTCTGCA GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538711.1
CDS392..3613
Misc Feature(1)482..715(+)
Misc Feature(2)941..1234(+)
Misc Feature(3)1331..1834(+)
Misc Feature(4)1904..2527(+)
Misc Feature(5)2501..3604(+)
Misc Feature(6)2732..3211(+)
Misc Feature(7)2936..3466(+)
Misc Feature(8)3077..3079(+)
Misc Feature(9)3146..3172(+)
Misc Feature(10)3209..3283(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538648
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538648

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGGTGA GTAGAGAGGG GGGTTCGGGA AGACAGCCCC GGGGCAGATG GACAGTTCCC
GCCCACCCCT ACCTGACCAC CAAGCTGTCC CAGATGCTCT ATTTGCTGTG CTCCTGGCCC
GAGCTGCCTG TGCTGAGCGC CCTGGAACTT CTGGACTTTA GCTTTCCCGA CTGCTACGTG
GGCTCCTTCG CCATCAAGTC CCTTCGGAAG CTGACGGACG ATGAGCTCTT CCAGTACCTT
CTGCAGCTGG TGCAAGTGCT CAAATATGAG TCCTACCTGG ACTGCGAGCT GACCAAATTC
TTGCTGGGCC GAGCCCTGGC TAACCGCAAG ATCGGACACT TCCTGTTCTG GCACCTCCGC
TCTGAGATGC ACGTACCATC AGTGGCTCTG CGGTTTGGTC TCATCATGGA AGCCTACTGC
AGAGGCAGCA CCCACCACAT GAAGGTGCTG ATGAAGCAGG GGGAAGCACT GAGCAAGCTT
AAGGCACTGA ATGACTTTGT GAAGGTGAGT TCCCAGAAGA CCACCAAGCC CCAAACCAAG
GAGATGATGC ATATGTGCAT GCGCCAGGAG ACCTACATGG AGGCCCTGTC CCACCTGCAG
TCTCCACTCG ACCCCAGCAC CCTGCTGGAG GAAGTCTGCA GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version XM_006538649.2
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930792. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538712.1
CDS388..3531
Misc Feature(1)478..711(+)
Misc Feature(2)937..1230(+)
Misc Feature(3)1327..1830(+)
Misc Feature(4)1897..2448(+)
Misc Feature(5)2422..3522(+)
Misc Feature(6)2650..3129(+)
Misc Feature(7)2854..3384(+)
Misc Feature(8)2995..2997(+)
Misc Feature(9)3064..3090(+)
Misc Feature(10)3127..3201(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538649
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538649

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19695
Accession Version XM_006538650.2
Sequence Information ORF Nucleotide Sequence (Length: 3138bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930794. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGCAGTGT GGAGCAGTGC ACCTTCATGG ACTCCAAAAT GAAGCCCCTG
TGGATCATGT ACAGCAGCGA GGAGGCGGGC AGTGCTGGCA ACGTGGGCAT CATCTTTAAG
AACGGGGATG ACCTCCGCCA GGACATGCTG ACTCTGCAGA TGATCCAGCT CATGGACGTC
CTGTGGAAGC AGGAGGGCCT GGACCTGAGG ATGACGCCCT ACGGCTGCCT CCCCACCGGG
GACCGCACAG GTCTCATCGA GGTGGTCCTC CACTCGGACA CCATCGCCAA CATCCAGCTG
AACAAAAGCA ACATGGCGGC CACAGCTGCC TTCAACAAGG ACGCCCTGCT CAACTGGCTC
AAGTCCAAGA ACCCTGGGGA GGCCCTGGAT CGGGCCATTG AGGAATTCAC CCTCTCCTGT
GCTGGCTACT GTGTGGCCAC ATATGTTCTG GGCATCGGTG ACCGGCACAG CGACAACATC
ATGATCAGAG AGAGTGGGCA GCTCTTCCAC ATTGATTTTG GCCACTTTCT GGGGAACTTC
AAGACCAAGT TTGGAATCAA CCGAGAGCGC GTCCCCTTCA TTCTCACCTA CGACTTTGTC
CACGTGATCC AGCAGGGGAA GACTAACAAC AGTGAGAAGT TTGAAAGGTT CCGCGGCTAC
TGTGAACGAG CCTATACCAT CCTGCGGCGC CACGGGCTGC TTTTCCTCCA TCTCTTCGCC
CTGATGCGGG CCGCAGGTCT GCCTGAGCTT AGCTGCTCCA AAGATATCCA GTATCTCAAG
GACTCTCTGG CACTGGGGAA GACGGAGGAA GAGGCGCTAA AGCACTTCCG GGTGAAGTTC
AACGAAGCTC TCCGAGAAAG CTGGAAAACC AAAGTCAACT GGCTGGCGCA CAATGTGTCC
AAGGATAACC GACAGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538713.1
CDS388..3525
Misc Feature(1)478..711(+)
Misc Feature(2)937..1230(+)
Misc Feature(3)1327..1830(+)
Misc Feature(4)1897..2439(+)
Misc Feature(5)2413..3516(+)
Misc Feature(6)2644..3123(+)
Misc Feature(7)2848..3378(+)
Misc Feature(8)2989..2991(+)
Misc Feature(9)3058..3084(+)
Misc Feature(10)3121..3195(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538650
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538650

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGCAGTGT GGAGCAGTGC ACCTTCATGG ACTCCAAAAT GAAGCCCCTG
TGGATCATGT ACAGCAGCGA GGAGGCGGGC AGTGCTGGCA ACGTGGGCAT CATCTTTAAG
AACGGGGATG ACCTCCGCCA GGACATGCTG ACTCTGCAGA TGATCCAGCT CATGGACGTC
CTGTGGAAGC AGGAGGGCCT GGACCTGAGG ATGACGCCCT ACGGCTGCCT CCCCACCGGG
GACCGCACAG GTCTCATCGA GGTGGTCCTC CACTCGGACA CCATCGCCAA CATCCAGCTG
AACAAAAGCA ACATGGCGGC CACAGCTGCC TTCAACAAGG ACGCCCTGCT CAACTGGCTC
AAGTCCAAGA ACCCTGGGGA GGCCCTGGAT CGGGCCATTG AGGAATTCAC CCTCTCCTGT
GCTGGCTACT GTGTGGCCAC ATATGTTCTG GGCATCGGTG ACCGGCACAG CGACAACATC
ATGATCAGAG AGAGTGGGCA GCTCTTCCAC ATTGATTTTG GCCACTTTCT GGGGAACTTC
AAGACCAAGT TTGGAATCAA CCGAGAGCGC GTCCCCTTCA TTCTCACCTA CGACTTTGTC
CACGTGATCC AGCAGGGGAA GACTAACAAC AGTGAGAAGT TTGAAAGGTT CCGCGGCTAC
TGTGAACGAG CCTATACCAT CCTGCGGCGC CACGGGCTGC TTTTCCTCCA TCTCTTCGCC
CTGATGCGGG CCGCAGGTCT GCCTGAGCTT AGCTGCTCCA AAGATATCCA GTATCTCAAG
GACTCTCTGG CACTGGGGAA GACGGAGGAA GAGGCGCTAA AGCACTTCCG GGTGAAGTTC
AACGAAGCTC TCCGAGAAAG CTGGAAAACC AAAGTCAACT GGCTGGCGCA CAATGTGTCC
AAGGATAACC GACAGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_006538651.2
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930796. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538714.1
CDS386..3520
Misc Feature(1)476..709(+)
Misc Feature(2)935..1228(+)
Misc Feature(3)1325..1828(+)
Misc Feature(4)1895..2437(+)
Misc Feature(5)2411..3511(+)
Misc Feature(6)2639..3118(+)
Misc Feature(7)2843..3373(+)
Misc Feature(8)2984..2986(+)
Misc Feature(9)3053..3079(+)
Misc Feature(10)3116..3190(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538651
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538651

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_011250206.1
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011248508.1
CDS186..3320
Misc Feature(1)276..509(+)
Misc Feature(2)735..1028(+)
Misc Feature(3)1125..1628(+)
Misc Feature(4)1695..2237(+)
Misc Feature(5)2211..3311(+)
Misc Feature(6)2439..2918(+)
Misc Feature(7)2643..3173(+)
Misc Feature(8)2784..2786(+)
Misc Feature(9)2853..2879(+)
Misc Feature(10)2916..2990(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_011250206
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X4, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011250206

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19427
Accession Version XM_006538652.2
Sequence Information ORF Nucleotide Sequence (Length: 3132bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:568930798. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGATGC TCTATTTGCT GTGCTCCTGG CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA
CTTCTGGACT TTAGCTTTCC CGACTGCTAC GTGGGCTCCT TCGCCATCAA GTCCCTTCGG
AAGCTGACGG ACGATGAGCT CTTCCAGTAC CTTCTGCAGC TGGTGCAAGT GCTCAAATAT
GAGTCCTACC TGGACTGCGA GCTGACCAAA TTCTTGCTGG GCCGAGCCCT GGCTAACCGC
AAGATCGGAC ACTTCCTGTT CTGGCACCTC CGCTCTGAGA TGCACGTACC ATCAGTGGCT
CTGCGGTTTG GTCTCATCAT GGAAGCCTAC TGCAGAGGCA GCACCCACCA CATGAAGGTG
CTGATGAAGC AGGGGGAAGC ACTGAGCAAG CTTAAGGCAC TGAATGACTT TGTGAAGGTG
AGTTCCCAGA AGACCACCAA GCCCCAAACC AAGGAGATGA TGCATATGTG CATGCGCCAG
GAGACCTACA TGGAGGCCCT GTCCCACCTG CAGTCTCCAC TCGACCCCAG CACCCTGCTG
GAGGAAGTCT GTGTGGAGCA GTGCACCTTC ATGGACTCCA AAATGAAGCC CCTGTGGATC
ATGTACAGCA GCGAGGAGGC GGGCAGTGCT GGCAACGTGG GCATCATCTT TAAGAACGGG
GATGACCTCC GCCAGGACAT GCTGACTCTG CAGATGATCC AGCTCATGGA CGTCCTGTGG
AAGCAGGAGG GCCTGGACCT GAGGATGACG CCCTACGGCT GCCTCCCCAC CGGGGACCGC
ACAGGTCTCA TCGAGGTGGT CCTCCACTCG GACACCATCG CCAACATCCA GCTGAACAAA
AGCAACATGG CGGCCACAGC TGCCTTCAAC AAGGACGCCC TGCTCAACTG GCTCAAGTCC
AAGAACCCTG GGGAGGCCCT GGATCGGGCC ATTGAGGAAT TCACCCTCTC CTGTGCTGGC
TACTGTGTGG CCACATATGT TCTGGGCATC GGTGACCGGC ACAGCGACAA CATCATGATC
AGAGAGAGTG GGCAGCTCTT CCACATTGAT TTTGGCCACT TTCTGGGGAA CTTCAAGACC
AAGTTTGGAA TCAACCGAGA GCGCGTCCCC TTCATTCTCA CCTACGACTT TGTCCACGTG
ATCCAGCAGG GGAAGACTAA CAACAGTGAG AAGTTTGAAA GGTTCCGCGG CTACTGTGAA
CGAGCCTATA CCATCCTGCG GCGCCACGGG CTGCTTTTCC TCCATCTCTT CGCCCTGATG
CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC TCCAAAGATA TCCAGTATCT CAAGGACTCT
CTGGCACTGG GGAAGACGGA GGAAGAGGCG CTAAAGCACT TCCGGGTGAA GTTCAACGAA
GCTCTCCGAG AAAGCTGGAA AACCAAAGTC AACTGGCTGG CGCACAATGT GTCCAAGGAT
AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538715.1
CDS387..3518
Misc Feature(1)477..710(+)
Misc Feature(2)936..1229(+)
Misc Feature(3)1326..1829(+)
Misc Feature(4)1899..2435(+)
Misc Feature(5)2409..3509(+)
Misc Feature(6)2637..3116(+)
Misc Feature(7)2841..3371(+)
Misc Feature(8)2982..2984(+)
Misc Feature(9)3051..3077(+)
Misc Feature(10)3114..3188(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538652
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538652

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGATGC TCTATTTGCT GTGCTCCTGG CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA
CTTCTGGACT TTAGCTTTCC CGACTGCTAC GTGGGCTCCT TCGCCATCAA GTCCCTTCGG
AAGCTGACGG ACGATGAGCT CTTCCAGTAC CTTCTGCAGC TGGTGCAAGT GCTCAAATAT
GAGTCCTACC TGGACTGCGA GCTGACCAAA TTCTTGCTGG GCCGAGCCCT GGCTAACCGC
AAGATCGGAC ACTTCCTGTT CTGGCACCTC CGCTCTGAGA TGCACGTACC ATCAGTGGCT
CTGCGGTTTG GTCTCATCAT GGAAGCCTAC TGCAGAGGCA GCACCCACCA CATGAAGGTG
CTGATGAAGC AGGGGGAAGC ACTGAGCAAG CTTAAGGCAC TGAATGACTT TGTGAAGGTG
AGTTCCCAGA AGACCACCAA GCCCCAAACC AAGGAGATGA TGCATATGTG CATGCGCCAG
GAGACCTACA TGGAGGCCCT GTCCCACCTG CAGTCTCCAC TCGACCCCAG CACCCTGCTG
GAGGAAGTCT GTGTGGAGCA GTGCACCTTC ATGGACTCCA AAATGAAGCC CCTGTGGATC
ATGTACAGCA GCGAGGAGGC GGGCAGTGCT GGCAACGTGG GCATCATCTT TAAGAACGGG
GATGACCTCC GCCAGGACAT GCTGACTCTG CAGATGATCC AGCTCATGGA CGTCCTGTGG
AAGCAGGAGG GCCTGGACCT GAGGATGACG CCCTACGGCT GCCTCCCCAC CGGGGACCGC
ACAGGTCTCA TCGAGGTGGT CCTCCACTCG GACACCATCG CCAACATCCA GCTGAACAAA
AGCAACATGG CGGCCACAGC TGCCTTCAAC AAGGACGCCC TGCTCAACTG GCTCAAGTCC
AAGAACCCTG GGGAGGCCCT GGATCGGGCC ATTGAGGAAT TCACCCTCTC CTGTGCTGGC
TACTGTGTGG CCACATATGT TCTGGGCATC GGTGACCGGC ACAGCGACAA CATCATGATC
AGAGAGAGTG GGCAGCTCTT CCACATTGAT TTTGGCCACT TTCTGGGGAA CTTCAAGACC
AAGTTTGGAA TCAACCGAGA GCGCGTCCCC TTCATTCTCA CCTACGACTT TGTCCACGTG
ATCCAGCAGG GGAAGACTAA CAACAGTGAG AAGTTTGAAA GGTTCCGCGG CTACTGTGAA
CGAGCCTATA CCATCCTGCG GCGCCACGGG CTGCTTTTCC TCCATCTCTT CGCCCTGATG
CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC TCCAAAGATA TCCAGTATCT CAAGGACTCT
CTGGCACTGG GGAAGACGGA GGAAGAGGCG CTAAAGCACT TCCGGGTGAA GTTCAACGAA
GCTCTCCGAG AAAGCTGGAA AACCAAAGTC AACTGGCTGG CGCACAATGT GTCCAAGGAT
AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34055
Accession Version XM_006538653.1
Sequence Information ORF Nucleotide Sequence (Length: 2439bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_187033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
ATGTCACACG AAAGCCACCT GACCACATTA CCCAGCCTCC CTGCCTGGAG TGGTTGTAAG 
CTGCTTCAAA ACAGGAAGGG GGAGTGGGGT GGGCCAGCCA GCCAGAGACT GATTCGTGGA
AACCCGGGCA GAGCAGATTT CTGTGTATTT GACTTTGGTG GAGGTTGTGG GGATGAAAGA
GGCATCCGGG GAGGTGTGAG AGGTGCAAGG AAGAGCCTGC TGCAGCTGGT CTGGCTGGTT
GTTCAGGCCG GGCTCTTCCA TGGCAATGAG ATGCTGTGCA AGACTGTGTC AAGCTCGGAG
GTGAATGTAT GCTCAGAGCC CGTGTGGAAG CAGCGACTGG AGTTCGATAT CAGCGTCTGT
GACCTCCCGC GCATGGCTCG ACTCTGTTTT GCTCTCTATG CCGTCGTGGA GAAGGCTAAG
AAGGCACGCT CCACAAAGAA GAAGTCTAAG AAGGCGGACT GCCCCATCGC TTGGGCCAAC
CTCATGCTAT TCGACTACAA AGATCAGCTC AAGACGGGGG AGCGCTGCCT CTACATGTGG
CCCTCTGTCC CAGATGAGAA GGGAGAGCTG CTGAATCCTG CGGGTACAGT GCGCGGGAAC
CCCAACACGG AGAGTGCCGC TGCCCTGGTC ATCTACCTGC CTGAGGTGGC CCCCCACCCT
GTGTACTTCC CCGCTCTGGA GAAGATCCTG GAGCTGGGGC GTCACGGGGA GCGTGGGCGC
ATCACGGAGG AGGAGCAGCT GCAGCTGCGG GAGATCCTGG AACGGCGGGG ATCCGGGGAA
CTGTACGAAC ATGAGAAGGA CCTGGTGTGG AAGATGCGCC ACGAAGTCCA GGAGCATTTC
CCAGAGGCGC TGGCCCGCCT GCTGCTGGTC ACCAAGTGGA ATAAACACGA GGATGTGGCC
CAGGTGAGTA GAGAGGGGGG TTCGGGAAGA CAGCCCCGGG GCAGATGGAC AGTTCCCGCC
CACCCCTACC TGACCACCAA GCTGTCCCAG ATGCTCTATT TGCTGTGCTC CTGGCCCGAG
CTGCCTGTGC TGAGCGCCCT GGAACTTCTG GACTTTAGCT TTCCCGACTG CTACGTGGGC
TCCTTCGCCA TCAAGTCCCT TCGGAAGCTG ACGGACGATG AGCTCTTCCA GTACCTTCTG
CAGCTGGTGC AAGTGCTCAA ATATGAGTCC TACCTGGACT GCGAGCTGAC CAAATTCTTG
CTGGGCCGAG CCCTGGCTAA CCGCAAGATC GGACACTTCC TGTTCTGGCA CCTCCGCTCT
GAGATGCACG TACCATCAGT GGCTCTGCGG TTTGGTCTCA TCATGGAAGC CTACTGCAGA
GGCAGCACCC ACCACATGAA GGTGCTGATG AAGCAGGGGG AAGCACTGAG CAAGCTTAAG
GCACTGAATG ACTTTGTGAA GGTGAGTTCC CAGAAGACCA CCAAGCCCCA AACCAAGGAG
ATGATGCATA TGTGCATGCG CCAGGAGACC TACATGGAGG CCCTGTCCCA CCTGCAGTCT
CCACTCGACC CCAGCACCCT GCTGGAGGAA GTCTGCAGTG TGGAGCAGTG CACCTTCATG
GACTCCAAAA TGAAGCCCCT GTGGATCATG TACAGCAGCG AGGAGGCGGG CAGTGCTGGC
AACGTGGGCA TCATCTTTAA GAACGGGGAT GACCTCCGCC AGGACATGCT GACTCTGCAG
ATGATCCAGC TCATGGACGT CCTGTGGAAG CAGGAGGGCC TGGACCTGAG GATGACGCCC
TACGGCTGCC TCCCCACCGG GGACCGCACA GGTCTCATCG AGGTGGTCCT CCACTCGGAC
ACCATCGCCA ACATCCAGCT GAACAAAAGC AACATGGCGG CCACAGCTGC CTTCAACAAG
GACGCCCTGC TCAACTGGCT CAAGTCCAAG AACCCTGGGG AGGCCCTGGA TCGGGCCATT
GAGGAATTCA CCCTCTCCTG TGCTGGCTAC TGTGTGGCCA CATATGTTCT GGGCATCGGT
GACCGGCACA GCGACAACAT CATGATCAGA GAGAGTGGGC AGCTCTTCCA CATTGATTTT
GGCCACTTTC TGGGGAACTT CAAGACCAAG TTTGGAATCA ACCGAGAGCG CGTCCCCTTC
ATTCTCACCT ACGACTTTGT CCACGTGATC CAGCAGGGGA AGACTAACAA CAGTGAGAAG
TTTGAAAGGT TCCGCGGCTA CTGTGAACGA GCCTATACCA TCCTGCGGCG CCACGGGCTG
CTTTTCCTCC ATCTCTTCGC CCTGATGCGG GCCGCAGGTC TGCCTGAGCT TAGCTGCTCC
AAAGATATCC AGTATCTCAA GGACTCTCTG GCACTGGGGA AGACGGAGGA AGAGGCGCTA
AAGCACTTCC GGGTGAAGTT CAACGAAGCT CTCCGAGAAA GCTGGAAAAC CAAAGTCAAC
TGGCTGGCGC ACAATGTGTC CAAGGATAAC CGACAGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006538716.1
CDS91..2529
Misc Feature(1)325..747(+)
Misc Feature(2)814..1443(+)
Misc Feature(3)1417..2520(+)
Misc Feature(4)1648..2127(+)
Misc Feature(5)1852..2382(+)
Misc Feature(6)1993..1995(+)
Misc Feature(7)2062..2088(+)
Misc Feature(8)2125..2199(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006538653
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006538653

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
ATGTCACACG AAAGCCACCT GACCACATTA CCCAGCCTCC CTGCCTGGAG TGGTTGTAAG 
CTGCTTCAAA ACAGGAAGGG GGAGTGGGGT GGGCCAGCCA GCCAGAGACT GATTCGTGGA
AACCCGGGCA GAGCAGATTT CTGTGTATTT GACTTTGGTG GAGGTTGTGG GGATGAAAGA
GGCATCCGGG GAGGTGTGAG AGGTGCAAGG AAGAGCCTGC TGCAGCTGGT CTGGCTGGTT
GTTCAGGCCG GGCTCTTCCA TGGCAATGAG ATGCTGTGCA AGACTGTGTC AAGCTCGGAG
GTGAATGTAT GCTCAGAGCC CGTGTGGAAG CAGCGACTGG AGTTCGATAT CAGCGTCTGT
GACCTCCCGC GCATGGCTCG ACTCTGTTTT GCTCTCTATG CCGTCGTGGA GAAGGCTAAG
AAGGCACGCT CCACAAAGAA GAAGTCTAAG AAGGCGGACT GCCCCATCGC TTGGGCCAAC
CTCATGCTAT TCGACTACAA AGATCAGCTC AAGACGGGGG AGCGCTGCCT CTACATGTGG
CCCTCTGTCC CAGATGAGAA GGGAGAGCTG CTGAATCCTG CGGGTACAGT GCGCGGGAAC
CCCAACACGG AGAGTGCCGC TGCCCTGGTC ATCTACCTGC CTGAGGTGGC CCCCCACCCT
GTGTACTTCC CCGCTCTGGA GAAGATCCTG GAGCTGGGGC GTCACGGGGA GCGTGGGCGC
ATCACGGAGG AGGAGCAGCT GCAGCTGCGG GAGATCCTGG AACGGCGGGG ATCCGGGGAA
CTGTACGAAC ATGAGAAGGA CCTGGTGTGG AAGATGCGCC ACGAAGTCCA GGAGCATTTC
CCAGAGGCGC TGGCCCGCCT GCTGCTGGTC ACCAAGTGGA ATAAACACGA GGATGTGGCC
CAGGTGAGTA GAGAGGGGGG TTCGGGAAGA CAGCCCCGGG GCAGATGGAC AGTTCCCGCC
CACCCCTACC TGACCACCAA GCTGTCCCAG ATGCTCTATT TGCTGTGCTC CTGGCCCGAG
CTGCCTGTGC TGAGCGCCCT GGAACTTCTG GACTTTAGCT TTCCCGACTG CTACGTGGGC
TCCTTCGCCA TCAAGTCCCT TCGGAAGCTG ACGGACGATG AGCTCTTCCA GTACCTTCTG
CAGCTGGTGC AAGTGCTCAA ATATGAGTCC TACCTGGACT GCGAGCTGAC CAAATTCTTG
CTGGGCCGAG CCCTGGCTAA CCGCAAGATC GGACACTTCC TGTTCTGGCA CCTCCGCTCT
GAGATGCACG TACCATCAGT GGCTCTGCGG TTTGGTCTCA TCATGGAAGC CTACTGCAGA
GGCAGCACCC ACCACATGAA GGTGCTGATG AAGCAGGGGG AAGCACTGAG CAAGCTTAAG
GCACTGAATG ACTTTGTGAA GGTGAGTTCC CAGAAGACCA CCAAGCCCCA AACCAAGGAG
ATGATGCATA TGTGCATGCG CCAGGAGACC TACATGGAGG CCCTGTCCCA CCTGCAGTCT
CCACTCGACC CCAGCACCCT GCTGGAGGAA GTCTGCAGTG TGGAGCAGTG CACCTTCATG
GACTCCAAAA TGAAGCCCCT GTGGATCATG TACAGCAGCG AGGAGGCGGG CAGTGCTGGC
AACGTGGGCA TCATCTTTAA GAACGGGGAT GACCTCCGCC AGGACATGCT GACTCTGCAG
ATGATCCAGC TCATGGACGT CCTGTGGAAG CAGGAGGGCC TGGACCTGAG GATGACGCCC
TACGGCTGCC TCCCCACCGG GGACCGCACA GGTCTCATCG AGGTGGTCCT CCACTCGGAC
ACCATCGCCA ACATCCAGCT GAACAAAAGC AACATGGCGG CCACAGCTGC CTTCAACAAG
GACGCCCTGC TCAACTGGCT CAAGTCCAAG AACCCTGGGG AGGCCCTGGA TCGGGCCATT
GAGGAATTCA CCCTCTCCTG TGCTGGCTAC TGTGTGGCCA CATATGTTCT GGGCATCGGT
GACCGGCACA GCGACAACAT CATGATCAGA GAGAGTGGGC AGCTCTTCCA CATTGATTTT
GGCCACTTTC TGGGGAACTT CAAGACCAAG TTTGGAATCA ACCGAGAGCG CGTCCCCTTC
ATTCTCACCT ACGACTTTGT CCACGTGATC CAGCAGGGGA AGACTAACAA CAGTGAGAAG
TTTGAAAGGT TCCGCGGCTA CTGTGAACGA GCCTATACCA TCCTGCGGCG CCACGGGCTG
CTTTTCCTCC ATCTCTTCGC CCTGATGCGG GCCGCAGGTC TGCCTGAGCT TAGCTGCTCC
AAAGATATCC AGTATCTCAA GGACTCTCTG GCACTGGGGA AGACGGAGGA AGAGGCGCTA
AAGCACTTCC GGGTGAAGTT CAACGAAGCT CTCCGAGAAA GCTGGAAAAC CAAAGTCAAC
TGGCTGGCGC ACAATGTGTC CAAGGATAAC CGACAGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006535999.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536062.1
CDS307..3531
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2445(+)
Misc Feature(5)2419..3522(+)
Misc Feature(6)2650..3129(+)
Misc Feature(7)2854..3384(+)
Misc Feature(8)2995..2997(+)
Misc Feature(9)3064..3090(+)
Misc Feature(10)3127..3201(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006535999
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X5, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006535999

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536000.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536063.1
CDS306..3530
Misc Feature(1)396..629(+)
Misc Feature(2)855..1148(+)
Misc Feature(3)1245..1748(+)
Misc Feature(4)1815..2444(+)
Misc Feature(5)2418..3521(+)
Misc Feature(6)2649..3128(+)
Misc Feature(7)2853..3383(+)
Misc Feature(8)2994..2996(+)
Misc Feature(9)3063..3089(+)
Misc Feature(10)3126..3200(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536000
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X6, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536000

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536001.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018987. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536064.1
CDS189..3413
Misc Feature(1)279..512(+)
Misc Feature(2)738..1031(+)
Misc Feature(3)1128..1631(+)
Misc Feature(4)1698..2327(+)
Misc Feature(5)2301..3404(+)
Misc Feature(6)2532..3011(+)
Misc Feature(7)2736..3266(+)
Misc Feature(8)2877..2879(+)
Misc Feature(9)2946..2972(+)
Misc Feature(10)3009..3083(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536001
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X7, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536001

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536002.2
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018989. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536065.1
CDS327..3551
Misc Feature(1)417..650(+)
Misc Feature(2)876..1169(+)
Misc Feature(3)1266..1769(+)
Misc Feature(4)1836..2465(+)
Misc Feature(5)2439..3542(+)
Misc Feature(6)2670..3149(+)
Misc Feature(7)2874..3404(+)
Misc Feature(8)3015..3017(+)
Misc Feature(9)3084..3110(+)
Misc Feature(10)3147..3221(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536002
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X8, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536002

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536003.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536066.1
CDS197..3421
Misc Feature(1)287..520(+)
Misc Feature(2)746..1039(+)
Misc Feature(3)1136..1639(+)
Misc Feature(4)1706..2335(+)
Misc Feature(5)2309..3412(+)
Misc Feature(6)2540..3019(+)
Misc Feature(7)2744..3274(+)
Misc Feature(8)2885..2887(+)
Misc Feature(9)2954..2980(+)
Misc Feature(10)3017..3091(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536003
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X9, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536003

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34052
Accession Version XM_006536004.1
Sequence Information ORF Nucleotide Sequence (Length: 3225bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536067.1
CDS255..3479
Misc Feature(1)345..578(+)
Misc Feature(2)804..1097(+)
Misc Feature(3)1194..1697(+)
Misc Feature(4)1764..2393(+)
Misc Feature(5)2367..3470(+)
Misc Feature(6)2598..3077(+)
Misc Feature(7)2802..3332(+)
Misc Feature(8)2943..2945(+)
Misc Feature(9)3012..3038(+)
Misc Feature(10)3075..3149(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536004
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X10, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536004

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GCAGTGTGGA GCAGTGCACC
TTCATGGACT CCAAAATGAA GCCCCTGTGG ATCATGTACA GCAGCGAGGA GGCGGGCAGT
GCTGGCAACG TGGGCATCAT CTTTAAGAAC GGGGATGACC TCCGCCAGGA CATGCTGACT
CTGCAGATGA TCCAGCTCAT GGACGTCCTG TGGAAGCAGG AGGGCCTGGA CCTGAGGATG
ACGCCCTACG GCTGCCTCCC CACCGGGGAC CGCACAGGTC TCATCGAGGT GGTCCTCCAC
TCGGACACCA TCGCCAACAT CCAGCTGAAC AAAAGCAACA TGGCGGCCAC AGCTGCCTTC
AACAAGGACG CCCTGCTCAA CTGGCTCAAG TCCAAGAACC CTGGGGAGGC CCTGGATCGG
GCCATTGAGG AATTCACCCT CTCCTGTGCT GGCTACTGTG TGGCCACATA TGTTCTGGGC
ATCGGTGACC GGCACAGCGA CAACATCATG ATCAGAGAGA GTGGGCAGCT CTTCCACATT
GATTTTGGCC ACTTTCTGGG GAACTTCAAG ACCAAGTTTG GAATCAACCG AGAGCGCGTC
CCCTTCATTC TCACCTACGA CTTTGTCCAC GTGATCCAGC AGGGGAAGAC TAACAACAGT
GAGAAGTTTG AAAGGTTCCG CGGCTACTGT GAACGAGCCT ATACCATCCT GCGGCGCCAC
GGGCTGCTTT TCCTCCATCT CTTCGCCCTG ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC
TGCTCCAAAG ATATCCAGTA TCTCAAGGAC TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG
GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC GAAGCTCTCC GAGAAAGCTG GAAAACCAAA
GTCAACTGGC TGGCGCACAA TGTGTCCAAG GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34053
Accession Version XM_006536006.2
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569018997. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536069.1
CDS307..3528
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2445(+)
Misc Feature(5)2419..3519(+)
Misc Feature(6)2647..3126(+)
Misc Feature(7)2851..3381(+)
Misc Feature(8)2992..2994(+)
Misc Feature(9)3061..3087(+)
Misc Feature(10)3124..3198(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536006
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X11, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536006

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGG TGAGTAGAGA GGGGGGTTCG GGAAGACAGC CCCGGGGCAG ATGGACAGTT
CCCGCCCACC CCTACCTGAC CACCAAGCTG TCCCAGATGC TCTATTTGCT GTGCTCCTGG
CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA CTTCTGGACT TTAGCTTTCC CGACTGCTAC
GTGGGCTCCT TCGCCATCAA GTCCCTTCGG AAGCTGACGG ACGATGAGCT CTTCCAGTAC
CTTCTGCAGC TGGTGCAAGT GCTCAAATAT GAGTCCTACC TGGACTGCGA GCTGACCAAA
TTCTTGCTGG GCCGAGCCCT GGCTAACCGC AAGATCGGAC ACTTCCTGTT CTGGCACCTC
CGCTCTGAGA TGCACGTACC ATCAGTGGCT CTGCGGTTTG GTCTCATCAT GGAAGCCTAC
TGCAGAGGCA GCACCCACCA CATGAAGGTG CTGATGAAGC AGGGGGAAGC ACTGAGCAAG
CTTAAGGCAC TGAATGACTT TGTGAAGGTG AGTTCCCAGA AGACCACCAA GCCCCAAACC
AAGGAGATGA TGCATATGTG CATGCGCCAG GAGACCTACA TGGAGGCCCT GTCCCACCTG
CAGTCTCCAC TCGACCCCAG CACCCTGCTG GAGGAAGTCT GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34054
Accession Version XM_006536007.1
Sequence Information ORF Nucleotide Sequence (Length: 3222bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGGTGA GTAGAGAGGG GGGTTCGGGA AGACAGCCCC GGGGCAGATG GACAGTTCCC
GCCCACCCCT ACCTGACCAC CAAGCTGTCC CAGATGCTCT ATTTGCTGTG CTCCTGGCCC
GAGCTGCCTG TGCTGAGCGC CCTGGAACTT CTGGACTTTA GCTTTCCCGA CTGCTACGTG
GGCTCCTTCG CCATCAAGTC CCTTCGGAAG CTGACGGACG ATGAGCTCTT CCAGTACCTT
CTGCAGCTGG TGCAAGTGCT CAAATATGAG TCCTACCTGG ACTGCGAGCT GACCAAATTC
TTGCTGGGCC GAGCCCTGGC TAACCGCAAG ATCGGACACT TCCTGTTCTG GCACCTCCGC
TCTGAGATGC ACGTACCATC AGTGGCTCTG CGGTTTGGTC TCATCATGGA AGCCTACTGC
AGAGGCAGCA CCCACCACAT GAAGGTGCTG ATGAAGCAGG GGGAAGCACT GAGCAAGCTT
AAGGCACTGA ATGACTTTGT GAAGGTGAGT TCCCAGAAGA CCACCAAGCC CCAAACCAAG
GAGATGATGC ATATGTGCAT GCGCCAGGAG ACCTACATGG AGGCCCTGTC CCACCTGCAG
TCTCCACTCG ACCCCAGCAC CCTGCTGGAG GAAGTCTGCA GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536070.1
CDS307..3528
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1819..2442(+)
Misc Feature(5)2416..3519(+)
Misc Feature(6)2647..3126(+)
Misc Feature(7)2851..3381(+)
Misc Feature(8)2992..2994(+)
Misc Feature(9)3061..3087(+)
Misc Feature(10)3124..3198(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536007
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X12, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536007

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGGTGA GTAGAGAGGG GGGTTCGGGA AGACAGCCCC GGGGCAGATG GACAGTTCCC
GCCCACCCCT ACCTGACCAC CAAGCTGTCC CAGATGCTCT ATTTGCTGTG CTCCTGGCCC
GAGCTGCCTG TGCTGAGCGC CCTGGAACTT CTGGACTTTA GCTTTCCCGA CTGCTACGTG
GGCTCCTTCG CCATCAAGTC CCTTCGGAAG CTGACGGACG ATGAGCTCTT CCAGTACCTT
CTGCAGCTGG TGCAAGTGCT CAAATATGAG TCCTACCTGG ACTGCGAGCT GACCAAATTC
TTGCTGGGCC GAGCCCTGGC TAACCGCAAG ATCGGACACT TCCTGTTCTG GCACCTCCGC
TCTGAGATGC ACGTACCATC AGTGGCTCTG CGGTTTGGTC TCATCATGGA AGCCTACTGC
AGAGGCAGCA CCCACCACAT GAAGGTGCTG ATGAAGCAGG GGGAAGCACT GAGCAAGCTT
AAGGCACTGA ATGACTTTGT GAAGGTGAGT TCCCAGAAGA CCACCAAGCC CCAAACCAAG
GAGATGATGC ATATGTGCAT GCGCCAGGAG ACCTACATGG AGGCCCTGTC CCACCTGCAG
TCTCCACTCG ACCCCAGCAC CCTGCTGGAG GAAGTCTGCA GTGTGGAGCA GTGCACCTTC
ATGGACTCCA AAATGAAGCC CCTGTGGATC ATGTACAGCA GCGAGGAGGC GGGCAGTGCT
GGCAACGTGG GCATCATCTT TAAGAACGGG GATGACCTCC GCCAGGACAT GCTGACTCTG
CAGATGATCC AGCTCATGGA CGTCCTGTGG AAGCAGGAGG GCCTGGACCT GAGGATGACG
CCCTACGGCT GCCTCCCCAC CGGGGACCGC ACAGGTCTCA TCGAGGTGGT CCTCCACTCG
GACACCATCG CCAACATCCA GCTGAACAAA AGCAACATGG CGGCCACAGC TGCCTTCAAC
AAGGACGCCC TGCTCAACTG GCTCAAGTCC AAGAACCCTG GGGAGGCCCT GGATCGGGCC
ATTGAGGAAT TCACCCTCTC CTGTGCTGGC TACTGTGTGG CCACATATGT TCTGGGCATC
GGTGACCGGC ACAGCGACAA CATCATGATC AGAGAGAGTG GGCAGCTCTT CCACATTGAT
TTTGGCCACT TTCTGGGGAA CTTCAAGACC AAGTTTGGAA TCAACCGAGA GCGCGTCCCC
TTCATTCTCA CCTACGACTT TGTCCACGTG ATCCAGCAGG GGAAGACTAA CAACAGTGAG
AAGTTTGAAA GGTTCCGCGG CTACTGTGAA CGAGCCTATA CCATCCTGCG GCGCCACGGG
CTGCTTTTCC TCCATCTCTT CGCCCTGATG CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC
TCCAAAGATA TCCAGTATCT CAAGGACTCT CTGGCACTGG GGAAGACGGA GGAAGAGGCG
CTAAAGCACT TCCGGGTGAA GTTCAACGAA GCTCTCCGAG AAAGCTGGAA AACCAAAGTC
AACTGGCTGG CGCACAATGT GTCCAAGGAT AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version XM_006536008.2
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019001. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536071.1
CDS307..3450
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2367(+)
Misc Feature(5)2341..3441(+)
Misc Feature(6)2569..3048(+)
Misc Feature(7)2773..3303(+)
Misc Feature(8)2914..2916(+)
Misc Feature(9)2983..3009(+)
Misc Feature(10)3046..3120(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536008
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X13, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536008

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19695
Accession Version XM_006536011.2
Sequence Information ORF Nucleotide Sequence (Length: 3138bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X6
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019007. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGCAGTGT GGAGCAGTGC ACCTTCATGG ACTCCAAAAT GAAGCCCCTG
TGGATCATGT ACAGCAGCGA GGAGGCGGGC AGTGCTGGCA ACGTGGGCAT CATCTTTAAG
AACGGGGATG ACCTCCGCCA GGACATGCTG ACTCTGCAGA TGATCCAGCT CATGGACGTC
CTGTGGAAGC AGGAGGGCCT GGACCTGAGG ATGACGCCCT ACGGCTGCCT CCCCACCGGG
GACCGCACAG GTCTCATCGA GGTGGTCCTC CACTCGGACA CCATCGCCAA CATCCAGCTG
AACAAAAGCA ACATGGCGGC CACAGCTGCC TTCAACAAGG ACGCCCTGCT CAACTGGCTC
AAGTCCAAGA ACCCTGGGGA GGCCCTGGAT CGGGCCATTG AGGAATTCAC CCTCTCCTGT
GCTGGCTACT GTGTGGCCAC ATATGTTCTG GGCATCGGTG ACCGGCACAG CGACAACATC
ATGATCAGAG AGAGTGGGCA GCTCTTCCAC ATTGATTTTG GCCACTTTCT GGGGAACTTC
AAGACCAAGT TTGGAATCAA CCGAGAGCGC GTCCCCTTCA TTCTCACCTA CGACTTTGTC
CACGTGATCC AGCAGGGGAA GACTAACAAC AGTGAGAAGT TTGAAAGGTT CCGCGGCTAC
TGTGAACGAG CCTATACCAT CCTGCGGCGC CACGGGCTGC TTTTCCTCCA TCTCTTCGCC
CTGATGCGGG CCGCAGGTCT GCCTGAGCTT AGCTGCTCCA AAGATATCCA GTATCTCAAG
GACTCTCTGG CACTGGGGAA GACGGAGGAA GAGGCGCTAA AGCACTTCCG GGTGAAGTTC
AACGAAGCTC TCCGAGAAAG CTGGAAAACC AAAGTCAACT GGCTGGCGCA CAATGTGTCC
AAGGATAACC GACAGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536074.1
CDS307..3444
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1816..2358(+)
Misc Feature(5)2332..3435(+)
Misc Feature(6)2563..3042(+)
Misc Feature(7)2767..3297(+)
Misc Feature(8)2908..2910(+)
Misc Feature(9)2977..3003(+)
Misc Feature(10)3040..3114(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536011
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X16, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536011

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGCAGTGT GGAGCAGTGC ACCTTCATGG ACTCCAAAAT GAAGCCCCTG
TGGATCATGT ACAGCAGCGA GGAGGCGGGC AGTGCTGGCA ACGTGGGCAT CATCTTTAAG
AACGGGGATG ACCTCCGCCA GGACATGCTG ACTCTGCAGA TGATCCAGCT CATGGACGTC
CTGTGGAAGC AGGAGGGCCT GGACCTGAGG ATGACGCCCT ACGGCTGCCT CCCCACCGGG
GACCGCACAG GTCTCATCGA GGTGGTCCTC CACTCGGACA CCATCGCCAA CATCCAGCTG
AACAAAAGCA ACATGGCGGC CACAGCTGCC TTCAACAAGG ACGCCCTGCT CAACTGGCTC
AAGTCCAAGA ACCCTGGGGA GGCCCTGGAT CGGGCCATTG AGGAATTCAC CCTCTCCTGT
GCTGGCTACT GTGTGGCCAC ATATGTTCTG GGCATCGGTG ACCGGCACAG CGACAACATC
ATGATCAGAG AGAGTGGGCA GCTCTTCCAC ATTGATTTTG GCCACTTTCT GGGGAACTTC
AAGACCAAGT TTGGAATCAA CCGAGAGCGC GTCCCCTTCA TTCTCACCTA CGACTTTGTC
CACGTGATCC AGCAGGGGAA GACTAACAAC AGTGAGAAGT TTGAAAGGTT CCGCGGCTAC
TGTGAACGAG CCTATACCAT CCTGCGGCGC CACGGGCTGC TTTTCCTCCA TCTCTTCGCC
CTGATGCGGG CCGCAGGTCT GCCTGAGCTT AGCTGCTCCA AAGATATCCA GTATCTCAAG
GACTCTCTGG CACTGGGGAA GACGGAGGAA GAGGCGCTAA AGCACTTCCG GGTGAAGTTC
AACGAAGCTC TCCGAGAAAG CTGGAAAACC AAAGTCAACT GGCTGGCGCA CAATGTGTCC
AAGGATAACC GACAGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version XM_006536013.1
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X7
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536076.1
CDS306..3440
Misc Feature(1)396..629(+)
Misc Feature(2)855..1148(+)
Misc Feature(3)1245..1748(+)
Misc Feature(4)1815..2357(+)
Misc Feature(5)2331..3431(+)
Misc Feature(6)2559..3038(+)
Misc Feature(7)2763..3293(+)
Misc Feature(8)2904..2906(+)
Misc Feature(9)2973..2999(+)
Misc Feature(10)3036..3110(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536013
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X18, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536013

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19427
Accession Version XM_006536015.2
Sequence Information ORF Nucleotide Sequence (Length: 3132bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X8
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 9, 2015 this sequence version replaced gi:569019015. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGATGC TCTATTTGCT GTGCTCCTGG CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA
CTTCTGGACT TTAGCTTTCC CGACTGCTAC GTGGGCTCCT TCGCCATCAA GTCCCTTCGG
AAGCTGACGG ACGATGAGCT CTTCCAGTAC CTTCTGCAGC TGGTGCAAGT GCTCAAATAT
GAGTCCTACC TGGACTGCGA GCTGACCAAA TTCTTGCTGG GCCGAGCCCT GGCTAACCGC
AAGATCGGAC ACTTCCTGTT CTGGCACCTC CGCTCTGAGA TGCACGTACC ATCAGTGGCT
CTGCGGTTTG GTCTCATCAT GGAAGCCTAC TGCAGAGGCA GCACCCACCA CATGAAGGTG
CTGATGAAGC AGGGGGAAGC ACTGAGCAAG CTTAAGGCAC TGAATGACTT TGTGAAGGTG
AGTTCCCAGA AGACCACCAA GCCCCAAACC AAGGAGATGA TGCATATGTG CATGCGCCAG
GAGACCTACA TGGAGGCCCT GTCCCACCTG CAGTCTCCAC TCGACCCCAG CACCCTGCTG
GAGGAAGTCT GTGTGGAGCA GTGCACCTTC ATGGACTCCA AAATGAAGCC CCTGTGGATC
ATGTACAGCA GCGAGGAGGC GGGCAGTGCT GGCAACGTGG GCATCATCTT TAAGAACGGG
GATGACCTCC GCCAGGACAT GCTGACTCTG CAGATGATCC AGCTCATGGA CGTCCTGTGG
AAGCAGGAGG GCCTGGACCT GAGGATGACG CCCTACGGCT GCCTCCCCAC CGGGGACCGC
ACAGGTCTCA TCGAGGTGGT CCTCCACTCG GACACCATCG CCAACATCCA GCTGAACAAA
AGCAACATGG CGGCCACAGC TGCCTTCAAC AAGGACGCCC TGCTCAACTG GCTCAAGTCC
AAGAACCCTG GGGAGGCCCT GGATCGGGCC ATTGAGGAAT TCACCCTCTC CTGTGCTGGC
TACTGTGTGG CCACATATGT TCTGGGCATC GGTGACCGGC ACAGCGACAA CATCATGATC
AGAGAGAGTG GGCAGCTCTT CCACATTGAT TTTGGCCACT TTCTGGGGAA CTTCAAGACC
AAGTTTGGAA TCAACCGAGA GCGCGTCCCC TTCATTCTCA CCTACGACTT TGTCCACGTG
ATCCAGCAGG GGAAGACTAA CAACAGTGAG AAGTTTGAAA GGTTCCGCGG CTACTGTGAA
CGAGCCTATA CCATCCTGCG GCGCCACGGG CTGCTTTTCC TCCATCTCTT CGCCCTGATG
CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC TCCAAAGATA TCCAGTATCT CAAGGACTCT
CTGGCACTGG GGAAGACGGA GGAAGAGGCG CTAAAGCACT TCCGGGTGAA GTTCAACGAA
GCTCTCCGAG AAAGCTGGAA AACCAAAGTC AACTGGCTGG CGCACAATGT GTCCAAGGAT
AACCGACAGT AG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536078.1
CDS307..3438
Misc Feature(1)397..630(+)
Misc Feature(2)856..1149(+)
Misc Feature(3)1246..1749(+)
Misc Feature(4)1819..2355(+)
Misc Feature(5)2329..3429(+)
Misc Feature(6)2557..3036(+)
Misc Feature(7)2761..3291(+)
Misc Feature(8)2902..2904(+)
Misc Feature(9)2971..2997(+)
Misc Feature(10)3034..3108(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536015
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X20, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536015

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCTGCAGCTG CGGGAGATCC TGGAACGGCG GGGATCCGGG
GAACTGTACG AACATGAGAA GGACCTGGTG TGGAAGATGC GCCACGAAGT CCAGGAGCAT
TTCCCAGAGG CGCTGGCCCG CCTGCTGCTG GTCACCAAGT GGAATAAACA CGAGGATGTG
GCCCAGATGC TCTATTTGCT GTGCTCCTGG CCCGAGCTGC CTGTGCTGAG CGCCCTGGAA
CTTCTGGACT TTAGCTTTCC CGACTGCTAC GTGGGCTCCT TCGCCATCAA GTCCCTTCGG
AAGCTGACGG ACGATGAGCT CTTCCAGTAC CTTCTGCAGC TGGTGCAAGT GCTCAAATAT
GAGTCCTACC TGGACTGCGA GCTGACCAAA TTCTTGCTGG GCCGAGCCCT GGCTAACCGC
AAGATCGGAC ACTTCCTGTT CTGGCACCTC CGCTCTGAGA TGCACGTACC ATCAGTGGCT
CTGCGGTTTG GTCTCATCAT GGAAGCCTAC TGCAGAGGCA GCACCCACCA CATGAAGGTG
CTGATGAAGC AGGGGGAAGC ACTGAGCAAG CTTAAGGCAC TGAATGACTT TGTGAAGGTG
AGTTCCCAGA AGACCACCAA GCCCCAAACC AAGGAGATGA TGCATATGTG CATGCGCCAG
GAGACCTACA TGGAGGCCCT GTCCCACCTG CAGTCTCCAC TCGACCCCAG CACCCTGCTG
GAGGAAGTCT GTGTGGAGCA GTGCACCTTC ATGGACTCCA AAATGAAGCC CCTGTGGATC
ATGTACAGCA GCGAGGAGGC GGGCAGTGCT GGCAACGTGG GCATCATCTT TAAGAACGGG
GATGACCTCC GCCAGGACAT GCTGACTCTG CAGATGATCC AGCTCATGGA CGTCCTGTGG
AAGCAGGAGG GCCTGGACCT GAGGATGACG CCCTACGGCT GCCTCCCCAC CGGGGACCGC
ACAGGTCTCA TCGAGGTGGT CCTCCACTCG GACACCATCG CCAACATCCA GCTGAACAAA
AGCAACATGG CGGCCACAGC TGCCTTCAAC AAGGACGCCC TGCTCAACTG GCTCAAGTCC
AAGAACCCTG GGGAGGCCCT GGATCGGGCC ATTGAGGAAT TCACCCTCTC CTGTGCTGGC
TACTGTGTGG CCACATATGT TCTGGGCATC GGTGACCGGC ACAGCGACAA CATCATGATC
AGAGAGAGTG GGCAGCTCTT CCACATTGAT TTTGGCCACT TTCTGGGGAA CTTCAAGACC
AAGTTTGGAA TCAACCGAGA GCGCGTCCCC TTCATTCTCA CCTACGACTT TGTCCACGTG
ATCCAGCAGG GGAAGACTAA CAACAGTGAG AAGTTTGAAA GGTTCCGCGG CTACTGTGAA
CGAGCCTATA CCATCCTGCG GCGCCACGGG CTGCTTTTCC TCCATCTCTT CGCCCTGATG
CGGGCCGCAG GTCTGCCTGA GCTTAGCTGC TCCAAAGATA TCCAGTATCT CAAGGACTCT
CTGGCACTGG GGAAGACGGA GGAAGAGGCG CTAAAGCACT TCCGGGTGAA GTTCAACGAA
GCTCTCCGAG AAAGCTGGAA AACCAAAGTC AACTGGCTGG CGCACAATGT GTCCAAGGAT
AACCGACAGT AG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu34055
Accession Version XM_006536016.1
Sequence Information ORF Nucleotide Sequence (Length: 2439bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform X9
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_166299.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Mus musculus Annotation Release 105 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
ATGTCACACG AAAGCCACCT GACCACATTA CCCAGCCTCC CTGCCTGGAG TGGTTGTAAG 
CTGCTTCAAA ACAGGAAGGG GGAGTGGGGT GGGCCAGCCA GCCAGAGACT GATTCGTGGA
AACCCGGGCA GAGCAGATTT CTGTGTATTT GACTTTGGTG GAGGTTGTGG GGATGAAAGA
GGCATCCGGG GAGGTGTGAG AGGTGCAAGG AAGAGCCTGC TGCAGCTGGT CTGGCTGGTT
GTTCAGGCCG GGCTCTTCCA TGGCAATGAG ATGCTGTGCA AGACTGTGTC AAGCTCGGAG
GTGAATGTAT GCTCAGAGCC CGTGTGGAAG CAGCGACTGG AGTTCGATAT CAGCGTCTGT
GACCTCCCGC GCATGGCTCG ACTCTGTTTT GCTCTCTATG CCGTCGTGGA GAAGGCTAAG
AAGGCACGCT CCACAAAGAA GAAGTCTAAG AAGGCGGACT GCCCCATCGC TTGGGCCAAC
CTCATGCTAT TCGACTACAA AGATCAGCTC AAGACGGGGG AGCGCTGCCT CTACATGTGG
CCCTCTGTCC CAGATGAGAA GGGAGAGCTG CTGAATCCTG CGGGTACAGT GCGCGGGAAC
CCCAACACGG AGAGTGCCGC TGCCCTGGTC ATCTACCTGC CTGAGGTGGC CCCCCACCCT
GTGTACTTCC CCGCTCTGGA GAAGATCCTG GAGCTGGGGC GTCACGGGGA GCGTGGGCGC
ATCACGGAGG AGGAGCAGCT GCAGCTGCGG GAGATCCTGG AACGGCGGGG ATCCGGGGAA
CTGTACGAAC ATGAGAAGGA CCTGGTGTGG AAGATGCGCC ACGAAGTCCA GGAGCATTTC
CCAGAGGCGC TGGCCCGCCT GCTGCTGGTC ACCAAGTGGA ATAAACACGA GGATGTGGCC
CAGGTGAGTA GAGAGGGGGG TTCGGGAAGA CAGCCCCGGG GCAGATGGAC AGTTCCCGCC
CACCCCTACC TGACCACCAA GCTGTCCCAG ATGCTCTATT TGCTGTGCTC CTGGCCCGAG
CTGCCTGTGC TGAGCGCCCT GGAACTTCTG GACTTTAGCT TTCCCGACTG CTACGTGGGC
TCCTTCGCCA TCAAGTCCCT TCGGAAGCTG ACGGACGATG AGCTCTTCCA GTACCTTCTG
CAGCTGGTGC AAGTGCTCAA ATATGAGTCC TACCTGGACT GCGAGCTGAC CAAATTCTTG
CTGGGCCGAG CCCTGGCTAA CCGCAAGATC GGACACTTCC TGTTCTGGCA CCTCCGCTCT
GAGATGCACG TACCATCAGT GGCTCTGCGG TTTGGTCTCA TCATGGAAGC CTACTGCAGA
GGCAGCACCC ACCACATGAA GGTGCTGATG AAGCAGGGGG AAGCACTGAG CAAGCTTAAG
GCACTGAATG ACTTTGTGAA GGTGAGTTCC CAGAAGACCA CCAAGCCCCA AACCAAGGAG
ATGATGCATA TGTGCATGCG CCAGGAGACC TACATGGAGG CCCTGTCCCA CCTGCAGTCT
CCACTCGACC CCAGCACCCT GCTGGAGGAA GTCTGCAGTG TGGAGCAGTG CACCTTCATG
GACTCCAAAA TGAAGCCCCT GTGGATCATG TACAGCAGCG AGGAGGCGGG CAGTGCTGGC
AACGTGGGCA TCATCTTTAA GAACGGGGAT GACCTCCGCC AGGACATGCT GACTCTGCAG
ATGATCCAGC TCATGGACGT CCTGTGGAAG CAGGAGGGCC TGGACCTGAG GATGACGCCC
TACGGCTGCC TCCCCACCGG GGACCGCACA GGTCTCATCG AGGTGGTCCT CCACTCGGAC
ACCATCGCCA ACATCCAGCT GAACAAAAGC AACATGGCGG CCACAGCTGC CTTCAACAAG
GACGCCCTGC TCAACTGGCT CAAGTCCAAG AACCCTGGGG AGGCCCTGGA TCGGGCCATT
GAGGAATTCA CCCTCTCCTG TGCTGGCTAC TGTGTGGCCA CATATGTTCT GGGCATCGGT
GACCGGCACA GCGACAACAT CATGATCAGA GAGAGTGGGC AGCTCTTCCA CATTGATTTT
GGCCACTTTC TGGGGAACTT CAAGACCAAG TTTGGAATCA ACCGAGAGCG CGTCCCCTTC
ATTCTCACCT ACGACTTTGT CCACGTGATC CAGCAGGGGA AGACTAACAA CAGTGAGAAG
TTTGAAAGGT TCCGCGGCTA CTGTGAACGA GCCTATACCA TCCTGCGGCG CCACGGGCTG
CTTTTCCTCC ATCTCTTCGC CCTGATGCGG GCCGCAGGTC TGCCTGAGCT TAGCTGCTCC
AAAGATATCC AGTATCTCAA GGACTCTCTG GCACTGGGGA AGACGGAGGA AGAGGCGCTA
AAGCACTTCC GGGTGAAGTT CAACGAAGCT CTCCGAGAAA GCTGGAAAAC CAAAGTCAAC
TGGCTGGCGC ACAATGTGTC CAAGGATAAC CGACAGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006536079.1
CDS91..2529
Misc Feature(1)325..747(+)
Misc Feature(2)814..1443(+)
Misc Feature(3)1417..2520(+)
Misc Feature(4)1648..2127(+)
Misc Feature(5)1852..2382(+)
Misc Feature(6)1993..1995(+)
Misc Feature(7)2062..2088(+)
Misc Feature(8)2125..2199(+)
Translation
Position Chain Variation Link

Target ORF information:

RefSeq Version XM_006536016
Organism Mus musculus (house mouse)
Definition PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X21, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006536016

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
ATGTCACACG AAAGCCACCT GACCACATTA CCCAGCCTCC CTGCCTGGAG TGGTTGTAAG 
CTGCTTCAAA ACAGGAAGGG GGAGTGGGGT GGGCCAGCCA GCCAGAGACT GATTCGTGGA
AACCCGGGCA GAGCAGATTT CTGTGTATTT GACTTTGGTG GAGGTTGTGG GGATGAAAGA
GGCATCCGGG GAGGTGTGAG AGGTGCAAGG AAGAGCCTGC TGCAGCTGGT CTGGCTGGTT
GTTCAGGCCG GGCTCTTCCA TGGCAATGAG ATGCTGTGCA AGACTGTGTC AAGCTCGGAG
GTGAATGTAT GCTCAGAGCC CGTGTGGAAG CAGCGACTGG AGTTCGATAT CAGCGTCTGT
GACCTCCCGC GCATGGCTCG ACTCTGTTTT GCTCTCTATG CCGTCGTGGA GAAGGCTAAG
AAGGCACGCT CCACAAAGAA GAAGTCTAAG AAGGCGGACT GCCCCATCGC TTGGGCCAAC
CTCATGCTAT TCGACTACAA AGATCAGCTC AAGACGGGGG AGCGCTGCCT CTACATGTGG
CCCTCTGTCC CAGATGAGAA GGGAGAGCTG CTGAATCCTG CGGGTACAGT GCGCGGGAAC
CCCAACACGG AGAGTGCCGC TGCCCTGGTC ATCTACCTGC CTGAGGTGGC CCCCCACCCT
GTGTACTTCC CCGCTCTGGA GAAGATCCTG GAGCTGGGGC GTCACGGGGA GCGTGGGCGC
ATCACGGAGG AGGAGCAGCT GCAGCTGCGG GAGATCCTGG AACGGCGGGG ATCCGGGGAA
CTGTACGAAC ATGAGAAGGA CCTGGTGTGG AAGATGCGCC ACGAAGTCCA GGAGCATTTC
CCAGAGGCGC TGGCCCGCCT GCTGCTGGTC ACCAAGTGGA ATAAACACGA GGATGTGGCC
CAGGTGAGTA GAGAGGGGGG TTCGGGAAGA CAGCCCCGGG GCAGATGGAC AGTTCCCGCC
CACCCCTACC TGACCACCAA GCTGTCCCAG ATGCTCTATT TGCTGTGCTC CTGGCCCGAG
CTGCCTGTGC TGAGCGCCCT GGAACTTCTG GACTTTAGCT TTCCCGACTG CTACGTGGGC
TCCTTCGCCA TCAAGTCCCT TCGGAAGCTG ACGGACGATG AGCTCTTCCA GTACCTTCTG
CAGCTGGTGC AAGTGCTCAA ATATGAGTCC TACCTGGACT GCGAGCTGAC CAAATTCTTG
CTGGGCCGAG CCCTGGCTAA CCGCAAGATC GGACACTTCC TGTTCTGGCA CCTCCGCTCT
GAGATGCACG TACCATCAGT GGCTCTGCGG TTTGGTCTCA TCATGGAAGC CTACTGCAGA
GGCAGCACCC ACCACATGAA GGTGCTGATG AAGCAGGGGG AAGCACTGAG CAAGCTTAAG
GCACTGAATG ACTTTGTGAA GGTGAGTTCC CAGAAGACCA CCAAGCCCCA AACCAAGGAG
ATGATGCATA TGTGCATGCG CCAGGAGACC TACATGGAGG CCCTGTCCCA CCTGCAGTCT
CCACTCGACC CCAGCACCCT GCTGGAGGAA GTCTGCAGTG TGGAGCAGTG CACCTTCATG
GACTCCAAAA TGAAGCCCCT GTGGATCATG TACAGCAGCG AGGAGGCGGG CAGTGCTGGC
AACGTGGGCA TCATCTTTAA GAACGGGGAT GACCTCCGCC AGGACATGCT GACTCTGCAG
ATGATCCAGC TCATGGACGT CCTGTGGAAG CAGGAGGGCC TGGACCTGAG GATGACGCCC
TACGGCTGCC TCCCCACCGG GGACCGCACA GGTCTCATCG AGGTGGTCCT CCACTCGGAC
ACCATCGCCA ACATCCAGCT GAACAAAAGC AACATGGCGG CCACAGCTGC CTTCAACAAG
GACGCCCTGC TCAACTGGCT CAAGTCCAAG AACCCTGGGG AGGCCCTGGA TCGGGCCATT
GAGGAATTCA CCCTCTCCTG TGCTGGCTAC TGTGTGGCCA CATATGTTCT GGGCATCGGT
GACCGGCACA GCGACAACAT CATGATCAGA GAGAGTGGGC AGCTCTTCCA CATTGATTTT
GGCCACTTTC TGGGGAACTT CAAGACCAAG TTTGGAATCA ACCGAGAGCG CGTCCCCTTC
ATTCTCACCT ACGACTTTGT CCACGTGATC CAGCAGGGGA AGACTAACAA CAGTGAGAAG
TTTGAAAGGT TCCGCGGCTA CTGTGAACGA GCCTATACCA TCCTGCGGCG CCACGGGCTG
CTTTTCCTCC ATCTCTTCGC CCTGATGCGG GCCGCAGGTC TGCCTGAGCT TAGCTGCTCC
AAAGATATCC AGTATCTCAA GGACTCTCTG GCACTGGGGA AGACGGAGGA AGAGGCGCTA
AAGCACTTCC GGGTGAAGTT CAACGAAGCT CTCCGAGAAA GCTGGAAAAC CAAAGTCAAC
TGGCTGGCGC ACAATGTGTC CAAGGATAAC CGACAGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version NM_001029837.2
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CF164288.1, AK040867.1, AK149935.1, AK153304.1 and AW124359.1. On or before Mar 2, 2012 this sequence version replaced gi:377837187, gi:377837189, gi:377837191, gi:377837193, gi:377837195, gi:377837197, gi:377837199, gi:377837201, gi:377837203, gi:377837205, gi:377837207, gi:377837209, gi:377837211, gi:377837213, gi:377837215, gi:377837217, gi:71067115. Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 4. The resulting isoform (b) includes an additional 3-aa internal segment, compared to isoform c. Both variants 2 and 3 encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK040867.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001025008.2
CDS279..3422
Misc Feature(1)267..269(+)
Misc Feature(2)369..602(+)
Misc Feature(3)828..1121(+)
Misc Feature(4)1218..1721(+)
Misc Feature(5)1788..2339(+)
Misc Feature(6)2313..3413(+)
Misc Feature(7)2541..3020(+)
Misc Feature(8)2745..3275(+)
Misc Feature(9)2886..2888(+)
Misc Feature(10)2955..2981(+)
Misc Feature(11)3018..3092(+)
Exon (1)1..127
Gene:Pik3cd
Gene Synonym:
Exon (2)128..246
Gene:Pik3cd
Gene Synonym:
Exon (3)247..419
Gene:Pik3cd
Gene Synonym:
Exon (4)420..648
Gene:Pik3cd
Gene Synonym:
Exon (5)649..878
Gene:Pik3cd
Gene Synonym:
Exon (6)879..1058
Gene:Pik3cd
Gene Synonym:
Exon (7)1059..1208
Gene:Pik3cd
Gene Synonym:
Exon (8)1209..1298
Gene:Pik3cd
Gene Synonym:
Exon (9)1299..1520
Gene:Pik3cd
Gene Synonym:
Exon (10)1521..1617
Gene:Pik3cd
Gene Synonym:
Exon (11)1618..1748
Gene:Pik3cd
Gene Synonym:
Exon (12)1749..1799
Gene:Pik3cd
Gene Synonym:
Exon (13)1800..1967
Gene:Pik3cd
Gene Synonym:
Exon (14)1968..2098
Gene:Pik3cd
Gene Synonym:
Exon (15)2099..2242
Gene:Pik3cd
Gene Synonym:
Exon (16)2243..2342
Gene:Pik3cd
Gene Synonym:
Exon (17)2343..2521
Gene:Pik3cd
Gene Synonym:
Exon (18)2522..2634
Gene:Pik3cd
Gene Synonym:
Exon (19)2635..2713
Gene:Pik3cd
Gene Synonym:
Exon (20)2714..2881
Gene:Pik3cd
Gene Synonym:
Exon (21)2882..3005
Gene:Pik3cd
Gene Synonym:
Exon (22)3006..3151
Gene:Pik3cd
Gene Synonym:
Exon (23)3152..3284
Gene:Pik3cd
Gene Synonym:
Exon (24)3285..4894
Gene:Pik3cd
Gene Synonym:
Translation
Position Chain Variation Link
9 9 -, gtggttctttctggcttctc dbSNP:218461214
22 22 c, t dbSNP:387854858
28 28 a, c dbSNP:212036299
43 43 a, g dbSNP:387482248
45 45 c, t dbSNP:32062068
82 82 -, agtg dbSNP:253122108
103 103 a, t dbSNP:47150377
109 109 c, t dbSNP:216712105
209 209 a, g dbSNP:223972376
249 249 a, g dbSNP:239338675
255 255 a, g dbSNP:218964167
581 581 c, g dbSNP:240300958
623 623 c, t dbSNP:222723878
767 767 c, g dbSNP:213837013
818 818 c, t dbSNP:251700991
825 825 c, t dbSNP:236548726
830 830 c, t dbSNP:213119376
1031 1031 c, t dbSNP:220759106
1283 1283 g, t dbSNP:32625894
1313 1313 c, t dbSNP:222152211
1385 1385 c, t dbSNP:257984189
1630 1630 a, g dbSNP:260749632
1736 1736 c, t dbSNP:242945471
1952 1952 c, t dbSNP:32631645
2246 2246 c, t dbSNP:261481932
2342 2342 a, g dbSNP:235501245
2366 2366 a, g dbSNP:261669710
2393 2393 c, t dbSNP:32477590
2558 2558 a, g dbSNP:32630912
2591 2591 a, g dbSNP:239609762
2909 2909 a, g dbSNP:258949751
2951 2951 g, t dbSNP:51799546
2975 2975 c, t dbSNP:47860031
3107 3107 c, t dbSNP:256715650
3158 3158 a, c dbSNP:6365974
3179 3179 c, t dbSNP:6365934
3197 3197 c, t dbSNP:258157993
3236 3236 c, t dbSNP:236687438
3257 3257 c, t dbSNP:213222593
3260 3260 c, t dbSNP:248385673
3357 3357 a, c dbSNP:50245876
3392 3392 a, g dbSNP:254775112
3498 3498 c, g dbSNP:236808332
3606 3606 a, g dbSNP:214858058
3688 3688 a, c, g dbSNP:48275057
3703 3703 c, t dbSNP:49353469
3840 3840 c, t dbSNP:387099947
3886 3886 c, g dbSNP:214459290
3974 3974 a, g dbSNP:50863494
3979 3979 c, t dbSNP:51318895
4046 4046 a, g dbSNP:258855642
4104 4104 c, t dbSNP:247414873
4122 4122 c, t dbSNP:48281206
4133 4133 a, g dbSNP:265520140
4160 4160 g, t dbSNP:46963869
4174 4174 a, c dbSNP:46783071
4180 4180 a, g dbSNP:51750552
4273 4273 a, c dbSNP:50539445
4290 4290 a, g dbSNP:49120436
4307 4307 c, t dbSNP:48262359
4323 4323 -, ag dbSNP:229051276
4330 4330 c, t dbSNP:236746252
4357 4357 a, g dbSNP:49735657
4362 4362 g, t dbSNP:50235754
4375 4375 -, caccc dbSNP:250517494
4379 4379 a, g dbSNP:4224946
4406 4406 a, g dbSNP:387614635
4416 4416 c, t dbSNP:4224947
4435 4435 c, t dbSNP:4224948
4438 4438 a, g dbSNP:4224949
4481 4481 a, g dbSNP:4224950
4522 4522 g, t dbSNP:387548839
4593 4593 -, gtg dbSNP:240099061
4634 4634 c, t dbSNP:4224951
4638 4638 c, t dbSNP:386923887
4646 4646 c, t dbSNP:4224952
4654 4654 a, c dbSNP:4224953
4764 4764 -, ggcctgtgt dbSNP:234773386
4765 4765 c, t dbSNP:4224954
4792 4792 -, aa dbSNP:260773300
4792 4792 c, t dbSNP:13470755
4808 4808 a, g dbSNP:4224955
4839 4839 a, t dbSNP:229997234
4844 4844 a, g dbSNP:265318113

Target ORF information:

RefSeq Version NM_001029837
Organism Mus musculus (house mouse)
Definition Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001029837

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19651
Accession Version NM_008840.3
Sequence Information ORF Nucleotide Sequence (Length: 3135bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform c
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL626808.28, AK149935.1, AK040867.1, AK153304.1 and AW124359.1. On or before Feb 15, 2015 this sequence version replaced gi:755567889, gi:569019013, gi:71067113. Transcript Variant: This variant (4) represents the longest transcript and encodes isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK149935.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_032866.2
CDS481..3615
Misc Feature(1)469..471(+)
Misc Feature(2)571..804(+)
Misc Feature(3)1030..1323(+)
Misc Feature(4)1420..1923(+)
Misc Feature(5)1990..2532(+)
Misc Feature(6)2050..2052(+)
Misc Feature(7)2506..3606(+)
Misc Feature(8)2734..3213(+)
Misc Feature(9)2938..3468(+)
Misc Feature(10)3079..3081(+)
Misc Feature(11)3148..3174(+)
Misc Feature(12)3211..3285(+)
Misc Feature(13)3595..3597(+)
Exon (1)1..154
Gene:Pik3cd
Gene Synonym:
Exon (2)155..329
Gene:Pik3cd
Gene Synonym:
Exon (3)330..448
Gene:Pik3cd
Gene Synonym:
Exon (4)449..621
Gene:Pik3cd
Gene Synonym:
Exon (5)622..850
Gene:Pik3cd
Gene Synonym:
Exon (6)851..1080
Gene:Pik3cd
Gene Synonym:
Exon (7)1081..1260
Gene:Pik3cd
Gene Synonym:
Exon (8)1261..1410
Gene:Pik3cd
Gene Synonym:
Exon (9)1411..1500
Gene:Pik3cd
Gene Synonym:
Exon (10)1501..1722
Gene:Pik3cd
Gene Synonym:
Exon (11)1723..1819
Gene:Pik3cd
Gene Synonym:
Exon (12)1820..1950
Gene:Pik3cd
Gene Synonym:
Exon (13)1951..2001
Gene:Pik3cd
Gene Synonym:
Exon (14)2002..2169
Gene:Pik3cd
Gene Synonym:
Exon (15)2170..2291
Gene:Pik3cd
Gene Synonym:
Exon (16)2292..2435
Gene:Pik3cd
Gene Synonym:
Exon (17)2436..2535
Gene:Pik3cd
Gene Synonym:
Exon (18)2536..2714
Gene:Pik3cd
Gene Synonym:
Exon (19)2715..2827
Gene:Pik3cd
Gene Synonym:
Exon (20)2828..2906
Gene:Pik3cd
Gene Synonym:
Exon (21)2907..3074
Gene:Pik3cd
Gene Synonym:
Exon (22)3075..3198
Gene:Pik3cd
Gene Synonym:
Exon (23)3199..3344
Gene:Pik3cd
Gene Synonym:
Exon (24)3345..3477
Gene:Pik3cd
Gene Synonym:
Exon (25)3478..5087
Gene:Pik3cd
Gene Synonym:
Translation
Position Chain Variation Link
411 411 a, g dbSNP:223972376
451 451 a, g dbSNP:239338675
457 457 a, g dbSNP:218964167
783 783 c, g dbSNP:240300958
825 825 c, t dbSNP:222723878
969 969 c, g dbSNP:213837013
1020 1020 c, t dbSNP:251700991
1027 1027 c, t dbSNP:236548726
1032 1032 c, t dbSNP:213119376
1233 1233 c, t dbSNP:220759106
1485 1485 g, t dbSNP:32625894
1515 1515 c, t dbSNP:222152211
1587 1587 c, t dbSNP:257984189
1832 1832 a, g dbSNP:260749632
1938 1938 c, t dbSNP:242945471
2154 2154 c, t dbSNP:32631645
2439 2439 c, t dbSNP:261481932
2535 2535 a, g dbSNP:235501245
2559 2559 a, g dbSNP:261669710
2586 2586 c, t dbSNP:32477590
2751 2751 a, g dbSNP:32630912
2784 2784 a, g dbSNP:239609762
3102 3102 a, g dbSNP:258949751
3144 3144 g, t dbSNP:51799546
3168 3168 c, t dbSNP:47860031
3300 3300 c, t dbSNP:256715650
3351 3351 a, c dbSNP:6365974
3372 3372 c, t dbSNP:6365934
3390 3390 c, t dbSNP:258157993
3429 3429 c, t dbSNP:236687438
3450 3450 c, t dbSNP:213222593
3453 3453 c, t dbSNP:248385673
3550 3550 a, c dbSNP:50245876
3585 3585 a, g dbSNP:254775112
3691 3691 c, g dbSNP:236808332
3799 3799 a, g dbSNP:214858058
3881 3881 a, c, g dbSNP:48275057
3896 3896 c, t dbSNP:49353469
4033 4033 c, t dbSNP:387099947
4079 4079 c, g dbSNP:214459290
4167 4167 a, g dbSNP:50863494
4172 4172 c, t dbSNP:51318895
4239 4239 a, g dbSNP:258855642
4297 4297 c, t dbSNP:247414873
4315 4315 c, t dbSNP:48281206
4326 4326 a, g dbSNP:265520140
4353 4353 g, t dbSNP:46963869
4367 4367 a, c dbSNP:46783071
4373 4373 a, g dbSNP:51750552
4466 4466 a, c dbSNP:50539445
4483 4483 a, g dbSNP:49120436
4500 4500 c, t dbSNP:48262359
4516 4516 -, ag dbSNP:229051276
4523 4523 c, t dbSNP:236746252
4550 4550 a, g dbSNP:49735657
4555 4555 g, t dbSNP:50235754
4568 4568 -, caccc dbSNP:250517494
4572 4572 a, g dbSNP:4224946
4599 4599 a, g dbSNP:387614635
4609 4609 c, t dbSNP:4224947
4628 4628 c, t dbSNP:4224948
4631 4631 a, g dbSNP:4224949
4674 4674 a, g dbSNP:4224950
4715 4715 g, t dbSNP:387548839
4786 4786 -, gtg dbSNP:240099061
4827 4827 c, t dbSNP:4224951
4831 4831 c, t dbSNP:386923887
4839 4839 c, t dbSNP:4224952
4847 4847 a, c dbSNP:4224953
4957 4957 -, ggcctgtgt dbSNP:234773386
4958 4958 c, t dbSNP:4224954
4985 4985 -, aa dbSNP:260773300
4985 4985 c, t dbSNP:13470755
5001 5001 a, g dbSNP:4224955
5032 5032 a, t dbSNP:229997234
5037 5037 a, g dbSNP:265318113

Target ORF information:

RefSeq Version NM_008840
Organism Mus musculus (house mouse)
Definition Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 4, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_008840

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGTGTGGA GCAGTGCACC TTCATGGACT CCAAAATGAA GCCCCTGTGG
ATCATGTACA GCAGCGAGGA GGCGGGCAGT GCTGGCAACG TGGGCATCAT CTTTAAGAAC
GGGGATGACC TCCGCCAGGA CATGCTGACT CTGCAGATGA TCCAGCTCAT GGACGTCCTG
TGGAAGCAGG AGGGCCTGGA CCTGAGGATG ACGCCCTACG GCTGCCTCCC CACCGGGGAC
CGCACAGGTC TCATCGAGGT GGTCCTCCAC TCGGACACCA TCGCCAACAT CCAGCTGAAC
AAAAGCAACA TGGCGGCCAC AGCTGCCTTC AACAAGGACG CCCTGCTCAA CTGGCTCAAG
TCCAAGAACC CTGGGGAGGC CCTGGATCGG GCCATTGAGG AATTCACCCT CTCCTGTGCT
GGCTACTGTG TGGCCACATA TGTTCTGGGC ATCGGTGACC GGCACAGCGA CAACATCATG
ATCAGAGAGA GTGGGCAGCT CTTCCACATT GATTTTGGCC ACTTTCTGGG GAACTTCAAG
ACCAAGTTTG GAATCAACCG AGAGCGCGTC CCCTTCATTC TCACCTACGA CTTTGTCCAC
GTGATCCAGC AGGGGAAGAC TAACAACAGT GAGAAGTTTG AAAGGTTCCG CGGCTACTGT
GAACGAGCCT ATACCATCCT GCGGCGCCAC GGGCTGCTTT TCCTCCATCT CTTCGCCCTG
ATGCGGGCCG CAGGTCTGCC TGAGCTTAGC TGCTCCAAAG ATATCCAGTA TCTCAAGGAC
TCTCTGGCAC TGGGGAAGAC GGAGGAAGAG GCGCTAAAGC ACTTCCGGGT GAAGTTCAAC
GAAGCTCTCC GAGAAAGCTG GAAAACCAAA GTCAACTGGC TGGCGCACAA TGTGTCCAAG
GATAACCGAC AGTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu18986
Accession Version NM_001164049.1
Sequence Information ORF Nucleotide Sequence (Length: 3144bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform b
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL626808.28 and AL607078.26. On or before Feb 15, 2015 this sequence version replaced gi:755567882, gi:569019003, gi:407264606, gi:407264608, gi:407264610, gi:407264612, gi:407264614, gi:407264616, gi:407264618, gi:407264620, gi:407264622, gi:407264624, gi:407264626, gi:407264628, gi:407264630, gi:407264632. Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 4. The resulting isoform (b) includes an additional 3-aa internal segment, compared to isoform c. Both variants 2 and 3 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK172222.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001157521.1
CDS306..3449
Misc Feature(1)294..296(+)
Misc Feature(2)396..629(+)
Misc Feature(3)855..1148(+)
Misc Feature(4)1245..1748(+)
Misc Feature(5)1815..2366(+)
Misc Feature(6)1875..1877(+)
Misc Feature(7)2340..3440(+)
Misc Feature(8)2568..3047(+)
Misc Feature(9)2772..3302(+)
Misc Feature(10)2913..2915(+)
Misc Feature(11)2982..3008(+)
Misc Feature(12)3045..3119(+)
Misc Feature(13)3429..3431(+)
Exon (1)1..154
Gene:Pik3cd
Gene Synonym:
Exon (2)155..273
Gene:Pik3cd
Gene Synonym:
Exon (3)274..446
Gene:Pik3cd
Gene Synonym:
Exon (4)447..675
Gene:Pik3cd
Gene Synonym:
Exon (5)676..905
Gene:Pik3cd
Gene Synonym:
Exon (6)906..1085
Gene:Pik3cd
Gene Synonym:
Exon (7)1086..1235
Gene:Pik3cd
Gene Synonym:
Exon (8)1236..1325
Gene:Pik3cd
Gene Synonym:
Exon (9)1326..1547
Gene:Pik3cd
Gene Synonym:
Exon (10)1548..1644
Gene:Pik3cd
Gene Synonym:
Exon (11)1645..1775
Gene:Pik3cd
Gene Synonym:
Exon (12)1776..1826
Gene:Pik3cd
Gene Synonym:
Exon (13)1827..1994
Gene:Pik3cd
Gene Synonym:
Exon (14)1995..2125
Gene:Pik3cd
Gene Synonym:
Exon (15)2126..2269
Gene:Pik3cd
Gene Synonym:
Exon (16)2270..2369
Gene:Pik3cd
Gene Synonym:
Exon (17)2370..2548
Gene:Pik3cd
Gene Synonym:
Exon (18)2549..2661
Gene:Pik3cd
Gene Synonym:
Exon (19)2662..2740
Gene:Pik3cd
Gene Synonym:
Exon (20)2741..2908
Gene:Pik3cd
Gene Synonym:
Exon (21)2909..3032
Gene:Pik3cd
Gene Synonym:
Exon (22)3033..3178
Gene:Pik3cd
Gene Synonym:
Exon (23)3179..3311
Gene:Pik3cd
Gene Synonym:
Exon (24)3312..4921
Gene:Pik3cd
Gene Synonym:
Translation
Position Chain Variation Link
236 236 a, g dbSNP:223972376
276 276 a, g dbSNP:239338675
282 282 a, g dbSNP:218964167
608 608 c, g dbSNP:240300958
650 650 c, t dbSNP:222723878
794 794 c, g dbSNP:213837013
845 845 c, t dbSNP:251700991
852 852 c, t dbSNP:236548726
857 857 c, t dbSNP:213119376
1058 1058 c, t dbSNP:220759106
1310 1310 g, t dbSNP:32625894
1340 1340 c, t dbSNP:222152211
1412 1412 c, t dbSNP:257984189
1657 1657 a, g dbSNP:260749632
1763 1763 c, t dbSNP:242945471
1979 1979 c, t dbSNP:32631645
2273 2273 c, t dbSNP:261481932
2369 2369 a, g dbSNP:235501245
2393 2393 a, g dbSNP:261669710
2420 2420 c, t dbSNP:32477590
2585 2585 a, g dbSNP:32630912
2618 2618 a, g dbSNP:239609762
2936 2936 a, g dbSNP:258949751
2978 2978 g, t dbSNP:51799546
3002 3002 c, t dbSNP:47860031
3134 3134 c, t dbSNP:256715650
3185 3185 a, c dbSNP:6365974
3206 3206 c, t dbSNP:6365934
3224 3224 c, t dbSNP:258157993
3263 3263 c, t dbSNP:236687438
3284 3284 c, t dbSNP:213222593
3287 3287 c, t dbSNP:248385673
3384 3384 a, c dbSNP:50245876
3419 3419 a, g dbSNP:254775112
3525 3525 c, g dbSNP:236808332
3633 3633 a, g dbSNP:214858058
3715 3715 a, c, g dbSNP:48275057
3730 3730 c, t dbSNP:49353469
3867 3867 c, t dbSNP:387099947
3913 3913 c, g dbSNP:214459290
4001 4001 a, g dbSNP:50863494
4006 4006 c, t dbSNP:51318895
4073 4073 a, g dbSNP:258855642
4131 4131 c, t dbSNP:247414873
4149 4149 c, t dbSNP:48281206
4160 4160 a, g dbSNP:265520140
4187 4187 g, t dbSNP:46963869
4201 4201 a, c dbSNP:46783071
4207 4207 a, g dbSNP:51750552
4300 4300 a, c dbSNP:50539445
4317 4317 a, g dbSNP:49120436
4334 4334 c, t dbSNP:48262359
4350 4350 -, ag dbSNP:229051276
4357 4357 c, t dbSNP:236746252
4384 4384 a, g dbSNP:49735657
4389 4389 g, t dbSNP:50235754
4402 4402 -, caccc dbSNP:250517494
4406 4406 a, g dbSNP:4224946
4433 4433 a, g dbSNP:387614635
4443 4443 c, t dbSNP:4224947
4462 4462 c, t dbSNP:4224948
4465 4465 a, g dbSNP:4224949
4508 4508 a, g dbSNP:4224950
4549 4549 g, t dbSNP:387548839
4620 4620 -, gtg dbSNP:240099061
4661 4661 c, t dbSNP:4224951
4665 4665 c, t dbSNP:386923887
4673 4673 c, t dbSNP:4224952
4681 4681 a, c dbSNP:4224953
4791 4791 -, ggcctgtgt dbSNP:234773386
4792 4792 c, t dbSNP:4224954
4819 4819 -, aa dbSNP:260773300
4819 4819 c, t dbSNP:13470755
4835 4835 a, g dbSNP:4224955
4866 4866 a, t dbSNP:229997234
4871 4871 a, g dbSNP:265318113

Target ORF information:

RefSeq Version NM_001164049
Organism Mus musculus (house mouse)
Definition Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant 3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001164049

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGC TGTCCCAGAT GCTCTATTTG CTGTGCTCCT GGCCCGAGCT GCCTGTGCTG
AGCGCCCTGG AACTTCTGGA CTTTAGCTTT CCCGACTGCT ACGTGGGCTC CTTCGCCATC
AAGTCCCTTC GGAAGCTGAC GGACGATGAG CTCTTCCAGT ACCTTCTGCA GCTGGTGCAA
GTGCTCAAAT ATGAGTCCTA CCTGGACTGC GAGCTGACCA AATTCTTGCT GGGCCGAGCC
CTGGCTAACC GCAAGATCGG ACACTTCCTG TTCTGGCACC TCCGCTCTGA GATGCACGTA
CCATCAGTGG CTCTGCGGTT TGGTCTCATC ATGGAAGCCT ACTGCAGAGG CAGCACCCAC
CACATGAAGG TGCTGATGAA GCAGGGGGAA GCACTGAGCA AGCTTAAGGC ACTGAATGAC
TTTGTGAAGG TGAGTTCCCA GAAGACCACC AAGCCCCAAA CCAAGGAGAT GATGCATATG
TGCATGCGCC AGGAGACCTA CATGGAGGCC CTGTCCCACC TGCAGTCTCC ACTCGACCCC
AGCACCCTGC TGGAGGAAGT CTGTGTGGAG CAGTGCACCT TCATGGACTC CAAAATGAAG
CCCCTGTGGA TCATGTACAG CAGCGAGGAG GCGGGCAGTG CTGGCAACGT GGGCATCATC
TTTAAGAACG GGGATGACCT CCGCCAGGAC ATGCTGACTC TGCAGATGAT CCAGCTCATG
GACGTCCTGT GGAAGCAGGA GGGCCTGGAC CTGAGGATGA CGCCCTACGG CTGCCTCCCC
ACCGGGGACC GCACAGGTCT CATCGAGGTG GTCCTCCACT CGGACACCAT CGCCAACATC
CAGCTGAACA AAAGCAACAT GGCGGCCACA GCTGCCTTCA ACAAGGACGC CCTGCTCAAC
TGGCTCAAGT CCAAGAACCC TGGGGAGGCC CTGGATCGGG CCATTGAGGA ATTCACCCTC
TCCTGTGCTG GCTACTGTGT GGCCACATAT GTTCTGGGCA TCGGTGACCG GCACAGCGAC
AACATCATGA TCAGAGAGAG TGGGCAGCTC TTCCACATTG ATTTTGGCCA CTTTCTGGGG
AACTTCAAGA CCAAGTTTGG AATCAACCGA GAGCGCGTCC CCTTCATTCT CACCTACGAC
TTTGTCCACG TGATCCAGCA GGGGAAGACT AACAACAGTG AGAAGTTTGA AAGGTTCCGC
GGCTACTGTG AACGAGCCTA TACCATCCTG CGGCGCCACG GGCTGCTTTT CCTCCATCTC
TTCGCCCTGA TGCGGGCCGC AGGTCTGCCT GAGCTTAGCT GCTCCAAAGA TATCCAGTAT
CTCAAGGACT CTCTGGCACT GGGGAAGACG GAGGAAGAGG CGCTAAAGCA CTTCCGGGTG
AAGTTCAACG AAGCTCTCCG AGAAAGCTGG AAAACCAAAG TCAACTGGCT GGCGCACAAT
GTGTCCAAGG ATAACCGACA GTAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OMu19695
Accession Version NM_001164050.1
Sequence Information ORF Nucleotide Sequence (Length: 3138bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-FEB-2015
Organism Mus musculus (house mouse)
Product phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform isoform d
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL626808.28 and AL607078.26. On or before Feb 15, 2015 this sequence version replaced gi:755567887, gi:569019009. Transcript Variant: This variant (5) lacks an alternate exon in the 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 4. The resulting isoform (d) includes an additional 1-aa internal segment, compared to isoform c. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC035203.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMN00849374, SAMN00849375 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
ATGCCCCCTG GGGTGGACTG CCCCATGGAG TTCTGGACCA AAGAGGAGAG CCAGAGCGTG 
GTTGTTGACT TCTTGCTGCC CACAGGGGTC TACTTGAACT TCCCCGTGTC CCGCAATGCC
AACCTCAGCA CCATCAAGCA GGTGCTGTGG CACCGTGCAC AGTATGAGCC ACTCTTCCAC
ATGCTCAGTG ACCCCGAGGC CTATGTGTTC ACCTGTGTGA ACCAGACGGC GGAGCAGCAG
GAGTTGGAGG ATGAGCAGCG GAGGCTGTGC GACATCCAGC CCTTCCTGCC CGTGCTGCGC
CTCGTGGCCC GAGAGGGGGA CCGCGTGAAG AAGCTCATTA ACTCCCAGAT CAGCCTCCTC
ATTGGCAAAG GTCTCCATGA GTTTGATTCC CTGCGGGACC CGGAAGTAAA CGACTTCCGC
ACTAAGATGC GCCAGTTTTG TGAAGAGGCT GCTGCTCACC GCCAGCAGCT GGGCTGGGTG
GAATGGCTGC AGTACAGCTT CCCCCTGCAG CTGGAGCCCT CAGCAAGGGG TTGGCGGGCC
GGCTTATTGC GTGTCAGCAA CCGAGCCCTG CTGGTCAACG TGAAGTTCGA GGGCAGTGAG
GAGAGCTTCA CCTTCCAGGT ATCCACCAAG GACATGCCCC TGGCACTGAT GGCCTGTGCC
CTCCGAAAAA AGGCCACAGT GTTCCGGCAG CCTCTGGTGG AGCAGCCTGA GGAATATGCC
CTGCAGGTGA ACGGGAGGCA CGAATACCTC TACGGCAACT ACCCGCTCTG CCACTTTCAG
TACATCTGCA GCTGCCTACA CAGCGGGCTG ACCCCTCATC TGACCATGGT CCACTCCTCC
TCCATCCTTG CTATGCGGGA TGAGCAGAGC AATCCTGCCC CCCAAGTACA GAAACCACGT
GCCAAACCTC CCCCGATCCC TGCCAAGAAG CCCTCCTCTG TGTCCCTGTG GTCCCTGGAA
CAGCCATTCT CCATTGAGCT GATCGAGGGC CGAAAAGTGA ATGCTGACGA GCGGATGAAG
CTGGTTGTTC AGGCCGGGCT CTTCCATGGC AATGAGATGC TGTGCAAGAC TGTGTCAAGC
TCGGAGGTGA ATGTATGCTC AGAGCCCGTG TGGAAGCAGC GACTGGAGTT CGATATCAGC
GTCTGTGACC TCCCGCGCAT GGCTCGACTC TGTTTTGCTC TCTATGCCGT CGTGGAGAAG
GCTAAGAAGG CACGCTCCAC AAAGAAGAAG TCTAAGAAGG CGGACTGCCC CATCGCTTGG
GCCAACCTCA TGCTATTCGA CTACAAAGAT CAGCTCAAGA CGGGGGAGCG CTGCCTCTAC
ATGTGGCCCT CTGTCCCAGA TGAGAAGGGA GAGCTGCTGA ATCCTGCGGG TACAGTGCGC
GGGAACCCCA ACACGGAGAG TGCCGCTGCC CTGGTCATCT ACCTGCCTGA GGTGGCCCCC
CACCCTGTGT ACTTCCCCGC TCTGGAGAAG ATCCTGGAGC TGGGGCGTCA CGGGGAGCGT
GGGCGCATCA CGGAGGAGGA GCAGCTGCAG CTGCGGGAGA TCCTGGAACG GCGGGGATCC
GGGGAACTGT ACGAACATGA GAAGGACCTG GTGTGGAAGA TGCGCCACGA AGTCCAGGAG
CATTTCCCAG AGGCGCTGGC CCGCCTGCTG CTGGTCACCA AGTGGAATAA ACACGAGGAT
GTGGCCCAGA TGCTCTATTT GCTGTGCTCC TGGCCCGAGC TGCCTGTGCT GAGCGCCCTG
GAACTTCTGG ACTTTAGCTT TCCCGACTGC TACGTGGGCT CCTTCGCCAT CAAGTCCCTT
CGGAAGCTGA CGGACGATGA GCTCTTCCAG TACCTTCTGC AGCTGGTGCA AGTGCTCAAA
TATGAGTCCT ACCTGGACTG CGAGCTGACC AAATTCTTGC TGGGCCGAGC CCTGGCTAAC
CGCAAGATCG GACACTTCCT GTTCTGGCAC CTCCGCTCTG AGATGCACGT ACCATCAGTG
GCTCTGCGGT TTGGTCTCAT CATGGAAGCC TACTGCAGAG GCAGCACCCA CCACATGAAG
GTGCTGATGA AGCAGGGGGA AGCACTGAGC AAGCTTAAGG CACTGAATGA CTTTGTGAAG
GTGAGTTCCC AGAAGACCAC CAAGCCCCAA ACCAAGGAGA TGATGCATAT GTGCATGCGC
CAGGAGACCT ACATGGAGGC CCTGTCCCAC CTGCAGTCTC CACTCGACCC CAGCACCCTG
CTGGAGGAAG TCTGCAGTGT GGAGCAGTGC ACCTTCATGG ACTCCAAAAT GAAGCCCCTG
TGGATCATGT ACAGCAGCGA GGAGGCGGGC AGTGCTGGCA ACGTGGGCAT CATCTTTAAG
AACGGGGATG ACCTCCGCCA GGACATGCTG ACTCTGCAGA TGATCCAGCT CATGGACGTC
CTGTGGAAGC AGGAGGGCCT GGACCTGAGG ATGACGCCCT ACGGCTGCCT CCCCACCGGG
GACCGCACAG GTCTCATCGA GGTGGTCCTC CACTCGGACA CCATCGCCAA CATCCAGCTG
AACAAAAGCA ACATGGCGGC CACAGCTGCC TTCAACAAGG ACGCCCTGCT CAACTGGCTC
AAGTCCAAGA ACCCTGGGGA GGCCCTGGAT CGGGCCATTG AGGAATTCAC CCTCTCCTGT
GCTGGCTACT GTGTGGCCAC ATATGTTCTG GGCATCGGTG ACCGGCACAG CGACAACATC
ATGATCAGAG AGAGTGGGCA GCTCTTCCAC ATTGATTTTG GCCACTTTCT GGGGAACTTC
AAGACCAAGT TTGGAATCAA CCGAGAGCGC GTCCCCTTCA TTCTCACCTA CGACTTTGTC
CACGTGATCC AGCAGGGGAA GACTAACAAC AGTGAGAAGT TTGAAAGGTT CCGCGGCTAC
TGTGAACGAG CCTATACCAT CCTGCGGCGC CACGGGCTGC TTTTCCTCCA TCTCTTCGCC
CTGATGCGGG CCGCAGGTCT GCCTGAGCTT AGCTGCTCCA AAGATATCCA GTATCTCAAG
GACTCTCTGG CACTGGGGAA GACGGAGGAA GAGGCGCTAA AGCACTTCCG GGTGAAGTTC
AACGAAGCTC TCCGAGAAAG CTGGAAAACC AAAGTCAACT GGCTGGCGCA CAATGTGTCC
AAGGATAACC GACAGTAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001157522.1
CDS306..3443
Misc Feature(1)294..296(+)
Misc Feature(2)396..629(+)
Misc Feature(3)855..1148(+)
Misc Feature(4)1245..1748(+)
Misc Feature(5)1815..2357(+)
Misc Feature(6)1875..1877(+)
Misc Feature(7)2331..3434(+)
Misc Feature(8)2562..3041(+)
Misc Feature(9)2766..3296(+)
Misc Feature(10)2907..2909(+)
Misc Feature(11)2976..3002(+)
Misc Feature(12)3039..3113(+)
Misc Feature(13)3423..3425(+)
Exon (1)1..154
Gene:Pik3cd
Gene Synonym:
Exon (2)155..273
Gene:Pik3cd
Gene Synonym:
Exon (3)274..446
Gene:Pik3cd
Gene Synonym:
Exon (4)447..675
Gene:Pik3cd
Gene Synonym:
Exon (5)676..905
Gene:Pik3cd
Gene Synonym:
Exon (6)906..1085
Gene:Pik3cd
Gene Synonym:
Exon (7)1086..1235
Gene:Pik3cd
Gene Synonym:
Exon (8)1236..1325
Gene:Pik3cd
Gene Synonym:
Exon (9)1326..1547
Gene:Pik3cd
Gene Synonym:
Exon (10)1548..1644
Gene:Pik3cd
Gene Synonym:
Exon (11)1645..1775
Gene:Pik3cd
Gene Synonym:
Exon (12)1776..1826
Gene:Pik3cd
Gene Synonym:
Exon (13)1827..1994
Gene:Pik3cd
Gene Synonym:
Exon (14)1995..2116
Gene:Pik3cd
Gene Synonym:
Exon (15)2117..2260
Gene:Pik3cd
Gene Synonym:
Exon (16)2261..2360
Gene:Pik3cd
Gene Synonym:
Exon (17)2361..2539
Gene:Pik3cd
Gene Synonym:
Exon (18)2540..2655
Gene:Pik3cd
Gene Synonym:
Exon (19)2656..2734
Gene:Pik3cd
Gene Synonym:
Exon (20)2735..2902
Gene:Pik3cd
Gene Synonym:
Exon (21)2903..3026
Gene:Pik3cd
Gene Synonym:
Exon (22)3027..3172
Gene:Pik3cd
Gene Synonym:
Exon (23)3173..3305
Gene:Pik3cd
Gene Synonym:
Exon (24)3306..4915
Gene:Pik3cd
Gene Synonym:
Translation